WorldWideScience

Sample records for ribosomal subunit reveals

  1. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  2. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  3. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  4. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  5. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  6. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  7. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  8. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  9. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  10. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  11. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  12. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  13. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  14. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  15. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  16. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  17. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  18. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  19. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  20. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  1. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  2. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  3. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  4. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Science.gov (United States)

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  5. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  6. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  7. Neutron scattering and the 30 S ribosomal subunit of E. coli

    International Nuclear Information System (INIS)

    Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.

    1982-01-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  8. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Ribosome formation from subunits studied by stopped-flow and Rayleigh light scattering

    Directory of Open Access Journals (Sweden)

    Antoun Ayman

    2004-01-01

    Full Text Available Light scattering and standard stopped-flow techniques were used to monitor rapid association of ribosomal subunits during initiation of eubacterial protein synthesis. The effects of the initiation factors IF1, IF2, IF3 and buffer conditions on subunit association were studied along with the role of GTP in this process. The part of light scattering theory that is essential for kinetic measurements is high-lighted in the main text and a more general treatment of Rayleigh scattering from macromolecules is given in an appendix.

  10. A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

    Directory of Open Access Journals (Sweden)

    Andrea Ciammaruconi

    2008-01-01

    Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

  11. Release of newly synthesized nucleoplasmic ribosomal subunits or their precursor particles from isolated nuclei of regenerating rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine

    1930-06-16

    The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.

  12. Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.

    2008-01-01

    The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.

  13. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J

    2012-07-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.

  14. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  15. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  16. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  17. Chlamydia abortus YhbZ, a truncated Obg family GTPase, associates with the Escherichia coli large ribosomal subunit.

    Science.gov (United States)

    Polkinghorne, Adam; Vaughan, Lloyd

    2011-01-01

    The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

  18. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

    International Nuclear Information System (INIS)

    Uchiumi, T.; Wahba, A.J.; Traut, R.R.

    1987-01-01

    The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO 4 /polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO 4 gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO 4 /polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1) 2 and (P2) 2 dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits

  19. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

  20. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  2. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  3. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  6. D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

    Science.gov (United States)

    Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

    2011-09-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

  7. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  8. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  9. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  10. Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

    International Nuclear Information System (INIS)

    Gross, M.; Redman, R.; Kaplansky, D.A.

    1985-01-01

    The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

  11. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  12. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  13. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

    Science.gov (United States)

    Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

    2004-12-01

    Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

  14. D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

    Science.gov (United States)

    Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

    2011-01-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

  15. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  16. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    Energy Technology Data Exchange (ETDEWEB)

    Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)

    1994-12-31

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.

  17. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    International Nuclear Information System (INIS)

    Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.

    1994-01-01

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA

  18. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  19. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  20. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  1. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  2. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  3. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  4. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  5. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  6. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  7. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  9. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  10. Complex long-distance effects of mutations that confer linezolid resistance in the large ribosomal subunit

    Science.gov (United States)

    Fulle, Simone; Saini, Jagmohan S.; Homeyer, Nadine; Gohlke, Holger

    2015-01-01

    The emergence of multidrug-resistant pathogens will make current antibiotics ineffective. For linezolid, a member of the novel oxazolidinone class of antibiotics, 10 nucleotide mutations in the ribosome have been described conferring resistance. Hypotheses for how these mutations affect antibiotics binding have been derived based on comparative crystallographic studies. However, a detailed description at the atomistic level of how remote mutations exert long-distance effects has remained elusive. Here, we show that the G2032A-C2499A double mutation, located > 10 Å away from the antibiotic, confers linezolid resistance by a complex set of effects that percolate to the binding site. By molecular dynamics simulations and free energy calculations, we identify U2504 and C2452 as spearheads among binding site nucleotides that exert the most immediate effect on linezolid binding. Structural reorganizations within the ribosomal subunit due to the mutations are likely associated with mutually compensating changes in the effective energy. Furthermore, we suggest two main routes of information transfer from the mutation sites to U2504 and C2452. Between these, we observe cross-talk, which suggests that synergistic effects observed for the two mutations arise in an indirect manner. These results should be relevant for the development of oxazolidinone derivatives that are active against linezolid-resistant strains. PMID:26202966

  11. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  12. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  13. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  14. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  15. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  16. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    Science.gov (United States)

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  17. Crystal Structure of the 30S Ribosomal Subunit from Thermus Thermophilus: Purification, Crystallization and Structure Determination

    International Nuclear Information System (INIS)

    Clemons, William M. Jr.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki

    2001-01-01

    We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 (angstrom) resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 (angstrom) resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.

  18. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  19. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  20. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  1. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  2. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  3. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  4. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  5. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  6. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  7. Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

    International Nuclear Information System (INIS)

    Nowotny, V.; Nierhaus, K.H.

    1988-01-01

    A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

  8. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  9. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  10. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  11. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  12. A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

    Directory of Open Access Journals (Sweden)

    Saurav Mallik

    Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

  13. Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit.

    Science.gov (United States)

    Rohrmoser, Michaela; Hölzel, Michael; Grimm, Thomas; Malamoussi, Anastassia; Harasim, Thomas; Orban, Mathias; Pfisterer, Iris; Gruber-Eber, Anita; Kremmer, Elisabeth; Eick, Dirk

    2007-05-01

    The PeBoW complex is essential for cell proliferation and maturation of the large ribosomal subunit in mammalian cells. Here we examined the role of PeBoW-specific proteins Pes1, Bop1, and WDR12 in complex assembly and stability, nucleolar transport, and pre-ribosome association. Recombinant expression of the three subunits is sufficient for complex formation. The stability of all three subunits strongly increases upon incorporation into the complex. Only overexpression of Bop1 inhibits cell proliferation and rRNA processing, and its negative effects could be rescued by coexpression of WDR12, but not Pes1. Elevated levels of Bop1 induce Bop1/WDR12 and Bop1/Pes1 subcomplexes. Knockdown of Bop1 abolishes the copurification of Pes1 with WDR12, demonstrating Bop1 as the integral component of the complex. Overexpressed Bop1 substitutes for endogenous Bop1 in PeBoW complex assembly, leading to the instability of endogenous Bop1. Finally, indirect immunofluorescence, cell fractionation, and sucrose gradient centrifugation experiments indicate that transport of Bop1 from the cytoplasm to the nucleolus is Pes1 dependent, while Pes1 can migrate to the nucleolus and bind to preribosomal particles independently of Bop1. We conclude that the assembly and integrity of the PeBoW complex are highly sensitive to changes in Bop1 protein levels.

  14. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    Science.gov (United States)

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  15. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  16. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  17. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  18. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  19. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  20. A new genus of athecate interstitial dinoflagellates, Togula gen. nov., previously encompassed within Amphidinium sensu lato: Inferred from light and electron microscopy and phylogenetic analyses of partial large subunit ribosomal DNA sequences

    DEFF Research Database (Denmark)

    Jørgensen, Mårten Flø; Murray, Shauna; Daugbjerg, Niels

    2004-01-01

    was not closely related to other genera included in the molecular phylogenetic analyses, but formed a highly supported clade in Bayesian analysis together with the six small-sized strains. The six strains also formed a highly supported clade, consisting of two closely related, albeit distinct, clades. Light......The recent emendation of Amphidinium (Dinophyceae), which now only consists of species with minute left-deflected epicone, has left more than 100 species without a clear generic affiliation. In the present study, a strain identified as one of the species with a divergent epicone type, Amphidinium...... subunit ribosomal DNA as well as in size and shape. Based on morphological similarity and partial large subunit ribosomal DNA evidence, we erect the new genus, Togula gen. nov. with the emended type species Togula britannica (Herdman) comb. nov. Based on differences in division pattern and partial large...

  1. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  2. Identification of cross-linked amino acids in the protein pair HmaL23-HmaL29 from the 50S ribosomal subunit of the archaebacterium Haloarcula marismortui.

    Science.gov (United States)

    Bergmann, U; Wittmann-Liebold, B

    1993-03-23

    50S ribosomal subunits from the extreme halophilic archaebacterium Haloarcula marismortui were treated with the homobifunctional protein-protein cross-linking reagents diepoxybutane (4 A) and dithiobis(succinimidyl propionate) (12 A). The dominant product with both cross-linking reagents was identified on the protein level as HmaL23-HmaL29, which is homologous to the protein pair L23-L29 from Escherichia coli [Walleczek, J., Martin, T., Redl, B., Stöffler-Meilicke, M., & Stöffler, G. (1989) Biochemistry 28, 4099-4105] and from Bacillus stearothermophilus [Brockmöller, J., & Kamp, R. M. (1986) Biol. Chem. Hoppe-Seyler 367, 925-935]. To reveal the exact cross-linking site in HmaL23-HmaL29, the cross-linked complex was purified on a preparative scale by conventional and high-performance liquid chromatography. After endoproteolytic fragmentation of the protein pair, the amino acids engaged in cross-link formation were unambiguously identified by N-terminal sequence analysis and mass spectrometry of the cross-linked peptides. The cross-link is formed between lysine-57 in the C-terminal region of HmaL29 and the alpha-amino group of the N-terminal serine in protein HmaL23, irrespective of the cross-linking reagent. This result demonstrates that the N-terminal region of protein HmaL23 and the C-terminal domain of HmaL29 are highly flexible so that the distance between the two polypeptide chains can vary by at least 8 A. Comparison of our cross-linking results with those obtained with B. stearothermophilus revealed that the fine structure within this ribosomal domain is at least partially conserved.

  3. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  4. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  5. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  6. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  7. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  8. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  9. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  10. The mitochondrial ribosomal protein of the large subunit, Afo1p, determines cellular longevity through mitochondrial back-signaling via TOR1.

    Science.gov (United States)

    Heeren, Gino; Rinnerthaler, Mark; Laun, Peter; von Seyerl, Phyllis; Kössler, Sonja; Klinger, Harald; Hager, Matthias; Bogengruber, Edith; Jarolim, Stefanie; Simon-Nobbe, Birgit; Schüller, Christoph; Carmona-Gutierrez, Didac; Breitenbach-Koller, Lore; Mück, Christoph; Jansen-Dürr, Pidder; Criollo, Alfredo; Kroemer, Guido; Madeo, Frank; Breitenbach, Michael

    2009-07-13

    Yeast mother cell-specific aging constitutes a model of replicative aging as it occurs in stem cell populations of higher eukaryotes. Here, we present a new long-lived yeast deletion mutation,afo1 (for aging factor one), that confers a 60% increase in replicative lifespan. AFO1/MRPL25 codes for a protein that is contained in the large subunit of the mitochondrial ribosome. Double mutant experiments indicate that the longevity-increasing action of the afo1 mutation is independent of mitochondrial translation, yet involves the cytoplasmic Tor1p as well as the growth-controlling transcription factor Sfp1p. In their final cell cycle, the long-lived mutant cells do show the phenotypes of yeast apoptosis indicating that the longevity of the mutant is not caused by an inability to undergo programmed cell death. Furthermore, the afo1 mutation displays high resistance against oxidants. Despite the respiratory deficiency the mutant has paradoxical increase in growth rate compared to generic petite mutants. A comparison of the single and double mutant strains for afo1 and fob1 shows that the longevity phenotype of afo1 is independent of the formation of ERCs (ribosomal DNA minicircles). AFO1/MRPL25 function establishes a new connection between mitochondria, metabolism and aging.

  11. Ribosome•RelA structures reveal the mechanism of stringent response activation

    Science.gov (United States)

    Loveland, Anna B; Bah, Eugene; Madireddy, Rohini; Zhang, Ying; Brilot, Axel F; Grigorieff, Nikolaus; Korostelev, Andrei A

    2016-01-01

    Stringent response is a conserved bacterial stress response underlying virulence and antibiotic resistance. RelA/SpoT-homolog proteins synthesize transcriptional modulators (p)ppGpp, allowing bacteria to adapt to stress. RelA is activated during amino-acid starvation, when cognate deacyl-tRNA binds to the ribosomal A (aminoacyl-tRNA) site. We report four cryo-EM structures of E. coli RelA bound to the 70S ribosome, in the absence and presence of deacyl-tRNA accommodating in the 30S A site. The boomerang-shaped RelA with a wingspan of more than 100 Å wraps around the A/R (30S A-site/RelA-bound) tRNA. The CCA end of the A/R tRNA pins the central TGS domain against the 30S subunit, presenting the (p)ppGpp-synthetase domain near the 30S spur. The ribosome and A/R tRNA are captured in three conformations, revealing hitherto elusive states of tRNA engagement with the ribosomal decoding center. Decoding-center rearrangements are coupled with the step-wise 30S-subunit 'closure', providing insights into the dynamics of high-fidelity tRNA decoding. DOI: http://dx.doi.org/10.7554/eLife.17029.001 PMID:27434674

  12. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  13. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  14. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  15. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  16. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  17. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    Science.gov (United States)

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  18. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  19. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  20. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    International Nuclear Information System (INIS)

    Buck, M.; Cooperman, B.S.

    1990-01-01

    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  1. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  3. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  4. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  5. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  6. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  7. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  8. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

    Science.gov (United States)

    Filbin, Megan E; Kieft, Jeffrey S

    2011-07-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.

  9. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  10. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  11. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  12. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  13. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  14. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  15. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  16. Halogenated benzimidazole inhibitors of phosphorylation, ''in vitro'' and ''in vivo'', of the surface acidic proteins of the yeast ribosomal 60S subunit by endogenous protein kinases CK-II and PK60S

    International Nuclear Information System (INIS)

    Szyszka, Ryszard; Boguszewska, Aleksandra; Grankowski, Nikodem; Shugar, David

    1996-01-01

    Several halogeno benzimidazoles and 2-azabenzimidazoles, previously shown to be relatively selective inhibitors of protein kinases CK-I and/or CK-II from various sources, including CK-II from yeast [Szyszka et al. (1995) Biochem. Biophys. Res. Commun. 208, 418-424] inhibit also the yeast ribosomal protein kinase PK60S. The most effective inhibitor of CK-II and PK60S was tetrabromo-2-azabenzimidazole (TetraBr-2-azaBz), which was competitive with respect to ATP (and GTP in the case of CK-II) with K i values of 0.7 μM for CK-II, and 0.1 μM for PK60S. PK60S phosphorylates only three (YP1β, YB1β', YP2α) out of five polypeptides of pp13 kDa acidic proteins of 60S subunit phosphorylated by CK-II [Szyszka et al. (1995) Acta Biochim. Polon. 42, 357-362]. Accordingly, TetraBr-azaBz inhibits phosphorylation only of these polypeptides, catalysed by PK60S. Addition of TetraBr-2Bz to cultures of yeast cells, at concentrations which were without effect on cell growth, led to inhibition of intracellular phosphorylation of ribosomal acidic proteins, paralleling that observed ''in vitro''. TetraBr-2-azaBz is shown to be a useful tool for studies on the intracellular regulation of phosphorylation of the ribosomal 60S acidic proteins, which are involved in formation of active ribosomes. (author). 36 refs, 4 figs, 2 tabs

  17. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  18. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  19. The D1-D2 region of the large subunit ribosomal DNA as barcode for ciliates.

    Science.gov (United States)

    Stoeck, T; Przybos, E; Dunthorn, M

    2014-05-01

    Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our planet and are an essential component for ecosystem function, processes and stability. Accurate identification of these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists. To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic distance analyses, we identified a D1-D2 sequence divergence of DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL barcode for ciliated protists. © 2013 John Wiley & Sons Ltd.

  20. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  1. Characterization of a Novel Class I Transcription Factor A (CITFA) Subunit That Is Indispensable for Transcription by the Multifunctional RNA Polymerase I of Trypanosoma brucei

    KAUST Repository

    Nguyen, T. N.

    2012-10-26

    Trypanosoma brucei is the only organism known to have evolved a multifunctional RNA polymerase I (pol I) system that is used to express the parasite\\'s ribosomal RNAs, as well as its major cell surface antigens, namely, the variant surface glycoprotein (VSG) and procyclin, which are vital for establishing successful infections in the mammalian host and the tsetse vector, respectively. Thus far, biochemical analyses of the T. brucei RNA pol I transcription machinery have elucidated the subunit structure of the enzyme and identified the class I transcription factor A (CITFA). CITFA binds to RNA pol I promoters, and its CITFA-2 subunit was shown to be absolutely essential for RNA pol I transcription in the parasite. Tandem affinity purification (TAP) of CITFA revealed the subunits CITFA-1 to -6, which are conserved only among kinetoplastid organisms, plus the dynein light chain DYNLL1. Here, by tagging CITFA-6 instead of CITFA-2, a complex was purified that contained all known CITFA subunits, as well as a novel proline-rich protein. Functional studies carried out in vivo and in vitro, as well as a colocalization study, unequivocally demonstrated that this protein is a bona fide CITFA subunit, essential for parasite viability and indispensable for RNA pol I transcription of ribosomal gene units and the active VSG expression site in the mammalian-infective life cycle stage of the parasite. Interestingly, CITFA-7 function appears to be species specific, because expression of an RNA interference (RNAi)-resistant CITFA-7 transgene from Trypanosoma cruzi could not rescue the lethal phenotype of silencing endogenous CITFA-7.

  2. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  3. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  4. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    Directory of Open Access Journals (Sweden)

    Alexander M. Brannan

    2015-12-01

    Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

  5. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  6. Formation of covalent linkages between nuclear and protein constituents of ribosomes of E. coli MRE 600 irradiated by gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    Ekert, B; Giocanti, N [Institut du Radium, 91 - Orsay (France)

    1977-04-01

    Gamma irradiation of E.coli MRE 600 ribosomes in aqueous suspensions led to covalent linkages between the RNA and some ribosomal proteins. The presence of oxygen during the irradiation strongly inhibited this phenomenon. It appears clearly that only a few proteins were able to participate in these cross-linking reactions, which occurred simultaneously in the two sub-units. The radiochemical yield was determined at several concentrations and was relatively low.

  7. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  8. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  9. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  10. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  11. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  12. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  13. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  14. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  16. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  17. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    Science.gov (United States)

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Comparison of phosphorylation of ribosomal proteins from HeLa and Krebs II ascites-tumour cells by cyclic AMP-dependent and cyclic GMP-dependent protein kinases

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H; Speichermann, N

    1980-01-01

    Phosphorylation of eukaryotic ribosomal proteins in vitro by essentially homogeneous preparations of cyclic AMP-dependent protein kinase catalytic subunit and cyclic GMP-dependent protein kinase was compared. Each protein kinase was added at a concentration of 30nM. Ribosomal proteins were...... by the cyclic AMP-dependent enzyme. Between 0.1 and 0.2 mol of phosphate was incorporated/mol of these phosphorylated proteins. With the exception of protein S7, the same proteins were also major substrates for the cyclic GMP-dependent protein kinase. Time courses of the phosphorylation of individual proteins...... from the small and large ribosomal subunits in the presence of either protein kinase suggested four types of phosphorylation reactions: (1) proteins S2, S10 and L5 were preferably phosphorylated by the cyclic GMP-dependent protein kinase; (2) proteins S3 and L6 were phosphorylated at very similar rates...

