Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli
DEFF Research Database (Denmark)
Aagaard, C; Rosendahl, G; Dam, M
1991-01-01
The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...
Secondary structures of rRNAs from all three domains of life.
Directory of Open Access Journals (Sweden)
Anton S Petrov
Full Text Available Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2° structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU 23S/28S and small subunit (SSU 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only, Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery. Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision.
Felske, A; Akkermans, A D; De Vos, W M
1998-11-01
A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.
Identifying small RNAs derived from maternal- and somatic-type rRNAs in zebrafish development.
Locati, Mauro D; Pagano, Johanna F B; Abdullah, Farah; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Spaink, Herman P; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2018-02-09
rRNAs are non-coding RNAs present in all prokaryotes and eukaryotes. In eukaryotes there are four rRNAs: 18S, 5.8S, 28S, originating from a common precursor (45S), and 5S. We have recently discovered the existence of two distinct developmental types of rRNA: a maternal-type, present in eggs and a somatic-type, expressed in adult tissues. Lately, next-generation sequencing has allowed the discovery of new small-RNAs deriving from longer non-coding RNAs, including small-RNAs from rRNAs (srRNAs). Here, we systemically investigated srRNAs of maternal- or somatic-type 18S, 5.8S, 28S, with small-RNAseq from many zebrafish developmental stages. We identified new srRNAs for each rRNA. For 5.8S, we found srRNA consisting of the 5' or 3' halves, with only the latter having different sequence for the maternal- and somatic-types. For 18S, we discovered 21 nt srRNA from the 5' end of the 18S rRNA with a striking resemblance to microRNAs; as it is likely processed from a stem-loop precursor and present in human and mouse Argonaute-complexed small-RNA. For 28S, an abundant 80 nt srRNA from the 3' end of the 28S rRNA was found. The expression levels during embryogenesis of these srRNA indicate they are not generated from rRNA degradation and might have a role in the zebrafish development.
Placeholder factors in ribosome biogenesis: please, pave my way
Directory of Open Access Journals (Sweden)
Francisco J. Espinar-Marchena
2017-04-01
Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.
Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA
International Nuclear Information System (INIS)
Barciszewska, M.Z.
1994-01-01
In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.
Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S
1984-01-01
Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Expression of ribosomal genes in pea cotyledons at the initial stages of germination
International Nuclear Information System (INIS)
Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.
1986-01-01
The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination
Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.
Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz
2014-12-16
5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
He, Yangzi
and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...
Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert
2012-05-01
The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.
Ribosomal RNA: a key to phylogeny
Olsen, G. J.; Woese, C. R.
1993-01-01
As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.
Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V
2015-10-01
Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.
The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron
Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.
1982-01-01
The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.
Institute of Scientific and Technical Information of China (English)
Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao
2017-01-01
As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.
Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques
2017-12-05
Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.
Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.
Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria
2017-07-06
Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Regulatory Role of Small Nucleolar RNAs in Human Diseases
Directory of Open Access Journals (Sweden)
Grigory A. Stepanov
2015-01-01
Full Text Available Small nucleolar RNAs (snoRNAs are appreciable players in gene expression regulation in human cells. The canonical function of box C/D and box H/ACA snoRNAs is posttranscriptional modification of ribosomal RNAs (rRNAs, namely, 2′-O-methylation and pseudouridylation, respectively. A series of independent studies demonstrated that snoRNAs, as well as other noncoding RNAs, serve as the source of various short regulatory RNAs. Some snoRNAs and their fragments can also participate in the regulation of alternative splicing and posttranscriptional modification of mRNA. Alterations in snoRNA expression in human cells can affect numerous vital cellular processes. SnoRNA level in human cells, blood serum, and plasma presents a promising target for diagnostics and treatment of human pathologies. Here we discuss the relation between snoRNAs and oncological, neurodegenerative, and viral diseases and also describe changes in snoRNA level in response to artificial stress and some drugs.
Non-Coding RNAs and Endometrial Cancer
Directory of Open Access Journals (Sweden)
Cristina Vallone
2018-03-01
Full Text Available Non-coding RNAs (ncRNAs are involved in the regulation of cell metabolism and neoplastic transformation. Recent studies have tried to clarify the significance of these information carriers in the genesis and progression of various cancers and their use as biomarkers for the disease; possible targets for the inhibition of growth and invasion by the neoplastic cells have been suggested. The significance of ncRNAs in lung cancer, bladder cancer, kidney cancer, and melanoma has been amply investigated with important results. Recently, the role of long non-coding RNAs (lncRNAs has also been included in cancer studies. Studies on the relation between endometrial cancer (EC and ncRNAs, such as small ncRNAs or micro RNAs (miRNAs, transfer RNAs (tRNAs, ribosomal RNAs (rRNAs, antisense RNAs (asRNAs, small nuclear RNAs (snRNAs, Piwi-interacting RNAs (piRNAs, small nucleolar RNAs (snoRNAs, competing endogenous RNAs (ceRNAs, lncRNAs, and long intergenic ncRNAs (lincRNAs have been published. The recent literature produced in the last three years was extracted from PubMed by two independent readers, which was then selected for the possible relation between ncRNAs, oncogenesis in general, and EC in particular.
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Milbury Coren A
2010-09-01
Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R
2014-10-14
Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
Distinct maternal and somatic rRNA types in zebrafish development
Locati, M.
2017-01-01
There is mounting evidence that the ribosome is not a static translation machinery, but a cell-specific, adaptive system. Ribosomal variations have mostly been studied at the protein level, even though the essential transcriptional functions are primarily performed by ribosomal RNAs (rRNAs). At the
Repertoire of noncoding RNAs in corpus luteum of early pregnancy in buffalo (Bubalus bubalis
Directory of Open Access Journals (Sweden)
A. Jerome
2017-09-01
Full Text Available Aim: The present study was designed to identify other noncoding RNAs (ncRNAs in the corpus luteum (CL during early pregnancy in buffalo. Materials and Methods: For this study, CL (n=2 from two buffalo gravid uteri, obtained from the slaughter house, was transported to laboratory after snap freezing in liquid nitrogen (-196°C. The stage of pregnancy was determined by measuring the crown-rump region of the fetus. This was followed by isolation of RNA and deep sequencing. Post-deep sequencing, the obtained reads were checked and aligned against various ncRNA databases (GtRNA, RFAM, and deep guide. Various parameters, namely, frequency of specific ncRNAs, length, mismatch, and genomic location target in several model species were deciphered. Results: Frequency of piwi-interacting RNAs (piwi-RNAs, having target location in rodents and human genomes, were significantly higher compared to other piwi-RNAs and ncRNAs. Ribosomal RNAs (rRNAs deduced had nucleotides (nts ranging from 17 to 50 nts, but the occurrence of small length rRNAs was more than lengthier fragments. The target on 16S rRNA species confirms the conservation of 16S rRNA across species. With respect to transfer RNA (tRNA, the abundantly occurring tRNAs were unique with no duplication. Small nucleolar RNAs (snoRNAs, identified in this study, showed a strong tendency for coding box C/D snoRNAs in comparison to H/ACA snoRNAs. Regulatory and evolutionary implications of these identified ncRNAs are yet to be delineated in many species, including buffaloes. Conclusion: This is the first report of identification of other ncRNAs in CL of early pregnancy in buffalo.
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
DNA replication stress restricts ribosomal DNA copy number.
Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L
2017-09-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
DNA replication stress restricts ribosomal DNA copy number
Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin
2017-01-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237
DNA replication stress restricts ribosomal DNA copy number.
Directory of Open Access Journals (Sweden)
Devika Salim
2017-09-01
Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Assembly and disassembly of the nucleolus during the cell cycle.
Hernandez-Verdun, Danièle
2011-01-01
The nucleolus is a large nuclear domain in which transcription, maturation and assembly of ribosomes take place. In higher eukaryotes, nucleolar organization in three sub-domains reflects the compartmentation of the machineries related to active or inactive transcription of the ribosomal DNA, ribosomal RNA processing and assembly with ribosomal proteins of the two (40S and 60S) ribosomal subunits. The assembly of the nucleoli during telophase/early G(1) depends on pre-existing machineries inactivated during prophase (the transcription machinery and RNP processing complexes) and on partially processed 45S rRNAs inherited throughout mitosis. In telophase, the 45S rRNAs nucleate the prenucleolar bodies and order the dynamics of nucleolar assembly. The assembly/disassembly processes of the nucleolus depend on the equilibrium between phosphorylation/dephosphorylation of the transcription machinery and on the RNP processing complexes under the control of the CDK1-cyclin B kinase and PP1 phosphatases. The dynamics of assembly/disassembly of the nucleolus is time and space regulated.
Directory of Open Access Journals (Sweden)
Andrea Ciammaruconi
2008-01-01
Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.
RNA Export through the NPC in Eukaryotes.
Okamura, Masumi; Inose, Haruko; Masuda, Seiji
2015-03-20
In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.
Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian
2016-01-01
Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.
Problem-Based Test: Functional Analysis of Mutant 16S rRNAs
Szeberenyi, Jozsef
2010-01-01
Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…
Hwang, Ui Wook
2007-04-01
Phylogenetic position of a diplomonad protist Giardia, a principle cause of diarrhea, among eukaryotes has been vigorously debated so far. Through the comparisons of primary and secondary structures of SSU rRNAs of G. intestinalis, G. microti, G. ardeae, and G. muris, I found two major indel regions (a 6-nt indel and a 22-26-nt indel), which correspond to the helix 10 of the V2 region and helices E23-8 to E23-9 of the V4 region, respectively. As generally shown in eukaryotes, G. intestinalis and G. microti have commonly a relatively longer helix 10 (a 7-bp stem and a 4-nt loop), and also the eukaryote-specific helices E23-6 to E23-9. On the other hand, G. muris and G. ardeae have a shorter helix 10: a 2-bp stem and a 6-nt loop in G. ardeae and a 3-bp stem and a 6-nt loop in G. muris. In the V4, they have a single long helix (like the P23-1 helix in prokaryotes) instead of the helices E23-6 to E23-9. Among the four Giardia species, co-appearance of prokaryote- and eukaryote-typical features might be significant evidence to suggest that Giardia (Archezoa) is a living fossil showing an "intermediate stage" during the evolution from prokaryotes to eukaryotes.
Tu, Chunyan; Du, Tieshuai; Shao, Chengchen; Liu, Zengjia; Li, Liliang; Shen, Yiwen
2018-04-24
The precise estimation of postmortem interval (PMI) is a critical step in death investigation of forensic cases. Detecting the degradation of RNA in tissues by real time quantitative polymerase chain reaction (RT-qPCR) technology provides a new theoretical basis for estimation of PMI. However, most commonly used reference genes degrade over time, while previous studies seldom consider this when selecting suitable reference genes for the estimation of PMI. Studies have shown microRNAs (miRNAs) are very stable and circular RNAs (circRNAs) have recently emerged as a novel class of RNAs with high stability. We aimed to evaluate the stability of the two kinds of RNAs and normal reference genes using geNorm and NormFinder algorithms to identify tissue-specific reference genes for PMI estimation. The content of candidate RNAs from mouse heart, liver and skeletal muscle tissues were dynamically examined in 8 consecutive days after death. Among the 11 candidate genes (β-actin, Gapdh, Rps18, 5S, 18S, U6, miR-133a, miR-122, circ-AFF1, LC-Ogdh and LC-LRP6), the following genes showed prioritized stability: miR-122, miR-133a and 18S in heart tissues; LC-Ogdh, circ-AFF1 and miR-122 in liver tissues; and miR-133a, circ-AFF1 and LC-LRP6 in skeletal muscle tissues. Our results suggested that miRNAs and circRNAs were more stable as reference genes than other kinds of RNAs regarding PMI estimation. The appropriate internal control genes were not completely the same across tissue types.
DEFF Research Database (Denmark)
Garrett, R A; Christensen, A; Douthwaite, S
1984-01-01
An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...
Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip
International Nuclear Information System (INIS)
Andoh, Tomoko; Oshiro, Yukiko; Hayashi, Sachiko; Takeo, Hideki; Tani, Tokio
2006-01-01
Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization
Validation of two ribosomal RNA removal methods for microbial metatranscriptomics
Energy Technology Data Exchange (ETDEWEB)
He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip
2010-10-01
The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.
Panthu, Baptiste; Terrier, Olivier; Carron, Coralie; Traversier, Aurélien; Corbin, Antoine; Balvay, Laurent; Lina, Bruno; Rosa-Calatrava, Manuel; Ohlmann, Théophile
2017-10-27
The non-structural protein NS1 of influenza A viruses exerts pleiotropic functions during infection. Among these functions, NS1 was shown to be involved in the control of both viral and cellular translation; however, the mechanism by which this occurs remains to be determined. Thus, we have revisited the role of NS1 in translation by using a combination of influenza infection, mRNA reporter transfection, and in vitro functional and biochemical assays. Our data show that the NS1 protein is able to enhance the translation of virtually all tested mRNAs with the exception of constructs bearing the Dicistroviruses Internal ribosome entry segment (IRESes) (DCV and CrPV), suggesting a role at the level of translation initiation. The domain of NS1 required for translation stimulation was mapped to the RNA binding amino-terminal motif of the protein with residues R38 and K41 being critical for activity. Although we show that NS1 can bind directly to mRNAs, it does not correlate with its ability to stimulate translation. This activity rather relies on the property of NS1 to associate with ribosomes and to recruit them to target mRNAs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Donovan, Jesse; Rath, Sneha; Kolet-Mandrikov, David; Korennykh, Alexei
2017-11-01
Mammalian cells respond to double-stranded RNA (dsRNA) by activating a translation-inhibiting endoribonuclease, RNase L. Consensus in the field indicates that RNase L arrests protein synthesis by degrading ribosomal RNAs (rRNAs) and messenger RNAs (mRNAs). However, here we provide evidence for a different and far more efficient mechanism. By sequencing abundant RNA fragments generated by RNase L in human cells, we identify site-specific cleavage of two groups of noncoding RNAs: Y-RNAs, whose function is poorly understood, and cytosolic tRNAs, which are essential for translation. Quantitative analysis of human RNA cleavage versus nascent protein synthesis in lung carcinoma cells shows that RNase L stops global translation when tRNAs, as well as rRNAs and mRNAs, are still intact. Therefore, RNase L does not have to degrade the translation machinery to stop protein synthesis. Our data point to a rapid mechanism that transforms a subtle RNA cleavage into a cell-wide translation arrest. © 2017 Donovan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1994-01-01
The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...
International Nuclear Information System (INIS)
Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.
1979-01-01
Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)
Barik, Amita; Das, Santasabuj
2018-01-02
Small RNAs (sRNAs) in bacteria have emerged as key players in transcriptional and post-transcriptional regulation of gene expression. Here, we present a statistical analysis of different sequence- and structure-related features of bacterial sRNAs to identify the descriptors that could discriminate sRNAs from other bacterial RNAs. We investigated a comprehensive and heterogeneous collection of 816 sRNAs, identified by northern blotting across 33 bacterial species and compared their various features with other classes of bacterial RNAs, such as tRNAs, rRNAs and mRNAs. We observed that sRNAs differed significantly from the rest with respect to G+C composition, normalized minimum free energy of folding, motif frequency and several RNA-folding parameters like base-pairing propensity, Shannon entropy and base-pair distance. Based on the selected features, we developed a predictive model using Random Forests (RF) method to classify the above four classes of RNAs. Our model displayed an overall predictive accuracy of 89.5%. These findings would help to differentiate bacterial sRNAs from other RNAs and further promote prediction of novel sRNAs in different bacterial species.
Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.
Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger
2010-07-15
The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
Structured RNAs and synteny regions in the pig genome
DEFF Research Database (Denmark)
Anthon, Christian; Tafer, Hakim; Havgaard, Jakob H
2014-01-01
BACKGROUND: Annotating mammalian genomes for noncoding RNAs (ncRNAs) is nontrivial since far from all ncRNAs are known and the computational models are resource demanding. Currently, the human genome holds the best mammalian ncRNA annotation, a result of numerous efforts by several groups. However......, a more direct strategy is desired for the increasing number of sequenced mammalian genomes of which some, such as the pig, are relevant as disease models and production animals. RESULTS: We present a comprehensive annotation of structured RNAs in the pig genome. Combining sequence and structure...... lncRNA loci, 11 conflicts of annotation, and 3,183 ncRNA genes. The ncRNA genes comprise 359 miRNAs, 8 ribozymes, 185 rRNAs, 638 snoRNAs, 1,030 snRNAs, 810 tRNAs and 153 ncRNA genes not belonging to the here fore mentioned classes. When running the pipeline on a local shuffled version of the genome...
International Nuclear Information System (INIS)
Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim
2005-01-01
Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs
In vitro degradation of ribosomes.
Mora, G; Rivas, A
1976-12-01
The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.
Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L
2017-11-01
Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In
Interaction of tRNA with Eukaryotic Ribosome
Directory of Open Access Journals (Sweden)
Dmitri Graifer
2015-03-01
Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.
Yang, Rui; Guan, De-Long; Xu, Sheng-Quan
2016-09-01
The whole-genome Illumina sequence of the Chinese endemic grasshopper Fruhstorferiola kulinga mitogenome was constructed and reported in this study. In all, the circular genome was obtained with 15,655 bp in length and contains 75.4% A + T. It typically consists of 37 genes, including 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), 2 ribosomal RNAs (rRNAs) and 1 D-loop region. All PCGs are initiated with ATN codons. Most of the PCGs use TAA as their stop codons, while the others use TAG as stop codons (COX1 and ND1). The size of the large and small ribosomal RNA genes are 1314 bp and 851 bp. The A + T-rich region (777 bp) showed strong resemblance to the other known Orthoptera insects. Our data would contribute to confirm the close relationship and other evolutionary researches of the F. kulinga.
Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9
Directory of Open Access Journals (Sweden)
Arava Yoav
2007-08-01
Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.
Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.
Directory of Open Access Journals (Sweden)
Pierre Bonnin
2017-05-01
Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling
Posttranscriptional modifications in the A-loop of 23S rRNAs from selected archaea and eubacteria.
Hansen, M A; Kirpekar, F; Ritterbusch, W; Vester, B
2002-01-01
Posttranscriptional modifications were mapped in helices 90-92 of 23S rRNA from the following phylogenetically diverse organisms: Haloarcula marismortui, Sulfolobus acidocaldarius, Bacillus subtilis, and Bacillus stearothermophilus. Helix 92 is a component of the ribosomal A-site, which contacts the aminoacyl-tRNA during protein synthesis, implying that posttranscriptional modifications in helices 90-92 may be important for ribosome function. RNA fragments were isolated from 23S rRNA by site-...