  19. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  20. The Role of Chaperone-subunit Usher Domain Interactions in the Mechanism of Bacterial Pilus Biogenesis Revealed by ESI-MS*

    Science.gov (United States)

    Morrissey, Bethny; Leney, Aneika C.; Toste Rêgo, Ana; Phan, Gilles; Allen, William J.; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E.; Radford, Sheena E.

    2012-01-01

    The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species. PMID:22371487

  1. The role of chaperone-subunit usher domain interactions in the mechanism of bacterial pilus biogenesis revealed by ESI-MS.

    Science.gov (United States)

    Morrissey, Bethny; Leney, Aneika C; Toste Rêgo, Ana; Phan, Gilles; Allen, William J; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E; Radford, Sheena E

    2012-07-01

    The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species.

  2. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    International Nuclear Information System (INIS)

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-01-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

  3. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jun-ichi Kakehi

    Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

  4. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  5. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  6. Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography

    OpenAIRE

    Sauguet , Ludovic; Raia , Pierre; Henneke , Ghislaine; Delarue , Marc

    2016-01-01

    International audience; Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has ...

  7. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Small ribosomal protein subunit S7 suppresses ovarian tumorigenesis through regulation of the PI3K/AKT and MAPK pathways.

    Directory of Open Access Journals (Sweden)

    Ziliang Wang

    Full Text Available Small ribosomal protein subunit S7 (RPS7 has been reported to be associated with various malignancies, but the role of RPS7 in ovarian cancer remains unclear. In this study, we found that silencing of RPS7 by a specific shRNA promoted ovarian cancer cell proliferation, accelerated cell cycle progression, and slightly reduced cell apoptosis and response to cisplatin treatment. Knockdown of RPS7 resulted in increased expression of P85α, P110α, and AKT2. Although the basal levels of ERK1/2, MEK1/2, and P38 were inconsistently altered in ovarian cancer cells, the phosphorylated forms of MEK1/2 (Ser217/221, ERK1/2 (Thr202/Tyr204, JNK1/2 (Thr183/Tyr185, and P38 (Thr180/Tyr182 were consistently reduced after RPS7 was silenced. Both the in vitro anchorage-independent colony formation and in vivo animal tumor formation capability of cells were enhanced after RPS7 was depleted. We also showed that silencing of RPS7 enhanced ovarian cancer cell migration and invasion. In sum, our results suggest that RPS7 suppresses ovarian tumorigenesis and metastasis through PI3K/AKT and MAPK signal pathways. Thus, RPS7 may be used as a potential marker for diagnosis and treatment of ovarian cancer.

  9. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  10. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  11. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    . In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  12. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

    Science.gov (United States)

    Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

    2003-09-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

  13. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. The structure of the TFIIH p34 subunit reveals a von Willebrand factor A like fold.

    Directory of Open Access Journals (Sweden)

    Dominik R Schmitt

    Full Text Available RNA polymerase II dependent transcription and nucleotide excision repair are mediated by a multifaceted interplay of subunits within the general transcription factor II H (TFIIH. A better understanding of the molecular structure of TFIIH is the key to unravel the mechanism of action of this versatile protein complex within these vital cellular processes. The importance of this complex becomes further evident in the context of severe diseases like xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy, that arise from single point mutations in TFIIH subunits. Here we describe the structure of the p34 subunit of the TFIIH complex from the eukaryotic thermophilic fungus Chaetomium thermophilum. The structure revealed that p34 contains a von Willebrand Factor A (vWA like domain, a fold which is generally known to be involved in protein-protein interactions. Within TFIIH p34 strongly interacts with p44, a positive regulator of the helicase XPD. Putative protein-protein interfaces are analyzed and possible binding sites for the p34-p44 interaction suggested.

  15. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  16. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  17. 4.0-A resolution cryo-EM structure of the mammalian chaperonin TRiC/CCT reveals its unique subunit arrangement.

    Science.gov (United States)

    Cong, Yao; Baker, Matthew L; Jakana, Joanita; Woolford, David; Miller, Erik J; Reissmann, Stefanie; Kumar, Ramya N; Redding-Johanson, Alyssa M; Batth, Tanveer S; Mukhopadhyay, Aindrila; Ludtke, Steven J; Frydman, Judith; Chiu, Wah

    2010-03-16

    The essential double-ring eukaryotic chaperonin TRiC/CCT (TCP1-ring complex or chaperonin containing TCP1) assists the folding of approximately 5-10% of the cellular proteome. Many TRiC substrates cannot be folded by other chaperonins from prokaryotes or archaea. These unique folding properties are likely linked to TRiC's unique heterooligomeric subunit organization, whereby each ring consists of eight different paralogous subunits in an arrangement that remains uncertain. Using single particle cryo-EM without imposing symmetry, we determined the mammalian TRiC structure at 4.7-A resolution. This revealed the existence of a 2-fold axis between its two rings resulting in two homotypic subunit interactions across the rings. A subsequent 2-fold symmetrized map yielded a 4.0-A resolution structure that evinces the densities of a large fraction of side chains, loops, and insertions. These features permitted unambiguous identification of all eight individual subunits, despite their sequence similarity. Independent biochemical near-neighbor analysis supports our cryo-EM derived TRiC subunit arrangement. We obtained a Calpha backbone model for each subunit from an initial homology model refined against the cryo-EM density. A subsequently optimized atomic model for a subunit showed approximately 95% of the main chain dihedral angles in the allowable regions of the Ramachandran plot. The determination of the TRiC subunit arrangement opens the way to understand its unique function and mechanism. In particular, an unevenly distributed positively charged wall lining the closed folding chamber of TRiC differs strikingly from that of prokaryotic and archaeal chaperonins. These interior surface chemical properties likely play an important role in TRiC's cellular substrate specificity.

  18. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  19. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  20. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  1. Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography.

    Science.gov (United States)

    Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc

    2016-08-22

    Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same 'double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs.

  2. Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    O’Farrell Heather C

    2012-10-01

    Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

  3. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  4. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  5. Phosphorylation of ribosomal proteins influences subunit association and translation of poly (U) in Streptomyces coelicolor

    Czech Academy of Sciences Publication Activity Database

    Mikulík, Karel; Bobek, Jan; Ziková, Alice; Smětáková, Magdalena; Bezoušková, Silvia

    2011-01-01

    Roč. 7, č. 3 (2011), s. 817-823 ISSN 1742-206X R&D Projects: GA ČR GAP302/10/0468; GA ČR GA303/09/0475; GA ČR GA310/07/1009; GA AV ČR(CZ) IAA500110805 Institutional research plan: CEZ:AV0Z50200510 Keywords : ESCHERICHIA-COLI RIBOSOME * ELONGATION-FACTOR-G * MESSENGER-RNA Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2011

  6. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  7. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  8. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    Science.gov (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  9. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  10. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  11. Ribosomal subunit protein typing using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) for the identification and discrimination of Aspergillus species.

    Science.gov (United States)

    Nakamura, Sayaka; Sato, Hiroaki; Tanaka, Reiko; Kusuya, Yoko; Takahashi, Hiroki; Yaguchi, Takashi

    2017-04-26

    Accurate identification of Aspergillus species is a very important subject. Mass spectral fingerprinting using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) is generally employed for the rapid identification of fungal isolates. However, the results are based on simple mass spectral pattern-matching, with no peak assignment and no taxonomic input. We propose here a ribosomal subunit protein (RSP) typing technique using MALDI-TOF MS for the identification and discrimination of Aspergillus species. The results are concluded to be phylogenetic in that they reflect the molecular evolution of housekeeping RSPs. The amino acid sequences of RSPs of genome-sequenced strains of Aspergillus species were first verified and compared to compile a reliable biomarker list for the identification of Aspergillus species. In this process, we revealed that many amino acid sequences of RSPs (about 10-60%, depending on strain) registered in the public protein databases needed to be corrected or newly added. The verified RSPs were allocated to RSP types based on their mass. Peak assignments of RSPs of each sample strain as observed by MALDI-TOF MS were then performed to set RSP type profiles, which were then further processed by means of cluster analysis. The resulting dendrogram based on RSP types showed a relatively good concordance with the tree based on β-tubulin gene sequences. RSP typing was able to further discriminate the strains belonging to Aspergillus section Fumigati. The RSP typing method could be applied to identify Aspergillus species, even for species within section Fumigati. The discrimination power of RSP typing appears to be comparable to conventional β-tubulin gene analysis. This method would therefore be suitable for species identification and discrimination at the strain to species level. Because RSP typing can characterize the strains within section Fumigati, this method has potential as a powerful and reliable tool in

  12. The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

    DEFF Research Database (Denmark)

    Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

    2006-01-01

    potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...

  13. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Science.gov (United States)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  14. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Science.gov (United States)

    Long, Katherine S.

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  15. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  16. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  17. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  18. The antituberculosis antibiotic capreomycin inhibits protein synthesis by disrupting interaction between ribosomal proteins L12 and L10.

    Science.gov (United States)

    Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong

    2014-01-01

    Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.

  19. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  20. Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3

    OpenAIRE

    Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.

    2003-01-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...

  1. The ribosome-bound chaperones RAC and Ssb1/2p are required for accurate translation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Rakwalska, Magdalena; Rospert, Sabine

    2004-10-01

    The chaperone homologs RAC (ribosome-associated complex) and Ssb1/2p are anchored to ribosomes; Ssb1/2p directly interacts with nascent polypeptides. The absence of RAC or Ssb1/2p results in a similar set of phenotypes, including hypersensitivity against the aminoglycoside paromomycin, which binds to the small ribosomal subunit and compromises the fidelity of translation. In order to understand this phenomenon we measured the frequency of translation termination and misincorporation in vivo and in vitro with a novel reporter system. Translational fidelity was impaired in the absence of functional RAC or Ssb1/2p, and the effect was further enhanced by paromomycin. The mutant strains suffered primarily from a defect in translation termination, while misincorporation was compromised to a lesser extent. Consistently, a low level of soluble translation termination factor Sup35p enhanced growth defects in the mutant strains. Based on the combined data we conclude that RAC and Ssb1/2p are crucial in maintaining translational fidelity beyond their postulated role as chaperones for nascent polypeptides.

  2. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  3. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  4. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  5. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  6. Isolation of eukaryotic ribosomal proteins. Purification and characterization of the 60 S ribosomal subunit proteins L4, L5, L7, L9, L11, L12, L13, L21, L22, L23, L26, L27, L30, L33, L35', L37, and L39.

    Science.gov (United States)

    Tsurugi, K; Collatz, E; Wool, E G; Lin, A

    1976-12-25

    The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Seventeen proteins (L4, L5, L7, L9, L11, L12, L13, L21, L22, L23, L26, L27, L30, L33, L35', L37, and L39) were isolated from three of the groups (B60, D60, G60) by ion exchange chromatography on carboxymethylcellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.5 to 15 mg. Eight of the proteins (L9, L11, L13, L21, L22, L35', L37 and L39) had no detectable contamination; the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  7. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Nucleolar Proteome Analysis and Proteasomal Activity Assays Reveal a Link between Nucleolus and 26S Proteasome in A. thaliana

    Science.gov (United States)

    Montacié, Charlotte; Durut, Nathalie; Opsomer, Alison; Palm, Denise; Comella, Pascale; Picart, Claire; Carpentier, Marie-Christine; Pontvianne, Frederic; Carapito, Christine; Schleiff, Enrico; Sáez-Vásquez, Julio

    2017-01-01

    In all eukaryotic cells, the nucleolus is functionally and structurally linked to rRNA synthesis and ribosome biogenesis. This compartment contains as well factors involved in other cellular activities, but the functional interconnection between non-ribosomal activities and the nucleolus (structure and function) still remains an open question. Here, we report a novel mass spectrometry analysis of isolated nucleoli from Arabidopsis thaliana plants using the FANoS (Fluorescence Assisted Nucleolus Sorting) strategy. We identified many ribosome biogenesis factors (RBF) and proteins non-related with ribosome biogenesis, in agreement with the recognized multi-functionality of the nucleolus. Interestingly, we found that 26S proteasome subunits localize in the nucleolus and demonstrated that proteasome activity and nucleolus organization are intimately linked to each other. Proteasome subunits form discrete foci in the disorganized nucleolus of nuc1.2 plants. Nuc1.2 protein extracts display reduced proteasome activity in vitro compared to WT protein extracts. Remarkably, proteasome activity in nuc1.2 is similar to proteasome activity in WT plants treated with proteasome inhibitors (MG132 or ALLN). Finally, we show that MG132 treatment induces disruption of nucleolar structures in WT but not in nuc1.2 plants. Altogether, our data suggest a functional interconnection between nucleolus structure and proteasome activity. PMID:29104584

  9. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  10. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  12. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  13. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

    International Nuclear Information System (INIS)

    Pereira, Larissa Miranda

    2009-01-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

  14. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  15. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  16. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  17. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  18. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  19. Analysis of Schizosaccharomyces pombe mediator reveals a set of essential subunits conserved between yeast and metazoan cells

    DEFF Research Database (Denmark)

    Spåhr, H; Samuelsen, C O; Baraznenok, V

    2001-01-01

    . cerevisiae share an essential protein module, which associates with nonessential speciesspecific subunits. In support of this view, sequence analysis of the conserved yeast Mediator components Med4 and Med8 reveals sequence homology to the metazoan Mediator components Trap36 and Arc32. Therefore, 8 of 10...... essential genes conserved between S. pombe and S. cerevisiae also have a metazoan homolog, indicating that an evolutionary conserved Mediator core is present in all eukaryotic cells. Our data suggest a closer functional relationship between yeast and metazoan Mediator than previously anticipated....

  20. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  1. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  2. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  3. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  4. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  5. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  6. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  7. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  8. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.

    Science.gov (United States)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B; Steitz, Thomas A

    2009-05-29

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 A. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  9. U2504 Determines the Species Specificity of the A-Site Cleft Antibiotics: The Structures of Tiamulin, Homoharringtonine, and Bruceantin Bound to the Ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.; Yale

    2009-06-30

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the Asite cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  10. Functional Characterization of the Role of the N-terminal Domain of the c/Nip1 Subunit of Eukaryotic Initiation Factor 3 (eIF3) in AUG Recognition

    Czech Academy of Sciences Publication Activity Database

    Karásková, Martina; Gunišová, Stanislava; Herrmannová, Anna; Wagner, Susan; Munzarová, Vanda; Valášek, Leoš Shivaya

    2012-01-01

    Roč. 287, č. 34 (2012), s. 28420-28434 ISSN 0021-9258 R&D Projects: GA ČR GAP305/10/0335 Institutional support: RVO:61388971 Keywords : START CODON SELECTION * 40S RIBOSOMAL-SUBUNIT * GCN4 TRANSLATIONAL CONTROL Subject RIV: CE - Biochemistry Impact factor: 4.651, year: 2012

  11. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  12. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  13. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  14. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  15. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  16. The D3-D5 region of large subunit ribosomal DNA provides good resolution of German limnic and terrestrial nematode communities

    NARCIS (Netherlands)

    Schenk, Janina; Hohberg, Karin; Helder, Hans; Ristau, Kai; Traunspurger, Walter

    2017-01-01

    Reliable and well-developed DNA barcode databases are indispensable for the identification of microscopic life. However, effectiveness of molecular barcoding in identifying terrestrial specimens, and nematodes in particular, has received little attention. In this study, ca 600 ribosomal large

  17. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  18. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    The secondary structure of the large-subunit ribosomal RNA (24-26S rRNA) has been studied with emphasis on comparative analysis of the folding patterns of the divergent domains in the available protist sequences, that is Prorocentrum micans (dinoflagellate), Saccharomyces carlsbergensis (yeast......), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  19. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics: The sStructures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Gurel, G.; Blaha, G; Moore, P; Steitz,

    2009-01-01

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  20. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. AKAP18:PKA-RIIα structure reveals crucial anchor points for recognition of regulatory subunits of PKA.

    Science.gov (United States)

    Götz, Frank; Roske, Yvette; Schulz, Maike Svenja; Autenrieth, Karolin; Bertinetti, Daniela; Faelber, Katja; Zühlke, Kerstin; Kreuchwig, Annika; Kennedy, Eileen J; Krause, Gerd; Daumke, Oliver; Herberg, Friedrich W; Heinemann, Udo; Klussmann, Enno

    2016-07-01

    A-kinase anchoring proteins (AKAPs) interact with the dimerization/docking (D/D) domains of regulatory subunits of the ubiquitous protein kinase A (PKA). AKAPs tether PKA to defined cellular compartments establishing distinct pools to increase the specificity of PKA signalling. Here, we elucidated the structure of an extended PKA-binding domain of AKAP18β bound to the D/D domain of the regulatory RIIα subunits of PKA. We identified three hydrophilic anchor points in AKAP18β outside the core PKA-binding domain, which mediate contacts with the D/D domain. Such anchor points are conserved within AKAPs that bind regulatory RII subunits of PKA. We derived a different set of anchor points in AKAPs binding regulatory RI subunits of PKA. In vitro and cell-based experiments confirm the relevance of these sites for the interaction of RII subunits with AKAP18 and of RI subunits with the RI-specific smAKAP. Thus we report a novel mechanism governing interactions of AKAPs with PKA. The sequence specificity of each AKAP around the anchor points and the requirement of these points for the tight binding of PKA allow the development of selective inhibitors to unequivocally ascribe cellular functions to the AKAP18-PKA and other AKAP-PKA interactions. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  2. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    International Nuclear Information System (INIS)

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.

    2001-01-01

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny

  4. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  5. Structure of a yeast 40S-eIF1-eIF1A-eIF3-eIF3j initiation complex.

    Science.gov (United States)

    Aylett, Christopher H S; Boehringer, Daniel; Erzberger, Jan P; Schaefer, Tanja; Ban, Nenad

    2015-03-01

    Eukaryotic translation initiation requires cooperative assembly of a large protein complex at the 40S ribosomal subunit. We have resolved a budding yeast initiation complex by cryo-EM, allowing placement of prior structures of eIF1, eIF1A, eIF3a, eIF3b and eIF3c. Our structure highlights differences in initiation-complex binding to the ribosome compared to that of mammalian eIF3, demonstrates a direct contact between eIF3j and eIF1A and reveals the network of interactions between eIF3 subunits.

  6. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)

    Science.gov (United States)

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  7. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics. The Structures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    Science.gov (United States)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.

    2009-01-01

    Structures have been obtained for the complexes tiamulin, homoharringtonine and bruceatin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.8 to 3.2 Å. They show that these inhibitors all block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl transferase center, which is universally conserved. In addition these structures support the hypothesis that the species-specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (E. coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms. PMID:19362093

  8. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  9. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  10. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  11. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  12. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  13. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    International Nuclear Information System (INIS)

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-01-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  14. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  15. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  16. Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

    Science.gov (United States)

    Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

    1971-01-01

    Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

  17. Phaseolin expression in tobacco chloroplast reveals an autoregulatory mechanism in heterologous protein translation.

    Science.gov (United States)

    De Marchis, Francesca; Bellucci, Michele; Pompa, Andrea

    2016-02-01

    Plastid DNA engineering is a well-established research area of plant biotechnology, and plastid transgenes often give high expression levels. However, it is still almost impossible to predict the accumulation rate of heterologous protein in transplastomic plants, and there are many cases of unsuccessful transgene expression. Chloroplasts regulate their proteome at the post-transcriptional level, mainly through translation control. One of the mechanisms to modulate the translation has been described in plant chloroplasts for the chloroplast-encoded subunits of multiprotein complexes, and the autoregulation of the translation initiation of these subunits depends on the availability of their assembly partners [control by epistasy of synthesis (CES)]. In Chlamydomonas reinhardtii, autoregulation of endogenous proteins recruited in the assembly of functional complexes has also been reported. In this study, we revealed a self-regulation mechanism triggered by the accumulation of a soluble recombinant protein, phaseolin, in the stroma of chloroplast-transformed tobacco plants. Immunoblotting experiments showed that phaseolin could avoid this self-regulation mechanism when targeted to the thylakoids in transplastomic plants. To inhibit the thylakoid-targeted phaseolin translation as well, this protein was expressed in the presence of a nuclear version of the phaseolin gene with a transit peptide. Pulse-chase and polysome analysis revealed that phaseolin mRNA translation on plastid ribosomes was repressed due to the accumulation in the stroma of the same soluble polypeptide imported from the cytosol. We suggest that translation autoregulation in chloroplast is not limited to heteromeric protein subunits but also involves at least some of the foreign soluble recombinant proteins, leading to the inhibition of plastome-encoded transgene expression in chloroplast. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  19. Organization of Subunits in the Membrane Domain of the Bovine F-ATPase Revealed by Covalent Cross-linking.

    Science.gov (United States)

    Lee, Jennifer; Ding, ShuJing; Walpole, Thomas B; Holding, Andrew N; Montgomery, Martin G; Fearnley, Ian M; Walker, John E

    2015-05-22

    The F-ATPase in bovine mitochondria is a membrane-bound complex of about 30 subunits of 18 different kinds. Currently, ∼85% of its structure is known. The enzyme has a membrane extrinsic catalytic domain, and a membrane intrinsic domain where the turning of the enzyme's rotor is generated from the transmembrane proton-motive force. The domains are linked by central and peripheral stalks. The central stalk and a hydrophobic ring of c-subunits in the membrane domain constitute the enzyme's rotor. The external surface of the catalytic domain and membrane subunit a are linked by the peripheral stalk, holding them static relative to the rotor. The membrane domain contains six additional subunits named ATP8, e, f, g, DAPIT (diabetes-associated protein in insulin-sensitive tissues), and 6.8PL (6.8-kDa proteolipid), each with a single predicted transmembrane α-helix, but their orientation and topography are unknown. Mutations in ATP8 uncouple the enzyme and interfere with its assembly, but its roles and the roles of the other five subunits are largely unknown. We have reacted accessible amino groups in the enzyme with bifunctional cross-linking agents and identified the linked residues. Cross-links involving the supernumerary subunits, where the structures are not known, show that the C terminus of ATP8 extends ∼70 Å from the membrane into the peripheral stalk and that the N termini of the other supernumerary subunits are on the same side of the membrane, probably in the mitochondrial matrix. These experiments contribute significantly toward building up a complete structural picture of the F-ATPase. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Organization of Subunits in the Membrane Domain of the Bovine F-ATPase Revealed by Covalent Cross-linking*

    Science.gov (United States)

    Lee, Jennifer; Ding, ShuJing; Walpole, Thomas B.; Holding, Andrew N.; Montgomery, Martin G.; Fearnley, Ian M.; Walker, John E.

    2015-01-01

    The F-ATPase in bovine mitochondria is a membrane-bound complex of about 30 subunits of 18 different kinds. Currently, ∼85% of its structure is known. The enzyme has a membrane extrinsic catalytic domain, and a membrane intrinsic domain where the turning of the enzyme's rotor is generated from the transmembrane proton-motive force. The domains are linked by central and peripheral stalks. The central stalk and a hydrophobic ring of c-subunits in the membrane domain constitute the enzyme's rotor. The external surface of the catalytic domain and membrane subunit a are linked by the peripheral stalk, holding them static relative to the rotor. The membrane domain contains six additional subunits named ATP8, e, f, g, DAPIT (diabetes-associated protein in insulin-sensitive tissues), and 6.8PL (6.8-kDa proteolipid), each with a single predicted transmembrane α-helix, but their orientation and topography are unknown. Mutations in ATP8 uncouple the enzyme and interfere with its assembly, but its roles and the roles of the other five subunits are largely unknown. We have reacted accessible amino groups in the enzyme with bifunctional cross-linking agents and identified the linked residues. Cross-links involving the supernumerary subunits, where the structures are not known, show that the C terminus of ATP8 extends ∼70 Å from the membrane into the peripheral stalk and that the N termini of the other supernumerary subunits are on the same side of the membrane, probably in the mitochondrial matrix. These experiments contribute significantly toward building up a complete structural picture of the F-ATPase. PMID:25851905

  1. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  2. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru.

  3. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C. Miguel; Vallejo, Gustavo A.

    2015-01-01

    Abstract Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(−)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru. PMID:26645579

  4. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  5. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  6. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  7. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  8. Localization in the Nucleolus and Coiled Bodies of Protein Subunits of the Ribonucleoprotein Ribonuclease P

    Science.gov (United States)

    Jarrous, Nayef; Wolenski, Joseph S.; Wesolowski, Donna; Lee, Christopher; Altman, Sidney

    1999-01-01

    The precise location of the tRNA processing ribonucleoprotein ribonuclease P (RNase P) and the mechanism of its intranuclear distribution have not been completely delineated. We show that three protein subunits of human RNase P (Rpp), Rpp14, Rpp29 and Rpp38, are found in the nucleolus and that each can localize a reporter protein to nucleoli of cells in tissue culture. In contrast to Rpp38, which is uniformly distributed in nucleoli, Rpp14 and Rpp29 are confined to the dense fibrillar component. Rpp29 and Rpp38 possess functional, yet distinct domains required for subnucleolar localization. The subunit Rpp14 lacks such a domain and appears to be dependent on a piggyback process to reach the nucleolus. Biochemical analysis suggests that catalytically active RNase P exists in the nucleolus. We also provide evidence that Rpp29 and Rpp38 reside in coiled bodies, organelles that are implicated in the biogenesis of several other small nuclear ribonucleoproteins required for processing of precursor mRNA. Because some protein subunits of RNase P are shared by the ribosomal RNA processing ribonucleoprotein RNase MRP, these two evolutionary related holoenzymes may share common intranuclear localization and assembly pathways to coordinate the processing of tRNA and rRNA precursors. PMID:10444065

  9. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  10. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    Science.gov (United States)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  11. Metaxa: a software tool for automated detection and discrimination among ribosomal small subunit (12S/16S/18S) sequences of archaea, bacteria, eukaryotes, mitochondria, and chloroplasts in metagenomes and environmental sequencing datasets.

    Science.gov (United States)

    Bengtsson, Johan; Eriksson, K Martin; Hartmann, Martin; Wang, Zheng; Shenoy, Belle Damodara; Grelet, Gwen-Aëlle; Abarenkov, Kessy; Petri, Anna; Rosenblad, Magnus Alm; Nilsson, R Henrik

    2011-10-01

    The ribosomal small subunit (SSU) rRNA gene has emerged as an important genetic marker for taxonomic identification in environmental sequencing datasets. In addition to being present in the nucleus of eukaryotes and the core genome of prokaryotes, the gene is also found in the mitochondria of eukaryotes and in the chloroplasts of photosynthetic eukaryotes. These three sets of genes are conceptually paralogous and should in most situations not be aligned and analyzed jointly. To identify the origin of SSU sequences in complex sequence datasets has hitherto been a time-consuming and largely manual undertaking. However, the present study introduces Metaxa ( http://microbiology.se/software/metaxa/ ), an automated software tool to extract full-length and partial SSU sequences from larger sequence datasets and assign them to an archaeal, bacterial, nuclear eukaryote, mitochondrial, or chloroplast origin. Using data from reference databases and from full-length organelle and organism genomes, we show that Metaxa detects and scores SSU sequences for origin with very low proportions of false positives and negatives. We believe that this tool will be useful in microbial and evolutionary ecology as well as in metagenomics.

  12. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  13. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  14. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  15. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  16. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  17. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  18. Alpha-momorcharin: a ribosome-inactivating protein from Momordica charantia, possessing DNA cleavage properties.

    Science.gov (United States)

    Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi

    2013-11-01

    Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.

  19. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  20. Isolation of eukaryotic ribosomal proteins. Purification and characterization of 60 S ribosomal subunit proteins L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37'.

    Science.gov (United States)

    Tsurugi, K; Collatz, E; Todokoro, K; Wool, I G

    1977-06-10

    The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37') were isolated from three groups (C60, E60, and F60) by ion exchange chromatography on carboxymethycellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.3 to 25 mg. Nine of the proteins (L6, L8, L18, L27', L28, L29, L34, L36, and L36') had no detectable contamination: the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  1. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  2. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  3. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S

    2000-01-01

    Oxazolidinone antibiotics inhibit bacterial protein synthesis by interacting with the large ribosomal subunit. The structure and exact location of the oxazolidinone binding site remain obscure, as does the manner in which these drugs inhibit translation. To investigate the drug-ribosome interaction......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis...

  4. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  5. Probing the functional subunits of the tonoplast H+-ATPase

    International Nuclear Information System (INIS)

    Randall, S.K.; Lai, S.; Sze, H.

    1986-01-01

    The tonoplast ATPase of oat roots is composed of at least three polypeptides of 72, 60, and 16 kDa. The 16 kDA polypeptide covalently binds N,N'-dicyclohexylcarbodiimide and is postulated to be a component of the proton channel. Initial studies to identify other subunits indicate that both the 72 and 60 kDa subunits covalently bind 14 C]-7-chloro-4-nitrobenzo-2-oxa-1,3-diazole and [ 14 C]N-ethylamleimide, inhibitors of the tonoplast ATPase. ATP prevents binding of these inhibitors suggesting that both the 72 and 60 kDa subunits are involved in substrate binding. Polyclonal antibody has been made to the 72 kDa subunit. Western blot analysis of tonoplast vesicles reveals single reactive polypeptide (72 kDa). The antibody shows no cross-reactivity towards either the mitochondrial F 1 -ATPase or the plasma membrane ATPase. This antibody specifically inhibits ATP hydrolysis and ATP-dependent H + pumping in native tonoplast vesicles. The authors conclude that the 72 kDa subunit is intimately associated with the catalytic (or ATP-binding) site

  6. Intramolecular ex vivo Fluorescence Resonance Energy Transfer (FRET of Dihydropyridine Receptor (DHPR β1a Subunit Reveals Conformational Change Induced by RYR1 in Mouse Skeletal Myotubes.

    Directory of Open Access Journals (Sweden)

    Dipankar Bhattacharya

    Full Text Available The dihydropyridine receptor (DHPR β1a subunit is essential for skeletal muscle excitation-contraction coupling, but the structural organization of β1a as part of the macromolecular DHPR-ryanodine receptor type I (RyR1 complex is still debatable. We used fluorescence resonance energy transfer (FRET to probe proximity relationships within the β1a subunit in cultured skeletal myotubes lacking or expressing RyR1. The fluorescein biarsenical reagent FlAsH was used as the FRET acceptor, which exhibits fluorescence upon binding to specific tetracysteine motifs, and enhanced cyan fluorescent protein (CFP was used as the FRET donor. Ten β1a reporter constructs were generated by inserting the CCPGCC FlAsH binding motif into five positions probing the five domains of β1a with either carboxyl or amino terminal fused CFP. FRET efficiency was largest when CCPGCC was positioned next to CFP, and significant intramolecular FRET was observed for all constructs suggesting that in situ the β1a subunit has a relatively compact conformation in which the carboxyl and amino termini are not extended. Comparison of the FRET efficiency in wild type to that in dyspedic (lacking RyR1 myotubes revealed that in only one construct (H458 CCPGCC β1a -CFP FRET efficiency was specifically altered by the presence of RyR1. The present study reveals that the C-terminal of the β1a subunit changes conformation in the presence of RyR1 consistent with an interaction between the C-terminal of β1a and RyR1 in resting myotubes.

  7. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  8. Proteomic analysis of human norepinephrine transporter complexes reveals associations with protein phosphatase 2A anchoring subunit and 14-3-3 proteins

    International Nuclear Information System (INIS)

    Sung, Uhna; Jennings, Jennifer L.; Link, Andrew J.; Blakely, Randy D.

    2005-01-01

    The norepinephrine transporter (NET) terminates noradrenergic signals by clearing released NE at synapses. NET regulation by receptors and intracellular signaling pathways is supported by a growing list of associated proteins including syntaxin1A, protein phosphatase 2A (PP2A) catalytic subunit (PP2A-C), PICK1, and Hic-5. In the present study, we sought evidence for additional partnerships by mass spectrometry-based analysis of proteins co-immunoprecipitated with human NET (hNET) stably expressed in a mouse noradrenergic neuroblastoma cell line. Our initial proteomic analyses reveal multiple peptides derived from hNET, peptides arising from the mouse PP2A anchoring subunit (PP2A-Ar) and peptides derived from 14-3-3 proteins. We verified physical association of NET with PP2A-Ar via co-immunoprecipitation studies using mouse vas deferens extracts and with 14-3-3 via a fusion pull-down approach, implicating specifically the hNET NH 2 -terminus for interactions. The transporter complexes described likely support mechanisms regulating transporter activity, localization, and trafficking

  9. Overexpression of the PP2A regulatory subunit Tap46 leads to enhanced plant growth through stimulation of the TOR signalling pathway

    Science.gov (United States)

    Ahn, Chang Sook; Ahn, Hee-Kyung; Pai, Hyun-Sook

    2015-01-01

    Tap46, a regulatory subunit of protein phosphatase 2A (PP2A), plays an essential role in plant growth and development through a functional link with the Target of Rapamycin (TOR) signalling pathway. Here, we have characterized the molecular mechanisms behind a gain-of-function phenotype of Tap46 and its relationship with TOR to gain further insights into Tap46 function in plants. Constitutive overexpression of Tap46 in Arabidopsis resulted in overall growth stimulation with enlarged organs, such as leaves and siliques. Kinematic analysis of leaf growth revealed that increased cell size was mainly responsible for the leaf enlargement. Tap46 overexpression also enhanced seed size and viability under accelerated ageing conditions. Enhanced plant growth was also observed in dexamethasone (DEX)-inducible Tap46 overexpression Arabidopsis lines, accompanied by increased cellular activities of nitrate-assimilating enzymes. DEX-induced Tap46 overexpression and Tap46 RNAi resulted in increased and decreased phosphorylation of S6 kinase (S6K), respectively, which is a sensitive indicator of endogenous TOR activity, and Tap46 interacted with S6K in planta based on bimolecular fluorescence complementation and co-immunoprecipitation. Furthermore, inactivation of TOR by estradiol-inducible RNAi or rapamycin treatment decreased Tap46 protein levels, but increased PP2A catalytic subunit levels. Real-time quantitative PCR analysis revealed that Tap46 overexpression induced transcriptional modulation of genes involved in nitrogen metabolism, ribosome biogenesis, and lignin biosynthesis. These findings suggest that Tap46 modulates plant growth as a positive effector of the TOR signalling pathway and Tap46/PP2Ac protein abundance is regulated by TOR activity. PMID:25399018

  10. Impact of ribosomal modification on the binding of the antibiotic telithromycin using a combined grand canonical monte carlo/molecular dynamics simulation approach.

    Directory of Open Access Journals (Sweden)

    Meagan C Small

    Full Text Available Resistance to macrolide antibiotics is conferred by mutation of A2058 to G or methylation by Erm methyltransferases of the exocyclic N6 of A2058 (E. coli numbering that forms the macrolide binding site in the 50S subunit of the ribosome. Ketolides such as telithromycin mitigate A2058G resistance yet remain susceptible to Erm-based resistance. Molecular details associated with macrolide resistance due to the A2058G mutation and methylation at N6 of A2058 by Erm methyltransferases were investigated using empirical force field-based simulations. To address the buried nature of the macrolide binding site, the number of waters within the pocket was allowed to fluctuate via the use of a Grand Canonical Monte Carlo (GCMC methodology. The GCMC water insertion/deletion steps were alternated with Molecular Dynamics (MD simulations to allow for relaxation of the entire system. From this GCMC/MD approach information on the interactions between telithromycin and the 50S ribosome was obtained. In the wild-type (WT ribosome, the 2'-OH to A2058 N1 hydrogen bond samples short distances with a higher probability, while the effectiveness of telithromycin against the A2058G mutation is explained by a rearrangement of the hydrogen bonding pattern of the 2'-OH to 2058 that maintains the overall antibiotic-ribosome interactions. In both the WT and A2058G mutation there is significant flexibility in telithromycin's imidazole-pyridine side chain (ARM, indicating that entropic effects contribute to the binding affinity. Methylated ribosomes show lower sampling of short 2'-OH to 2058 distances and also demonstrate enhanced G2057-A2058 stacking leading to disrupted A752-U2609 Watson-Crick (WC interactions as well as hydrogen bonding between telithromycin's ARM and U2609. This information will be of utility in the rational design of novel macrolide analogs with improved activity against methylated A2058 ribosomes.

  11. Highly conserved small subunit residues influence rubisco large subunit catalysis.

    Science.gov (United States)

    Genkov, Todor; Spreitzer, Robert J

    2009-10-30

    The chloroplast enzyme ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) catalyzes the rate-limiting step of photosynthetic CO(2) fixation. With a deeper understanding of its structure-function relationships and competitive inhibition by O(2), it may be possible to engineer an increase in agricultural productivity and renewable energy. The chloroplast-encoded large subunits form the active site, but the nuclear-encoded small subunits can also influence catalytic efficiency and CO(2)/O(2) specificity. To further define the role of the small subunit in Rubisco function, the 10 most conserved residues in all small subunits were substituted with alanine by transformation of a Chlamydomonas reinhardtii mutant that lacks the small subunit gene family. All the mutant strains were able to grow photosynthetically, indicating that none of the residues is essential for function. Three of the substitutions have little or no effect (S16A, P19A, and E92A), one primarily affects holoenzyme stability (L18A), and the remainder affect catalysis with or without some level of associated structural instability (Y32A, E43A, W73A, L78A, P79A, and F81A). Y32A and E43A cause decreases in CO(2)/O(2) specificity. Based on the x-ray crystal structure of Chlamydomonas Rubisco, all but one (Glu-92) of the conserved residues are in contact with large subunits and cluster near the amino- or carboxyl-terminal ends of large subunit alpha-helix 8, which is a structural element of the alpha/beta-barrel active site. Small subunit residues Glu-43 and Trp-73 identify a possible structural connection between active site alpha-helix 8 and the highly variable small subunit loop between beta-strands A and B, which can also influence Rubisco CO(2)/O(2) specificity.