Directory of Open Access Journals (Sweden)
Chen Chun-Long
2009-11-01
Full Text Available Abstract Background SnoRNAs represent an excellent model for studying the structural and functional evolution of small non-coding RNAs involved in the post-transcriptional modification machinery for rRNAs and snRNAs in eukaryotic cells. Identification of snoRNAs from Neurospora crassa, an important model organism playing key roles in the development of modern genetics, biochemistry and molecular biology will provide insights into the evolution of snoRNA genes in the fungus kingdom. Results Fifty five box C/D snoRNAs were identified and predicted to guide 71 2'-O-methylated sites including four sites on snRNAs and three sites on tRNAs. Additionally, twenty box H/ACA snoRNAs, which potentially guide 17 pseudouridylations on rRNAs, were also identified. Although not exhaustive, the study provides the first comprehensive list of two major families of snoRNAs from the filamentous fungus N. crassa. The independently transcribed strategy dominates in the expression of box H/ACA snoRNA genes, whereas most of the box C/D snoRNA genes are intron-encoded. This shows that different genomic organizations and expression modes have been adopted by the two major classes of snoRNA genes in N. crassa . Remarkably, five gene clusters represent an outstanding organization of box C/D snoRNA genes, which are well conserved among yeasts and multicellular fungi, implying their functional importance for the fungus cells. Interestingly, alternative splicing events were found in the expression of two polycistronic snoRNA gene hosts that resemble the UHG-like genes in mammals. Phylogenetic analysis further revealed that the extensive separation and recombination of two functional elements of snoRNA genes has occurred during fungus evolution. Conclusion This is the first genome-wide analysis of the filamentous fungus N. crassa snoRNAs that aids in understanding the differences between unicellular fungi and multicellular fungi. As compared with two yeasts, a more complex
Mutations in C12orf65 in patients with encephalomyopathy and a mitochondrial translation defect
DEFF Research Database (Denmark)
Antonicka, Hana; Østergaard, Elsebet; Sasarman, Florin
2010-01-01
We investigated the genetic basis for a global and uniform decrease in mitochondrial translation in fibroblasts from patients in two unrelated pedigrees who developed Leigh syndrome, optic atrophy, and ophthalmoplegia. Analysis of the assembly of the oxidative phosphorylation complexes showed...... severe decreases of complexes I, IV, and V and a smaller decrease in complex III. The steady-state levels of mitochondrial mRNAs, tRNAs, and rRNAs were not reduced, nor were those of the mitochondrial translation elongation factors or the protein components of the mitochondrial ribosome. Using...... includes mtRF1a, mtRF1, and Ict1, all characterized by the presence of a GGQ motif at the active site. However, C12orf65 does not exhibit peptidyl-tRNA hydrolase activity in an in vitro assay with bacterial ribosomes. We suggest that it might play a role in recycling abortive peptidyl-tRNA species...
Organism-specific rRNA capture system for application in next-generation sequencing.
Directory of Open Access Journals (Sweden)
Sai-Kam Li
Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.
Recent studies implicate the nucleolus as the major site of nuclear translation.
McLeod, Tina; Abdullahi, Akilu; Li, Min; Brogna, Saverio
2014-08-01
The nucleolus is the most prominent morphological feature within the nucleus of eukaryotic cells and is best known for its role in ribosome biogenesis. It forms around highly transcribed ribosomal RNA gene repeats which yield precursor rRNAs that are co-transcriptionally processed, folded and, while still within the nucleolus, associate with most of the ribosomal proteins. The nucleolus is therefore often thought of as a factory for making ribosomal subunits, which are exported as inactive precursors to the cytoplasm where late maturation makes them capable of mRNA binding and translation initiation. However, recent studies have shown substantial evidence for the presence of functional, translation competent ribosomal subunits within the nucleus, particularly in the nucleolus. These observations raise the intriguing possibility that the nucleolus, as well as being a ribosome factory, is also an important nuclear protein-synthesis plant.
DEFF Research Database (Denmark)
tang, T. H.; Polacek, N.; Zywicki, M.
2005-01-01
By generating a specialized cDNA library from the archaeon Sulfolobus solfataricus, we have identified 57 novel small non-coding RNA (ncRNA) candidates and confirmed their expression by Northern blot analysis. The majority was found to belong to one of two classes, either antisense or antisense...... elements by inhibiting expression of the transposase mRNA. Surprisingly, the class of antisense RNAs also contained RNAs complementary to tRNAs or sRNAs (small-nucleolar-like RNAs). For the antisense-box ncRNAs, the majority could be assigned to the class of C/D sRNAs, which specify 2'-O-methylation sites...... on rRNAs or tRNAs. Five C/D sRNAs of this group are predicted to target methylation at six sites in 13 different tRNAs, thus pointing to the widespread role of these sRNA species in tRNA modification in Archaea. Another group of antisense-box RNAs, lacking typical C/D sRNA motifs, was predicted...
Thiry, Marc; Ploton, Dominique
2008-01-01
Here we describe a new, rapid method for isolating nucleoli from Ehrlich tumor cells that preserves their morphological integrity and high transcriptional activity. Until now, methods for isolation of nucleoli were generally assumed to empty one of their three main compartments, the fibrillar center, of its contents. This new method consists of sonicating cells in an isotonic medium containing MgSO(4), spermidine, and spermine, followed by separation of nucleoli through a Percoll density gradient. Using the nonisotopic approach of labelling with BrUTP, we have further investigated the dynamics of nascent ribosomal RNAs (rRNAs) within morphologically intact isolated nucleoli at the electron microscope level. We show that ribosomal transcripts are elongated in the cortex of the fibrillar center and then enter the surrounding dense fibrillar component.
Posttranscriptional modifications in the A-loop of 23S rRNAs from selected archaea and eubacteria.
Hansen, M A; Kirpekar, F; Ritterbusch, W; Vester, B
2002-02-01
Posttranscriptional modifications were mapped in helices 90-92 of 23S rRNA from the following phylogenetically diverse organisms: Haloarcula marismortui, Sulfolobus acidocaldarius, Bacillus subtilis, and Bacillus stearothermophilus. Helix 92 is a component of the ribosomal A-site, which contacts the aminoacyl-tRNA during protein synthesis, implying that posttranscriptional modifications in helices 90-92 may be important for ribosome function. RNA fragments were isolated from 23S rRNA by site-directed RNase H digestion. A novel method of mapping modifications by analysis of short, nucleotide-specific, RNase digestion fragments with Matrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-MS) was utilized. The MALDI-MS data were complemented by two primer extension techniques using reverse transcriptase. One technique utilizes decreasing concentrations of deoxynucleotide triphosphates to map 2'-O-ribose methylations. In the other, the rRNA is chemically modified, followed by mild alkaline hydrolysis to map pseudouridines (psis). A total of 10 posttranscriptionally methylated nucleotides and 6 psis were detected in the five organisms. Eight of the methylated nucleotides and one psi have not been reported previously. The distribution of modified nucleotides and their locations on the surface of the ribosomal peptidyl transferase cleft suggests functional importance.
Trapping the ribosome to control gene expression.
Boehringer, Daniel; Ban, Nenad
2007-09-21
Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
Mung Bean nuclease mapping of RNAs 3' end
Directory of Open Access Journals (Sweden)
Barbieri Rainer
2009-05-01
Full Text Available Abstract A method is described that allows an accurate mapping of 3' ends of RNAs. In this method a labeled DNA probe, containing the presumed 3' end of the RNA under analysis is allowed to anneals to the RNA itself. Mung-bean nuclease is then used to digest single strands of both RNA and DNA. Electrophoretic fractionation of "protected" undigested, labeled DNA is than performed using a sequence reaction of a known DNA as length marker. This procedure was applied to the analysis of both a polyA RNA (Interleukin 10 mRNA and non polyA RNAs (sea urchin 18S and 26S rRNAs. This method might be potentially relevant for the evaluation of the role of posttrascriptional control of IL-10 in the pathogenesis of the immune and inflammatory mediated diseases associated to ageing. This might allow to develop new strategies to approach to the diagnosis and therapy of age related diseases.
Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes
Directory of Open Access Journals (Sweden)
Nicholas T. Ingolia
2014-09-01
Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.
Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.
Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek
2017-06-29
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.
DEFF Research Database (Denmark)
Belsham, Graham; Nielsen, Inge; Normann, Preben
2008-01-01
The initiation of protein synthesis on mRNAs within eukaryotic cells is achieved either by a 5' cap-dependent mechanism or through internal initiation directed by an internal ribosome entry site (IRES). Picornavirus IRES elements, located in the 59 untranslated region (5'UTR), contain extensive s...
The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN
Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth
2015-01-01
Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078
Guan, De-Long; Xu, Sheng-Quan
2016-09-01
The complete mitogenome of the geophilous grasshopper Trilophidia annulata was reconstructed from whole-genome Illumina sequencing data. After annotation, the circular genome was obtained with 16,501 bp in length, and typically consisted of 37 genes, including 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), 2 ribosomal RNAs (rRNAs) and 1 D-loop region. All PCGs were initiated with ATN codons, except ND2 with the start codon GTG. Most of the PCGs used TAA as their stop codons, while the others used TAG as stop codons (COX1, COX3&ND1). The nucleotide composition was asymmetric (42.3% A, 15.0% C, 11.0% G, 31.8% T) with an overall GC content of 25.9%. These data would contribute to the design of novel molecular markers for population and evolutionary research of T. annulata.
Directory of Open Access Journals (Sweden)
Jeffrey A Hussmann
2015-12-01
Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
tRNAs: cellular barcodes for amino acids
DEFF Research Database (Denmark)
Banerjee, Rajat; Chen, Shawn; Dare, Kiley
2010-01-01
The role of tRNA in translating the genetic code has received considerable attention over the last 50 years, and we now know in great detail how particular amino acids are specifically selected and brought to the ribosome in response to the corresponding mRNA codon. Over the same period, it has...... also become increasingly clear that the ribosome is not the only destination to which tRNAs deliver amino acids, with processes ranging from lipid modification to antibiotic biosynthesis all using aminoacyl-tRNAs as substrates. Here we review examples of alternative functions for tRNA beyond...... translation, which together suggest that the role of tRNA is to deliver amino acids for a variety of processes that includes, but is not limited to, protein synthesis....
Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly
DEFF Research Database (Denmark)
Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw
2018-01-01
Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...
Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis
DEFF Research Database (Denmark)
Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.
2009-01-01
In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...
Tomecki, Rafal; Sikorski, Pawel J; Zakrzewska-Placzek, Monika
2017-07-01
Proper regulation of ribosome biosynthesis is mandatory for cellular adaptation, growth and proliferation. Ribosome biogenesis is the most energetically demanding cellular process, which requires tight control. Abnormalities in ribosome production have severe consequences, including developmental defects in plants and genetic diseases (ribosomopathies) in humans. One of the processes occurring during eukaryotic ribosome biogenesis is processing of the ribosomal RNA precursor molecule (pre-rRNA), synthesized by RNA polymerase I, into mature rRNAs. It must not only be accurate but must also be precisely coordinated with other phenomena leading to the synthesis of functional ribosomes: RNA modification, RNA folding, assembly with ribosomal proteins and nucleocytoplasmic RNP export. A multitude of ribosome biogenesis factors ensure that these events take place in a correct temporal order. Among them are endo- and exoribonucleases involved in pre-rRNA processing. Here, we thoroughly present a wide spectrum of ribonucleases participating in rRNA maturation, focusing on their biochemical properties, regulatory mechanisms and substrate specificity. We also discuss cooperation between various ribonucleolytic activities in particular stages of pre-rRNA processing, delineating major similarities and differences between three representative groups of eukaryotes: yeast, plants and humans. © 2017 Federation of European Biochemical Societies.
Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu
2006-01-01
Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker ...
Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome
Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.
2015-06-01
The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Cleavage of rRNA ensures translational cessation in sperm at fertilization
Johnson, G.D.; Sendler, E.; Lalancette, C.; Hauser, R.; Diamond, M.P.; Krawetz, S.A.
2011-01-01
Intact ribosomal RNAs (rRNAs) comprise the majority of somatic transcripts, yet appear conspicuously absent in spermatozoa, perhaps reflecting cytoplasmic expulsion during spermatogenesis. To discern their fate, total RNA retained in mature spermatozoa from three fertile donors was characterized by Next Generation Sequencing. In all samples, >75% of total sequence reads aligned to rRNAs. The distribution of reads along the length of these transcripts exhibited a high degree of non-uniformity that was reiterated between donors. The coverage of sequencing reads was inversely correlated with guanine-cytosine (GC)-richness such that sequences greater than ∼70% GC were virtually absent in all sperm RNA samples. To confirm the loss of sequence, the relative abundance of specific regions of the 28S transcripts in sperm was established by 7-Deaza-2′-deoxy-guanosine-5′-triphosphate RT–PCR. The inability to amplify specific regions of the 28S sequence from sperm despite the abundant representation of this transcript in the sequencing libraries demonstrates that approximately three-quarters of RNA retained in the mature male gamete are products of rRNA fragmentation. Hence, cleavage (not expulsion of the RNA component of the translational machinery) is responsible for preventing spurious translation following spermiogenesis. These results highlight the potential importance of those transcripts, including many mRNAs, which evade fragmentation and remain intact when sperm are delivered at fertilization. Sequencing data are deposited in GEO as: GSE29160. PMID:21831882
Extensive localization of long noncoding RNAs to the cytosol and mono- and polyribosomal complexes
Heesch, S. van; Iterson, M. van; Jacobi, J.; Boymans, S.; Essers, P.B.; Bruijn, E. de; Hao, W.; Macinnes, A.W.; Cuppen, E.; Simonis, M.
2014-01-01
BACKGROUND: Long noncoding RNAs (lncRNAs) form an abundant class of transcripts, but the function of the majority of them remains elusive. While it has been shown that some lncRNAs are bound by ribosomes, it has also been convincingly demonstrated that these transcripts do not code for proteins. To
Pseudoknot in domain II of 23 S rRNA is essential for ribosome function
DEFF Research Database (Denmark)
Rosendahl, G; Hansen, L H; Douthwaite, S
1995-01-01
The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...
Gaston, Kirk W; Limbach, Patrick A
2014-01-01
The analysis of ribonucleic acids (RNA) by mass spectrometry has been a valuable analytical approach for more than 25 years. In fact, mass spectrometry has become a method of choice for the analysis of modified nucleosides from RNA isolated out of biological samples. This review summarizes recent progress that has been made in both nucleoside and oligonucleotide mass spectral analysis. Applications of mass spectrometry in the identification, characterization and quantification of modified nucleosides are discussed. At the oligonucleotide level, advances in modern mass spectrometry approaches combined with the standard RNA modification mapping protocol enable the characterization of RNAs of varying lengths ranging from low molecular weight short interfering RNAs (siRNAs) to the extremely large 23 S rRNAs. New variations and improvements to this protocol are reviewed, including top-down strategies, as these developments now enable qualitative and quantitative measurements of RNA modification patterns in a variety of biological systems. PMID:25616408
Gaston, Kirk W; Limbach, Patrick A
2014-01-01
The analysis of ribonucleic acids (RNA) by mass spectrometry has been a valuable analytical approach for more than 25 years. In fact, mass spectrometry has become a method of choice for the analysis of modified nucleosides from RNA isolated out of biological samples. This review summarizes recent progress that has been made in both nucleoside and oligonucleotide mass spectral analysis. Applications of mass spectrometry in the identification, characterization and quantification of modified nucleosides are discussed. At the oligonucleotide level, advances in modern mass spectrometry approaches combined with the standard RNA modification mapping protocol enable the characterization of RNAs of varying lengths ranging from low molecular weight short interfering RNAs (siRNAs) to the extremely large 23 S rRNAs. New variations and improvements to this protocol are reviewed, including top-down strategies, as these developments now enable qualitative and quantitative measurements of RNA modification patterns in a variety of biological systems.
Directory of Open Access Journals (Sweden)
Picard Flora
2012-10-01
Full Text Available Abstract Background In bacteria, the weak correlations at the genome scale between mRNA and protein levels suggest that not all mRNAs are translated with the same efficiency. To experimentally explore mRNA translational level regulation at the systemic level, the detailed translational status (translatome of all mRNAs was measured in the model bacterium Lactococcus lactis in exponential phase growth. Results Results demonstrated that only part of the entire population of each mRNA species was engaged in translation. For transcripts involved in translation, the polysome size reached a maximum of 18 ribosomes. The fraction of mRNA engaged in translation (ribosome occupancy and ribosome density were not constant for all genes. This high degree of variability was analyzed by bioinformatics and statistical modeling in order to identify general rules of translational regulation. For most of the genes, the ribosome density was lower than the maximum value revealing major control of translation by initiation. Gene function was a major translational regulatory determinant. Both ribosome occupancy and ribosome density were particularly high for transcriptional regulators, demonstrating the positive role of translational regulation in the coordination of transcriptional networks. mRNA stability was a negative regulatory factor of ribosome occupancy and ribosome density, suggesting antagonistic regulation of translation and mRNA stability. Furthermore, ribosome occupancy was identified as a key component of intracellular protein levels underlining the importance of translational regulation. Conclusions We have determined, for the first time in a bacterium, the detailed translational status for all mRNAs present in the cell. We have demonstrated experimentally the high diversity of translational states allowing individual gene differentiation and the importance of translation-level regulation in the complex process linking gene expression to protein
Sardana, Richa; White, Joshua P; Johnson, Arlen W
2013-06-01
Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.
rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.
Directory of Open Access Journals (Sweden)
Gisela Pöll
Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.
Wang, Ying; Cao, Jin-Jun; Li, Wei-Hai
2018-02-28
Stoneflies comprise an ancient group of insects, but the phylogenetic position of Plecoptera and phylogenetic relations within Plecoptera have long been controversial, and more molecular data is required to reconstruct precise phylogeny. Herein, we present the complete mitogenome of a stonefly, Suwallia teleckojensis , which is 16146 bp in length and consists of 13 protein-coding genes (PCGs), 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a control region (CR). Most PCGs initiate with the standard start codon ATN. However, ND5 and ND1 started with GTG and TTG. Typical termination codons TAA and TAG were found in eleven PCGs, and the remaining two PCGs ( COII and ND5 ) have incomplete termination codons. All transfer RNA genes (tRNAs) have the classic cloverleaf secondary structures, with the exception of tRNA Ser(AGN) , which lacks the dihydrouridine (DHU) arm. Secondary structures of the two ribosomal RNAs were shown referring to previous models. A large tandem repeat region, two potential stem-loop (SL) structures, Poly N structure (2 poly-A, 1 poly-T and 1 poly-C), and four conserved sequence blocks (CSBs) were detected in the control region. Finally, both maximum likelihood (ML) and Bayesian inference (BI) analyses suggested that the Capniidae was monophyletic, and the other five stonefly families form a monophyletic group. In this study, S. teleckojensis was closely related to Sweltsa longistyla , and Chloroperlidae and Perlidae were herein supported to be a sister group.
Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA
DEFF Research Database (Denmark)
Aagaard, C; Douthwaite, S
1994-01-01
RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...
Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs
International Nuclear Information System (INIS)
Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.
1986-01-01
5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation
Alejo, Jose Luis
In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.
Wang, Shuzhen; Zhang, Yubo; Liu, Honggao; He, Ying; Yan, Junjie; Wu, Zhihua; Ding, Yi
2012-11-01
Alpha-momorcharin (α-MC), a member of the ribosome-inactivating protein (RIP) family, has been used not only as antiviral, antimicrobial, and antitumor agents, but also as toxicant to protozoa, insects, and fungi. In this study, we expressed the protein in Escherichia coli Rosetta (DE3) pLysS strain and purified it by nickel-nitrilotriacetic acid affinity chromatography. A total of 85 mg of homogeneous protein was obtained from 1 l culture supernatant of Rosetta (DE3) pLysS, showing a high recovery rate of 73.9%. Protein activity assay indicated that α-MC had both N-glycosidase activity and DNA-nuclease activity, the former releasing RIP diagnostic RNA fragment (Endo's fragment) from rice rRNAs and the latter converting supercoiled circular DNA of plasmid pET-32a(+) into linear conformations in a concentration-dependent manner. Specially, we found that α-MC could inhibit the mycelial growth of Fusarium solani and Fusarium oxysporum with IC(50) values of 6.23 and 4.15 μM, respectively. Results of optical microscopy and transmission electron microscopy demonstrated that α-MC caused extensive septum formation, loss of integrity of the cell wall, separation of the cytoplasm from the cell wall, deformation of cells with irregular budding sites, and apoptosis in F. solani. Moreover, α-MC was active against Pseudomonas aeruginosa with an IC(50) value of 0.59 μM. The α-MC protein carries a high potential for the design of new antifungal drugs or the development of transgenic crops resistant to pathogens.
Nucleolar integrity is required for the maintenance of long-term synaptic plasticity.
Directory of Open Access Journals (Sweden)
Kim D Allen
Full Text Available Long-term memory (LTM formation requires new protein synthesis and new gene expression. Based on our work in Aplysia, we hypothesized that the rRNA genes, stimulation-dependent targets of the enzyme Poly(ADP-ribose polymerase-1 (PARP-1, are primary effectors of the activity-dependent changes in synaptic function that maintain synaptic plasticity and memory. Using electrophysiology, immunohistochemistry, pharmacology and molecular biology techniques, we show here, for the first time, that the maintenance of forskolin-induced late-phase long-term potentiation (L-LTP in mouse hippocampal slices requires nucleolar integrity and the expression of new rRNAs. The activity-dependent upregulation of rRNA, as well as L-LTP expression, are poly(ADP-ribosylation (PAR dependent and accompanied by an increase in nuclear PARP-1 and Poly(ADP ribose molecules (pADPr after forskolin stimulation. The upregulation of PARP-1 and pADPr is regulated by Protein kinase A (PKA and extracellular signal-regulated kinase (ERK--two kinases strongly associated with long-term plasticity and learning and memory. Selective inhibition of RNA Polymerase I (Pol I, responsible for the synthesis of precursor rRNA, results in the segmentation of nucleoli, the exclusion of PARP-1 from functional nucleolar compartments and disrupted L-LTP maintenance. Taken as a whole, these results suggest that new rRNAs (28S, 18S, and 5.8S ribosomal components--hence, new ribosomes and nucleoli integrity--are required for the maintenance of long-term synaptic plasticity. This provides a mechanistic link between stimulation-dependent gene expression and the new protein synthesis known to be required for memory consolidation.
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Exploration of small RNA-seq data for small non-coding RNAs in Human Colorectal Cancer.
Koduru, Srinivas V; Tiwari, Amit K; Hazard, Sprague W; Mahajan, Milind; Ravnic, Dino J
2017-01-01
Background: Improved healthcare and recent breakthroughs in technology have substantially reduced cancer mortality rates worldwide. Recent advancements in next-generation sequencing (NGS) have allowed genomic analysis of the human transcriptome. Now, using NGS we can further look into small non-coding regions of RNAs (sncRNAs) such as microRNAs (miRNAs), Piwi-interacting-RNAs (piRNAs), long non-coding RNAs (lncRNAs), and small nuclear/nucleolar RNAs (sn/snoRNAs) among others. Recent studies looking at sncRNAs indicate their role in important biological processes such as cancer progression and predict their role as biomarkers for disease diagnosis, prognosis, and therapy. Results: In the present study, we data mined publically available small RNA sequencing data from colorectal tissue samples of eight matched patients (benign, tumor, and metastasis) and remapped the data for various small RNA annotations. We identified aberrant expression of 13 miRNAs in tumor and metastasis specimens [tumor vs benign group (19 miRNAs) and metastasis vs benign group (38 miRNAs)] of which five were upregulated, and eight were downregulated, during disease progression. Pathway analysis of aberrantly expressed miRNAs showed that the majority of miRNAs involved in colon cancer were also involved in other cancers. Analysis of piRNAs revealed six to be over-expressed in the tumor vs benign cohort and 24 in the metastasis vs benign group. Only two piRNAs were shared between the two cohorts. Examining other types of small RNAs [sn/snoRNAs, mt_rRNA, miscRNA, nonsense mediated decay (NMD), and rRNAs] identified 15 sncRNAs in the tumor vs benign group and 104 in the metastasis vs benign group, with only four others being commonly expressed. Conclusion: In summary, our comprehensive analysis on publicly available small RNA-seq data identified multiple differentially expressed sncRNAs during colorectal cancer progression at different stages compared to normal colon tissue. We speculate that
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Directory of Open Access Journals (Sweden)
Chan Zhou
2017-08-01
Full Text Available N6-methyladenosine (m6A is the most abundant internal modification of mRNAs and is implicated in all aspects of post-transcriptional RNA metabolism. However, little is known about m6A modifications to circular (circ RNAs. We developed a computational pipeline (AutoCirc that, together with depletion of ribosomal RNA and m6A immunoprecipitation, defined thousands of m6A circRNAs with cell-type-specific expression. The presence of m6A circRNAs is corroborated by interaction between circRNAs and YTHDF1/YTHDF2, proteins that read m6A sites in mRNAs, and by reduced m6A levels upon depletion of METTL3, the m6A writer. Despite sharing m6A readers and writers, m6A circRNAs are frequently derived from exons that are not methylated in mRNAs, whereas mRNAs that are methylated on the same exons that compose m6A circRNAs exhibit less stability in a process regulated by YTHDF2. These results expand our understanding of the breadth of m6A modifications and uncover regulation of circRNAs through m6A modification.
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian
2016-02-01
Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Directory of Open Access Journals (Sweden)
Nerea Irigoyen
2016-02-01
Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the
Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae
Directory of Open Access Journals (Sweden)
Mônica de Oliveira Santos
2007-01-01
Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.
The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.
Rodnina, Marina V; Wintermeyer, Wolfgang
2011-04-01
Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.
The functional half-life of an mRNA depends on the ribosome spacing in an early coding region
DEFF Research Database (Denmark)
Pedersen, Margit; Nissen, Søren; Mitarai, Namiko
2011-01-01
Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...
The ribosome structure controls and directs mRNA entry, translocation and exit dynamics
International Nuclear Information System (INIS)
Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej
2008-01-01
The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit
Directory of Open Access Journals (Sweden)
Keeling Patrick J
2007-09-01
Full Text Available Abstract Background Dinoflagellates comprise an ecologically significant and diverse eukaryotic phylum that is sister to the phylum containing apicomplexan endoparasites. The mitochondrial genome of apicomplexans is uniquely reduced in gene content and size, encoding only three proteins and two ribosomal RNAs (rRNAs within a highly compacted 6 kb DNA. Dinoflagellate mitochondrial genomes have been comparatively poorly studied: limited available data suggest some similarities with apicomplexan mitochondrial genomes but an even more radical type of genomic organization. Here, we investigate structure, content and expression of dinoflagellate mitochondrial genomes. Results From two dinoflagellates, Crypthecodinium cohnii and Karlodinium micrum, we generated over 42 kb of mitochondrial genomic data that indicate a reduced gene content paralleling that of mitochondrial genomes in apicomplexans, i.e., only three protein-encoding genes and at least eight conserved components of the highly fragmented large and small subunit rRNAs. Unlike in apicomplexans, dinoflagellate mitochondrial genes occur in multiple copies, often as gene fragments, and in numerous genomic contexts. Analysis of cDNAs suggests several novel aspects of dinoflagellate mitochondrial gene expression. Polycistronic transcripts were found, standard start codons are absent, and oligoadenylation occurs upstream of stop codons, resulting in the absence of termination codons. Transcripts of at least one gene, cox3, are apparently trans-spliced to generate full-length mRNAs. RNA substitutional editing, a process previously identified for mRNAs in dinoflagellate mitochondria, is also implicated in rRNA expression. Conclusion The dinoflagellate mitochondrial genome shares the same gene complement and fragmentation of rRNA genes with its apicomplexan counterpart. However, it also exhibits several unique characteristics. Most notable are the expansion of gene copy numbers and their arrangements
Directory of Open Access Journals (Sweden)
Aaron R. Poole
2017-09-01
Full Text Available Many ribonucleoproteins (RNPs, which are comprised of noncoding RNA and associated proteins, are involved in essential cellular processes such as translation and pre-mRNA splicing. One class of RNP is the small Cajal body-specific RNP (scaRNP, which contributes to the biogenesis of small nuclear RNPs (snRNPs that are central components of the spliceosome. Three scaRNAs are internally processed, generating stable nucleolus-enriched RNAs of unknown function. Here, we provide data that show that these RNAs become part of RNPs we term regulatory RNPs (regRNPs. Most modifications within rRNA (predominantly pseudouridylation and ribose 2′-O-methylation are conducted by small nucleolar RNPs (snoRNPs, and we provide evidence that the activity of at least some of these snoRNPs is under the control of regRNPs. Because modifications within rRNA can vary in different physiological or pathological situations, rRNA modifications are thought to be the major source of ribosome heterogeneity. Our identification of regRNPs thus provides a potential mechanism for how ribosome heterogeneity may be accomplished. This work also provides additional functional connections between the Cajal body and the nucleolus.
New technologies accelerate the exploration of non-coding RNAs in horticultural plants
Energy Technology Data Exchange (ETDEWEB)
Liu, Degao; Mewalal, Ritesh; Hu, Rongbin; Tuskan, Gerald A.; Yang, Xiaohan
2017-07-05
Non-coding RNAs (ncRNAs), that is, RNAs not translated into proteins, are crucial regulators of a variety of biological processes in plants. While protein-encoding genes have been relatively well-annotated in sequenced genomes, accounting for a small portion of the genome space in plants, the universe of plant ncRNAs is rapidly expanding. Recent advances in experimental and computational technologies have generated a great momentum for discovery and functional characterization of ncRNAs. Here we summarize the classification and known biological functions of plant ncRNAs, review the application of next-generation sequencing (NGS) technology and ribosome profiling technology to ncRNA discovery in horticultural plants and discuss the application of new technologies, especially the new genome-editing tool clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) systems, to functional characterization of plant ncRNAs.
Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.
Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V
2007-04-01
During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.
Directory of Open Access Journals (Sweden)
Jun Yang
Full Text Available Ribosomes are large ribonucleoprotein complexes that are fundamental for protein synthesis. Ribosomes are ribozymes because their catalytic functions such as peptidyl transferase and peptidyl-tRNA hydrolysis depend on the rRNA. rRNA is a heterogeneous biopolymer comprising of at least 112 chemically modified residues that are believed to expand its topological potential. In the present study, we established a comprehensive modification profile of Saccharomyces cerevisiae's 18S and 25S rRNA using a high resolution Reversed-Phase High Performance Liquid Chromatography (RP-HPLC. A combination of mung bean nuclease assay, rDNA point mutants and snoRNA deletions allowed us to systematically map all ribose and base modifications on both rRNAs to a single nucleotide resolution. We also calculated approximate molar levels for each modification using their UV (254nm molar response factors, showing sub-stoichiometric amount of modifications at certain residues. The chemical nature, their precise location and identification of partial modification will facilitate understanding the precise role of these chemical modifications, and provide further evidence for ribosome heterogeneity in eukaryotes.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
A poly (U) polymerase in ribosome preparations from Ehrlich ascites tumor cells
International Nuclear Information System (INIS)
Guimaraes, R.C.; Bloch, D.P.
1981-01-01
A ribosome-bound poly (U) polymerase from Ehrlich ascites tumor cells is partially characterized. It adds UMPs to RNAs terminating in U-(3')-OH. The UMP-rich segments added reach average sizes of up to 18 nucleotides. CTP is strongly inhibitory to the enzyme. The main endogenous primers are low molecular weight RNAs which are found, after the addition of UMPs, mostly in the 6-8 S range. Some evidence suggests that a 5 S rRNA or polysome-associated 7 S RNA could be the main endogenous primers. (Author) [pt
Wang, Ying; Cao, Jinjun; Li, Weihai
2017-03-13
We present the complete mitochondrial (mt) genome sequence of the stonefly, Styloperla spinicercia Wu, 1935 (Plecoptera: Styloperlidae), the type species of the genus Styloperla and the first complete mt genome for the family Styloperlidae. The genome is circular, 16,129 base pairs long, has an A+T content of 70.7%, and contains 37 genes including the large and small ribosomal RNA (rRNA) subunits, 13 protein coding genes (PCGs), 22 tRNA genes and a large non-coding region (CR). All of the PCGs use the standard initiation codon ATN except ND1 and ND5, which start with TTG and GTG. Twelve of the PCGs stop with conventional terminal codons TAA and TAG, except ND5 which shows an incomplete terminator signal T. All tRNAs have the classic clover-leaf structures with the dihydrouridine (DHU) arm of tRNASer(AGN) forming a simple loop. Secondary structures of the two ribosomal RNAs are presented with reference to previous models. The structural elements and the variable numbers of tandem repeats are described within the control region. Phylogenetic analyses using both Bayesian (BI) and Maximum Likelihood (ML) methods support the previous hypotheses regarding family level relationships within the Pteronarcyoidea. The genetic distance calculated based on 13 PCGs and two rRNAs between Styloperla sp. and S. spinicercia is provided and interspecific divergence is discussed.
Castellano, Leandro; Stebbing, Justin
2013-03-01
MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression. They are characterized by specific maturation processes defined by canonical and non-canonical biogenic pathways. Analysis of ∼0.5 billion sequences from mouse data sets derived from different tissues, developmental stages and cell types, partly characterized by either ablation or mutation of the main proteins belonging to miRNA processor complexes, reveals 66 high-confidence new genomic loci coding for miRNAs that could be processed in a canonical or non-canonical manner. A proportion of the newly discovered miRNAs comprises mirtrons, for which we define a new sub-class. Notably, some of these newly discovered miRNAs are generated from untranslated and open reading frames of coding genes, and we experimentally validate these. We also show that many annotated miRNAs do not present miRNA-like features, as they are neither processed by known processing complexes nor loaded on AGO2; this indicates that the current miRNA miRBase database list should be refined and re-defined. Accordingly, a group of them map on ribosomal RNA molecules, whereas others cannot undergo genuine miRNA biogenesis. Notably, a group of annotated miRNAs are Dgcr8 independent and DICER dependent endogenous small interfering RNAs that derive from a unique hairpin formed from a short interspersed nuclear element.
Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function
Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars
2012-01-01
Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...
Ribosome-catalyzed formation of an abnormal peptide analogue
International Nuclear Information System (INIS)
Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.
1986-01-01
The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1982-01-01
The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
Directory of Open Access Journals (Sweden)
Feng Zhu
2018-02-01
Full Text Available Ribosome-inactivating proteins (RIPs are toxic N-glycosidases that depurinate eukaryotic and prokaryotic rRNAs, thereby arresting protein synthesis during translation. RIPs are widely found in various plant species and within different tissues. It is demonstrated in vitro and in transgenic plants that RIPs have been connected to defense by antifungal, antibacterial, antiviral, and insecticidal activities. However, the mechanism of these effects is still not completely clear. There are a number of reviews of RIPs. However, there are no reviews on the biological functions of RIPs in defense against pathogens and insect pests. Therefore, in this report, we focused on the effect of RIPs from plants in defense against pathogens and insect pest attacks. First, we summarize the three different types of RIPs based on their physical properties. RIPs are generally distributed in plants. Then, we discuss the distribution of RIPs that are found in various plant species and in fungi, bacteria, algae, and animals. Various RIPs have shown unique bioactive properties including antibacterial, antifungal, antiviral, and insecticidal activity. Finally, we divided the discussion into the biological roles of RIPs in defense against bacteria, fungi, viruses, and insects. This review is focused on the role of plant RIPs in defense against bacteria, fungi, viruses, and insect attacks. The role of plant RIPs in defense against pathogens and insects is being comprehended currently. Future study utilizing transgenic technology approaches to study the mechanisms of RIPs will undoubtedly generate a better comprehending of the role of plant RIPs in defense against pathogens and insects. Discovering additional crosstalk mechanisms between RIPs and phytohormones or reactive oxygen species (ROS against pathogen and insect infections will be a significant subject in the field of biotic stress study. These studies are helpful in revealing significance of genetic control that can
Sánchez-Nieves, Rubén; Facciotti, Marc; Saavedra-Collado, Sofía; Dávila-Santiago, Lizbeth; Rodríguez-Carrero, Roy; Montalvo-Rodríguez, Rafael
2016-03-01
The genus Haloarcula belongs to the family Halobacteriaceae which currently has 10 valid species. Here we report the draft genome sequence of strain SL3, a new species within this genus, isolated from the Solar Salterns of Cabo Rojo, Puerto Rico. Genome assembly performed using NGEN Assembler resulted in 18 contigs (N50 = 601,911 bp), the largest of which contains 1,023,775 bp. The genome consists of 3.97 MB and has a GC content of 61.97%. Like all species of Haloarcula, the genome encodes heterogeneous copies of the small subunit ribosomal RNA. In addition, the genome includes 6 rRNAs, 48 tRNAs, and 3797 protein coding sequences. Several carbohydrate-active enzymes genes were found, as well as enzymes involved in the dihydroxyacetone processing pathway which are not found in other Haloarcula species. The NCBI accession number for this genome is LIUF00000000 and the strain deposit number is CECT9001.
Death of a dogma: eukaryotic mRNAs can code for more than one protein.
Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier
2016-01-08
mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Mammalian small nucleolar RNAs are mobile genetic elements.
Directory of Open Access Journals (Sweden)
Michel J Weber
2006-12-01
Full Text Available Small nucleolar RNAs (snoRNAs of the H/ACA box and C/D box categories guide the pseudouridylation and the 2'-O-ribose methylation of ribosomal RNAs by forming short duplexes with their target. Similarly, small Cajal body-specific RNAs (scaRNAs guide modifications of spliceosomal RNAs. The vast majority of vertebrate sno/scaRNAs are located in introns of genes transcribed by RNA polymerase II and processed by exonucleolytic trimming after splicing. A bioinformatic search for orthologues of human sno/scaRNAs in sequenced mammalian genomes reveals the presence of species- or lineage-specific sno/scaRNA retroposons (sno/scaRTs characterized by an A-rich tail and an approximately 14-bp target site duplication that corresponds to their insertion site, as determined by interspecific genomic alignments. Three classes of snoRTs are defined based on the extent of intron and exon sequences from the snoRNA parental host gene they contain. SnoRTs frequently insert in gene introns in the sense orientation at genomic hot spots shared with other genetic mobile elements. Previously characterized human snoRNAs are encoded in retroposons whose parental copies can be identified by phylogenic analysis, showing that snoRTs can be faithfully processed. These results identify snoRNAs as a new family of mobile genetic elements. The insertion of new snoRNA copies might constitute a safeguard mechanism by which the biological activity of snoRNAs is maintained in spite of the risk of mutations in the parental copy. I furthermore propose that retroposition followed by genetic drift is a mechanism that increased snoRNA diversity during vertebrate evolution to eventually acquire new RNA-modification functions.
Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.
Mustafi, Mainak; Weisshaar, James C
2018-01-16
In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid
The complete structure of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad
2014-11-13
Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.