  12. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  13. Purification and characterization of ribosomal proteins L27 and L30 having antimicrobial activity produced by the Lactobacillus salivarius SGL 03.

    Science.gov (United States)

    Pidutti, P; Federici, F; Brandi, J; Manna, L; Rizzi, E; Marini, U; Cecconi, D

    2018-02-01

    The aim of this study was to investigate the antimicrobial potential of proteins secreted by a new strain of Lactobacillus salivarius. The secretome of L. salivarius SGL 03 strain was analysed by gel-assisted fractionation and MS/MS to identify low-molecular-mass proteins. This strategy allowed us to identify 10 secreted proteins. Then, a combination of heterologous expression and agar well diffusion was used to characterize them as to their antimicrobial activity, mechanisms of action and stability. Our findings indicate that L27 and L30 proteins of the 50S ribosomal subunit have antimicrobial activity against Streptococcus pyogenes, Streptococcus uberis and Enterococcus faecium. In addition, both proteins are bactericidal against S. pyogenes and maintain their antimicrobial activity after different protease treatments, at acidic pH, after heat treatment, and if stored in a refrigerated ambient at least at 4°C. The overall results demonstrated that the L27 and L30 ribosomal proteins are of interest as new antimicrobial molecules to prevent the growth of S. pyogenes, S. uberis and E. faecium. Our results provide the first insight into the extra-ribosomal activity of L27 and L30 secreted proteins of L. salivarius. This study demonstrated the capacity of L. salivarius SGL 03 to produce antimicrobial molecules and suggested this strain as a promising probiotic candidate. © 2017 The Society for Applied Microbiology.

  14. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Genetic diversity of Clavispora lusitaniae isolated from Agave fourcroydes Lem, as revealed by DNA fingerprinting.

    Science.gov (United States)

    Pérez-Brito, Daisy; Magaña-Alvarez, Anuar; Lappe-Oliveras, Patricia; Cortes-Velazquez, Alberto; Torres-Calzada, Claudia; Herrera-Suarez, Teófilo; Larqué-Saavedra, Alfonso; Tapia-Tussell, Raul

    2015-01-01

    This study characterized Clavispora lusitaniae strains isolated from different stages of the processing and early fermentation of a henequen (Agave fourcroydes) spirit produced in Yucatan, Mexico using a molecular technique. Sixteen strains identified based on morphological features, obtained from different substrates, were typed molecularly. Nine different versions of the divergent D1/D2 domain of the large-subunit ribosomal DNA sequence were identified among the C. lusitaniae strains. The greatest degree of polymorphism was found in the 90-bp structural motif of the D2 domain. The MSP-PCR technique was able to differentiate 100% of the isolates. This study provides significant insight into the genetic diversity of the mycobiota present during the henequen fermentation process, especially that of C. lusitaniae, for which only a few studies in plants have been published. The applied MSP-PCR markers were very efficient in revealing olymorphisms between isolates of this species.

  16. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  17. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  18. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate...... transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells...

  19. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  20. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  1. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  2. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  3. Overexpression of the PP2A regulatory subunit Tap46 leads to enhanced plant growth through stimulation of the TOR signalling pathway.

    Science.gov (United States)

    Ahn, Chang Sook; Ahn, Hee-Kyung; Pai, Hyun-Sook

    2015-02-01

    Tap46, a regulatory subunit of protein phosphatase 2A (PP2A), plays an essential role in plant growth and development through a functional link with the Target of Rapamycin (TOR) signalling pathway. Here, we have characterized the molecular mechanisms behind a gain-of-function phenotype of Tap46 and its relationship with TOR to gain further insights into Tap46 function in plants. Constitutive overexpression of Tap46 in Arabidopsis resulted in overall growth stimulation with enlarged organs, such as leaves and siliques. Kinematic analysis of leaf growth revealed that increased cell size was mainly responsible for the leaf enlargement. Tap46 overexpression also enhanced seed size and viability under accelerated ageing conditions. Enhanced plant growth was also observed in dexamethasone (DEX)-inducible Tap46 overexpression Arabidopsis lines, accompanied by increased cellular activities of nitrate-assimilating enzymes. DEX-induced Tap46 overexpression and Tap46 RNAi resulted in increased and decreased phosphorylation of S6 kinase (S6K), respectively, which is a sensitive indicator of endogenous TOR activity, and Tap46 interacted with S6K in planta based on bimolecular fluorescence complementation and co-immunoprecipitation. Furthermore, inactivation of TOR by estradiol-inducible RNAi or rapamycin treatment decreased Tap46 protein levels, but increased PP2A catalytic subunit levels. Real-time quantitative PCR analysis revealed that Tap46 overexpression induced transcriptional modulation of genes involved in nitrogen metabolism, ribosome biogenesis, and lignin biosynthesis. These findings suggest that Tap46 modulates plant growth as a positive effector of the TOR signalling pathway and Tap46/PP2Ac protein abundance is regulated by TOR activity. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  4. Systematic relationships among Lutzomyia sand flies (Diptera: Psychodidae) of Peru and Colombia based on the analysis of 12S and 28S ribosomal DNA sequences.

    Science.gov (United States)

    Beati, Lorenza; Cáceres, Abraham G; Lee, Jamie A; Munstermann, Leonard E

    2004-02-01

    Lutzomyia spp. are New World phlebotomine sand flies, many of which are involved in the transmission of human diseases, such as leishmaniases and bartonellosis. The systematic classification of the approximately 400 species in the genus has been based on morphological characters, but the relationships within the genus are still very much in question. We have inferred phylogenies of 32 species of phlebotomine sand flies belonging to seven sub-genera and two species groups, by using fragments of the mitochondrial small subunit (12SrRNA) and of the nuclear large subunit (28SrRNA) ribosomal gene sequences. The subgenus Helcocyrtomyia and the Verrucarum species group, prominent representatives of the Peruvian sand fly fauna, were represented by 11 and 7 species, respectively. Although based on a limited number of taxa, the resulting phylogenies, based on 837 characters, provide an initial phylogenetic backbone for the progressive reconstruction of infrageneric relationships within Lutzomyia.

  5. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  6. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  7. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  8. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  9. Microarray data analyses of yeast RNA Pol I subunit RPA12 deletion strain

    Directory of Open Access Journals (Sweden)

    Kamlesh Kumar Yadav

    2016-06-01

    Full Text Available The ribosomal RNA (rRNA biosynthesis is the most energy consuming process in all living cells and the majority of total transcription activity is dedicated for synthesizing rRNA. The cells may adjust the synthesis of rRNA with the availability of resources. rRNA is mainly synthesized by RNA polymerase I that is composed of 14 subunits. Deletion of RPA12, 14, 39 and 49 are viable. RPA12 is a very small protein (13.6 kDa, and the amount of protein in the cells is very high (12,000 molecules per cell, but the role of this protein is unknown in other cellular metabolic processes (Kulak et al., 2014 [1]. RPA12 consists of two zinc-binding domains and it is required for the termination of rRNA synthesis (Mullem et al., 2002 [2]. Deletions of RPA12 in Saccharomyces cerevisiae and Schizosaccharomyces pombe cause a conditional growth defect (Nogi et al., 1993 [3]. In S. pombe, C-terminal deletion behaves like wild-type (Imazawa et al., 2001 [4]. This prompted us to investigate in detail the physiological role of RPA12 in S. cerevisiae, we performed the microarray of rpa12∆ strain and deposited into Gene Expression Omnibus under GSE68731. The analysis of microarray data revealed that the expression of major cellular metabolism genes is high. The amino acid biosynthesis, nonpolar lipid biosynthesis and glucose metabolic genes are highly expressed. The analyses also revealed that the rpa12∆ cells have an uncontrolled synthesis of cell metabolites, so RPA12 could be a master regulator for whole cellular metabolism.

  10. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  11. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  12. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  13. Multiple-Site Trimethylation of Ribosomal Protein L11 by the PrmA Methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2008-01-01

    Ribosomal protein L11 is a universally conserved component of the large subunit, and plays a significant role during initiation, elongation, and termination of protein synthesis. In Escherichia coli, the lysine methyltransferase PrmA trimethylates the N-terminal a-amino group and the -amino groups of Lys3 and Lys39. Here, we report four PrmA-L11 complex structures in different orientations with respect to the PrmA active site. Two structures capture the L11 N-terminal a-amino group in the active site in a trimethylated postcatalytic state and in a dimethylated state with bound S-adenosyl-L-homocysteine. Two other structures show L11 in a catalytic orientation to modify Lys39 and in a noncatalytic orientation. The comparison of complex structures in different orientations with a minimal substrate recognition complex shows that the binding mode remains conserved in all L11 orientations, and that substrate orientation is brought about by the unusual interdomain flexibility of PrmA.

  14. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  15. The structure of the protein phosphatase 2A PR65/A subunit reveals the conformation of its 15 tandemly repeated HEAT motifs

    NARCIS (Netherlands)

    Groves, M R; Hanlon, N; Turowski, P; Hemmings, B A; Barford, D

    1999-01-01

    The PR65/A subunit of protein phosphatase 2A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit, generating functionally diverse heterotrimers. Mutations of the beta isoform of PR65 are associated with lung and colon tumors. The

  16. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  17. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  18. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  19. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  1. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  2. iTRAQ Protein Profile Differential Analysis of Dormant and Germinated Grassbur Twin Seeds Reveals that Ribosomal Synthesis and Carbohydrate Metabolism Promote Germination Possibly Through the PI3K Pathway.

    Science.gov (United States)

    Zhang, Guo-Liang; Zhu, Yue; Fu, Wei-Dong; Wang, Peng; Zhang, Rui-Hai; Zhang, Yan-Lei; Song, Zhen; Xia, Gui-Xian; Wu, Jia-He

    2016-06-01

    Grassbur is a destructive and invasive weed in pastures, and its burs can cause gastric damage to animals. The strong adaptability and reproductive potential of grassbur are partly due to a unique germination mechanism whereby twin seeds develop in a single bur: one seed germinates, but the other remains dormant. To investigate the molecular mechanism of seed germination in twin seeds, we used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a dynamic proteomic analysis of germination and dormancy. A total of 1,984 proteins were identified, 161 of which were considered to be differentially accumulated. The differentially accumulated proteins comprised 102 up-regulated and 59 down-regulated proteins. These proteins were grouped into seven functional categories, ribosomal proteins being the predominant group. The authenticity and accuracy of the results were confirmed by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time reverse transcription-PCR (qPCR). A dynamic proteomic analysis revealed that ribosome synthesis and carbohydrate metabolism affect seed germination possibly through the phosphoinositide 3-kinase (PI3K) pathway. As the PI3K pathway is generally activated by insulin, analyses of seeds treated with exogenous insulin by qPCR, ELISA and iTRAQ confirmed that the PI3K pathway can be activated, which suppresses dormancy and promotes germination in twin grassbur seeds. Together, these results show that the PI3K pathway may play roles in stimulating seed germination in grassbur by modulating ribosomal synthesis and carbohydrate metabolism. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    Science.gov (United States)

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

  4. Catalytic Subunit 1 of Protein Phosphatase 2A Is a Subunit of the STRIPAK Complex and Governs Fungal Sexual Development

    Directory of Open Access Journals (Sweden)

    Anna Beier

    2016-06-01

    Full Text Available The generation of complex three-dimensional structures is a key developmental step for most eukaryotic organisms. The details of the molecular machinery controlling this step remain to be determined. An excellent model system to study this general process is the generation of three-dimensional fruiting bodies in filamentous fungi like Sordaria macrospora. Fruiting body development is controlled by subunits of the highly conserved striatin-interacting phosphatase and kinase (STRIPAK complex, which has been described in organisms ranging from yeasts to humans. The highly conserved heterotrimeric protein phosphatase PP2A is a subunit of STRIPAK. Here, catalytic subunit 1 of PP2A was functionally characterized. The Δpp2Ac1 strain is sterile, unable to undergo hyphal fusion, and devoid of ascogonial septation. Further, PP2Ac1, together with STRIPAK subunit PRO22, governs vegetative and stress-related growth. We revealed in vitro catalytic activity of wild-type PP2Ac1, and our in vivo analysis showed that inactive PP2Ac1 blocks the complementation of the sterile deletion strain. Tandem affinity purification, followed by mass spectrometry and yeast two-hybrid analysis, verified that PP2Ac1 is a subunit of STRIPAK. Further, these data indicate links between the STRIPAK complex and other developmental signaling pathways, implying the presence of a large interconnected signaling network that controls eukaryotic developmental processes. The insights gained in our study can be transferred to higher eukaryotes and will be important for understanding eukaryotic cellular development in general.

  5. Novel subunit structure observed for noncooperative hemoglobin from Urechis caupo.

    Science.gov (United States)

    Kolatkar, P R; Meador, W E; Stanfield, R L; Hackert, M L

    1988-03-05

    Tetrameric hemoglobin from the "fat innkeeper" worm Urechis caupo possesses a novel subunit arrangement having an "inside out" quaternary structure in that the G/H helices are located on the outer surface of the tetramer. A 5-A resolution crystal structure reveals that although the individual subunits are beta-like, having a distinct D helix and the general myoglobin fold, the subunit contacts are very different from those previously observed for hemoglobins. Furthermore, the hemoglobin from U. caupo is also quite different from the unusual hemoglobin tetramer from clam which also has its G/H helices on the outer surface but with the hemes in close proximity through E-F helical contacts (Royer, W. E., Jr., Love, W. E., and Fenderson, F. F. (1985) Nature 316, 277-280).

  6. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  7. Cholera Toxin B: One Subunit with Many Pharmaceutical Applications

    Directory of Open Access Journals (Sweden)

    Keegan J. Baldauf

    2015-03-01

    Full Text Available Cholera, a waterborne acute diarrheal disease caused by Vibrio cholerae, remains prevalent in underdeveloped countries and is a serious health threat to those living in unsanitary conditions. The major virulence factor is cholera toxin (CT, which consists of two subunits: the A subunit (CTA and the B subunit (CTB. CTB is a 55 kD homopentameric, non-toxic protein binding to the GM1 ganglioside on mammalian cells with high affinity. Currently, recombinantly produced CTB is used as a component of an internationally licensed oral cholera vaccine, as the protein induces potent humoral immunity that can neutralize CT in the gut. Additionally, recent studies have revealed that CTB administration leads to the induction of anti-inflammatory mechanisms in vivo. This review will cover the potential of CTB as an immunomodulatory and anti-inflammatory agent. We will also summarize various recombinant expression systems available for recombinant CTB bioproduction.

  8. HuR and Ago2 Bind the Internal Ribosome Entry Site of Enterovirus 71 and Promote Virus Translation and Replication.

    Directory of Open Access Journals (Sweden)

    Jing-Yi Lin

    Full Text Available EV71 (enterovirus 71 RNA contains an internal ribosomal entry site (IRES that directs cap-independent initiation of translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs. We reported recently that mRNA decay factor AUF1 is a negative-acting ITAF that binds IRES stem-loop II. We also reported that the small RNA-processing enzyme Dicer produces at least four small RNAs (vsRNAs from the EV71 IRES. One of these, vsRNA1, derived from IRES stem-loop II, reduces IRES activity and virus replication. Since its mechanism of action is unknown, we hypothesized that it might control association of ITAFs with the IRES. Here, we identified the mRNA stability factor HuR and the RISC subunit Argonaute 2 (Ago2 as two ITAFs that bind stem-loop II. In contrast to AUF1, HuR and Ago2 promote EV71 IRES activity and virus replication. In vitro RNA-binding assays revealed that vsRNA1 can alter association of Ago2, HuR, and AUF1 with stem-loop II. This presents a possible mechanism by which vsRNA1 could control viral translation and replication.

  9. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  10. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  11. Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

    Energy Technology Data Exchange (ETDEWEB)

    Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea; Hansen, Kasper B. (JHU); (Milan); (Montana)

    2017-07-31

    NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.

  12. Comparative sequence analysis of the complete set of 40S ribosomal proteins in the Senegalese sole (Solea senegalensis Kaup) and Atlantic halibut (Hippoglossus hippoglossus L.) (Teleostei: Pleuronectiformes): phylogeny and tissue- and development-specific expression.

    Science.gov (United States)

    Manchado, Manuel; Infante, Carlos; Asensio, Esther; Cañavate, Jose Pedro; Douglas, Susan E

    2007-07-03

    Ribosomal proteins (RPs) are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. The development of large-scale genomics of Senegalese sole (Solea senegalensis) and Atlantic halibut (Hippoglossus hippoglossus), two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S) ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29) in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.

  13. Comparative sequence analysis of the complete set of 40S ribosomal proteins in the Senegalese sole (Solea senegalensis Kaup and Atlantic halibut (Hippoglossus hippoglossus L. (Teleostei: Pleuronectiformes: phylogeny and tissue- and development-specific expression

    Directory of Open Access Journals (Sweden)

    Cañavate Jose

    2007-07-01

    Full Text Available Abstract Background Ribosomal proteins (RPs are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. Results The development of large-scale genomics of Senegalese sole (Solea senegalensis and Atlantic halibut (Hippoglossus hippoglossus, two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29 in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. Conclusion The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.

  14. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  15. Mutations in the Bacterial Ribosomal Protein L3 and Their Association with Antibiotic Resistance

    Science.gov (United States)

    Klitgaard, Rasmus N.; Ntokou, Eleni; Nørgaard, Katrine; Biltoft, Daniel; Hansen, Lykke H.; Trædholm, Nicolai M.; Kongsted, Jacob

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild-type genes with mutated L3 genes in a chromosomal L3 deletion strain. In this way, the essential L3 gene is available for the bacteria while allowing replacement of the wild type with mutated L3 genes. This enables investigation of the effect of single mutations in Escherichia coli without a wild-type L3 background. Ten plasmid-carried mutated L3 genes were constructed, and their effect on growth and antibiotic susceptibility was investigated. Additionally, computational modeling of the impact of L3 mutations in E. coli was used to assess changes in 50S structure and antibiotic binding. All mutations are placed in the loops of L3 near the PTC. Growth data show that 9 of the 10 mutations were well accepted in E. coli, although some of them came with a fitness cost. Only one of the mutants exhibited reduced susceptibility to linezolid, while five exhibited reduced susceptibility to tiamulin. PMID:25845869

  16. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  17. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  18. Catalytic Subunit 1 of Protein Phosphatase 2A Is a Subunit of the STRIPAK Complex and Governs Fungal Sexual Development.

    Science.gov (United States)

    Beier, Anna; Teichert, Ines; Krisp, Christoph; Wolters, Dirk A; Kück, Ulrich

    2016-06-21

    The generation of complex three-dimensional structures is a key developmental step for most eukaryotic organisms. The details of the molecular machinery controlling this step remain to be determined. An excellent model system to study this general process is the generation of three-dimensional fruiting bodies in filamentous fungi like Sordaria macrospora Fruiting body development is controlled by subunits of the highly conserved striatin-interacting phosphatase and kinase (STRIPAK) complex, which has been described in organisms ranging from yeasts to humans. The highly conserved heterotrimeric protein phosphatase PP2A is a subunit of STRIPAK. Here, catalytic subunit 1 of PP2A was functionally characterized. The Δpp2Ac1 strain is sterile, unable to undergo hyphal fusion, and devoid of ascogonial septation. Further, PP2Ac1, together with STRIPAK subunit PRO22, governs vegetative and stress-related growth. We revealed in vitro catalytic activity of wild-type PP2Ac1, and our in vivo analysis showed that inactive PP2Ac1 blocks the complementation of the sterile deletion strain. Tandem affinity purification, followed by mass spectrometry and yeast two-hybrid analysis, verified that PP2Ac1 is a subunit of STRIPAK. Further, these data indicate links between the STRIPAK complex and other developmental signaling pathways, implying the presence of a large interconnected signaling network that controls eukaryotic developmental processes. The insights gained in our study can be transferred to higher eukaryotes and will be important for understanding eukaryotic cellular development in general. The striatin-interacting phosphatase and kinase (STRIPAK) complex is highly conserved from yeasts to humans and is an important regulator of numerous eukaryotic developmental processes, such as cellular signaling and cell development. Although functional insights into the STRIPAK complex are accumulating, the detailed molecular mechanisms of single subunits are only partially understood

  19. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  20. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    Science.gov (United States)

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.

  1. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Role of adenosine 5'-monophosphate-activated protein kinase subunits in skeletal muscle mammalian target of rapamycin signaling

    DEFF Research Database (Denmark)

    Deshmukh, Atul S.; Treebak, Jonas Thue; Long, Yun Chau

    2008-01-01

    AMP-activated protein kinase (AMPK) is an important energy-sensing protein in skeletal muscle. Mammalian target of rapamycin (mTOR) mediates translation initiation and protein synthesis through ribosomal S6 kinase 1 (S6K1) and eukaryotic initiation factor 4E-binding protein 1 (4E-BP1). AMPK...... activation reduces muscle protein synthesis by down-regulating mTOR signaling, whereas insulin mediates mTOR signaling via Akt activation. We hypothesized that AMPK-mediated inhibitory effects on mTOR signaling depend on catalytic alpha2 and regulatory gamma3 subunits. Extensor digitorum longus muscle from...... (Thr37/46) (P mTOR targets, suggesting mTOR signaling is blocked by prior AMPK activation. The AICAR-induced inhibition was partly rescued...

  3. Verification of Ribosomal Proteins of Aspergillus fumigatus for Use as Biomarkers in MALDI-TOF MS Identification.

    Science.gov (United States)

    Nakamura, Sayaka; Sato, Hiroaki; Tanaka, Reiko; Yaguchi, Takashi

    2016-01-01

    We have previously proposed a rapid identification method for bacterial strains based on the profiles of their ribosomal subunit proteins (RSPs), observed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). This method can perform phylogenetic characterization based on the mass of housekeeping RSP biomarkers, ideally calculated from amino acid sequence information registered in public protein databases. With the aim of extending its field of application to medical mycology, this study investigates the actual state of information of RSPs of eukaryotic fungi registered in public protein databases through the characterization of ribosomal protein fractions extracted from genome-sequenced Aspergillus fumigatus strains Af293 and A1163 as a model. In this process, we have found that the public protein databases harbor problems. The RSP names are in confusion, so we have provisionally unified them using the yeast naming system. The most serious problem is that many incorrect sequences are registered in the public protein databases. Surprisingly, more than half of the sequences are incorrect, due chiefly to mis-annotation of exon/intron structures. These errors could be corrected by a combination of in silico inspection by sequence homology analysis and MALDI-TOF MS measurements. We were also able to confirm conserved post-translational modifications in eleven RSPs. After these verifications, the masses of 31 expressed RSPs under 20,000 Da could be accurately confirmed. These RSPs have a potential to be useful biomarkers for identifying clinical isolates of A. fumigatus .

  4. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  5. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  6. Rmt1 catalyzes zinc-finger independent arginine methylation of ribosomal protein Rps2 in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Lipson, Rebecca S.; Webb, Kristofor J.; Clarke, Steven G.

    2010-01-01

    Rps2/rpS2 is a well conserved protein of the eukaryotic ribosomal small subunit. Rps2 has previously been shown to contain asymmetric dimethylarginine residues, the addition of which is catalyzed by zinc-finger-containing arginine methyltransferase 3 (Rmt3) in the fission yeast Schizosaccharomyces pombe and protein arginine methyltransferase 3 (PRMT3) in mammalian cells. Here, we demonstrate that despite the lack of a zinc-finger-containing homolog of Rmt3/PRMT3 in the budding yeast Saccharomyces cerevisiae, Rps2 is partially modified to generate asymmetric dimethylarginine and monomethylarginine residues. We find that this modification of Rps2 is dependent upon the major arginine methyltransferase 1 (Rmt1) in S. cerevisiae. These results are suggestive of a role for Rmt1 in modifying the function of Rps2 in a manner distinct from that occurring in S. pombe and mammalian cells.

  7. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  8. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  9. Multilocus phylogenetic reconstruction of the Clavariaceae (Agaricales) reveals polyphyly of agaricoid members.

    Science.gov (United States)

    Birkebak, Joshua M; Adamčík, Slavomír; Looney, Brian P; Matheny, P Brandon

    2016-09-01

    The genus Camarophyllopsis contains species with lamellate (agaricoid) basidiomes in the family Clavariaceae (Agaricales), a group otherwise dominated by club-like (clavarioid) or branched (coralloid) forms. Previous studies have suggested that species classified in Camarophyllopsis occur in two independent lineages. We reconstructed a multilocus phylogeny of the Clavaria-Camarophyllopsis-Clavicorona clade in the Clavariaceae using RNA polymerase II second largest subunit (rpb2), nuclear ribosomal 28S, and nuclear ribosomal ITS1-5.8S-ITS2 regions data and detected three independent groups of agaricoid fungi, including the genera Camarophyllopsis, Hodophilus, and Lamelloclavaria gen. nov, which distinctly differ in their pileipellis structure. In all, nine major lineages within the Clavaria-Camarophyllopsis-Clavicorona clade were recovered: Clavaria sensu stricto, Camarophyllopsis sensu stricto, Hodophilus, the Clavaria pullei clade, the Clavaria fumosa clade, Lamelloclavaria gen. nov., the Clavaria atrofusca clade, Holocoryne (= Clavaria sect. Holocoryne), and Clavicorona Clavaria is paraphyletic and represented by five clades. Additional gene sampling is necessary to determine and confirm relatedness of these lineages before splitting Clavaria into additional genera. © 2016 by The Mycological Society of America.

  10. Two Nucleolar Proteins, GDP1 and OLI2, Function As Ribosome Biogenesis Factors and Are Preferentially Involved in Promotion of Leaf Cell Proliferation without Strongly Affecting Leaf Adaxial–Abaxial Patterning in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Koji Kojima

    2018-01-01

    Full Text Available Leaf abaxial–adaxial patterning is dependent on the mutual repression of leaf polarity genes expressed either adaxially or abaxially. In Arabidopsis thaliana, this process is strongly affected by mutations in ribosomal protein genes and in ribosome biogenesis genes in a sensitized genetic background, such as asymmetric leaves2 (as2. Most ribosome-related mutants by themselves do not show leaf abaxialization, and one of their typical phenotypes is the formation of pointed rather than rounded leaves. In this study, we characterized two ribosome-related mutants to understand how ribosome biogenesis is linked to several aspects of leaf development. Previously, we isolated oligocellula2 (oli2 which exhibits the pointed-leaf phenotype and has a cell proliferation defect. OLI2 encodes a homolog of Nop2 in Saccharomyces cerevisiae, a ribosome biogenesis factor involved in pre-60S subunit maturation. In this study, we found another pointed-leaf mutant that carries a mutation in a gene encoding an uncharacterized protein with a G-patch domain. Similar to oli2, this mutant, named g-patch domain protein1 (gdp1, has a reduced number of leaf cells. In addition, gdp1 oli2 double mutants showed a strong genetic interaction such that they synergistically impaired cell proliferation in leaves and produced markedly larger cells. On the other hand, they showed additive phenotypes when combined with several known ribosomal protein mutants. Furthermore, these mutants have a defect in pre-rRNA processing. GDP1 and OLI2 are strongly expressed in tissues with high cell proliferation activity, and GDP1-GFP and GFP-OLI2 are localized in the nucleolus. These results suggest that OLI2 and GDP1 are involved in ribosome biogenesis. We then examined the effects of gdp1 and oli2 on adaxial–abaxial patterning by crossing them with as2. Interestingly, neither gdp1 nor oli2 strongly enhanced the leaf polarity defect of as2. Similar results were obtained with as2 gdp1 oli2

  11. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  12. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  13. Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

    Science.gov (United States)

    Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

    2015-07-01

    Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

  14. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  15. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  16. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  18. The RNA recognition motif of eukaryotic translation initiation factor 3g (eIF3g) is required for resumption of scanning of posttermination ribosomes for reinitiation on GCN4 and together with eIF3i stimulates linear scanning.

    Science.gov (United States)

    Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos

    2010-10-01

    Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.

  19. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  20. [Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1996-12-01

    The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.

  1. Role of the Rubisco Small Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Spreitzer, Robert Joseph [Univ. of Nebraska, Lincoln, NE (United States)

    2016-11-05

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) catalyzes the rate-limiting step of CO2 fixation in photosynthesis. However, it is a slow enzyme, and O2 competes with CO2 at the active site. Oxygenation initiates the photorespiratory pathway, which also results in the loss of CO2. If carboxylation could be increased or oxygenation decreased, an increase in net CO2 fixation would be realized. Because Rubisco provides the primary means by which carbon enters all life on earth, there is much interest in engineering Rubisco to increase the production of food and renewable energy. Rubisco is located in the chloroplasts of plants, and it is comprised of two subunits. Much is known about the chloroplast-gene-encoded large subunit (rbcL gene), which contains the active site, but much less is known about the role of the nuclear-gene-encoded small subunit in Rubisco function (rbcS gene). Both subunits are coded by multiple genes in plants, which makes genetic engineering difficult. In the eukaryotic, green alga Chlamydomonas reinhardtii, it has been possible to eliminate all the Rubisco genes. These Rubisco-less mutants can be maintained by providing acetate as an alternative carbon source. In this project, focus has been placed on determining whether the small subunit might be a better genetic-engineering target for improving Rubisco. Analysis of a variable-loop structure (βA-βB loop) of the small subunit by genetic selection, directed mutagenesis, and construction of chimeras has shown that the small subunit can influence CO2/O2 specificity. X-ray crystal structures of engineered chimeric-loop enzymes have indicated that additional residues and regions of the small subunit may also contribute to Rubisco function. Structural dynamics of the small-subunit carboxyl terminus was also investigated. Alanine-scanning mutagenesis of the most-conserved small-subunit residues has identified a

  2. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  3. Characterization of the diatomite binding domain in the ribosomal protein L2 from E. coli and functions as an affinity tag.

    Science.gov (United States)

    Li, Junhua; Zhang, Yang; Yang, Yanjun

    2013-03-01

    The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.

  4. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  5. Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

    International Nuclear Information System (INIS)

    Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

    2008-01-01

    The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

  6. MPC1-like Is a Placental Mammal-specific Mitochondrial Pyruvate Carrier Subunit Expressed in Postmeiotic Male Germ Cells

    OpenAIRE

    Vanderperre, Benoît; Cermakova, Kristina; Escoffier Breancon, Jessica; Kaba, Mayis; Bender, Tom; Nef, Serge; Martinou, Jean-Claude

    2016-01-01

    Selective transport of pyruvate across the inner mitochondrial membrane by the mitochondrial pyruvate carrier (MPC) is a fundamental step that couples cytosolic and mitochondrial metabolism. The recent molecular identification of the MPC complex has revealed two interacting subunits, MPC1 and MPC2. Although in yeast, an additional subunit, MPC3, can functionally replace MPC2, no alternative MPC subunits have been described in higher eukaryotes. Here, we report for the first time the existence...

  7. cDNA Cloning, Overexpression, Purification and Pharmacologic Evaluation for Anticancer Activity of Ribosomal Protein L23A Gene (RPL23A from the Giant Panda

    Directory of Open Access Journals (Sweden)

    Si-Nan Zhang

    2012-02-01

    Full Text Available RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A gene of the Giant Panda (Ailuropoda melanoleuca. The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids

  8. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    Science.gov (United States)

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  9. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10; Clonagem, expressao, purificacao e caracterizacao estrutural da proteina ribossomal L10 humana recombinante

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Larissa Miranda

    2009-07-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813{sub Q}M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by {beta}- sheet feature. (author)

  10. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  11. Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chengliang [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Zhang, Qiongdi [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Hang, Tianrong [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Tao, Yue [Shanghai Children’s Medical Center, 1678 Dongfang Road, Pudong, Shanghai 200120, People’s Republic of (China); Ma, Xukai [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Wu, Minhao; Zhang, Xuan, E-mail: xuanzbin@ustc.edu.cn; Zang, Jianye, E-mail: xuanzbin@ustc.edu.cn [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China)

    2015-08-28

    The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66{sup 176–C} complexed with Rpl8{sup 204–224} in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity.

  12. Analyzing proteasomal subunit expression reveals Rpt4 as a prognostic marker in stage II colorectal cancer.

    LENUS (Irish Health Repository)

    2012-02-01

    Colorectal cancer is a leading cause of cancer-related deaths worldwide. Early diagnosis and treatment of colorectal cancer is the key to improving survival rates and as such a need exists to identify patients who may benefit from adjuvant chemotherapy. The dysregulation of the ubiquitin-proteasome system (UPS) has been implicated in oncogenesis and cancer cell survival, and proteasome inhibitors are in clinical use for a number of malignancies including multiple myeloma. In our study, we examined the protein expression of several key components of the UPS in colorectal cancer using immunohistochemistry to determine expression levels of ubiquitinylated proteins and the proteasomal subunits, 20S core and Rpt4 in a cohort of 228 patients with colon cancer. Multivariate Cox analysis revealed that neither the intensity of either ubiquitinylated proteins or the 20S core was predictive in either Stage II or III colon cancer for disease free survival or overall survival. In contrast, in Stage II patients increased Rpt4 staining was significantly associated with disease free survival (Cox proportional hazard ratio 0.605; p = 0.0217). Our data suggest that Rpt4 is an independent prognostic variable for Stage II colorectal cancer and may aid in the decision of which patients undergo adjuvant chemotherapy.

  13. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  14. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  15. Expression profiling of Ribosomal Protein gene family in dehydration stress responses and characterization of transgenic rice plants overexpressing RPL23A for water-use efficiency and tolerance to drought and salt stresses

    Science.gov (United States)

    Moin, Mazahar; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

    2017-11-01

    Our previous findings on the screening of a large-pool of activation tagged rice plants grown under limited water conditions revealed the activation of Ribosomal Protein Large (RPL) subunit genes, RPL6 and RPL23A in two mutants that exhibited high water-use efficiency (WUE) with the genes getting activated by the integrated 4x enhancers (Moin et al., 2016a). In continuation of these findings, we have comprehensively characterized the Ribosomal Protein (RP) gene family including both small (RPS) and large (RPL) subunits, which have been identified to be encoded by at least 70 representative genes; RP-genes exist as multiple expressed copies with high nucleotide and amino acid sequence similarity. The differential expression of all the representative genes in rice was performed under limited water and drought conditions at progressive time intervals in the present study. More than 50% of the RP genes were upregulated in both shoot and root tissues. Some of them exhibited an overlap in the upregulation under both the treatments indicating that they might have a common role in inducing tolerance under limited water and drought conditions. Among the genes that became significantly upregulated in both the tissues and under both the treatments are RPL6, 7, 23A, 24 and 31 and RPS4, 10 and 18a. To further validate the role of RP genes in WUE and inducing tolerance to other stresses, we have raised transgenic plants overexpressing RPL23A in rice. The high expression lines of RPL23A exhibited low Δ13C, increased quantum efficiency along with suitable growth and yield parameters with respect to negative control under the conditions of limited water availability. The constitutive expression of RPL23A was also associated with transcriptional upregulation of many other RPL and RPS genes. The seedlings of RPL23A high expression lines also showed a significant increase in fresh weight, root length, proline and chlorophyll contents under simulated drought and salt stresses. Taken

  16. Modeling of the structure of ribosomal protein L1 from the archaeon Haloarcula marismortui

    Science.gov (United States)

    Nevskaya, N. A.; Kljashtorny, V. G.; Vakhrusheva, A. V.; Garber, M. B.; Nikonov, S. V.

    2017-07-01

    The halophilic archaeon Haloarcula marismortui proliferates in the Dead Sea at extremely high salt concentrations (higher than 3 M). This is the only archaeon, for which the crystal structure of the ribosomal 50S subunit was determined. However, the structure of the functionally important side protuberance containing the abnormally negatively charged protein L1 (HmaL1) was not visualized. Attempts to crystallize HmaL1 in the isolated state or as its complex with RNA using normal salt concentrations (≤500 mM) failed. A theoretical model of HmaL1 was built based on the structural data for homologs of the protein L1 from other organisms, and this model was refined by molecular dynamics methods. Analysis of this model showed that the protein HmaL1 can undergo aggregation due to the presence of a cluster of positive charges unique for proteins L1. This cluster is located at the RNA-protein interface, which interferes with the crystallization of HmaL1 and the binding of the latter to RNA.

  17. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    Directory of Open Access Journals (Sweden)

    Sasaki Yukako

    2008-10-01

    Full Text Available Abstract Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit. Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas. The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98 ; L: 98–100%. The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed.

  18. Distribution of the a2, a3, and a5 nicotinic acetylcholine receptor subunits in the chick brain

    Directory of Open Access Journals (Sweden)

    Torrão A.S.

    1997-01-01

    Full Text Available Nicotinic acetylcholine receptors (nAChRs are ionotropic receptors comprised of a and ß subunits. These receptors are widely distributed in the central nervous system, and previous studies have revealed specific patterns of localization for some nAChR subunits in the vertebrate brain. In the present study we used immunohistochemical methods and monoclonal antibodies to localize the a2, a3, and a5 nAChR subunits in the chick mesencephalon and diencephalon. We observed a differential distribution of these three subunits in the chick brain, and showed that the somata and neuropil of many central structures contain the a5 nAChR subunit. The a2 and a3 subunits, on the other hand, exhibited a more restricted distribution than a5 and other subunits previously studied, namely a7, a8 and ß2. The patterns of distribution of the different nAChR subunits suggest that neurons in many brain structures may contain several subtypes of nAChRs and that in a few regions one particular subtype may determine the cholinergic nicotinic responses

  19. Molecular cloning of the α subunit of human and guinea pig leukocyte adhesion glycoprotein Mo1: Chromosomal localization and homology to the α subunits of integrins

    International Nuclear Information System (INIS)

    Arnaout, M.A.; Remold-O'Donnell, E.; Pierce, M.W.; Harris, P.; Tenen, D.G.