Dual Nature of Translational Control by Regulatory BC RNAs ▿
Eom, Taesun; Berardi, Valerio; Zhong, Jun; Risuleo, Gianfranco; Tiedge, Henri
2011-01-01
In higher eukaryotes, increasing evidence suggests, gene expression is to a large degree controlled by RNA. Regulatory RNAs have been implicated in the management of neuronal function and plasticity in mammalian brains. However, much of the molecular-mechanistic framework that enables neuronal regulatory RNAs to control gene expression remains poorly understood. Here, we establish molecular mechanisms that underlie the regulatory capacity of neuronal BC RNAs in the translational control of gene expression. We report that regulatory BC RNAs employ a two-pronged approach in translational control. One of two distinct repression mechanisms is mediated by C-loop motifs in BC RNA 3′ stem-loop domains. These C-loops bind to eIF4B and prevent the factor's interaction with 18S rRNA of the small ribosomal subunit. In the second mechanism, the central A-rich domains of BC RNAs target eIF4A, specifically inhibiting its RNA helicase activity. Thus, BC RNAs repress translation initiation in a bimodal mechanistic approach. As BC RNA functionality has evolved independently in rodent and primate lineages, our data suggest that BC RNA translational control was necessitated and implemented during mammalian phylogenetic development of complex neural systems. PMID:21930783
In vivo and in vitro translation of the RNAs of four tobamoviruses
DEFF Research Database (Denmark)
Beier, H; Mundry, K W; Issinger, O G
1980-01-01
The RNAs from four tobamoviruses [tobacco mosaic virus(TMV) vulgare, TMV dahlemense, TMV U2, and the cowpea strain of TMV (CcTMV)] were translated in a cell-free ribosome system from reticulocytes. Among the translation products found were two polypeptides with molecular weights of 170,000 and 120...
Hong, Sungki; Freeberg, Mallory A; Han, Ting; Kamath, Avani; Yao, Yao; Fukuda, Tomoko; Suzuki, Tsukasa; Kim, John K; Inoki, Ken
2017-06-26
The RNA binding protein, LARP1, has been proposed to function downstream of mTORC1 to regulate the translation of 5'TOP mRNAs such as those encoding ribosome proteins (RP). However, the roles of LARP1 in the translation of 5'TOP mRNAs are controversial and its regulatory roles in mTORC1-mediated translation remain unclear. Here we show that LARP1 is a direct substrate of mTORC1 and Akt/S6K1. Deep sequencing of LARP1-bound mRNAs reveal that non-phosphorylated LARP1 interacts with both 5' and 3'UTRs of RP mRNAs and inhibits their translation. Importantly, phosphorylation of LARP1 by mTORC1 and Akt/S6K1 dissociates it from 5'UTRs and relieves its inhibitory activity on RP mRNA translation. Concomitantly, phosphorylated LARP1 scaffolds mTORC1 on the 3'UTRs of translationally-competent RP mRNAs to facilitate mTORC1-dependent induction of translation initiation. Thus, in response to cellular mTOR activity, LARP1 serves as a phosphorylation-sensitive molecular switch for turning off or on RP mRNA translation and subsequent ribosome biogenesis.
Detection of plant microRNAs in honey.
Directory of Open Access Journals (Sweden)
Angelo Gismondi
Full Text Available For the first time in the literature, our group has managed to demonstrate the existence of plant RNAs in honey samples. In particular, in our work, different RNA extraction procedures were performed in order to identify a purification method for nucleic acids from honey. Purity, stability and integrity of the RNA samples were evaluated by spectrophotometric, PCR and electrophoretic analyses. Among all honey RNAs, we specifically revealed the presence of both plastidial and nuclear plant transcripts: RuBisCO large subunit mRNA, maturase K messenger and 18S ribosomal RNA. Surprisingly, nine plant microRNAs (miR482b, miR156a, miR396c, miR171a, miR858, miR162a, miR159c, miR395a and miR2118a were also detected and quantified by qPCR. In this context, a comparison between microRNA content in plant samples (i.e. flowers, nectars and their derivative honeys was carried out. In addition, peculiar microRNA profiles were also identified in six different monofloral honeys. Finally, the same plant microRNAs were investigated in other plant food products: tea, cocoa and coffee. Since plant microRNAs introduced by diet have been recently recognized as being able to modulate the consumer's gene expression, our research suggests that honey's benefits for human health may be strongly correlated to the bioactivity of plant microRNAs contained in this matrix.
Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.
Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C
2015-11-05
The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.
Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.
Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad
2015-04-17
Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
Structure based hypothesis of a mitochondrial ribosome rescue mechanism
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2012-05-01
Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.
Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian
2016-01-01
Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.
DEFF Research Database (Denmark)
Poulsen, S M; Karlsson, M; Johansson, L B
2001-01-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development
International Nuclear Information System (INIS)
Dessen, E.M.B.; Perondini, A.L.P.
1979-01-01
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt
International Nuclear Information System (INIS)
Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry
2008-01-01
The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library
The ribosome uses two active mechanisms to unwind messenger RNA during translation.
Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio
2011-07-06
The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved
Pan, Ting Shuang; Nie, Pin
2013-07-01
Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.
Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S
2018-03-15
Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.
Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.
Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P
2015-11-10
Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.
IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)
Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet
2016-01-01
Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539
MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW
Directory of Open Access Journals (Sweden)
Tobias von der Haar
2012-04-01
Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.
DEFF Research Database (Denmark)
Douthwaite, S; Powers, T; Lee, J Y
1989-01-01
The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...
Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose
2017-07-25
Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.
The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes
Directory of Open Access Journals (Sweden)
Mickey R. Miller
2014-09-01
Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.
Directory of Open Access Journals (Sweden)
Rubén Sánchez-Nieves
2016-03-01
Full Text Available The genus Haloarcula belongs to the family Halobacteriaceae which currently has 10 valid species. Here we report the draft genome sequence of strain SL3, a new species within this genus, isolated from the Solar Salterns of Cabo Rojo, Puerto Rico. Genome assembly performed using NGEN Assembler resulted in 18 contigs (N50 = 601,911 bp, the largest of which contains 1,023,775 bp. The genome consists of 3.97 MB and has a GC content of 61.97%. Like all species of Haloarcula, the genome encodes heterogeneous copies of the small subunit ribosomal RNA. In addition, the genome includes 6 rRNAs, 48 tRNAs, and 3797 protein coding sequences. Several carbohydrate-active enzymes genes were found, as well as enzymes involved in the dihydroxyacetone processing pathway which are not found in other Haloarcula species. The NCBI accession number for this genome is LIUF00000000 and the strain deposit number is CECT9001. Keywords: Halophilic archaea, Henome sequence, Puerto Rico
Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.
Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki
2015-11-17
rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.
Simulating movement of tRNA through the ribosome during hybrid-state formation.
Whitford, Paul C; Sanbonmatsu, Karissa Y
2013-09-28
Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the
Sato, Hiroshi; Nakasone, Kaoru; Yoshida, Takao; Kato, Chiaki; Maruyama, Tadashi
2015-07-01
When non-extremophiles encounter extreme environmental conditions, which are natural for the extremophiles, stress reactions, e.g., expression of heat shock proteins (HSPs), are thought to be induced for survival. To understand how the extremophiles live in such extreme environments, we studied the effects of high hydrostatic pressure on cellular contents of HSPs and their mRNAs during growth in a piezophilic bacterium, Shewanella violacea. HSPs increased at high hydrostatic pressures even when optimal for growth. The mRNAs and proteins of these HSPs significantly increased at higher hydrostatic pressure in S. violacea. In the non-piezophilic Escherichia coli, however, their mRNAs decreased, while their proteins did not change. Several transcriptional start sites (TSSs) for HSP genes were determined by the primer extension method and some of them showed hydrostatic pressure-dependent increase of the mRNAs. A major refolding target of one of the HSPs, chaperonin, at high hydrostatic pressure was shown to be RplB, a subunit of the 50S ribosome. These results suggested that in S. violacea, HSPs play essential roles, e.g., maintaining protein complex machinery including ribosomes, in the growth and viability at high hydrostatic pressure, and that, in their expression, the transcription is under the control of σ(32).
Chen, Zhi-Teng; Du, Yu-Zhou
2018-05-01
The complete mitochondrial genomes (mitogenomes) of Taeniopteryx ugola and Doddsia occidentalis (Plecoptera: Taeniopterygidae) were firstly sequenced from the family Taeniopterygidae. The 15,353-bp long mitogenome of T. ugola and the 16,020-bp long mitogenome of D. occidentalis each contained 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), two ribosomal RNA genes (rRNAs) and a control region (CR). The mitochondrial gene arrangement of the two taeniopterygids and other stoneflies was identical with the putative ancestral mitogenome of Drosophila yakuba. Most PCGs used standard ATN start codons and TAN termination codons. Twenty-one of the 22 tRNAs in each mitogenome could fold into the cloverleaf secondary structures, while the dihydrouridine (DHU) arm of trnSer (AGN) was reduced or absent. Stem-loop (SL) structures, poly-T stretch, poly-[AT] n stretch and tandem repeats were found in the CRs of the two mitogenomes. The phylogenetic analyses using Bayesian inference (BI) and maximum likelihood methods (ML) generated identical results, both supporting the monophyly of all stonefly families and the two infraorders, Systellognatha and Euholognatha. Taeniopterygidae was grouped with another two families from Euholognatha. The relationships within Plecoptera were recovered as (((Perlidae+Peltoperlidae)+((Pteronarcyidae+Chloroperlidae)+Styloperlidae))+((Capniidae+Taeniopterygidae)+Nemouridae))+Gripopterygidae. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sarit Edelheit
2013-06-01
Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.
Structural studies of EF-Tu complexes
DEFF Research Database (Denmark)
Johansen, Jesper Sanderhoff
2011-01-01
proteins and 22 tRNAs and 2 rRNAs. The mammalian mitochondria have their own specialised translational system for maintaining the synthesis of the 13 proteins. The mammalian mitochondrial protein synthesis resembles the prokaryotic system more than the cytosolic system from eukaryotes. Some of the t...
International Nuclear Information System (INIS)
Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.
1977-01-01
The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes
Comparison of Total RNA Isolation Methods for Analysis of Immune-Related microRNAs in Market Milks.
Oh, Sangnam; Park, Mi Ri; Son, Seok Jun; Kim, Younghoon
2015-01-01
Bovine milk provides essential nutrients, including immunologically important molecules, as the primary source of nutrition to newborns. Recent studies showed that RNAs from bovine milk contain immune-related microRNAs (miRNA) that regulate various immune systems. To evaluate the biological and immunological activity of miRNAs from milk products, isolation methods need to be established. Six methods for extracting total RNAs from bovine colostrums were adopted to evaluate the isolating efficiency and expression of miRNAs. Total RNA from milk was presented in formulation of small RNAs, rather than ribosomal RNAs. Column-combined phenol isolating methods showed high recovery of total RNAs, especially the commercial columns for biofluid samples, which demonstrated outstanding efficiency for recovering miRNAs. We also evaluated the quantity of five immune-related miRNAs (miR-93, miR-106a, miR-155, miR-181a, miR-451) in milk processed by temperature treatments including low temperature for long time (LTLT, 63℃ for 30 min)-, high temperature for short time (HTST, 75℃ for 15 s)-, and ultra heat treatment (UHT, 120-130℃ for 0.5-4 s). All targeted miRNAs had significantly reduced levels in processed milks compared to colostrum and raw mature milk. Interestingly, the amount of immune-related miRNAs from HTST milk was more resistant than those of LTLT and UHT milks. Our present study examined defined methods of RNA isolation and quantification of immune-specific miRNAs from small volumes of milk for use in further analysis.
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
An exit cavity was crucial to the polymerase activity of the early ribosome.
Fox, George E; Tran, Quyen; Yonath, Ada
2012-01-01
The emergence of an RNA entity capable of synthesizing peptides was a key prebiotic development. It is hypothesized that a precursor of the modern ribosomal exit tunnel was associated with this RNA entity (e.g., "protoribosome" or "bonding entity") from the earliest time and played an essential role. Various compounds that can bind and activate amino acids, including extremely short RNA chains carrying amino acids, and possibly di- or tripeptides, would have associated with the internal cavity of the protoribosome. This cavity hosts the site for peptide bond formation and adjacent to it a relatively elongated feature that could have evolved to the modern ribosomal exit tunnel, as it is wide enough to allow passage of an oligopeptide. When two of the compounds carrying amino acids or di- or tripeptides (to which we refer, for simplicity, as small aminoacylated RNAs) were in proximity within the heart of the protoribosome, a peptide bond could form spontaneously. The growing peptide would enter the nearby cavity and would not disrupt the attachment of the substrates to the protoribosome or interfere with the subsequent attachment of additional small aminoacylated RNAs. Additionally, the presence of the peptide in the cavity would increase the lifetime of the oligopeptide in the protoribosome. Thus, subsequent addition of another amino acid would be more likely than detachment from the protoribosome, and synthesis could continue. The early ability to synthesize peptides may have resulted in an abbreviated RNA World.
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques
2018-04-06
The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.
The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction
Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.
1989-01-01
Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Directory of Open Access Journals (Sweden)
Kai-Chun Chang
2012-01-01
Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.
Role of the Box C/D Motif in Localization of Small Nucleolar RNAs to Coiled Bodies and Nucleoli
Narayanan, Aarthi; Speckmann, Wayne; Terns, Rebecca; Terns, Michael P.
1999-01-01
Small nucleolar RNAs (snoRNAs) are a large family of eukaryotic RNAs that function within the nucleolus in the biogenesis of ribosomes. One major class of snoRNAs is the box C/D snoRNAs named for their conserved box C and box D sequence elements. We have investigated the involvement of cis-acting sequences and intranuclear structures in the localization of box C/D snoRNAs to the nucleolus by assaying the intranuclear distribution of fluorescently labeled U3, U8, and U14 snoRNAs injected into Xenopus oocyte nuclei. Analysis of an extensive panel of U3 RNA variants showed that the box C/D motif, comprised of box C′, box D, and the 3′ terminal stem of U3, is necessary and sufficient for the nucleolar localization of U3 snoRNA. Disruption of the elements of the box C/D motif of U8 and U14 snoRNAs also prevented nucleolar localization, indicating that all box C/D snoRNAs use a common nucleolar-targeting mechanism. Finally, we found that wild-type box C/D snoRNAs transiently associate with coiled bodies before they localize to nucleoli and that variant RNAs that lack an intact box C/D motif are detained within coiled bodies. These results suggest that coiled bodies play a role in the biogenesis and/or intranuclear transport of box C/D snoRNAs. PMID:10397754
Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues
International Nuclear Information System (INIS)
Shakin, S.H.; Liebhaber, S.A.
1987-01-01
The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation
Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins
Directory of Open Access Journals (Sweden)
Gayani N. P. Dedduwa-Mudalige
2015-09-01
Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.
Chen, Dong-Bin; Liu, Huan-Huan; Hu, Hua-Lei; Bian, Hai-Xu; Zhang, Ru-Song; Yang, Rui-Sheng; Jiang, Xing-Fu; Shi, Sheng-Lin
2018-01-01
Abstract The longhorn beetle Dorysthenes paradoxus (Faldermann, 1833) (Coleoptera: Cerambycidae) is not only a serious agricultural pest but also a traditionally edible insect in China. However, no genetic information on this species has been acquired. In the present study, we report the mitochondrial genome (mitogenome) of Do. paradoxus, as the first complete mitogenome of Prioninae. The circular mitogenome of 15,922 bp encodes 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), and two ribosomal RNAs (rRNAs), and it contains an A+T-rich region. This mitogenome exhibits the lowest A+T content (71.13%) but harbors the largest AT skew (0.116) among the completely sequenced Cerambycidae species. Eleven of the 13 PCGs have a typical ATN start codon, whereas COI and ND1 are tentatively designated by AAT and TTG, respectively. Only 4 of the 13 PCGs harbor a complete termination codon, and the remaining 9 possess incomplete termination codons (T or TA). Apart from tRNASer(AGN), the other 21 tRNAs can fold into a typical clover-leaf secondary structures. The Do. paradoxus A+T-rich region contains two poly-T stretches and a tandem repeat that comprises two 47-bp-long copies. Both Bayesian inference and Maximum likelihood analyses confirmed the subfamily ranks of Cerambycidae ([Prioninae + Cerambycinae] + Lamiinae) and the close relationship between Philinae and Prioninae/Cerambycinae. However, the data did not support the monophyly of Prioninae and Cerambycinae. The mitogenome presented here provides basic genetic information for this economically important species. PMID:29718483
Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B
2001-09-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.
Identification of candidate structured RNAs in the marine organism 'Candidatus Pelagibacter ubique'
Directory of Open Access Journals (Sweden)
Schwalbach Michael S
2009-06-01
Full Text Available Abstract Background Metagenomic sequence data are proving to be a vast resource for the discovery of biological components. Yet analysis of this data to identify functional RNAs lags behind efforts to characterize protein diversity. The genome of 'Candidatus Pelagibacter ubique' HTCC 1062 is the closest match for approximately 20% of marine metagenomic sequence reads. It is also small, contains little non-coding DNA, and has strikingly low GC content. Results To aid the discovery of RNA motifs within the marine metagenome we exploited the genomic properties of 'Cand. P. ubique' by targeting our search to long intergenic regions (IGRs with relatively high GC content. Analysis of known RNAs (rRNA, tRNA, riboswitches etc. shows that structured RNAs are significantly enriched in such IGRs. To identify additional candidate structured RNAs, we examined other IGRs with similar characteristics from 'Cand. P. ubique' using comparative genomics approaches in conjunction with marine metagenomic data. Employing this strategy, we discovered four candidate structured RNAs including a new riboswitch class as well as three additional likely cis-regulatory elements that precede genes encoding ribosomal proteins S2 and S12, and the cytoplasmic protein component of the signal recognition particle. We also describe four additional potential RNA motifs with few or no examples occurring outside the metagenomic data. Conclusion This work begins the process of identifying functional RNA motifs present in the metagenomic data and illustrates how existing completed genomes may be used to aid in this task.
Yuan, Yang; Jiaoming, Li; Xiang, Wang; Yanhui, Liu; Shu, Jiang; Maling, Gou; Qing, Mao
2018-05-01
Cross-talk between competitive endogenous RNAs (ceRNAs) may play a critical role in revealing potential mechanisms of tumor development and physiology. Glioblastoma is the most common type of malignant primary brain tumor, and the mechanisms of tumor genesis and development in glioblastoma are unclear. Here, to investigate the role of non-coding RNAs and the ceRNA network in glioblastoma, we performed paired-end RNA sequencing and microarray analyses to obtain the expression profiles of mRNAs, lncRNAs, circRNAs and miRNAs. We identified that the expression of 501 lncRNAs, 1999 mRNAs, 2038 circRNAs and 143 miRNAs were often altered between glioblastoma and matched normal brain tissue. Gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses were performed on these differentially expressed mRNAs and miRNA-mediated target genes of lncRNAs and circRNAs. Furthermore, we used a multi-step computational framework and several bioinformatics methods to construct a ceRNA network combining mRNAs, miRNAs, lncRNAs and circRNA, based on co-expression analysis between the differentially expressed RNAs. We identified that plenty of lncRNAs, CircRNAs and their downstream target genes in the ceRNA network are related to glutamatergic synapse, suggesting that glutamate metabolism is involved in glioma biological functions. Our results will accelerate the understanding of tumorigenesis, cancer progression and even therapeutic targeting in glioblastoma.
Complete mitochondrial genome of a Asian lion (Panthera leo goojratensis).
Li, Yu-Fei; Wang, Qiang; Zhao, Jian-ning
2016-01-01
The entire mitochondrial genome of this Asian lion (Panthera leo goojratensis) was 17,183 bp in length, gene composition and arrangement conformed to other lions, which contained the typical structure of 22 tRNAs, 2 rRNAs, 13 protein-coding genes and a non-coding region. The characteristic of the mitochondrial genome was analyzed in detail.