    1988-01-01

    The cell surface-glycoprotein Mo1 is a member of the family of leukocyte cell adhesion molecules (Leu-CAMs) that includes lymphocyte function-associated antigen 1 (LFA-1) and p150,95. Each Leu-CAM is a heterodimer with a distinct α subunit noncovalently associated with a common β subunit. The authors describe the isolation and analysis of two partial cDNA clones encoding the α subunit of the Leu-CAM Mo1 in humans and guinea pigs. A monoclonal antibody directed against an epitope in the carboxyl-terminal portion of the guinea pig α chain was used for immunoscreening a λgt11 expression library. The sequence of a 378-base-pair insert from one immunoreactive clone revealed a single continuous open reading frame encoding 126 amino acids including a 26-amino acid tryptic peptide isolated from the purified guinea pig α subunit. A cDNA clone of identical size was isolated from a human monocyte/lymphocyte cDNA library by using the guinea pig clone as a probe. The human clone also encoded a 126-amino acid peptide including the sequence of an additional tryptic peptide present in purified human Mo1α chain. Southern analysis of DNA from hamster-human hybrids localized the human Mo1α chain to chromosome 16, which has been shown to contain the gene for the α chain of lymphocyte function-associated antigen 1. These data suggest that the α subunits of Leu-CAMs evolved by gene duplication from a common ancestral gene and strengthen the hypothesis that the α subunits of these heterodimeric cell adhesion molecules on myeloid and lymphoid cells, platelets, and fibroblasts are evolutionary related

  20. Condensin HEAT subunits required for DNA repair, kinetochore/centromere function and ploidy maintenance in fission yeast.

    Directory of Open Access Journals (Sweden)

    Xingya Xu

    Full Text Available Condensin, a central player in eukaryotic chromosomal dynamics, contains five evolutionarily-conserved subunits. Two SMC (structural maintenance of chromosomes subunits contain ATPase, hinge, and coiled-coil domains. One non-SMC subunit is similar to bacterial kleisin, and two other non-SMC subunits contain HEAT (similar to armadillo repeats. Here we report isolation and characterization of 21 fission yeast (Schizosaccharomyces pombe mutants for three non-SMC subunits, created using error-prone mutagenesis that resulted in single-amino acid substitutions. Beside condensation, segregation, and DNA repair defects, similar to those observed in previously isolated SMC and cnd2 mutants, novel phenotypes were observed for mutants of HEAT-repeats containing Cnd1 and Cnd3 subunits. cnd3-L269P is hypersensitive to the microtubule poison, thiabendazole, revealing defects in kinetochore/centromere and spindle assembly checkpoints. Three cnd1 and three cnd3 mutants increased cell size and doubled DNA content, thereby eliminating the haploid state. Five of these mutations reside in helix B of HEAT repeats. Two non-SMC condensin subunits, Cnd1 and Cnd3, are thus implicated in ploidy maintenance.

  1. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  2. Recent studies implicate the nucleolus as the major site of nuclear translation.

    Science.gov (United States)

    McLeod, Tina; Abdullahi, Akilu; Li, Min; Brogna, Saverio

    2014-08-01

    The nucleolus is the most prominent morphological feature within the nucleus of eukaryotic cells and is best known for its role in ribosome biogenesis. It forms around highly transcribed ribosomal RNA gene repeats which yield precursor rRNAs that are co-transcriptionally processed, folded and, while still within the nucleolus, associate with most of the ribosomal proteins. The nucleolus is therefore often thought of as a factory for making ribosomal subunits, which are exported as inactive precursors to the cytoplasm where late maturation makes them capable of mRNA binding and translation initiation. However, recent studies have shown substantial evidence for the presence of functional, translation competent ribosomal subunits within the nucleus, particularly in the nucleolus. These observations raise the intriguing possibility that the nucleolus, as well as being a ribosome factory, is also an important nuclear protein-synthesis plant.

  3. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  4. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  5. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  6. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  7. Identification of Fasciola species based on mitochondrial and nuclear DNA reveals the co-existence of intermediate Fasciola and Fasciola gigantica in Thailand.

    Science.gov (United States)

    Wannasan, Anchalee; Khositharattanakool, Pathamet; Chaiwong, Prasong; Piangjai, Somsak; Uparanukraw, Pichart; Morakote, Nimit

    2014-11-01

    Molecular techniques were used to identify Fasciola species collected from Chiang Mai Thailand. Morphometrically, 65 stained and 45 fresh worms collected from cattle suggested the possible occurrence of both F. gigantica and F. hepatica. Twenty-two worms comprising 15 from cattle and 7 from human patients, were identified subsequently based on three genetic markers: mitochondrial nicotinamide adenine dinucleotide dehydrogenase subunit 1 (nad1), mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS2). All of them presented the F. gigantica type in maternally inherited mitochondrial sequences (nad1 and cox1), with six types in each sequence (FgNDI-CM1 to FgNDI-CM6 and FgCOI-CM1 to FgCOI-CM6, respectively). Remarkably, the predominant nad1 type, FgNDI-CM6, was identical to that of aspermic Fasciola sp. formerly reported from Thailand, Japan, Korea, China, Vietnam, and Myanmar. ITS2 sequences were analyzed successfully in 20 worms. Fifteen worms showed the F. gigantica type and five (including one worm from a patient) had mixed ITS2 sequences of both F. gigantica and F. hepatica in the same worms, with additional heterogeneity within both ITS2 types. This study revealed the intermediate form of Fasciola coexisting with F. gigantica for the first time in Thailand.

  8. Structure/Function Studies of the α4 Subunit Reveal Evolutionary Loss of a GlyR Subtype Involved in Startle and Escape Responses

    Directory of Open Access Journals (Sweden)

    Sophie Leacock

    2018-01-01

    Full Text Available Inhibitory glycine receptors (GlyRs are pentameric ligand-gated anion channels with major roles in startle disease/hyperekplexia (GlyR α1, cortical neuronal migration/autism spectrum disorder (GlyR α2, and inflammatory pain sensitization/rhythmic breathing (GlyR α3. However, the role of the GlyR α4 subunit has remained enigmatic, because the corresponding human gene (GLRA4 is thought to be a pseudogene due to an in-frame stop codon at position 390 within the fourth membrane-spanning domain (M4. Despite this, a recent genetic study has implicated GLRA4 in intellectual disability, behavioral problems and craniofacial anomalies. Analyzing data from sequenced genomes, we found that GlyR α4 subunit genes are predicted to be intact and functional in the majority of vertebrate species—with the exception of humans. Cloning of human GlyR α4 cDNAs excluded alternative splicing and RNA editing as mechanisms for restoring a full-length GlyR α4 subunit. Moreover, artificial restoration of the missing conserved arginine (R390 in the human cDNA was not sufficient to restore GlyR α4 function. Further bioinformatic and mutagenesis analysis revealed an additional damaging substitution at K59 that ablates human GlyR α4 function, which is not present in other vertebrate GlyR α4 sequences. The substitutions K59 and X390 were also present in the genome of an ancient Denisovan individual, indicating that GLRA4 has been a pseudogene for at least 30,000–50,000 years. In artificial synapses, we found that both mouse and gorilla α4β GlyRs mediate synaptic currents with unusually slow decay kinetics. Lastly, to gain insights into the biological role of GlyR α4 function, we studied the duplicated genes glra4a and glra4b in zebrafish. While glra4b expression is restricted to the retina, using a novel tol2-GAL4FF gene trap line (SAIGFF16B, we found that the zebrafish GlyR α4a subunit gene (glra4a is strongly expressed in spinal cord and hindbrain commissural

  9. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  10. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  11. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  12. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  13. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  14. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Madumycin II inhibits peptide bond formation by forcing the peptidyl transferase center into an inactive state

    Energy Technology Data Exchange (ETDEWEB)

    Osterman, Ilya A.; Khabibullina, Nelli F.; Komarova, Ekaterina S.; Kasatsky, Pavel; Kartsev, Victor G.; Bogdanov, Alexey A.; Dontsova, Olga A.; Konevega, Andrey L.; Sergiev, Petr V.; Polikanov, Yury S. (InterBioScreen); (UIC); (MSU-Russia); (Kurchatov)

    2017-05-13

    The emergence of multi-drug resistant bacteria is limiting the effectiveness of commonly used antibiotics, which spurs a renewed interest in revisiting older and poorly studied drugs. Streptogramins A is a class of protein synthesis inhibitors that target the peptidyl transferase center (PTC) on the large subunit of the ribosome. In this work, we have revealed the mode of action of the PTC inhibitor madumycin II, an alanine-containing streptogramin A antibiotic, in the context of a functional 70S ribosome containing tRNA substrates. Madumycin II inhibits the ribosome prior to the first cycle of peptide bond formation. It allows binding of the tRNAs to the ribosomal A and P sites, but prevents correct positioning of their CCA-ends into the PTC thus making peptide bond formation impossible. We also revealed a previously unseen drug-induced rearrangement of nucleotides U2506 and U2585 of the 23S rRNA resulting in the formation of the U2506•G2583 wobble pair that was attributed to a catalytically inactive state of the PTC. The structural and biochemical data reported here expand our knowledge on the fundamental mechanisms by which peptidyl transferase inhibitors modulate the catalytic activity of the ribosome.

  16. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  17. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    Directory of Open Access Journals (Sweden)

    Chao Xu

    Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  18. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  19. Quantitative proteomics and dynamic imaging of the nucleolus reveal distinct responses to UV and ionizing radiation.

    Science.gov (United States)

    Moore, Henna M; Bai, Baoyan; Boisvert, François-Michel; Latonen, Leena; Rantanen, Ville; Simpson, Jeremy C; Pepperkok, Rainer; Lamond, Angus I; Laiho, Marikki

    2011-10-01

    The nucleolus is a nuclear organelle that coordinates rRNA transcription and ribosome subunit biogenesis. Recent proteomic analyses have shown that the nucleolus contains proteins involved in cell cycle control, DNA processing and DNA damage response and repair, in addition to the many proteins connected with ribosome subunit production. Here we study the dynamics of nucleolar protein responses in cells exposed to stress and DNA damage caused by ionizing and ultraviolet (UV) radiation in diploid human fibroblasts. We show using a combination of imaging and quantitative proteomics methods that nucleolar substructure and the nucleolar proteome undergo selective reorganization in response to UV damage. The proteomic responses to UV include alterations of functional protein complexes such as the SSU processome and exosome, and paraspeckle proteins, involving both decreases and increases in steady state protein ratios, respectively. Several nonhomologous end-joining proteins (NHEJ), such as Ku70/80, display similar fast responses to UV. In contrast, nucleolar proteomic responses to IR are both temporally and spatially distinct from those caused by UV, and more limited in terms of magnitude. With the exception of the NHEJ and paraspeckle proteins, where IR induces rapid and transient changes within 15 min of the damage, IR does not alter the ratios of most other functional nucleolar protein complexes. The rapid transient decrease of NHEJ proteins in the nucleolus indicates that it may reflect a response to DNA damage. Our results underline that the nucleolus is a specific stress response organelle that responds to different damage and stress agents in a unique, damage-specific manner.

  20. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  1. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  2. ORF Alignment: NC_004431 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available |NP_313206.1| 50S ribosomal subunit protein ... L9 [Escherichia coli O157:H7] pdb|1P86|F Chain F, Real ... Space...The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|F Ch...ain F, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resolutio

  3. ORF Alignment: NC_002655 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available |NP_313206.1| 50S ribosomal subunit protein ... L9 [Escherichia coli O157:H7] pdb|1P86|F Chain F, Real ... Space...The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|F Ch...ain F, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resolutio

  4. ORF Alignment: NC_000913 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available |NP_313206.1| 50S ribosomal subunit protein ... L9 [Escherichia coli O157:H7] pdb|1P86|F Chain F, Real ... Space...The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|F Ch...ain F, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resolutio

  5. ORF Alignment: NC_004337 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available |NP_313206.1| 50S ribosomal subunit protein ... L9 [Escherichia coli O157:H7] pdb|1P86|F Chain F, Real ... Space...The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|F Ch...ain F, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resolutio

  6. ORF Alignment: NC_004741 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available |NP_313206.1| 50S ribosomal subunit protein ... L9 [Escherichia coli O157:H7] pdb|1P86|F Chain F, Real ... Space...The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|F Ch...ain F, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resolutio

  7. ORF Alignment: NC_002695 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available |NP_313206.1| 50S ribosomal subunit protein ... L9 [Escherichia coli O157:H7] pdb|1P86|F Chain F, Real ... Space...The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|F Ch...ain F, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resolutio

  8. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  9. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  10. Allosteric regulation and communication between subunits in uracil phosphoribosyltransferase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Arent, Susan; Harris, Pernille; Jensen, Kaj Frank

    2005-01-01

    organisms. To understand the allosteric regulation, crystal structures were determined for S. solfataricus UPRTase in complex with UMP and with UMP and the allosteric inhibitor CTP. Also, a structure with UMP bound in half of the active sites was determined. All three complexes form tetramers but reveal...... to rearrangements in the quaternary structure imply that this residue plays a major role in regulation of the enzyme and in communication between subunits. The ribose ring of UMP adopts alternative conformations in the cis and trans subunits of the UPRTase-UMP tetramer with associated differences...

  11. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  12. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  13. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  14. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  15. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  16. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  17. Expression and Trafficking of the γ Subunit of Na,K-ATPase in Hypertonically Challenged IMCD3 Cells

    International Nuclear Information System (INIS)

    Pihakaski-Maunsbach, Kaarina; Nonaka, Shoichi; Maunsbach, Arvid B.

    2008-01-01

    The γ subunit (FXYD2) of Na,K-ATPase is an important regulator of the sodium pump. In this investigation we have analysed the trafficking of γ to the plasma membrane in cultures of inner medullary collecting duct cells (IMCD3) following acute hypertonic challenge and brefeldin A (BFA) treatment. Following hypertonic challenging for 24 hr immunofluorescence labeling revealed initial co-localization of the γ subunit and 58K Golgi protein in the cytoplasm, but no co-localization of α1 and Golgi protein. Exposure of the challenged cells to BFA prevented the subsequent incorporation of γ into the basolateral plasma membrane. The γ subunit instead remained in cytoplasmic vesicles while cell proliferation and cell viability decreased simultaneously. Following removal of BFA from the hypertonic medium the IMCD3 cells recovered with distinct expression of γ in the basolateral membrane. The α1 subunit was only marginally influenced by BFA. The results demonstrate that the γ subunit trafficks to the plasma membrane via the Golgi apparatus, despite the absence of a signal sequence. The results also suggest that the γ and α subunits do not traffic together to the plasma membrane, and that the γ and α subunit have different turnover rates during these experimental conditions

  18. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    Science.gov (United States)

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. © 2016 The Royal Entomological Society.

  19. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  20. ORF Alignment: NC_000913 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available f|NP_312212.1| 50S ribosomal subunit protein ... L3 [Escherichia coli O157:H7] pdb|1P86|B Chain B, Real ... Space...hain B, Real ... Space Refined Coordinates Of The 50s Subunit Fitted Into ... The Low Resoluti... The Low Resolution Cryo-Em Map Of The Initiation-Like ... State Of E. Coli 70s Ribosome pdb|1P85|B C

  1. Models for the a subunits of the Thermus thermophilus V/A-ATPase and Saccharomyces cerevisiae V-ATPase enzymes by cryo-EM and evolutionary covariance

    Science.gov (United States)

    Schep, Daniel G.; Rubinstein, John L.

    2016-01-01

    Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669

  2. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  3. Exercise induced upregulation of glutamate-cysteine ligase catalytic subunit and glutamate-cysteine ligase modifier subunit gene expression in Thoroughbred horses

    Directory of Open Access Journals (Sweden)

    Jeong-Woong Park

    2017-05-01

    Full Text Available Objective This study was performed to reveal the molecular structure and expression patterns of horse glutamate-cysteine ligase catalytic subunit (GCLC and glutamate-cysteine ligase modifier subunit (GCLM genes whose products form glutamate cysteine ligase, which were identified as differentially expressed genes in the previous study. Methods We performed bioinformatics analyses, and gene expression assay with quantitative polymerase chain reaction (qPCR for horse GCLC and GCLM genes in muscle and blood leukocytes of Thoroughbred horses Results Expression of GCLC showed the same pattern in both blood and muscle tissues after exercise. Expression of GCLC increased in the muscle and blood of Thoroughbreds, suggesting a tissue-specific regulatory mechanism for the expression of GCLC. In addition, expression of the GCLM gene increased after exercise in both the blood and muscle of Thoroughbreds. Conclusion We established the expression patterns of GCLC and GCLM in the skeletal muscle and blood of Thoroughbred horses in response to exercise. Further study is now warranted to uncover the functional importance of these genes in exercise and recovery in racehorses.

  4. Reduced Insulin/Insulin-like Growth Factor-1 Signaling and Dietary Restriction Inhibit Translation but Preserve Muscle Mass in Caenorhabditis elegans

    Energy Technology Data Exchange (ETDEWEB)

    Depuydt, Geert; Xie, Fang; Petyuk, Vladislav A.; Shanmugam, Nilesh; Smolders, Arne; Dhondt, Ineke; Brewer, Heather M.; Camp, David G.; Smith, Richard D.; Braeckman, Bart P.

    2013-09-03

    Reduced signaling through the C. elegans insulin/IGF1 like tyrosine kinase receptor daf2 and dietary restriction via bacterial dilution are two well-characterized lifespan-extending interventions that operate in parallel or through (partially) independent mechanisms. Using accurate mass and time tag LCMS/MS quantitative proteomics we detected that the abundance of a large number of ribosomal subunits is decreased in response to dietary restriction as well as in the daf2(e1370) insulin/IGF1 receptor mutant. In addition, general protein synthesis levels in these long-lived worms are repressed. Surprisingly, ribosomal transcript levels were not correlated to actual protein abundance, suggesting that posttranscriptional regulation determines ribosome content. Proteomics also revealed increased presence of many structural muscle cell components in long-lived worms, which appears to result from prioritized preservation of muscle cell volume in nutrient-poor conditions or low insulin-like signaling. Activation of DAF16, but not diet-restriction, stimulates mRNA expression of muscle-related genes to prevent muscle atrophy. Important daf2 specific proteome changes include overexpression of aerobic metabolism enzymes and a general activation of stress responsive and immune defense systems, while increased abundance of many protein subunits of the proteasome core complex is a DR-specific characteristic.

  5. Role of regulatory subunits and protein kinase inhibitor (PKI) in determining nuclear localization and activity of the catalytic subunit of protein kinase A.

    Science.gov (United States)

    Wiley, J C; Wailes, L A; Idzerda, R L; McKnight, G S

    1999-03-05

    Regulation of protein kinase A by subcellular localization may be critical to target catalytic subunits to specific substrates. We employed epitope-tagged catalytic subunit to correlate subcellular localization and gene-inducing activity in the presence of regulatory subunit or protein kinase inhibitor (PKI). Transiently expressed catalytic subunit distributed throughout the cell and induced gene expression. Co-expression of regulatory subunit or PKI blocked gene induction and prevented nuclear accumulation. A mutant PKI lacking the nuclear export signal blocked gene induction but not nuclear accumulation, demonstrating that nuclear export is not essential to inhibit gene induction. When the catalytic subunit was targeted to the nucleus with a nuclear localization signal, it was not sequestered in the cytoplasm by regulatory subunit, although its activity was completely inhibited. PKI redistributed the nuclear catalytic subunit to the cytoplasm and blocked gene induction, demonstrating that the nuclear export signal of PKI can override a strong nuclear localization signal. With increasing PKI, the export process appeared to saturate, resulting in the return of catalytic subunit to the nucleus. These results demonstrate that both the regulatory subunit and PKI are able to completely inhibit the gene-inducing activity of the catalytic subunit even when the catalytic subunit is forced to concentrate in the nuclear compartment.

  6. Activity-dependent control of NMDA receptor subunit composition at hippocampal mossy fibre synapses.

    Science.gov (United States)

    Carta, Mario; Srikumar, Bettadapura N; Gorlewicz, Adam; Rebola, Nelson; Mulle, Christophe

    2018-02-15

    CA3 pyramidal cells display input-specific differences in the subunit composition of synaptic NMDA receptors (NMDARs). Although at low density, GluN2B contributes significantly to NMDAR-mediated EPSCs at mossy fibre synapses. Long-term potentiation (LTP) of NMDARs triggers a modification in the subunit composition of synaptic NMDARs by insertion of GluN2B. GluN2B subunits are essential for the expression of LTP of NMDARs at mossy fibre synapses. Single neurons express NMDA receptors (NMDARs) with distinct subunit composition and biophysical properties that can be segregated in an input-specific manner. The dynamic control of the heterogeneous distribution of synaptic NMDARs is crucial to control input-dependent synaptic integration and plasticity. In hippocampal CA3 pyramidal cells from mice of both sexes, we found that mossy fibre (MF) synapses display a markedly lower proportion of GluN2B-containing NMDARs than associative/commissural synapses. The mechanism involved in such heterogeneous distribution of GluN2B subunits is not known. Here we show that long-term potentiation (LTP) of NMDARs, which is selectively expressed at MF-CA3 pyramidal cell synapses, triggers a modification in the subunit composition of synaptic NMDARs by insertion of GluN2B. This activity-dependent recruitment of GluN2B at mature MF-CA3 pyramidal cell synapses contrasts with the removal of GluN2B subunits at other glutamatergic synapses during development and in response to activity. Furthermore, although expressed at low levels, GluN2B is necessary for the expression of LTP of NMDARs at MF-CA3 pyramidal cell synapses. Altogether, we reveal a previously unknown activity-dependent regulation and function of GluN2B subunits that may contribute to the heterogeneous plasticity induction rules in CA3 pyramidal cells. © 2017 Centre Nationnal de la Recherche Scientifique. The Journal of Physiology © 2017 The Physiological Society.

  7. Short communication: molecular characterization of dog and cat p65 subunits of NF-kappaB.

    Science.gov (United States)

    Ishikawa, Shingo; Takemitsu, Hiroshi; Li, Gebin; Mori, Nobuko; Yamamoto, Ichiro; Arai, Toshiro

    2015-04-01

    Nuclear factor kappa B (NF-κB) plays an important role in the immune system. The p65 subunit is an important part of NF-κB unit, and studies of dog and cat p65 subunits of NF-κB (dp65 and cp65) are important in understanding their immune function. In this study, we described the molecular characterization of dp65 and cp65. The dp65 and cp65 complementary DNA encoded 542 and 555 amino acids, respectively, showing a high sequence homology with the mammalian p65 subunit (>87.5%). Quantitative polymerase chain reaction revealed that the p65 messenger RNA is highly expressed in the dog stomach and cat heart and adipose tissue. Functional NF-κB promoter-luciferase reporter vectors revealed that our isolated dp65 and cp65 cDNA encodes a functionally active protein. Transiently expressed dp65 and cp65 up-regulated pro-inflammatory cytokine expression levels in dog and cat, respectively. These findings suggest that dp65 and cp65 play important roles in regulating immune function. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  9. Acetylcholine Receptor: Complex of Homologous Subunits

    Science.gov (United States)

    Raftery, Michael A.; Hunkapiller, Michael W.; Strader, Catherine D.; Hood, Leroy E.

    1980-06-01

    The acetylcholine receptor from the electric ray Torpedo californica is composed of five subunits; two are identical and the other three are structurally related to them. Microsequence analysis of the four polypeptides demonstrates amino acid homology among the subunits. Further sequence analysis of both membrane-bound and Triton-solubilized, chromatographically purified receptor gave the stoichiometry of the four subunits (40,000:50,000:60,000:65,000 daltons) as 2:1:1:1, indicating that this protein is a pentameric complex with a molecular weight of 255,000 daltons. Genealogical analysis suggests that divergence from a common ancestral gene occurred early in the evolution of the receptor. This shared ancestry argues that each of the four subunits plays a functional role in the receptor's physiological action.

  10. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  11. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  12. Genetic and physiological studies of antibiotic resistance in a clinical isolate of Streptococcus faecalis

    International Nuclear Information System (INIS)

    Sharma, V.K.

    1987-01-01

    An erythromycin-sensitive clinical isolate of Streptococcus faecalis (CS-4B) generated intermediate-level erythromycin-resistant isolates ([CS-4B(S)] at a frequency of 4 x 10 -8 per cell. CS-4B(S) produces high-level erythromycin-resistant isolates [CS-4B(L)] at a very high frequency. The erythromycin-resistance is non-transferable, chromosomally located, and distinct from the well described erythromycin-resistance of the MLS type. The erythromycin-resistance of CS-4B(S) and CS-4B(L) is not due to an in vitro or in vivo alteration or inactivation of erythromycin. 14 C-erythromycin binds in vitro, as evaluated with sucrose gradients, to 70S ribosomes and 50S ribosomal subunits in CS-4B. Binding to CS-4B(L) ribosomes was barely detectable whereas CS-4B(S) ribosomes retained binding capacity. The binding studies on filter membranes revealed a substantial reduction of 14 C-erythromycin binding to CS-4B(S) ribosomes when compared to CS-4B ribosomes. The in vivo accumulation of 14 C-erythromycin in CS-4B and CS-4B(S) parallel the in vitro binding capacity of ribosomes indicating the apparent absence of a permeability barrier to erythromycin in CS-4B

  13. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Dual functions of a small regulatory subunit in the mitochondrial calcium uniporter complex.

    Science.gov (United States)

    Tsai, Ming-Feng; Phillips, Charles B; Ranaghan, Matthew; Tsai, Chen-Wei; Wu, Yujiao; Willliams, Carole; Miller, Christopher

    2016-04-21

    Mitochondrial Ca(2+) uptake, a process crucial for bioenergetics and Ca(2+) signaling, is catalyzed by the mitochondrial calcium uniporter. The uniporter is a multi-subunit Ca(2+)-activated Ca(2+) channel, with the Ca(2+) pore formed by the MCU protein and Ca(2+)-dependent activation mediated by MICU subunits. Recently, a mitochondrial inner membrane protein EMRE was identified as a uniporter subunit absolutely required for Ca(2+) permeation. However, the molecular mechanism and regulatory purpose of EMRE remain largely unexplored. Here, we determine the transmembrane orientation of EMRE, and show that its known MCU-activating function is mediated by the interaction of transmembrane helices from both proteins. We also reveal a second function of EMRE: to maintain tight MICU regulation of the MCU pore, a role that requires EMRE to bind MICU1 using its conserved C-terminal polyaspartate tail. This dual functionality of EMRE ensures that all transport-competent uniporters are tightly regulated, responding appropriately to a dynamic intracellular Ca(2+) landscape.

  15. Structural Basis for Linezolid Binding Site Rearrangement in the Staphylococcus aureus Ribosome.

    Science.gov (United States)

    Belousoff, Matthew J; Eyal, Zohar; Radjainia, Mazdak; Ahmed, Tofayel; Bamert, Rebecca S; Matzov, Donna; Bashan, Anat; Zimmerman, Ella; Mishra, Satabdi; Cameron, David; Elmlund, Hans; Peleg, Anton Y; Bhushan, Shashi; Lithgow, Trevor; Yonath, Ada

    2017-05-09

    An unorthodox, surprising mechanism of resistance to the antibiotic linezolid was revealed by cryo-electron microscopy (cryo-EM) in the 70S ribosomes from a clinical isolate of Staphylococcus aureus This high-resolution structural information demonstrated that a single amino acid deletion in ribosomal protein uL3 confers linezolid resistance despite being located 24 Å away from the linezolid binding pocket in the peptidyl-transferase center. The mutation induces a cascade of allosteric structural rearrangements of the rRNA that ultimately results in the alteration of the antibiotic binding site. IMPORTANCE The growing burden on human health caused by various antibiotic resistance mutations now includes prevalent Staphylococcus aureus resistance to last-line antimicrobial drugs such as linezolid and daptomycin. Structure-informed drug modification represents a frontier with respect to designing advanced clinical therapies, but success in this strategy requires rapid, facile means to shed light on the structural basis for drug resistance (D. Brown, Nat Rev Drug Discov 14:821-832, 2015, https://doi.org/10.1038/nrd4675). Here, detailed structural information demonstrates that a common mechanism is at play in linezolid resistance and provides a step toward the redesign of oxazolidinone antibiotics, a strategy that could thwart known mechanisms of linezolid resistance. Copyright © 2017 Belousoff et al.

  16. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  17. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    Directory of Open Access Journals (Sweden)

    Seema Dharni

    2014-01-01

    Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

  18. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  19. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  20. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

    OpenAIRE

    Mundus, D; Wollenzien, P

    1998-01-01

    Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was...

  2. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  3. Subunit stoichiometry of the chloroplast photosystem I complex

    International Nuclear Information System (INIS)

    Bruce, B.D.; Malkin, R.

    1988-01-01

    A native photosystem I (PS I) complex and a PS I core complex depleted of antenna subunits has been isolated from the uniformly 14 C-labeled aquatic higher plant, Lemna. These complexes have been analyzed for their subunit stoichiometry by quantitative sodium dodecyl sulfate-polyacrylamide gel electrophoresis methods. The results for both preparations indicate that one copy of each high molecular mass subunit is present per PS I complex and that a single copy of most low molecular mass subunits is also present. These results suggest that iron-sulfur center X, an early PS I electron acceptor proposed to bind to the high molecular mass subunits, contains a single [4Fe-4S] cluster which is bound to a dimeric structure of high molecular mass subunits, each providing 2 cysteine residues to coordinate this cluster

  4. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  5. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  6. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  7. Sequence Classification: 893067 [

    Lifescience Database Archive (English)

    Full Text Available tuent of 66S pre-ribosomal particles, involved in 60S ribosomal subunit biogenesis; localizes to both nucleolus and cytoplasm; Nop15p || http://www.ncbi.nlm.nih.gov/protein/6324219 ...

  8. Human placental Na+, K+-ATPase α subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    International Nuclear Information System (INIS)

    Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.

    1987-01-01

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na + , K + -ATPase α subunit was cloned from human placenta and its sequence was identical to that encoding the α subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na + , K + -ATPase gene from various human tissues and cell lines revealed only one band (≅ 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) λgt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the α subunit is on the short is on the short arm (band p11-p13) of chromosome 1

  9. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  10. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  11. Soybean glycinin subunits: Characterization of physicochemical and adhesion properties.

    Science.gov (United States)

    Mo, Xiaoqun; Zhong, Zhikai; Wang, Donghai; Sun, Xiuzhi

    2006-10-04

    Soybean proteins have shown great potential for applications as renewable and environmentally friendly adhesives. The objective of this work was to study physicochemical and adhesion properties of soy glycinin subunits. Soybean glycinin was extracted from soybean flour and then fractionated into acidic and basic subunits with an estimated purity of 90 and 85%, respectively. Amino acid composition of glycinin subunits was determined. The high hydrophobic amino acid content is a major contributor to the solubility behavior and water resistance of the basic subunits. Acidic subunits and glycinin had similar solubility profiles, showing more than 80% solubility at pH 2.0-4.0 or 6.5-12.0, whereas basic subunits had considerably lower solubility with the minimum at pH 4.5-8.0. Thermal analysis using a differential scanning calorimeter suggested that basic subunits form new oligomeric structures with higher thermal stability than glycinin but no highly ordered structures present in isolated acidic subunits. The wet strength of basic subunits was 160% more than that of acidic subunits prepared at their respective isoelectric points (pI) and cured at 130 degrees C. Both pH and the curing temperature significantly affected adhesive performance. High-adhesion water resistance was usually observed for adhesives from protein prepared at their pI values and cured at elevated temperatures. Basic subunits are responsible for the water resistance of glycinin and are a good starting material for the development of water-resistant adhesives.

  12. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    Science.gov (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  13. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  14. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  15. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  16. Proteome analysis reveals phosphorylation of ATP synthase beta -subunit in human skeletal muscle and proteins with potential roles in type 2 diabetes

    DEFF Research Database (Denmark)

    Højlund, Kurt; Wrzesinski, Krzysztof; Larsen, Peter Mose

    2003-01-01

    quantitate a large number of proteins and their post-translational modifications simultaneously and is a powerful tool to study polygenic diseases like type 2 diabetes. Using this approach on human skeletal muscle biopsies, we have identified eight potential protein markers for type 2 diabetes in the fasting...... synthase beta-subunit phosphoisoform in diabetic muscle correlated inversely with fasting plasma glucose levels. These data suggest a role for phosphorylation of ATP synthase beta-subunit in the regulation of ATP synthesis and that alterations in the regulation of ATP synthesis and cellular stress proteins...

  17. RPL41, a Small Ribosomal Peptide Deregulated in Tumors, Is Essential for Mitosis and Centrosome Integrity

    Directory of Open Access Journals (Sweden)

    Shan Wang

    2010-03-01

    Full Text Available Ribosomal large subunit protein RPL41 is a basic (positively charged peptide consisting of only 25 amino acids. An antisense-based functional screening revealed that the down-regulation of RPL41 led to an anchorage-independent growth of NIH3T3 cells in soft agar plates. RPL41 depletion with gene-specific small interfering RNA also resulted in malignant transformation of NIH3T3 cells including increased tumor growth in mice. RPL41 deletion was detected in 59% of tumor cell lines by fluorescence in situ hybridization analyses and RPL41 down-regulation in 75% of primary breast cancers by real-time quantitative reverse transcription-polymerase chain reaction. These studies suggest a tumor suppression role for RPL41. By mass spectrometry, RPL41 was associated with several cytoskeleton components including tubulin β, γ, and myosin IIA, which was confirmed by Western blot analysis on both cellular lysis and individually in vitro-expressed proteins. RPL41 also bound directly to polymerized tubulins. Cells overexpressing a GFP-RPL41 were resistant to nocodazole-induced microtubule depolymerization. A synthetic RPL41 induced cellular α-tubulin acetylation and G2/M cell cycle arrest. These results indicate a stabilizing role of RPL41 on microtubule. Microtubule spindles are essential for chromosome segregation during mitosis. Cells with RPL41 knock-down showed abnormal spindles, frequent failure of cytokinesis, and formation of polynuclear cells. In interphase cells, RPL41-depleted cells had premature splitting of centrosome. Our results provide evidence that RPL41 is a microtubule-associated protein essential for functional spindles and for the integrity of centrosome and that the abnormal mitosis and disrupted centrosome associated with the RPL41 down-regulation may be related to malignant transformation.

  18. Microarray analysis reveals key genes and pathways in Tetralogy of Fallot

    Science.gov (United States)

    He, Yue-E; Qiu, Hui-Xian; Jiang, Jian-Bing; Wu, Rong-Zhou; Xiang, Ru-Lian; Zhang, Yuan-Hai

    2017-01-01

    The aim of the present study was to identify key genes that may be involved in the pathogenesis of Tetralogy of Fallot (TOF) using bioinformatics methods. The GSE26125 microarray dataset, which includes cardiovascular tissue samples derived from 16 children with TOF and five healthy age-matched control infants, was downloaded from the Gene Expression Omnibus database. Differential expression analysis was performed between TOF and control samples to identify differentially expressed genes (DEGs) using Student's t-test, and the R/limma package, with a log2 fold-change of >2 and a false discovery rate of <0.01 set as thresholds. The biological functions of DEGs were analyzed using the ToppGene database. The ReactomeFIViz application was used to construct functional interaction (FI) networks, and the genes in each module were subjected to pathway enrichment analysis. The iRegulon plugin was used to identify transcription factors predicted to regulate the DEGs in the FI network, and the gene-transcription factor pairs were then visualized using Cytoscape software. A total of 878 DEGs were identified, including 848 upregulated genes and 30 downregulated genes. The gene FI network contained seven function modules, which were all comprised of upregulated genes. Genes enriched in Module 1 were enriched in the following three neurological disorder-associated signaling pathways: Parkinson's disease, Alzheimer's disease and Huntington's disease. Genes in Modules 0, 3 and 5 were dominantly enriched in pathways associated with ribosomes and protein translation. The Xbox binding protein 1 transcription factor was demonstrated to be involved in the regulation of genes encoding the subunits of cytoplasmic and mitochondrial ribosomes, as well as genes involved in neurodegenerative disorders. Therefore, dysfunction of genes involved in signaling pathways associated with neurodegenerative disorders, ribosome function and protein translation may contribute to the pathogenesis of TOF

  19. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The ribosomal phosphoprotein P0 of the human malarial parasite Plasmodium falciparum (PfP0) has been identified as a protective surface protein. In Drosophila, P0 protein functions in the nucleus. The ribosomal function of P0 is mediated at the stalk of the large ribosomal subunit at the GTPase centre, where the ...