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
DEFF Research Database (Denmark)
Vester, Birte; Garrett, Roger Antony
1988-01-01
in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...
YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA
DEFF Research Database (Denmark)
Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M
2009-01-01
The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...
Directory of Open Access Journals (Sweden)
Jennifer L Houmani
Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.
Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.
Nikolaitchik, Olga A; Hu, Wei-Shau
2014-04-01
A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1
Evidence that viral RNAs have evolved for efficient, two-stage packaging.
Borodavka, Alexander; Tuma, Roman; Stockley, Peter G
2012-09-25
Genome packaging is an essential step in virus replication and a potential drug target. Single-stranded RNA viruses have been thought to encapsidate their genomes by gradual co-assembly with capsid subunits. In contrast, using a single molecule fluorescence assay to monitor RNA conformation and virus assembly in real time, with two viruses from differing structural families, we have discovered that packaging is a two-stage process. Initially, the genomic RNAs undergo rapid and dramatic (approximately 20-30%) collapse of their solution conformations upon addition of cognate coat proteins. The collapse occurs with a substoichiometric ratio of coat protein subunits and is followed by a gradual increase in particle size, consistent with the recruitment of additional subunits to complete a growing capsid. Equivalently sized nonviral RNAs, including high copy potential in vivo competitor mRNAs, do not collapse. They do support particle assembly, however, but yield many aberrant structures in contrast to viral RNAs that make only capsids of the correct size. The collapse is specific to viral RNA fragments, implying that it depends on a series of specific RNA-protein interactions. For bacteriophage MS2, we have shown that collapse is driven by subsequent protein-protein interactions, consistent with the RNA-protein contacts occurring in defined spatial locations. Conformational collapse appears to be a distinct feature of viral RNA that has evolved to facilitate assembly. Aspects of this process mimic those seen in ribosome assembly.
Gan, Huan You; Noor, Mohd Ezhar Mohd; Saari, Nur Azna; Musa, Najiah; Mustapha, Baharim; Usup, Gires
2015-01-01
Vibrio campbellii strain UMTGB204 was isolated from a green barrel tunicate. The genome of this strain comprises 5,652,224 bp with 5,014 open reading frames, 9 rRNAs, and 116 tRNAs. It contains genes related to virulence and environmental tolerance. Gene clusters for the biosynthesis of nonribosomal peptides and bacteriocin were also identified. PMID:25814609
DEFF Research Database (Denmark)
Han, Yi-Neng; Xia, Shengqiang; Zhang, Yuan-Yuan
2017-01-01
Circular RNAs (circRNAs) are a novel type of universal and diverse endogenous noncoding RNAs (ncRNAs) and they form a covalently closed continuous loop without 5' or 3' tails unlike linear RNAs. Most circRNAs are presented with characteristics of abundance, stability, conservatism, and often exhi...... and expression regulators, RBP sponges in cancer as well as current research methods of circRNAs, providing evidence for the significance of circRNAs in cancer diagnosis and clinical treatment....
Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Garrett, R A
1981-01-01
The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....
Replication and meiotic transmission of yeast ribosomal RNA genes.
Brewer, B J; Zakian, V A; Fangman, W L
1980-11-01
The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Lv, Yuanda; Liang, Zhikai; Ge, Min; Qi, Weicong; Zhang, Tifu; Lin, Feng; Peng, Zhaohua; Zhao, Han
2016-05-11
Nitrogen (N) is an essential and often limiting nutrient to plant growth and development. Previous studies have shown that the mRNA expressions of numerous genes are regulated by nitrogen supplies; however, little is known about the expressed non-coding elements, for example long non-coding RNAs (lncRNAs) that control the response of maize (Zea mays L.) to nitrogen. LncRNAs are a class of non-coding RNAs larger than 200 bp, which have emerged as key regulators in gene expression. In this study, we surveyed the intergenic/intronic lncRNAs in maize B73 leaves at the V7 stage under conditions of N-deficiency and N-sufficiency using ribosomal RNA depletion and ultra-deep total RNA sequencing approaches. By integration with mRNA expression profiles and physiological evaluations, 7245 lncRNAs and 637 nitrogen-responsive lncRNAs were identified that exhibited unique expression patterns. Co-expression network analysis showed that the nitrogen-responsive lncRNAs were enriched mainly in one of the three co-expressed modules. The genes in the enriched module are mainly involved in NADH dehydrogenase activity, oxidative phosphorylation and the nitrogen compounds metabolic process. We identified a large number of lncRNAs in maize and illustrated their potential regulatory roles in response to N stress. The results lay the foundation for further in-depth understanding of the molecular mechanisms of lncRNAs' role in response to nitrogen stresses.
C. elegans nucleostemin is required for larval growth and germline stem cell division.
Directory of Open Access Journals (Sweden)
Michelle M Kudron
2008-08-01
Full Text Available The nucleolus has shown to be integral for many processes related to cell growth and proliferation. Stem cells in particular are likely to depend upon nucleolus-based processes to remain in a proliferative state. A highly conserved nucleolar factor named nucleostemin is proposed to be a critical link between nucleolar function and stem-cell-specific processes. Currently, it is unclear whether nucleostemin modulates proliferation by affecting ribosome biogenesis or by another nucleolus-based activity that is specific to stem cells and/or highly proliferating cells. Here, we investigate nucleostemin (nst-1 in the nematode C. elegans, which enables us to examine nst-1 function during both proliferation and differentiation in vivo. Like mammalian nucleostemin, the NST-1 protein is localized to the nucleolus and the nucleoplasm; however, its expression is found in both differentiated and proliferating cells. Global loss of C. elegans nucleostemin (nst-1 leads to a larval arrest phenotype due to a growth defect in the soma, while loss of nst-1 specifically in the germ line causes germline stem cells to undergo a cell cycle arrest. nst-1 mutants exhibit reduced levels of rRNAs, suggesting defects in ribosome biogenesis. However, NST-1 is generally not present in regions of the nucleolus where rRNA transcription and processing occurs, so this reduction is likely secondary to a different defect in ribosome biogenesis. Transgenic studies indicate that NST-1 requires its N-terminal domain for stable expression and both its G1 GTPase and intermediate domains for proper germ line function. Our data support a role for C. elegans nucleostemin in cell growth and proliferation by promoting ribosome biogenesis.
Ishida, Hisashi; Matsumoto, Atsushi
2014-01-01
To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999
Directory of Open Access Journals (Sweden)
Hisashi Ishida
Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.
Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S
2008-07-01
Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.
Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering
International Nuclear Information System (INIS)
Burkhardt, N.
1997-01-01
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de
Riveros-Mckay, Fernando; Campos, Itzia; Giles-Gómez, Martha; Bolívar, Francisco; Escalante, Adelfo
2014-11-06
Leuconostoc mesenteroides P45 was isolated from the traditional Mexican pulque beverage. We report its draft genome sequence, assembled in 6 contigs consisting of 1,874,188 bp and no plasmids. Genome annotation predicted a total of 1,800 genes, 1,687 coding sequences, 52 pseudogenes, 9 rRNAs, 51 tRNAs, 1 noncoding RNA, and 44 frameshifted genes. Copyright © 2014 Riveros-Mckay et al.
Gürel, Güliz; Blaha, Gregor; Moore, Peter B; Steitz, Thomas A
2009-05-29
Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 A. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.
Energy Technology Data Exchange (ETDEWEB)
Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.; Yale
2009-06-30
Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the Asite cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.
Huang, Shijie; Zhu, Xuechen; Melançon, Charles E
2016-01-15
The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.
Directory of Open Access Journals (Sweden)
Bani Kumar Pathak
Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.
Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion
DEFF Research Database (Denmark)
Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup
2017-01-01
Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...
Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan
2013-05-01
The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Plasmodium falciparum mitochondria import tRNAs along with an active phenylalanyl-tRNA synthetase.
Sharma, Arvind; Sharma, Amit
2015-02-01
The Plasmodium falciparum protein translation enzymes aminoacyl-tRNA synthetases (aaRSs) are an emergent family of drug targets. The aaRS ensemble catalyses transfer of amino acids to cognate tRNAs, thus providing charged tRNAs for ribosomal consumption. P. falciparum proteome expression relies on a total of 36 aaRSs for the three translationally independent compartments of cytoplasm, apicoplast and mitochondria. In the present study, we show that, of this set of 36, a single genomic copy of mitochondrial phenylalanyl-tRNA synthetase (mFRS) is targeted to the parasite mitochondria, and that the mFRS gene is exclusive to malaria parasites within the apicomplexan phyla. Our protein cellular localization studies based on immunofluorescence data show that, along with mFRS, P. falciparum harbours two more phenylalanyl-tRNA synthetase (FRS) assemblies that are localized to its apicoplast and cytoplasm. The 'extra' mFRS is found in mitochondria of all asexual blood stage parasites and is competent in aminoacylation. We show further that the parasite mitochondria import tRNAs from the cytoplasmic tRNA pool. Hence drug targeting of FRSs presents a unique opportunity to potentially stall protein production in all three parasite translational compartments.
Energy Technology Data Exchange (ETDEWEB)
Gurel, G.; Blaha, G; Moore, P; Steitz,
2009-01-01
Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.
Adkar-Purushothama, Charith Raj; Iyer, Pavithran Sridharan; Perreault, Jean-Pierre
2017-08-21
It is well established that viroid derived small RNA (vd-sRNA) induces RNA silencing of endogenous mRNA. However, it remains not clear how exactly viroid infections can lead to severe symptom induction given the fact that fewer vd-sRNAs binding the specific target mRNAs were recovered from the infected plants. To answer this question, the two least expressed (+) and (-) strand vd-sRNAs of potato spindle tuber viroid (PSTVd) binding to both the 3' UTR and the coding region of tomato mRNAs were analyzed by infecting tomato plants with two variants of PSTVd. As products of these putative target mRNAs are involved in plant phenotype, the effect of this viroid on these genes were analyzed by infecting tomato plants with two variants of PSTVd. The direct interaction between the vd-sRNAs and putative mRNAs was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Parallel analysis of RNA ends of viroid infected plants revealed the widespread cleavage of the target mRNAs in locations other than the vd-sRNA binding site during the viroid infection implying the viroid-infection induced vd-sRNA independent degradation of endogenous mRNAs during viroid infection.
Directory of Open Access Journals (Sweden)
Harold S Bernhardt
2015-11-01
Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.
Yoshikatsu, Yuki; Ishida, Yo-ichi; Sudo, Haruka; Yuasa, Keizo; Tsuji, Akihiko; Nagahama, Masami
2015-08-28
Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. Copyright © 2015 Elsevier Inc. All rights reserved.
Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.
2009-01-01
Structures have been obtained for the complexes tiamulin, homoharringtonine and bruceatin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.8 to 3.2 Å. They show that these inhibitors all block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl transferase center, which is universally conserved. In addition these structures support the hypothesis that the species-specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (E. coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms. PMID:19362093
Functional interactions within 23S rRNA involving the peptidyltransferase center
DEFF Research Database (Denmark)
Douthwaite, S
1992-01-01
resistance than either mutation alone. 23S rRNAs containing mutations at position 2058 that confer clindamycin and erythromycin resistance become deleterious to cell growth when combined with the 2032A mutation and, additionally, confer hypersensitivity to erythromycin and sensitivity to clindamycin...
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
DEFF Research Database (Denmark)
Grankowski, N; Gasior, E; Issinger, O G
1993-01-01
Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...
Directory of Open Access Journals (Sweden)
Liang Huo
2018-02-01
Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.
Comparative Mitogenomic Analysis of Species Representing Six Subfamilies in the Family Tenebrionidae
Directory of Open Access Journals (Sweden)
Hong-Li Zhang
2016-05-01
Full Text Available To better understand the architecture and evolution of the mitochondrial genome (mitogenome, mitogenomes of ten specimens representing six subfamilies in Tenebrionidae were selected, and comparative analysis of these mitogenomes was carried out in this study. Ten mitogenomes in this family share a similar gene composition, gene order, nucleotide composition, and codon usage. In addition, our results show that nucleotide bias was strongly influenced by the preference of codon usage for A/T rich codons which significantly correlated with the G + C content of protein coding genes (PCGs. Evolutionary rate analyses reveal that all PCGs have been subjected to a purifying selection, whereas 13 PCGs displayed different evolution rates, among which ATPase subunit 8 (ATP8 showed the highest evolutionary rate. We inferred the secondary structure for all RNA genes of Tenebrio molitor (Te2 and used this as the basis for comparison with the same genes from other Tenebrionidae mitogenomes. Some conserved helices (stems and loops of RNA structures were found in different domains of ribosomal RNAs (rRNAs and the cloverleaf structure of transfer RNAs (tRNAs. With regard to the AT-rich region, we analyzed tandem repeat sequences located in this region and identified some essential elements including T stretches, the consensus motif at the flanking regions of T stretch, and the secondary structure formed by the motif at the 3′ end of T stretch in major strand, which are highly conserved in these species. Furthermore, phylogenetic analyses using mitogenomic data strongly support the relationships among six subfamilies: ((Tenebrionidae incertae sedis + (Diaperinae + Tenebrioninae + (Pimeliinae + Lagriinae, which is consistent with phylogenetic results based on morphological traits.
Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O
1995-01-01
Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.
Freyhult, Eva; Edvardsson, Sverker; Tamas, Ivica; Moulton, Vincent; Poole, Anthony M
2008-07-21
The H/ACA family of small nucleolar RNAs (snoRNAs) plays a central role in guiding the pseudouridylation of ribosomal RNA (rRNA). In an effort to systematically identify the complete set of rRNA-modifying H/ACA snoRNAs from the genome sequence of the budding yeast, Saccharomyces cerevisiae, we developed a program - Fisher - and previously presented several candidate snoRNAs based on our analysis 1. In this report, we provide a brief update of this work, which was aborted after the publication of experimentally-identified snoRNAs 2 identical to candidates we had identified bioinformatically using Fisher. Our motivation for revisiting this work is to report on the status of the candidate snoRNAs described in 1, and secondly, to report that a modified version of Fisher together with the available multiple yeast genome sequences was able to correctly identify several H/ACA snoRNAs for modification sites not identified by the snoGPS program 3. While we are no longer developing Fisher, we briefly consider the merits of the Fisher algorithm relative to snoGPS, which may be of use for workers considering pursuing a similar search strategy for the identification of small RNAs. The modified source code for Fisher is made available as supplementary material. Our results confirm the validity of using minimum free energy (MFE) secondary structure prediction to guide comparative genomic screening for RNA families with few sequence constraints.
Mapping of Mitochondrial RNA-Protein Interactions by Digital RNase Footprinting
Directory of Open Access Journals (Sweden)
Ganqiang Liu
2013-11-01
Full Text Available Human mitochondrial DNA is transcribed as long polycistronic transcripts that encompass each strand of the genome and are processed subsequently into mature mRNAs, tRNAs, and rRNAs, necessitating widespread posttranscriptional regulation. Here, we establish methods for massively parallel sequencing and analyses of RNase-accessible regions of human mitochondrial RNA and thereby identify specific regions within mitochondrial transcripts that are bound by proteins. This approach provides a range of insights into the contribution of RNA-binding proteins to the regulation of mitochondrial gene expression.
The complete mitochondrial genome of the Giant Manta ray, Manta birostris.
Hinojosa-Alvarez, Silvia; Díaz-Jaimes, Pindaro; Marcet-Houben, Marina; Gabaldón, Toni
2015-01-01
The complete mitochondrial genome of the giant manta ray (Manta birostris), consists of 18,075 bp with rich A + T and low G content. Gene organization and length is similar to other species of ray. It comprises of 13 protein-coding genes, 2 rRNAs genes, 23 tRNAs genes and 1 non-coding sequence, and the control region. We identified an AT tandem repeat region, similar to that reported in Mobula japanica.
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tamas Ivica
2008-07-01
Full Text Available Abstract Background The H/ACA family of small nucleolar RNAs (snoRNAs plays a central role in guiding the pseudouridylation of ribosomal RNA (rRNA. In an effort to systematically identify the complete set of rRNA-modifying H/ACA snoRNAs from the genome sequence of the budding yeast, Saccharomyces cerevisiae, we developed a program – Fisher – and previously presented several candidate snoRNAs based on our analysis 1. Findings In this report, we provide a brief update of this work, which was aborted after the publication of experimentally-identified snoRNAs 2 identical to candidates we had identified bioinformatically using Fisher. Our motivation for revisiting this work is to report on the status of the candidate snoRNAs described in 1, and secondly, to report that a modified version of Fisher together with the available multiple yeast genome sequences was able to correctly identify several H/ACA snoRNAs for modification sites not identified by the snoGPS program 3. While we are no longer developing Fisher, we briefly consider the merits of the Fisher algorithm relative to snoGPS, which may be of use for workers considering pursuing a similar search strategy for the identification of small RNAs. The modified source code for Fisher is made available as supplementary material. Conclusion Our results confirm the validity of using minimum free energy (MFE secondary structure prediction to guide comparative genomic screening for RNA families with few sequence constraints.
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1997-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1998-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Differential Stoichiometry among Core Ribosomal Proteins
Directory of Open Access Journals (Sweden)
Nikolai Slavov
2015-11-01
Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.
Directory of Open Access Journals (Sweden)
Mahmoud ElHefnawi
Full Text Available RNA interference (RNAi is a post-transcriptional gene silencing mechanism that mediates the sequence-specific degradation of targeted RNA and thus provides a tremendous opportunity for development of oligonucleotide-based drugs. Here, we report on the design and validation of small interfering RNAs (siRNAs targeting highly conserved regions of the hepatitis C virus (HCV genome. To aim for therapeutic applications by optimizing the RNAi efficacy and reducing potential side effects, we considered different factors such as target RNA variations, thermodynamics and accessibility of the siRNA and target RNA, and off-target effects. This aim was achieved using an in silico design and selection protocol complemented by an automated MysiRNA-Designer pipeline. The protocol included the design and filtration of siRNAs targeting highly conserved and accessible regions within the HCV internal ribosome entry site, and adjacent core sequences of the viral genome with high-ranking efficacy scores. Off-target analysis excluded siRNAs with potential binding to human mRNAs. Under this strict selection process, two siRNAs (HCV353 and HCV258 were selected based on their predicted high specificity and potency. These siRNAs were tested for antiviral efficacy in HCV genotype 1 and 2 replicon cell lines. Both in silico-designed siRNAs efficiently inhibited HCV RNA replication, even at low concentrations and for short exposure times (24h; they also exceeded the antiviral potencies of reference siRNAs targeting HCV. Furthermore, HCV353 and HCV258 siRNAs also inhibited replication of patient-derived HCV genotype 4 isolates in infected Huh-7 cells. Prolonged treatment of HCV replicon cells with HCV353 did not result in the appearance of escape mutant viruses. Taken together, these results reveal the accuracy and strength of our integrated siRNA design and selection protocols. These protocols could be used to design highly potent and specific RNAi-based therapeutic
Control of ribosome formation in rat heart
International Nuclear Information System (INIS)
Russo, L.A.
1987-01-01
Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation
DEFF Research Database (Denmark)
Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka
2012-01-01
additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad
2013-01-01
Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461
Ribosomal history reveals origins of modern protein synthesis.
Directory of Open Access Journals (Sweden)
Ajith Harish
Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.
Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs
DEFF Research Database (Denmark)
Khan, Aly A; Betel, Doron; Miller, Martin L
2009-01-01
Transfection of small RNAs (such as small interfering RNAs (siRNAs) and microRNAs (miRNAs)) into cells typically lowers expression of many genes. Unexpectedly, increased expression of genes also occurs. We investigated whether this upregulation results from a saturation effect--that is, competiti...
Post-transcriptional regulation of ribosome biogenesis in yeast
Directory of Open Access Journals (Sweden)
Isabelle C. Kos-Braun
2017-05-01
Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.
Ribosomal Antibiotics: Contemporary Challenges
Directory of Open Access Journals (Sweden)
Tamar Auerbach-Nevo
2016-06-01
Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.
Noncanonical microRNAs and endogenous siRNAs in lytic infection of murine gammaherpesvirus.
Directory of Open Access Journals (Sweden)
Jing Xia
Full Text Available MicroRNA (miRNA and endogenous small interfering RNA (endo-siRNA are two essential classes of small noncoding RNAs (sncRNAs in eukaryotes. The class of miRNA is diverse and there exist noncanonical miRNAs that bypass the canonical miRNA biogenesis pathway. In order to identify noncanonical miRNAs and endo-siRNAs responding to virus infection and study their potential function, we sequenced small-RNA species from cells lytically infected with murine gammaherpesvirus 68 (MHV68. In addition to three novel canonical miRNAs in mouse, two antisense miRNAs in virus and 25 novel noncanonical miRNAs, including miRNAs derived from transfer RNAs, small nucleolar RNAs and introns, in the host were identified. These noncanonical miRNAs exhibited features distinct from that of canonical miRNAs in lengths of hairpins, base pairings and first nucleotide preference. Many of the novel miRNAs are conserved in mammals. Besides several known murine endo-siRNAs detected by the sequencing profiling, a novel locus in the mouse genome was identified to produce endo-siRNAs. This novel endo-siRNA locus is comprised of two tandem inverted B4 short interspersed nuclear elements (SINEs. Unexpectedly, the SINE-derived endo-siRNAs were found in a variety of sequencing data and virus-infected cells. Moreover, a murine miRNA was up-regulated more than 35 fold in infected than in mock-treated cells. The putative targets of the viral and the up-regulated murine miRNAs were potentially involved in processes of gene transcription and protein phosphorylation, and localized to membranes, suggesting their potential role in manipulating the host basal immune system during lytic infection. Our results extended the number of noncanonical miRNAs in mammals and shed new light on their potential functions of lytic infection of MHV68.
Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes
International Nuclear Information System (INIS)
Singh, H.; Bishop, J.
1984-01-01
It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)
Hu, Weiming; Wu, Junwu; Jiang, Wenjing; Tang, Jianguo
2018-02-01
Presbycusis (age-related hearing loss) is the most universal sensory degenerative disease in elderly people caused by the degeneration of cochlear cells. Non-coding microRNAs (miRNAs) play a fundamental role in gene regulation in almost every multicellular organism, and control the aging processes. It has been identified that various miRNAs are up- or down-regulated during mammalian aging processes in tissue-specific manners. Most miRNAs bind to specific sites on their target messenger-RNAs (mRNAs) and decrease their expression. Germline mutation may lead to dysregulation of potential miRNAs expression, causing progressive hair cell degeneration and age-related hearing loss. Therapeutic innovations could emerge from a better understanding of diverse function of miRNAs in presbycusis. This review summarizes the relationship between miRNAs and presbycusis, and presents novel miRNAs-targeted strategies against presbycusis.
MicroRNAs from the parasitic plant Cuscuta campestris target host messenger RNAs.
Shahid, Saima; Kim, Gunjune; Johnson, Nathan R; Wafula, Eric; Wang, Feng; Coruh, Ceyda; Bernal-Galeano, Vivian; Phifer, Tamia; dePamphilis, Claude W; Westwood, James H; Axtell, Michael J
2018-01-03
Dodders (Cuscuta spp.) are obligate parasitic plants that obtain water and nutrients from the stems of host plants via specialized feeding structures called haustoria. Dodder haustoria facilitate bidirectional movement of viruses, proteins and mRNAs between host and parasite, but the functional effects of these movements are not known. Here we show that Cuscuta campestris haustoria accumulate high levels of many novel microRNAs (miRNAs) while parasitizing Arabidopsis thaliana. Many of these miRNAs are 22 nucleotides in length. Plant miRNAs of this length are uncommon, and are associated with amplification of target silencing through secondary short interfering RNA (siRNA) production. Several A. thaliana mRNAs are targeted by 22-nucleotide C. campestris miRNAs during parasitism, resulting in mRNA cleavage, secondary siRNA production, and decreased mRNA accumulation. Hosts with mutations in two of the loci that encode target mRNAs supported significantly higher growth of C. campestris. The same miRNAs that are expressed and active when C. campestris parasitizes A. thaliana are also expressed and active when it infects Nicotiana benthamiana. Homologues of target mRNAs from many other plant species also contain the predicted target sites for the induced C. campestris miRNAs. These data show that C. campestris miRNAs act as trans-species regulators of host-gene expression, and suggest that they may act as virulence factors during parasitism.
Emerging RNA-based drugs: siRNAs, microRNAs and derivates.
Pereira, Tiago Campos; Lopes-Cendes, Iscia
2012-09-01
An emerging new category of therapeutic agents based on ribonucleic acid has emerged and shown very promising in vitro, animal and pre-clinical results, known as small interfering RNAs (siRNAs), microRNAs mimics (miRNA mimics) and their derivates. siRNAs are small RNA molecules that promote potent and specific silencing of mutant, exogenous or aberrant genes through a mechanism known as RNA interference. These agents have called special attention to medicine since they have been used to experimentally treat a series of neurological conditions with distinct etiologies such as prion, viral, bacterial, fungal, genetic disorders and others. siRNAs have also been tested in other scenarios such as: control of anxiety, alcohol consumption, drug-receptor blockage and inhibition of pain signaling. Although in a much earlier stage, miRNAs mimics, anti-miRs and small activating RNAs (saRNAs) also promise novel therapeutic approaches to control gene expression. In this review we intend to introduce clinicians and medical researchers to the most recent advances in the world of siRNA- and miRNA-mediated gene control, its history, applications in cells, animals and humans, delivery methods (an yet unsolved hurdle), current status and possible applications in future clinical practice.
DEFF Research Database (Denmark)
Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten
1994-01-01
Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...
Individual microRNAs (miRNAs) display distinct mRNA targeting "rules".
Wang, Wang-Xia; Wilfred, Bernard R; Xie, Kevin; Jennings, Mary H; Hu, Yanling Hu; Stromberg, Arnold J; Nelson, Peter T
2010-01-01
MicroRNAs (miRNAs) guide Argonaute (AGO)-containing microribonucleoprotein (miRNP) complexes to target mRNAs.It has been assumed that miRNAs behave similarly to each other with regard to mRNA target recognition. The usual assumptions, which are based on prior studies, are that miRNAs target preferentially sequences in the 3'UTR of mRNAs,guided by the 5' "seed" portion of the miRNAs. Here we isolated AGO- and miRNA-containing miRNPs from human H4 tumor cells by co-immunoprecipitation (co-IP) with anti-AGO antibody. Cells were transfected with miR-107, miR-124,miR-128, miR-320, or a negative control miRNA. Co-IPed RNAs were subjected to downstream high-density Affymetrix Human Gene 1.0 ST microarray analyses using an assay we validated previously-a "RIP-Chip" experimental design. RIP-Chip data provided a list of mRNAs recruited into the AGO-miRNP in correlation to each miRNA. These experimentally identified miRNA targets were analyzed for complementary six nucleotide "seed" sequences within the transfected miRNAs. We found that miR-124 targets tended to have sequences in the 3'UTR that would be recognized by the 5' seed of miR-124, as described in previous studies. By contrast, miR-107 targets tended to have 'seed' sequences in the mRNA open reading frame, but not the 3' UTR. Further, mRNA targets of miR-128 and miR-320 are less enriched for 6-mer seed sequences in comparison to miR-107 and miR-124. In sum, our data support the importance of the 5' seed in determining binding characteristics for some miRNAs; however, the "binding rules" are complex, and individual miRNAs can have distinct sequence determinants that lead to mRNA targeting.
Vargas-Caro, Carolina; Bustamante, Carlos; Lamilla, Julio; Bennett, Michael B; Ovenden, Jennifer R
2016-07-01
The complete mitochondrial genome of the roughskin skate Dipturus trachyderma is described from 1 455 724 sequences obtained using Illumina NGS technology. Total length of the mitogenome was 16 909 base pairs, comprising 2 rRNAs, 13 protein-coding genes, 22 tRNAs and 2 non-coding regions. Phylogenetic analysis based on mtDNA revealed low genetic divergence among longnose skates, in particular, those dwelling the continental shelf and slope off the coasts of Chile and Argentina.
Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA
Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.
2015-01-01
Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222
Zheng, Ling-Ling; Li, Jun-Hao; Wu, Jie; Sun, Wen-Ju; Liu, Shun; Wang, Ze-Lin; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu
2016-01-04
Small non-coding RNAs (e.g. miRNAs) and long non-coding RNAs (e.g. lincRNAs and circRNAs) are emerging as key regulators of various cellular processes. However, only a very small fraction of these enigmatic RNAs have been well functionally characterized. In this study, we describe deepBase v2.0 (http://biocenter.sysu.edu.cn/deepBase/), an updated platform, to decode evolution, expression patterns and functions of diverse ncRNAs across 19 species. deepBase v2.0 has been updated to provide the most comprehensive collection of ncRNA-derived small RNAs generated from 588 sRNA-Seq datasets. Moreover, we developed a pipeline named lncSeeker to identify 176 680 high-confidence lncRNAs from 14 species. Temporal and spatial expression patterns of various ncRNAs were profiled. We identified approximately 24 280 primate-specific, 5193 rodent-specific lncRNAs, and 55 highly conserved lncRNA orthologs between human and zebrafish. We annotated 14 867 human circRNAs, 1260 of which are orthologous to mouse circRNAs. By combining expression profiles and functional genomic annotations, we developed lncFunction web-server to predict the function of lncRNAs based on protein-lncRNA co-expression networks. This study is expected to provide considerable resources to facilitate future experimental studies and to uncover ncRNA functions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Integrative analysis of circRNAs acting as ceRNAs involved in ethylene pathway in tomato.
Wang, Yunxiang; Wang, Qing; Gao, Lipu; Zhu, Benzhong; Luo, Yunbo; Deng, Zhiping; Zuo, Jinhua
2017-11-01
Circular RNAs (circRNAs) are a large class of non-coding endogenous RNAs that could act as competing endogenous RNAs (ceRNAs) to terminate the mRNA targets' suppression of miRNAs. To elucidate the intricate regulatory roles of circRNAs in the ethylene pathway in tomato fruit, deep sequencing and bioinformatics methods were performed. After strict screening, a total of 318 circRNAs were identified. Among these circRNAs, 282 were significantly differentially expressed among wild-type and sense-/antisense-LeERF1 transgenic tomato fruits. Besides, 1254 target genes were identified and a large amount of them were found to be involved in ethylene pathway. In addition, a sophisticated regulatory model consisting of circRNAs, target genes and ethylene was set up. Importantly, 61 circRNAs were found to be potential ceRNAs to combine with miRNAs and some of the miRNAs had been revealed to participate in the ethylene signaling pathway. This research further raised the possibility that the ethylene pathway in tomato fruit may be under the regulation of various circRNAs and provided a new perspective of the roles of circRNAs. © 2017 Scandinavian Plant Physiology Society.
Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants
Khraiwesh, Basel
2012-02-01
Small, non-coding RNAs are a distinct class of regulatory RNAs in plants and animals that control a variety of biological processes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved through a series of pathways. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs control the expression of cognate target genes by binding to reverse complementary sequences, resulting in cleavage or translational inhibition of the target RNAs. siRNAs have a similar structure, function, and biogenesis as miRNAs but are derived from long double-stranded RNAs and can often direct DNA methylation at target sequences. Besides their roles in growth and development and maintenance of genome integrity, small RNAs are also important components in plant stress responses. One way in which plants respond to environmental stress is by modifying their gene expression through the activity of small RNAs. Thus, understanding how small RNAs regulate gene expression will enable researchers to explore the role of small RNAs in biotic and abiotic stress responses. This review focuses on the regulatory roles of plant small RNAs in the adaptive response to stresses. This article is part of a Special Issue entitled: Plant gene regulation in response to abiotic stress. © 2011 Elsevier B.V.
An approach to analyse the specific impact of rapamycin on mRNA-ribosome association
Directory of Open Access Journals (Sweden)
Jaquier-Gubler Pascale
2008-08-01
Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
Emerging functions of ribosomal proteins in gene-specific transcription and translation
International Nuclear Information System (INIS)
Lindstroem, Mikael S.
2009-01-01
Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.
Directory of Open Access Journals (Sweden)
Mikhail M. Pooggin
2018-04-01
Full Text Available Viruses have compact genomes and usually translate more than one protein from polycistronic RNAs using leaky scanning, frameshifting, stop codon suppression or reinitiation mechanisms. Viral (pre-genomic RNAs often contain long 5′-leader sequences with short upstream open reading frames (uORFs and secondary structure elements, which control both translation initiation and replication. In plants, viral RNA and DNA are targeted by RNA interference (RNAi generating small RNAs that silence viral gene expression, while viral proteins are recognized by innate immunity and autophagy that restrict viral infection. In this review we focus on plant pararetroviruses of the family Caulimoviridae and describe the mechanisms of uORF- and secondary structure-driven ribosome shunting, leaky scanning and reinitiation after translation of short and long uORFs. We discuss conservation of these mechanisms in different genera of Caulimoviridae, including host genome-integrated endogenous viral elements, as well as in other viral families, and highlight a multipurpose use of the highly-structured leader sequence of plant pararetroviruses in regulation of translation, splicing, packaging, and reverse transcription of pregenomic RNA (pgRNA, and in evasion of RNAi. Furthermore, we illustrate how targeting of several host factors by a pararetroviral effector protein can lead to transactivation of viral polycistronic translation and concomitant suppression of antiviral defenses. Thus, activation of the plant protein kinase target of rapamycin (TOR by the Cauliflower mosaic virus transactivator/viroplasmin (TAV promotes reinitiation of translation after long ORFs on viral pgRNA and blocks antiviral autophagy and innate immunity responses, while interaction of TAV with the plant RNAi machinery interferes with antiviral silencing.
Directory of Open Access Journals (Sweden)
Anne Dallas
2013-01-01
Full Text Available We previously identified short synthetic shRNAs (sshRNAs that target a conserved hepatitis C virus (HCV sequence within the internal ribosome entry site (IRES of HCV and potently inhibit HCV IRES-linked gene expression. To assess in vivo liver delivery and activity, the HCV-directed sshRNA, SG220 was formulated into lipid nanoparticles (LNP and injected i.v. into mice whose livers supported stable HCV IRES-luciferase expression from a liver-specific promoter. After a single injection, RNase protection assays for the sshRNA and 3H labeling of a lipid component of the nanoparticles showed efficient liver uptake of both components and long-lasting survival of a significant fraction of the sshRNA in the liver. In vivo imaging showed a dose-dependent inhibition of luciferase expression (>90% 1 day after injection of 2.5 mg/kg sshRNA with t1/2 for recovery of about 3 weeks. These results demonstrate the ability of moderate levels of i.v.-injected, LNP-formulated sshRNAs to be taken up by liver hepatocytes at a level sufficient to substantially suppress gene expression. Suppression is rapid and durable, suggesting that sshRNAs may have promise as therapeutic agents for liver indications.
Network of microRNAs-mRNAs Interactions in Pancreatic Cancer
Naderi, Elnaz; Mostafaei, Mehdi; Pourshams, Akram
2014-01-01
Background. MicroRNAs are small RNA molecules that regulate the expression of certain genes through interaction with mRNA targets and are mainly involved in human cancer. This study was conducted to make the network of miRNAs-mRNAs interactions in pancreatic cancer as the fourth leading cause of cancer death. Methods. 56 miRNAs that were exclusively expressed and 1176 genes that were downregulated or silenced in pancreas cancer were extracted from beforehand investigations. MiRNA–mRNA interactions data analysis and related networks were explored using MAGIA tool and Cytoscape 3 software. Functional annotations of candidate genes in pancreatic cancer were identified by DAVID annotation tool. Results. This network is made of 217 nodes for mRNA, 15 nodes for miRNA, and 241 edges that show 241 regulations between 15 miRNAs and 217 target genes. The miR-24 was the most significantly powerful miRNA that regulated series of important genes. ACVR2B, GFRA1, and MTHFR were significant target genes were that downregulated. Conclusion. Although the collected previous data seems to be a treasure trove, there was no study simultaneous to analysis of miRNAs and mRNAs interaction. Network of miRNA-mRNA interactions will help to corroborate experimental remarks and could be used to refine miRNA target predictions for developing new therapeutic approaches. PMID:24895587
Network of microRNAs-mRNAs Interactions in Pancreatic Cancer
Directory of Open Access Journals (Sweden)
Elnaz Naderi
2014-01-01
Full Text Available Background. MicroRNAs are small RNA molecules that regulate the expression of certain genes through interaction with mRNA targets and are mainly involved in human cancer. This study was conducted to make the network of miRNAs-mRNAs interactions in pancreatic cancer as the fourth leading cause of cancer death. Methods. 56 miRNAs that were exclusively expressed and 1176 genes that were downregulated or silenced in pancreas cancer were extracted from beforehand investigations. MiRNA–mRNA interactions data analysis and related networks were explored using MAGIA tool and Cytoscape 3 software. Functional annotations of candidate genes in pancreatic cancer were identified by DAVID annotation tool. Results. This network is made of 217 nodes for mRNA, 15 nodes for miRNA, and 241 edges that show 241 regulations between 15 miRNAs and 217 target genes. The miR-24 was the most significantly powerful miRNA that regulated series of important genes. ACVR2B, GFRA1, and MTHFR were significant target genes were that downregulated. Conclusion. Although the collected previous data seems to be a treasure trove, there was no study simultaneous to analysis of miRNAs and mRNAs interaction. Network of miRNA-mRNA interactions will help to corroborate experimental remarks and could be used to refine miRNA target predictions for developing new therapeutic approaches.
Directory of Open Access Journals (Sweden)
Cuihua Gu
2018-02-01
Full Text Available Qat (Catha edulis, Celastraceae is a woody evergreen species with great economic and cultural importance. It is cultivated for its stimulant alkaloids cathine and cathinone in East Africa and southwest Arabia. However, genome information, especially DNA sequence resources, for C. edulis are limited, hindering studies regarding interspecific and intraspecific relationships. Herein, the complete chloroplast (cp genome of Catha edulis is reported. This genome is 157,960 bp in length with 37% GC content and is structurally arranged into two 26,577 bp inverted repeats and two single-copy areas. The size of the small single-copy and the large single-copy regions were 18,491 bp and 86,315 bp, respectively. The C. edulis cp genome consists of 129 coding genes including 37 transfer RNA (tRNA genes, 8 ribosomal RNA (rRNA genes, and 84 protein coding genes. For those genes, 112 are single copy genes and 17 genes are duplicated in two inverted regions with seven tRNAs, four rRNAs, and six protein coding genes. The phylogenetic relationships resolved from the cp genome of qat and 32 other species confirms the monophyly of Celastraceae. The cp genomes of C. edulis, Euonymus japonicus and seven Celastraceae species lack the rps16 intron, which indicates an intron loss took place among an ancestor of this family. The cp genome of C. edulis provides a highly valuable genetic resource for further phylogenomic research, barcoding and cp transformation in Celastraceae.