  20. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  1. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  2. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  3. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  4. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  5. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  6. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  7. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  8. Transcriptional regulators of Na, K-ATPase subunits

    Directory of Open Access Journals (Sweden)

    Zhiqin eLi

    2015-10-01

    Full Text Available The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic alpha-subunit, the beta-subunit and the FXYD proteins, are controlled extensively during development and to accommodate physiological needs. The spatial and temporal expression of Na,K-ATPase is partially regulated at the transcriptional level. Numerous transcription factors, hormones, growth factors, lipids and extracellular stimuli modulate the transcription of the Na,K-ATPase subunits. Moreover, epigenetic mechanisms also contribute to the regulation of Na,K-ATPase expression. With the ever growing knowledge about diseases associated with the malfunction of Na,K-ATPase, this review aims at summarizing the best-characterized transcription regulators that modulate Na,K-ATPase subunit levels. As abnormal expression of Na,K-ATPase subunits have been observed in many carcinoma, we will also discuss transcription factors that are associated with epithelial-to-mesenchymal transition, a crucial step in the progression of many tumors to malignant disease.

  9. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  10. The first transmembrane domain (TM1) of β2-subunit binds to the transmembrane domain S1 of α-subunit in BK potassium channels

    Science.gov (United States)

    Morera, Francisco J.; Alioua, Abderrahmane; Kundu, Pallob; Salazar, Marcelo; Gonzalez, Carlos; Martinez, Agustin D.; Stefani, Enrico; Toro, Ligia; Latorre, Ramon

    2012-01-01

    The BK channel is one of the most broadly expressed ion channels in mammals. In many tissues, the BK channel pore-forming α-subunit is associated to an auxiliary β-subunit that modulates the voltage- and Ca2+-dependent activation of the channel. Structural components present in β-subunits that are important for the physical association with the α-subunit are yet unknown. Here, we show through co-immunoprecipitation that the intracellular C-terminus, the second transmembrane domain (TM2) and the extracellular loop of the β2-subunit are dispensable for association with the α-subunit pointing transmembrane domain 1 (TM1) as responsible for the interaction. Indeed, the TOXCAT assay for transmembrane protein–protein interactions demonstrated for the first time that TM1 of the β2-subunit physically binds to the transmembrane S1 domain of the α-subunit. PMID:22710124

  11. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  12. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  13. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  14. 28 CFR 51.6 - Political subunits.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Political subunits. 51.6 Section 51.6 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PROCEDURES FOR THE ADMINISTRATION OF SECTION 5 OF THE VOTING RIGHTS ACT OF 1965, AS AMENDED General Provisions § 51.6 Political subunits. All political...

  15. An Aromatic Cap Seals the Substrate Binding Site in an ECF-Type S Subunit for Riboflavin

    Energy Technology Data Exchange (ETDEWEB)

    Karpowich, Nathan K.; Song, Jinmei; Wang, Da-Neng

    2016-06-13

    ECF transporters are a family of active membrane transporters for essential micronutrients, such as vitamins and trace metals. Found exclusively in archaea and bacteria, these transporters are composed of four subunits: an integral membrane substrate-binding subunit (EcfS), a transmembrane coupling subunit (EcfT), and two ATP-binding cassette ATPases (EcfA and EcfA'). We have characterized the structural basis of substrate binding by the EcfS subunit for riboflavin from Thermotoga maritima, TmRibU. TmRibU binds riboflavin with high affinity, and the protein–substrate complex is exceptionally stable in solution. The crystal structure of riboflavin-bound TmRibU reveals an electronegative binding pocket at the extracellular surface in which the substrate is completely buried. Analysis of the intermolecular contacts indicates that nearly every available substrate hydrogen bond is satisfied. A conserved aromatic residue at the extracellular end of TM5, Tyr130, caps the binding site to generate a substrate-bound, occluded state, and non-conservative mutation of Tyr130 reduces the stability of this conformation. Using a novel fluorescence binding assay, we find that an aromatic residue at this position is essential for high-affinity substrate binding. Comparison with other S subunit structures suggests that TM5 and Loop5-6 contain a dynamic, conserved motif that plays a key role in gating substrate entry and release by S subunits of ECF transporters.

  16. Involvement of proteasomal subunits zeta and iota in RNA degradation.

    Science.gov (United States)

    Petit, F; Jarrousse, A S; Dahlmann, B; Sobek, A; Hendil, K B; Buri, J; Briand, Y; Schmid, H P

    1997-01-01

    We have identified two distinct subunits of 20 S proteasomes that are associated with RNase activity. Proteasome subunits zeta and iota, eluted from two-dimensional Western blots, hydrolysed tobacco mosaic virus RNA, whereas none of the other subunits degraded this substrate under the same conditions. Additionally, proteasomes were dissociated by 6 M urea, and subunit zeta, containing the highest RNase activity, was isolated by anion-exchange chromatography and gel filtration. Purified subunit zeta migrated as a single spot on two-dimensional PAGE with a molecular mass of approx. 28 kDa. Addition of anti-(subunit zeta) antibodies led to the co-precipitation of this proteasome subunit and nuclease activity. This is the first evidence that proteasomal alpha-type subunits are associated with an enzymic activity, and our results provide further evidence that proteasomes may be involved in cellular RNA metabolism. PMID:9337855

  17. Subunit Stoichiometry of Human Muscle Chloride Channels

    OpenAIRE

    Fahlke, Christoph; Knittle, Timothy; Gurnett, Christina A.; Campbell, Kevin P.; George, Alfred L.

    1997-01-01

    Voltage-gated Cl? channels belonging to the ClC family appear to function as homomultimers, but the number of subunits needed to form a functional channel is controversial. To determine subunit stoichiometry, we constructed dimeric human skeletal muscle Cl? channels in which one subunit was tagged by a mutation (D136G) that causes profound changes in voltage-dependent gating. Sucrose-density gradient centrifugation experiments indicate that both monomeric and dimeric hClC-1 channels in their ...

  18. Transcriptional regulators of Na, K-ATPase subunits

    OpenAIRE

    Zhiqin eLi; Sigrid A Langhans

    2015-01-01

    The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic alpha-subunit, the beta-subunit and the FXYD proteins, are controlled extensively during developme...

  19. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  20. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  2. Structure of the Human Mitochondrial Ribosome Studied In Situ by Cryoelectron Tomography.

    Science.gov (United States)

    Englmeier, Robert; Pfeffer, Stefan; Förster, Friedrich

    2017-10-03

    Mitochondria maintain their own genome and its corresponding protein synthesis machine, the mitochondrial ribosome (mitoribosome). Mitoribosomes primarily synthesize highly hydrophobic proteins of the inner mitochondrial membrane. Recent studies revealed the complete structure of the isolated mammalian mitoribosome, but its mode of membrane association remained hypothetical. In this study, we used cryoelectron tomography to visualize human mitoribosomes in isolated mitochondria. The subtomogram average of the membrane-associated human mitoribosome reveals a single major contact site with the inner membrane, mediated by the mitochondria-specific protein mL45. A second rRNA-mediated contact site that is present in yeast is absent in humans, resulting in a more variable association of the human mitoribosome with the inner membrane. Despite extensive structural differences of mammalian and fungal mitoribosomal structure, the principal organization of peptide exit tunnel and the mL45 homolog remains invariant, presumably to align the mitoribosome with the membrane-embedded insertion machinery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Conservation of the TRAPPII-specific subunits of a Ypt/Rab exchanger complex

    Directory of Open Access Journals (Sweden)

    Yoo Eunice

    2007-02-01

    Full Text Available Abstract Background Ypt/Rab GTPases and their GEF activators regulate intra-cellular trafficking in all eukaryotic cells. In S. cerivisiae, the modular TRAPP complex acts as a GEF for the Golgi gatekeepers: Ypt1 and the functional pair Ypt31/32. While TRAPPI, which acts in early Golgi, is conserved from fungi to animals, not much is known about TRAPPII, which acts in late Golgi and consists of TRAPPI plus three additional subunits. Results Here, we show a phylogenetic analysis of the three TRAPPII-specific subunits. One copy of each of the two essential subunits, Trs120 and Trs130, is present in almost every fully sequenced eukaryotic genome. Moreover, the primary, as well as the predicted secondary, structure of the Trs120- and Trs130-related sequences are conserved from fungi to animals. The mammalian orthologs of Trs120 and Trs130, NIBP and TMEM1, respectively, are candidates for human disorders. Currently, NIBP is implicated in signaling, and TMEM1 is suggested to have trans-membrane domains (TMDs and to function as a membrane channel. However, we show here that the yeast Trs130 does not function as a trans-membrane protein, and the human TMEM1 does not contain putative TMDs. The non-essential subunit, Trs65, is conserved only among many fungi and some unicellular eukaryotes. Multiple alignment analysis of each TRAPPII-specific subunit revealed conserved domains that include highly conserved amino acids. Conclusion We suggest that the function of both NIBP and TMEM1 in the regulation of intra-cellular trafficking is conserved from yeast to man. The conserved domains and amino acids discovered here can be used for functional analysis that should help to resolve the differences in the assigned functions of these proteins in fungi and animals.

  4. Functional divergence of chloroplast Cpn60α subunits during Arabidopsis embryo development.

    Directory of Open Access Journals (Sweden)

    Xiaolong Ke

    2017-09-01

    Full Text Available Chaperonins are a class of molecular chaperones that assist in the folding and assembly of a wide range of substrates. In plants, chloroplast chaperonins are composed of two different types of subunits, Cpn60α and Cpn60β, and duplication of Cpn60α and Cpn60β genes occurs in a high proportion of plants. However, the importance of multiple Cpn60α and Cpn60β genes in plants is poorly understood. In this study, we found that loss-of-function of CPNA2 (AtCpn60α2, a gene encoding the minor Cpn60α subunit in Arabidopsis thaliana, resulted in arrested embryo development at the globular stage, whereas the other AtCpn60α gene encoding the dominant Cpn60α subunit, CPNA1 (AtCpn60α1, mainly affected embryonic cotyledon development at the torpedo stage and thereafter. Further studies demonstrated that CPNA2 can form a functional chaperonin with CPNB2 (AtCpn60β2 and CPNB3 (AtCpn60β3, while the functional partners of CPNA1 are CPNB1 (AtCpn60β1 and CPNB2. We also revealed that the functional chaperonin containing CPNA2 could assist the folding of a specific substrate, KASI (β-ketoacyl-[acyl carrier protein] synthase I, and that the KASI protein level was remarkably reduced due to loss-of-function of CPNA2. Furthermore, the reduction in the KASI protein level was shown to be the possible cause for the arrest of cpna2 embryos. Our findings indicate that the two Cpn60α subunits in Arabidopsis play different roles during embryo development through forming distinct chaperonins with specific AtCpn60β to assist the folding of particular substrates, thus providing novel insights into functional divergence of Cpn60α subunits in plants.

  5. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  6. Next generation sequencing reveals the hidden diversity of zooplankton assemblages.

    Directory of Open Access Journals (Sweden)

    Penelope K Lindeque

    Full Text Available BACKGROUND: Zooplankton play an important role in our oceans, in biogeochemical cycling and providing a food source for commercially important fish larvae. However, difficulties in correctly identifying zooplankton hinder our understanding of their roles in marine ecosystem functioning, and can prevent detection of long term changes in their community structure. The advent of massively parallel next generation sequencing technology allows DNA sequence data to be recovered directly from whole community samples. Here we assess the ability of such sequencing to quantify richness and diversity of a mixed zooplankton assemblage from a productive time series site in the Western English Channel. METHODOLOGY/PRINCIPLE FINDINGS: Plankton net hauls (200 µm were taken at the Western Channel Observatory station L4 in September 2010 and January 2011. These samples were analysed by microscopy and metagenetic analysis of the 18S nuclear small subunit ribosomal RNA gene using the 454 pyrosequencing platform. Following quality control a total of 419,041 sequences were obtained for all samples. The sequences clustered into 205 operational taxonomic units using a 97% similarity cut-off. Allocation of taxonomy by comparison with the National Centre for Biotechnology Information database identified 135 OTUs to species level, 11 to genus level and 1 to order, <2.5% of sequences were classified as unknowns. By comparison a skilled microscopic analyst was able to routinely enumerate only 58 taxonomic groups. CONCLUSIONS: Metagenetics reveals a previously hidden taxonomic richness, especially for Copepoda and hard-to-identify meroplankton such as Bivalvia, Gastropoda and Polychaeta. It also reveals rare species and parasites. We conclude that Next Generation Sequencing of 18S amplicons is a powerful tool for elucidating the true diversity and species richness of zooplankton communities. While this approach allows for broad diversity assessments of plankton it may

  7. Hemocyanin of the molluscan Concholepas concholepas exhibits an unusual heterodecameric array of subunits.

    Science.gov (United States)

    De Ioannes, Pablo; Moltedo, Bruno; Oliva, Harold; Pacheco, Rodrigo; Faunes, Fernando; De Ioannes, Alfredo E; Becker, María Inés

    2004-06-18

    We describe here the structure of the hemocyanin from the Chilean gastropod Concholepas concholepas (CCH), emphasizing some attributes that make it interesting among molluscan hemocyanins. CCH exhibits a predominant didecameric structure as revealed by electron microscopy and a size of 8 MDa by gel filtration, and, in contrast with other mollusc hemocyanins, its stabilization does not require additional Ca(2+) and/or Mg(2+) in the medium. Polyacrylamide gel electrophoresis studies, analyses by a MonoQ FPLC column, and Western blots with specific monoclonal antibodies showed that CCH is made by two subunits noncovalently linked, named CCH-A and CCH-B, with molecular masses of 405 and 350 kDa, respectively. Interestingly, one of the subunits undergoes changes within the macromolecule; we demonstrated that CCH-A has an autocleavage site that under reducing conditions is cleaved to yield two polypeptides, CCH-A1 (300 kDa) and CCH-A2 (108 kDa), whereas CCH-B remains unchanged. The CCH-A nick occurs at 4 degrees C, increases at 37 degrees C, and is not inhibited by the addition of protease inhibitors and/or divalent cations. Since the CCH structure is a heterodimer, we investigated whether subunits would be either intermingled, forming heterodecamers, or assembled as two homogeneous decamers. Light scattering and electron microscope studies of the in vitro reassociation of purified CCH subunits demonstrated that the sole addition of Mg(2+) is needed for its reassembly into the native decameric molecule; no homodecamer reorganization was found with either CCH-A or CCH-B subunits alone. Our evidence showed that C. concholepas hemocyanin is an unusual example of heterodecameric organization.

  8. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  9. The beta subunit of casein kinase II

    DEFF Research Database (Denmark)

    Boldyreff, B; Piontek, K; Schmidt-Spaniol, I

    1991-01-01

    cDNAs encoding the beta subunit of pig and mouse CKII were isolated. The porcine cDNA was expressed as a fusion protein in Escherichia coli and used for the production of anti-CKII-beta subunit specific antibodies....

  10. Characterization of fimbrial subunits from Bordetella species

    NARCIS (Netherlands)

    Mooi, F.R.; Heide, H.G.J. van der; Avest, A.R. ter; Welinder, K.G.; Livey, I.; Zeijst, B.A.M. van der; Gaastra, W.

    Using antisera raised against serotype 2 and 3 fimbrial subunits from Bordetella pertussis, serologically related polypeptides were detected in Bordetella bronchiseptica, Bordetella parapertussis and Bordetella avium strains. The two B. pertussis fimbrial subunits, and three of the serologically

  11. Dicty_cDB: Contig-U03408-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ec... 40 0.095 2 ( EF634883 ) Pristionchus pauli small subunit ribosomal protei... 42 0.25 2 ( EH361767 ) NP...Haliotis discus discus ribosomal p... 46 4e-04 EF634883_1( EF634883 |pid:none) Pristionchus pauli small subu

  12. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  13. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  14. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  15. Molecular cloning of the human casein kinase II α subunit

    International Nuclear Information System (INIS)

    Meisner, H.; Heller-Harrison, R.; Buxton, J.; Czech, M.P.

    1989-01-01

    A human cDNA encoding the α subunit of casein kinase II and a partial cDNA encoding the rat homologue were isolated by using a Drosophila casein kinase II cDNA probe. The 2.2-kb human cDNA contains a 1.2-kb open reading frame, 150 nucleotides of 5' leader, and 850 nucleotides of 3' noncoding region. Except for the first 7 deduced amino acids that are missing in the rat cDNA, the 328 amino acids beginning with the amino terminus are identical between human and rat. The Drosophila enzyme sequence is 90% identical with the human casein kinase II sequence, and there is only a single amino acid difference between the published partial bovine sequence and the human sequence. In addition, the C-terminus of the human cDNA has an extra 53 amino acids not present in Drosophila. Northern analysis of rat and human RNA showed predominant bands of 5.5, 3.1, and 1.8 kb. In rat tissues, brain and spleen had the highest levels of casein kinase II α subunit specific RNA, while skeletal muscle showed the lowest. Southern analysis of human cultured cell and tissue genomic DNA using the full-length cDNA probe revealed two bands with restriction enzymes that have no recognition sites within the cDNA and three to six bands with enzymes having single internal sites. These results are consistent with the possibility that two genes encode the α subunits

  16. Immunoproteasome subunit ß5i/LMP7-deficiency in atherosclerosis.

    Science.gov (United States)

    Hewing, Bernd; Ludwig, Antje; Dan, Cristian; Pötzsch, Max; Hannemann, Carmen; Petry, Andreas; Lauer, Dilyara; Görlach, Agnes; Kaschina, Elena; Müller, Dominik N; Baumann, Gert; Stangl, Verena; Stangl, Karl; Wilck, Nicola

    2017-10-17

    Management of protein homeostasis by the ubiquitin-proteasome system is critical for atherosclerosis development. Recent studies showed controversial results on the role of immunoproteasome (IP) subunit β5i/LMP7 in maintenance of protein homeostasis under cytokine induced oxidative stress. The present study aimed to investigate the effect of β5i/LMP7-deficiency on the initiation and progression of atherosclerosis as a chronic inflammatory, immune cell driven disease. LDLR -/- LMP7 -/- and LDLR -/- mice were fed a Western-type diet for either 6 or 24 weeks to induce early and advanced stage atherosclerosis, respectively. Lesion burden was similar between genotypes in both stages. Macrophage content and abundance of polyubiquitin conjugates in aortic root plaques were unaltered by β5i/LMP7-deficiency. In vitro experiments using bone marrow-derived macrophages (BMDM) showed that β5i/LMP7-deficiency did not influence macrophage polarization or accumulation of polyubiquitinated proteins and cell survival upon hydrogen peroxide and interferon-γ treatment. Analyses of proteasome core particle composition by Western blot revealed incorporation of standard proteasome subunits in β5i/LMP7-deficient BMDM and spleen. Chymotrypsin-, trypsin- and caspase-like activities assessed by using short fluorogenic peptides in BMDM whole cell lysates were similar in both genotypes. Taken together, deficiency of IP subunit β5i/LMP7 does not disturb protein homeostasis and does not aggravate atherogenesis in LDLR -/- mice.

  17. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  18. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  19. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  20. Sequence Classification: 891686 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH Non-TMB TMB Non-TMB Non-TMB >gi|6320838|ref|NP_010917.1| Constituent of 66S pre-ribosomal partic...les, involved in 60S ribosomal subunit biogenesis; Nop16p || http://www.ncbi.nlm.nih.gov/protein/6320838 ...