Tembrock, Luke R.; Zheng, Shaoyu; Wu, Zhiqiang
2018-01-01
Qat (Catha edulis, Celastraceae) is a woody evergreen species with great economic and cultural importance. It is cultivated for its stimulant alkaloids cathine and cathinone in East Africa and southwest Arabia. However, genome information, especially DNA sequence resources, for C. edulis are limited, hindering studies regarding interspecific and intraspecific relationships. Herein, the complete chloroplast (cp) genome of Catha edulis is reported. This genome is 157,960 bp in length with 37% GC content and is structurally arranged into two 26,577 bp inverted repeats and two single-copy areas. The size of the small single-copy and the large single-copy regions were 18,491 bp and 86,315 bp, respectively. The C. edulis cp genome consists of 129 coding genes including 37 transfer RNA (tRNA) genes, 8 ribosomal RNA (rRNA) genes, and 84 protein coding genes. For those genes, 112 are single copy genes and 17 genes are duplicated in two inverted regions with seven tRNAs, four rRNAs, and six protein coding genes. The phylogenetic relationships resolved from the cp genome of qat and 32 other species confirms the monophyly of Celastraceae. The cp genomes of C. edulis, Euonymus japonicus and seven Celastraceae species lack the rps16 intron, which indicates an intron loss took place among an ancestor of this family. The cp genome of C. edulis provides a highly valuable genetic resource for further phylogenomic research, barcoding and cp transformation in Celastraceae. PMID:29425128
A method for rapid similarity analysis of RNA secondary structures
Directory of Open Access Journals (Sweden)
Liu Na
2006-11-01
Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
Identification and characterization of microRNAs and endogenous siRNAs in Schistosoma japonicum
Directory of Open Access Journals (Sweden)
Wang Heng
2010-01-01
Full Text Available Abstract Background Small endogenous non-coding RNAs (sncRNAs such as small interfering RNA (siRNA, microRNA and other small RNA transcripts are derived from distinct loci in the genome and play critical roles in RNA-mediated gene silencing mechanisms in plants and metazoa. They are approximately 22 nucleotides long; regulate mRNA stability through perfect or imperfect match to the targets. The biological activities of sncRNAs have been related to many biological events, from resistance to microbe infections to cellular differentiation. The development of the zoonotic parasite Schistosoma japonicum parasite includes multiple steps of morphological alterations and biological differentiations, which provide a unique model for studies on the functions of small RNAs. Characterization of the genome-wide transcription of the sncRNAs will be a major step in understanding of the parasite biology. The objective of this study is to investigate the transcriptional profile and potential function of the small non-coding RNAs in the development of S. japanicum. Results The endogenous siRNAs were found mainly derived from transposable elements (TE or transposons and the natural antisense transcripts (NAT. In contrast to other organisms, the TE-derived siRNAs in S. japonicum were more predominant than other sncRNAs including microRNAs (miRNAs. Further, there were distinct length and 3'end variations in the sncRNAs, which were associated with the developmental differentiation of the parasite. Among the identified miRNA transcripts, there were 38 unique to S. japonicum and 16 that belonged to 13 miRNA families are common to other metazoan lineages. These miRNAs were either ubiquitously expressed, or they exhibited specific expression patterns related to the developmental stages or sex. Genes that encoded miRNAs are mainly located in clusters within the genome of S. japonicum. However, genes within one cluster could be differentially transcribed, which suggested
Directory of Open Access Journals (Sweden)
Yuan NJ
2017-12-01
Full Text Available Naijun Yuan,1,* Guijuan Zhang,2,* Fengjie Bie,1 Min Ma,1 Yi Ma,3 Xuefeng Jiang,1 Yurong Wang,1,* Xiaoqian Hao1 1College of Traditional Chinese Medicine of Jinan University, Institute of Integrated Traditional Chinese and Western Medicine of Jinan University, 2The First Affiliated Hospital of Jinan University, 3Department of Cellular Biology, Guangdong Province Key Lab of Bioengineering Medicine, Institute of Biomedicine, Jinan University, Guangdong, China *These authors contributed equally to this work Abstract: Triple negative breast cancer (TNBC is a particular subtype of breast malignant tumor with poorer prognosis than other molecular subtypes. Currently, there is increasing focus on long non-coding RNAs (lncRNAs, which can act as competing endogenous RNAs (ceRNAs and suppress miRNA functions involved in post-transcriptional regulatory networks in the tumor. Therefore, to investigate specific mechanisms of TNBC carcinogenesis and improve treatment efficiency, we comprehensively integrated expression profiles, including data on mRNAs, lncRNAs and miRNAs obtained from 116 TNBC tissues and 11 normal tissues from The Cancer Genome Atlas. As a result, we selected the threshold with |log2FC|>2.0 and an adjusted p-value >0.05 to obtain the differentially expressed mRNAs, miRNAs and lncRNAs. Hereafter, weighted gene co-expression network analysis was performed to identify the expression characteristics of dysregulated genes. We obtained five co-expression modules and related clinical feature. By means of correlating gene modules with protein–protein interaction network analysis that had identified 22 hub mRNAs which could as hub target genes. Eleven key dysregulated differentially expressed micro RNAs (DEmiRNAs were identified that were significantly associated with the 22 hub potential target genes. Moreover, we found that 14 key differentially expressed lncRNAs could interact with the key DEmiRNAs. Then, the ceRNA crosstalk network of TNBC was
Highly Complementary Target RNAs Promote Release of Guide RNAs from Human Argonaute2
De, Nabanita; Young, Lisa; Lau, Pick-Wei; Meisner, Nicole-Claudia; Morrissey, David V.; MacRae, Ian J.
2013-01-01
SUMMARY Argonaute proteins use small RNAs to guide the silencing of complementary target RNAs in many eukaryotes. Although small RNA biogenesis pathways are well studied, mechanisms for removal of guide RNAs from Argonaute are poorly understood. Here we show that the Argonaute2 (Ago2) guide RNA complex is extremely stable, with a half-life on the order of days. However, highly complementary target RNAs destabilize the complex and significantly accelerate release of the guide RNA from Ago2. This “unloading” activity can be enhanced by mismatches between the target and the guide 5′ end and attenuated by mismatches to the guide 3′ end. The introduction of 3′ mismatches leads to more potent silencing of abundant mRNAs in mammalian cells. These findings help to explain why the 3′ ends of mammalian microRNAs (miRNAs) rarely match their targets, suggest a mechanism for sequence-specific small RNA turnover, and offer insights for controlling small RNAs in mammalian cells. PMID:23664376
Sun, Shao'e; Hui, Ming; Wang, Minxiao; Sha, Zhongli
2018-03-01
Deep-sea hydrothermal vent is one of the most extreme environments on Earth with low oxygen and high levels of toxins. Decapod species from the family Alvinocarididae have colonized and successfully adapted to this extremely harsh environment. Mitochondria plays a vital role in oxygen usage and energy metabolism, thus it may be under selection in the adaptive evolution of the hydrothermal vent shrimps. In this study, the mitochondrial genome (mitogenome) of alvinocaridid shrimp Shinkaicaris leurokolos (Kikuchi & Hashimoto, 2000) was determined through Illumina sequencing. The mitogenome of S. leurokolos was 15,903bp in length, containing 13 protein-coding genes, 2 rRNAs, and 22 tRNAs. The gene order and orientation were identical to those of sequenced alvinocaridids. It has the longest concatenated sequences of protein-coding genes, tRNAs and shortest pooled rRNAs among the alvinocaridids. The control regions (CRs) of alvinocaridid were significantly longer (penergy metabolism to adapt to the hydrothermal environment. Phylogenetic analysis supported that the deep-sea hydrothermal vent shrimps may have originated from those living in shallow area. Positive selection analysis reveals the evidence of adaptive change in the mitogenome of Alvinocarididae. Thirty potentially important adaptive residues were identified, which were located in atp6, cox1, cox3, cytb and nad1-5. This study explores the mitochondrial genetic basis of hydrothermal vent adaptation in alvinocaridid for the first time, and provides valuable clues regarding the adaptation. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Jiajia; Li, Hu; Dai, Renhuai
2017-12-01
Here, we describe the first complete mitochondrial genome (mitogenome) sequence of the leafhopper Taharana fasciana (Coelidiinae). The mitogenome sequence contains 15,161 bp with an A + T content of 77.9%. It includes 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one non-coding (A + T-rich) region; in addition, a repeat region is also present (GenBank accession no. KY886913). These genes/regions are in the same order as in the inferred insect ancestral mitogenome. All protein-coding genes have ATN as the start codon, and TAA or single T as the stop codons, except the gene ND3, which ends with TAG. Furthermore, we predicted the secondary structures of the rRNAs in T. fasciana. Six domains (domain III is absent in arthropods) and 41 helices were predicted for 16S rRNA, and 12S rRNA comprised three structural domains and 24 helices. Phylogenetic tree analysis confirmed that T. fasciana and other members of the Cicadellidae are clustered into a clade, and it identified the relationships among the subfamilies Deltocephalinae, Coelidiinae, Idiocerinae, Cicadellinae, and Typhlocybinae.
DEFF Research Database (Denmark)
Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien
2011-01-01
Escherichia coli possesses three paralogues. These comprise the methyltransferases TrmA that targets U54 in tRNAs, RlmC that modifies U747 in 23S rRNA and RlmD that is specific for U1939 in 23S rRNA. The tRNAs and rRNAs of the Gram-positive bacterium Bacillus subtilis have the same three m(5)U modifications....... However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...
Directory of Open Access Journals (Sweden)
Ian M Willis
2008-07-01
Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.
Micro RNAs in animal development.
Plasterk, R.H.A.
2006-01-01
Micro RNAs (miRNAs) are approximately 22 nucleotide single-stranded noncoding RNA molecules that bind to target messenger RNAs (mRNAs) and silence their expression. This Essay explores the importance of miRNAs in animal development and their possible roles in disease and evolution.
Long noncoding RNAs(lncRNAs) and the molecular hallmarks of aging.
Grammatikakis, Ioannis; Panda, Amaresh C; Abdelmohsen, Kotb; Gorospe, Myriam
2014-12-01
During aging, progressive deleterious changes increase the risk of disease and death. Prominent molecular hallmarks of aging are genomic instability, telomere attrition, epigenetic alterations, loss of proteostasis, cellular senescence, stem cell exhaustion, and altered intercellular communication. Long noncoding RNAs (lncRNAs) play important roles in a wide range of biological processes, including age-related diseases like cancer, cardiovascular pathologies, and neurodegenerative disorders. Evidence is emerging that lncRNAs influence the molecular processes that underlie age-associated phenotypes. Here, we review our current understanding of lncRNAs that control the development of aging traits.
Energy Technology Data Exchange (ETDEWEB)
Sameshima, M; Ito, K; Iwabuchi, M
1972-01-01
In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.
Progress and Prospects of Long Noncoding RNAs (lncRNAs in Hepatocellular Carcinoma
Directory of Open Access Journals (Sweden)
Chen Li
2015-05-01
Full Text Available Hepatocellular carcinoma (HCC is one of the most frequently occurring cancers with poor prognosis, and novel diagnostic or prognostic biomarkers and therapeutic targets for HCC are urgently required. With the advance of high-resolution microarrays and massively parallel sequencing technology, lncRNAs are suggested to play critical roles in the tumorigenesis and development of human HCC. To date, dysregulation of many HCC-related lncRNAs such as HULC, HOTAIR, MALAT1, and H19 have been identified. From transcriptional “noise” to indispensable elements, lncRNAs may re-write the central dogma. Also, lncRNAs found in body fluids have demonstrated their utility as fluid-based noninvasive markers for clinical use and as therapeutic targets for HCC. Even though several lncRNAs have been characterized, the underlying mechanisms of their contribution to HCC remain unknown, and many important questions about lncRNAs need resolving. A better understanding of the molecular mechanism in HCC-related lncRNAs will provide a rationale for novel effective lncRNA-based targeted therapies. In this review, we highlight the emerging roles of lncRNAs in HCC, and discuss their potential clinical applications as biomarkers for the diagnosis, prognosis, monitoring and treatment of HCC.
Molecular markers of oocyte differentiation in European eel during hormonally induced oogenesis.
Rojo-Bartolomé, Iratxe; Martínez-Miguel, Leticia; Lafont, Anne-Gaëlle; Vílchez, M Carmen; Asturiano, Juan F; Pérez, Luz; Cancio, Ibon
2017-09-01
Reproduction in captivity is a key study issue in Anguilla anguilla as a possible solution for its dwindling population. Understanding the mechanisms controlling the production of ribosomal building blocks during artificially induced oocyte maturation could be particularly interesting. Transcription levels of ribosomal biogenesis associated genes could be used as markers to monitor oogenesis. Eels from the Albufera Lagoon were injected with carp pituitary extract for 15weeks and ovaries in previtellogenic (PV) stage (non-injected), in early-, mid-, late-vitellogenesis (EV, MV, LV), as well as in migratory nucleus stage (MN) were analysed. 5S rRNA and related genes were highly transcribed in ovaries with PV oocytes. As oocytes developed, transcriptional levels of genes related to 5S rRNA production (gtf3a), accumulation (gtf3a, 42sp43) and nucleocytoplasmic transport (rpl5, rpl11) and the 5S/18S rRNA index decreased (PV>EV>MV>LV>MN). On the contrary, 18S rRNA was at its highest at MN stage while ubtf1 in charge of activating RNA-polymerase I and synthesising 18S rRNA behaved as 5S related genes. Individuals that did not respond (NR) to the treatment showed 5S/18S index values similar to PV females, while studied genes showed EV/LV-like transcription levels. Therefore, NR females fail to express the largest rRNAs, which could thus be taken as markers of successful vitellogenesis progression. In conclusion, we have proved that the transcriptional dynamics of ribosomal genes provides useful tools to characterize induced ovarian development in European eels. In the future, such markers should be studied as putative indicators of response to hormonal treatments and of the quality of obtained eel oocytes. Copyright © 2017. Published by Elsevier Inc.
Utility of MicroRNAs and siRNAs in Cervical Carcinogenesis
Directory of Open Access Journals (Sweden)
Sacnite del Mar Díaz-González
2015-01-01
Full Text Available MicroRNAs and siRNAs belong to a family of small noncoding RNAs which bind through partial sequence complementarity to 3′-UTR regions of mRNA from target genes, resulting in the regulation of gene expression. MicroRNAs have become an attractive target for genetic and pharmacological modulation due to the critical function of their target proteins in several signaling pathways, and their expression profiles have been found to be altered in various cancers. A promising technology platform for selective silencing of cell and/or viral gene expression using siRNAs is currently in development. Cervical cancer is the most common cancer in women in the developing world and sexually transmitted infection with HPV is the cause of this malignancy. Therefore, a cascade of abnormal events is induced during cervical carcinogenesis, including the induction of genomic instability, reprogramming of cellular metabolic pathways, deregulation of cell proliferation, inhibition of apoptotic mechanisms, disruption of cell cycle control mechanisms, and alteration of gene expression. Thus, in the present review article, we highlight new research on microRNA expression profiles which may be utilized as biomarkers for cervical cancer. Furthermore, we discuss selective silencing of HPV E6 and E7 with siRNAs which represents a potential gene therapy strategy against cervical cancer.
Directory of Open Access Journals (Sweden)
Milijana Mirkovic-Hösle
Full Text Available Transposable elements are a serious threat for genome integrity and their control via small RNA mediated silencing pathways is an ancient strategy. The fruit fly Drosophila melanogaster has two silencing activities that target transposons: endogenous siRNAs (esiRNAs or endo-siRNAs and Piwi-interacting small RNAs (piRNAs. The biogenesis of endo-siRNAs involves the Dicer-2 co-factors Loqs-PD, which acts predominantly during processing of dsRNA by Dcr-2, and R2D2, which primarily helps to direct siRNAs into the RNA interference effector Ago2. Nonetheless, loss of either protein is not sufficient to produce a phenotype comparable with a dcr-2 mutation. We provide further deep sequencing evidence supporting the notion that R2D2 and Loqs-PD have partially overlapping function. Certain transposons display a preference for either dsRBD-protein during production or loading; this appeared to correlate neither with overall abundance, classification of the transposon or a specific site of genomic origin. The endo-siRNA biogenesis pathway in germline operates according to the same principles as the existing model for the soma, and its impairment does not significantly affect piRNAs. Expanding the analysis, we confirmed the occurrence of somatic piRNA-like RNAs (pilRNAs that show a ping-pong signature. We detected expression of the Piwi-family protein mRNAs only barely above background, indicating that the somatic pilRNAs may arise from a small sub-population of somatic cells that express a functional piRNA pathway.
International Nuclear Information System (INIS)
Petri, Rebecca; Malmevik, Josephine; Fasching, Liana; Åkerblom, Malin; Jakobsson, Johan
2014-01-01
MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the post-transcriptional level. In the brain, a large number of miRNAs are expressed and there is a growing body of evidence demonstrating that miRNAs are essential for brain development and neuronal function. Conditional knockout studies of the core components in the miRNA biogenesis pathway, such as Dicer and DGCR8, have demonstrated a crucial role for miRNAs during the development of the central nervous system. Furthermore, mice deleted for specific miRNAs and miRNA-clusters demonstrate diverse functional roles for different miRNAs during the development of different brain structures. miRNAs have been proposed to regulate cellular functions such as differentiation, proliferation and fate-determination of neural progenitors. In this review we summarise the findings from recent studies that highlight the importance of miRNAs in brain development with a focus on the mouse model. We also discuss the technical limitations of current miRNA studies that still limit our understanding of this family of non-coding RNAs and propose the use of novel and refined technologies that are needed in order to fully determine the impact of specific miRNAs in brain development. - Highlights: • miRNAs are essential for brain development and neuronal function. • KO of Dicer is embryonically lethal. • Conditional Dicer KO results in defective proliferation or increased apoptosis. • KO of individual miRNAs or miRNA families is necessary to determine function
The Phosphorylation of Ribosomal Protein in Lemna minor
Trewavas, A.
1973-01-01
Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405
Circular RNAs and systemic lupus erythematosus
Energy Technology Data Exchange (ETDEWEB)
Li, Lian-Ju; Huang, Qing; Pan, Hai-Feng; Ye, Dong-Qing, E-mail: ydqahmu@gmail.com
2016-08-15
Circular RNAs (circRNAs) are a large class of noncoding RNAs that form covalently closed RNA circles. The discovery of circRNAs discloses a new layer of gene regulation occurred post-transcriptionally. Identification of endogenous circRNAs benefits from the advance in high-throughput RNA sequencing and remains challenging. Many studies probing into the mechanisms of circRNAs formation occurred cotranscriptionally or posttranscriptionally emerge and conclude that canonical splicing mechanism, sequence properties, and certain regulatory factors are at play in the process. Although our knowledge on functions of circRNAs is rather limited, a few circRNAs are shown to sponge miRNA and regulate gene transcription. The clearest case is one circRNA CDR1as that serves as sponge of miR-7. Researches on circRNAs in human diseases such as cancers highlight the function and physical relevance of circRNAs. Given the implication of miRNAs in the initiation and progression of systemic lupus erythematosus (SLE) and the roles of circRNAs in sponging miRNA and gene regulation, it is appealing to speculate that circRNAs may associate with SLE and may be potential therapeutic targets for treatment of SLE. Future studies should attach more importance to the relationship between circRNAs and SLE. This review will concern identification, biogenesis, and function of circRNAs, introduce reports exploring the association of circRNAs with human diseases, and conjecture the potential roles of circRNAs in SLE. - Highlights: • Studies have discovered thousands of circRNAs and interpreted their biogenesis. • Cytoplasmic circRNAs sponge miRNA and nuclear circRNAs modulate gene transcription. • Aberrant expression of circRNAs has been observed in various cancers. • CircRNAs may partake in the pathogenesis of systemic lupus erythematosus.
Circular RNAs and systemic lupus erythematosus
International Nuclear Information System (INIS)
Li, Lian-Ju; Huang, Qing; Pan, Hai-Feng; Ye, Dong-Qing
2016-01-01
Circular RNAs (circRNAs) are a large class of noncoding RNAs that form covalently closed RNA circles. The discovery of circRNAs discloses a new layer of gene regulation occurred post-transcriptionally. Identification of endogenous circRNAs benefits from the advance in high-throughput RNA sequencing and remains challenging. Many studies probing into the mechanisms of circRNAs formation occurred cotranscriptionally or posttranscriptionally emerge and conclude that canonical splicing mechanism, sequence properties, and certain regulatory factors are at play in the process. Although our knowledge on functions of circRNAs is rather limited, a few circRNAs are shown to sponge miRNA and regulate gene transcription. The clearest case is one circRNA CDR1as that serves as sponge of miR-7. Researches on circRNAs in human diseases such as cancers highlight the function and physical relevance of circRNAs. Given the implication of miRNAs in the initiation and progression of systemic lupus erythematosus (SLE) and the roles of circRNAs in sponging miRNA and gene regulation, it is appealing to speculate that circRNAs may associate with SLE and may be potential therapeutic targets for treatment of SLE. Future studies should attach more importance to the relationship between circRNAs and SLE. This review will concern identification, biogenesis, and function of circRNAs, introduce reports exploring the association of circRNAs with human diseases, and conjecture the potential roles of circRNAs in SLE. - Highlights: • Studies have discovered thousands of circRNAs and interpreted their biogenesis. • Cytoplasmic circRNAs sponge miRNA and nuclear circRNAs modulate gene transcription. • Aberrant expression of circRNAs has been observed in various cancers. • CircRNAs may partake in the pathogenesis of systemic lupus erythematosus.
Vella, Monica C; Slack, Frank J
2005-09-21
MicroRNAs (miRNAs) are small, non-coding regulatory RNAs found in many phyla that control such diverse events as development, metabolism, cell fate and cell death. They have also been implicated in human cancers. The C. elegans genome encodes hundreds of miRNAs, including the founding members of the miRNA family lin-4 and let-7. Despite the abundance of C. elegans miRNAs, few miRNA targets are known and little is known about the mechanism by which they function. However, C. elegans research continues to push the boundaries of discovery in this area. lin-4 and let-7 are the best understood miRNAs. They control the timing of adult cell fate determination in hypodermal cells by binding to partially complementary sites in the mRNA of key developmental regulators to repress protein expression. For example, lin-4 is predicted to bind to seven sites in the lin-14 3' untranslated region (UTR) to repress LIN-14, while let-7 is predicted to bind two let-7 complementary sites in the lin-41 3' UTR to down-regulate LIN-41. Two other miRNAs, lsy-6 and mir-273, control left-right asymmetry in neural development, and also target key developmental regulators for repression. Approximately one third of the C. elegans miRNAs are differentially expressed during development indicating a major role for miRNAs in C. elegans development. Given the remarkable conservation of developmental mechanism across phylogeny, many of the principles of miRNAs discovered in C. elegans are likely to be applicable to higher animals.
Directory of Open Access Journals (Sweden)
Brittany Burton
Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.
MicroRNAs, Regulatory Networks, and Comorbidities
DEFF Research Database (Denmark)
Russo, Francesco; Belling, Kirstine; Jensen, Anders Boeck
2017-01-01
MicroRNAs (miRNAs) are small noncoding RNAs involved in the posttranscriptional regulation of messenger RNAs (mRNAs). Each miRNA targets a specific set of mRNAs. Upon binding the miRNA inhibits mRNA translation or facilitate mRNA degradation. miRNAs are frequently deregulated in several pathologies...
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...
On the control of ribosomal protein biosynthesis in Escherichia coli
International Nuclear Information System (INIS)
Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.
1977-01-01
The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
DeepBase: annotation and discovery of microRNAs and other noncoding RNAs from deep-sequencing data.
Yang, Jian-Hua; Qu, Liang-Hu
2012-01-01
Recent advances in high-throughput deep-sequencing technology have produced large numbers of short and long RNA sequences and enabled the detection and profiling of known and novel microRNAs (miRNAs) and other noncoding RNAs (ncRNAs) at unprecedented sensitivity and depth. In this chapter, we describe the use of deepBase, a database that we have developed to integrate all public deep-sequencing data and to facilitate the comprehensive annotation and discovery of miRNAs and other ncRNAs from these data. deepBase provides an integrative, interactive, and versatile web graphical interface to evaluate miRBase-annotated miRNA genes and other known ncRNAs, explores the expression patterns of miRNAs and other ncRNAs, and discovers novel miRNAs and other ncRNAs from deep-sequencing data. deepBase also provides a deepView genome browser to comparatively analyze these data at multiple levels. deepBase is available at http://deepbase.sysu.edu.cn/.
In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis
Essers, P.B.M.
2013-01-01
Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Plant and Animal microRNAs (miRNAs) and Their Potential for Inter-kingdom Communication.
Zhao, Yuhai; Cong, Lin; Lukiw, Walter J
2018-01-01
microRNAs (miRNAs) comprise a class of ~18-25 nucleotide (nt) single-stranded non-coding RNAs (sncRNAs) that are the smallest known carriers of gene-encoded, post-transcriptional regulatory information in both plants and animals. There are many fundamental similarities between plant and animal miRNAs-the miRNAs of both kingdoms play essential roles in development, aging and disease, and the shaping of the transcriptome of many cell types. Both plant and animal miRNAs appear to predominantly exert their genetic and transcriptomic influences by regulating gene expression at the level of messenger RNA (mRNA) stability and/or translational inhibition. Certain miRNA species, such as miRNA-155, miRNA-168, and members of the miRNA-854 family may be expressed in both plants and animals, suggesting a common origin and functional selection of specific miRNAs over vast periods of evolution (for example, Arabidopsis thaliana-Homo sapiens divergence ~1.5 billion years). Although there is emerging evidence for cross-kingdom miRNA communication-that plant-enriched miRNAs may enter the diet and play physiological and/or pathophysiological roles in human health and disease-some research reports repudiate this possibility. This research paper highlights some recent, controversial, and remarkable findings in plant- and animal-based miRNA signaling research with emphasis on the intriguing possibility that dietary miRNAs and/or sncRNAs may have potential to contribute to both intra- and inter-kingdom signaling, and in doing so modulate molecular-genetic mechanisms associated with human health and disease.
An easy method for plant polysome profiling
DEFF Research Database (Denmark)
Lecampion, Cécile; Floris, Maina Huguette Joséphine; Fantino, Jean Raphaël
2016-01-01
are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis......Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues....... A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After...
Hypoxic stress-induced changes in ribosomes of maize seedling roots
International Nuclear Information System (INIS)
Bailey-Serres, J.; Freeling, M.
1990-01-01
The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress
Directory of Open Access Journals (Sweden)
Heather J Beck
Full Text Available Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs that contain a conventional untranslated leader and Shine-Dalgarno (SD sequence upstream of the gene's start codon while also containing an AUG triplet at the mRNA's 5'- terminus (5'-uAUG. Fusion of the coding sequence specified by the 5'-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5'-terminal upstream open reading frames (5'-uORFs tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5'-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5'-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5'-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5'-uORFs may play roles in downstream regulation. Since the 5'-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5'-uAUGs should be examined for their potential to function also as leaderless mRNAs.
Lazare, Seka S.; Wojtowicz, Edyta E.; Bystrykh, Leonid V.; de Haan, Gerald
2014-01-01
miRNAs have been implicated in all stages of hematopoiesis including maintenance of self-renewal of hematopoietic stem cells (HSCs) and differentiation into mature blood cells. Regulation by miRNAs is markedly intertwined with transcription factors. In this review, we highlight miRNAs shown to be
Zhao, Huiying; Yu, Jiafeng; Guo, Chengang; Dou, Xianghua; Song, Feng; Hu, Guodong; Cao, Zanxia; Qu, Yuanxu
2018-01-01
Abstract Long non-coding RNAs (lncRNAs) play important functional roles in various biological processes. Early databases were utilized to deposit all lncRNA candidates produced by high-throughput experimental and/or computational techniques to facilitate classification, assessment and validation. As more lncRNAs are validated by low-throughput experiments, several databases were established for experimentally validated lncRNAs. However, these databases are small in scale (with a few hundreds of lncRNAs only) and specific in their focuses (plants, diseases or interactions). Thus, it is highly desirable to have a comprehensive dataset for experimentally validated lncRNAs as a central repository for all of their structures, functions and phenotypes. Here, we established EVLncRNAs by curating lncRNAs validated by low-throughput experiments (up to 1 May 2016) and integrating specific databases (lncRNAdb, LncRANDisease, Lnc2Cancer and PLNIncRBase) with additional functional and disease-specific information not covered previously. The current version of EVLncRNAs contains 1543 lncRNAs from 77 species that is 2.9 times larger than the current largest database for experimentally validated lncRNAs. Seventy-four percent lncRNA entries are partially or completely new, comparing to all existing experimentally validated databases. The established database allows users to browse, search and download as well as to submit experimentally validated lncRNAs. The database is available at http://biophy.dzu.edu.cn/EVLncRNAs. PMID:28985416
Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)
1975-06-01
Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.
Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.
Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E
2017-01-01
Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.
International Nuclear Information System (INIS)
Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya
2013-01-01
Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of
Architecture of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad
2014-01-23
Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.
International Nuclear Information System (INIS)
Ying, S.-Y.; Lin, S.-L.
2005-01-01
MicroRNAs (miRNAs), small single-stranded regulatory RNAs capable of interfering with intracellular mRNAs that contain partial complementarity, are useful for the design of new therapies against cancer polymorphism and viral mutation. MiRNA was originally discovered in the intergenic regions of the Caenorhabditis elegans genome as native RNA fragments that modulate a wide range of genetic regulatory pathways during animal development. However, neither RNA promoter nor polymerase responsible for miRNA biogenesis was determined. Recent findings of intron-derived miRNA in C. elegans, mouse, and human have inevitably led to an alternative pathway for miRNA biogenesis, which relies on the coupled interaction of Pol-II-mediated pre-mRNA transcription and intron excision, occurring in certain nuclear regions proximal to genomic perichromatin fibrils
gamma. radiation effect on the functional properties of the cotton ribosomes
Energy Technology Data Exchange (ETDEWEB)
Ibragimov, A P; Safarov, Sh
1973-01-01
A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.
MicroRNAs and Periodontal Homeostasis.
Luan, X; Zhou, X; Trombetta-eSilva, J; Francis, M; Gaharwar, A K; Atsawasuwan, P; Diekwisch, T G H
2017-05-01
MicroRNAs (miRNAs) are a group of small RNAs that control gene expression in all aspects of eukaryotic life, primarily through RNA silencing mechanisms. The purpose of the present review is to introduce key miRNAs involved in periodontal homeostasis, summarize the mechanisms by which they affect downstream genes and tissues, and provide an introduction into the therapeutic potential of periodontal miRNAs. In general, miRNAs function synergistically to fine-tune the regulation of biological processes and to remove expression noise rather than by causing drastic changes in expression levels. In the periodontium, miRNAs play key roles in development and periodontal homeostasis and during the loss of periodontal tissue integrity as a result of periodontal disease. As part of the anabolic phase of periodontal homeostasis and periodontal development, miRNAs direct periodontal fibroblasts toward alveolar bone lineage differentiation and new bone formation through WNT, bone morphogenetic protein, and Notch signaling pathways. miRNAs contribute equally to the catabolic aspect of periodontal homeostasis as they affect osteoclastogenesis and osteoclast function, either by directly promoting osteoclast activity or by inhibiting osteoclast signaling intermediaries or through negative feedback loops. Their small size and ability to target multiple regulatory networks of related sets of genes have predisposed miRNAs to become ideal candidates for drug delivery and tissue regeneration. To address the immense therapeutic potential of miRNAs and their antagomirs, an ever growing number of delivery approaches toward clinical applications have been developed, including nanoparticle carriers and secondary structure interference inhibitor systems. However, only a fraction of the miRNAs involved in periodontal health and disease are known today. It is anticipated that continued research will lead to a more comprehensive understanding of the periodontal miRNA world, and a systematic
Macrolide antibiotic interaction and resistance on the bacterial ribosome.
Poehlsgaard, Jacob; Douthwaite, Stephen
2003-02-01
Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.
International Nuclear Information System (INIS)
Otaka, E.; Kobata, K.
1978-01-01
The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de
Targeting of microRNAs for therapeutics
DEFF Research Database (Denmark)
Stenvang, Jan; Lindow, Morten; Kauppinen, Sakari
2008-01-01
miRNAs (microRNAs) comprise a class of small endogenous non-coding RNAs that post-transcriptionally repress gene expression by base-pairing with their target mRNAs. Recent evidence has shown that miRNAs play important roles in a wide variety of human diseases, such as viral infections, cancer...
Jang-Liaw, Nian-Hong; Chang, Chia-Hao; Tsai, Chi-Li
2013-06-01
We sequenced the complete mitochondrial genome of two spotted barbs native to Taiwan: Puntius semifasciolatus and Puntius snyderi. The complete mitochondrial genomes are 16,594 and 16,578 bp in size, respectively. Both of them contain 37 genes coding for 13 proteins, 2 rRNAs, 22 tRNAs, and 1 control region. They share the same gene arrangement pattern that was identical with most vertebrates. Nucleotide sequence divergence (K2P distance) between the two whole mitochondrial genomes was 7.63%. These two spotted barbs show very close relationship based on the comparison of the characters of their mitochondrial genomes.
Mitochondrial cardiomyopathies
Directory of Open Access Journals (Sweden)
Ayman W. El-Hattab
2016-07-01
Full Text Available Mitochondria are found in all nucleated human cells and perform a variety of essential functions, including the generation of cellular energy. Mitochondria are under dual genome control. Only a small fraction of their proteins are encoded by mitochondrial DNA (mtDNA while more than 99% of them are encoded by nuclear DNA (nDNA. Mutations in mtDNA or mitochondria-related nDNA genes result in mitochondrial dysfunction leading to insufficient energy production required to meet the needs of various organs, particularly those with high energy requirements, including the central nervous system, skeletal and cardiac muscles, kidneys, liver, and endocrine system. Because cardiac muscles are one of the high energy demanding tissues, cardiac involvement occurs in mitochondrial diseases with cardiomyopathies being one of the most frequent cardiac manifestations found in these disorders. Cardiomyopathy is estimated to occur in 20-40% of children with mitochondrial diseases. Mitochondrial cardiomyopathies can vary in severity from asymptomatic status to severe manifestations including heart failure, arrhythmias, and sudden cardiac death. Hypertrophic cardiomyopathy is the most common type; however, mitochondrial cardiomyopathies might also present as dilated, restrictive, left ventricular noncompaction, and histiocytoid cardiomyopathies. Cardiomyopathies are frequent manifestations of mitochondrial diseases associated with defects in electron transport chain (ETC complexes subunits and their assembly factors, mitochondrial tRNAs, rRNAs, ribosomal proteins, and translation factors, mtDNA maintenance, and coenzyme Q10 synthesis. Other mitochondrial diseases with cardiomyopathies include Barth syndrome, Sengers syndrome, TMEM70-related mitochondrial complex V deficiency, and Friedreich ataxia.
Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?
Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I
2016-11-01
Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan
2017-06-01
Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.
MicroRNAs regulate osteogenesis and chondrogenesis
International Nuclear Information System (INIS)
Dong, Shiwu; Yang, Bo; Guo, Hongfeng; Kang, Fei
2012-01-01
Highlights: ► To focus on the role of miRNAs in chondrogenesis and osteogenesis. ► Involved in the regulation of miRNAs in osteoarthritis. ► To speculate some therapeutic targets for bone diseases. -- Abstract: MicroRNAs (miRNAs) are a class of small molecules and non-coding single strand RNAs that regulate gene expression at the post-transcriptional level by binding to specific sequences within target genes. miRNAs have been recognized as important regulatory factors in organism development and disease expression. Some miRNAs regulate the proliferation and differentiation of osteoblasts, osteoclasts and chondrocytes, eventually influencing metabolism and bone formation. miRNAs are expected to provide potential gene therapy targets for the clinical treatment of metabolic bone diseases and bone injuries. Here, we review the recent research progress on the regulation of miRNAs in bone biology, with a particular focus on the miRNA-mediated control mechanisms of bone and cartilage formation.
MicroRNAs regulate osteogenesis and chondrogenesis
Energy Technology Data Exchange (ETDEWEB)
Dong, Shiwu, E-mail: shiwudong@gmail.com [Laboratory of Biomechanics, Department of Anatomy, The Third Military Medical University, Chongqing (China); Yang, Bo; Guo, Hongfeng; Kang, Fei [Laboratory of Biomechanics, Department of Anatomy, The Third Military Medical University, Chongqing (China)
2012-02-24
Highlights: Black-Right-Pointing-Pointer To focus on the role of miRNAs in chondrogenesis and osteogenesis. Black-Right-Pointing-Pointer Involved in the regulation of miRNAs in osteoarthritis. Black-Right-Pointing-Pointer To speculate some therapeutic targets for bone diseases. -- Abstract: MicroRNAs (miRNAs) are a class of small molecules and non-coding single strand RNAs that regulate gene expression at the post-transcriptional level by binding to specific sequences within target genes. miRNAs have been recognized as important regulatory factors in organism development and disease expression. Some miRNAs regulate the proliferation and differentiation of osteoblasts, osteoclasts and chondrocytes, eventually influencing metabolism and bone formation. miRNAs are expected to provide potential gene therapy targets for the clinical treatment of metabolic bone diseases and bone injuries. Here, we review the recent research progress on the regulation of miRNAs in bone biology, with a particular focus on the miRNA-mediated control mechanisms of bone and cartilage formation.
Time-Dependent Expression Profiles of microRNAs and mRNAs in Rat Milk Whey
Izumi, Hirohisa; Kosaka, Nobuyoshi; Shimizu, Takashi; Sekine, Kazunori; Ochiya, Takahiro; Takase, Mitsunori
2014-01-01
Functional RNAs, such as microRNA (miRNA) and mRNA, are present in milk, but their roles are unknown. To clarify the roles of milk RNAs, further studies using experimental animals such as rats are needed. However, it is unclear whether rat milk also contains functional RNAs and what their time dependent expression profiles are. Thus, we prepared total RNA from whey isolated from rat milk collected on days 2, 9, and 16 postpartum and analyzed using microarrays and quantitative PCR. The concentration of RNA in colostrum whey (day 2) was markedly higher than that in mature milk whey (days 9 and 16). Microarray analysis detected 161 miRNAs and 10,948 mRNA transcripts. Most of the miRNAs and mRNA transcripts were common to all tested milks. Finally, we selected some immune- and development-related miRNAs and mRNAs, and analysed them by quantitative PCR (in equal sample volumes) to determine their time-dependent changes in expression in detail. Some were significantly more highly expressed in colostrum whey than in mature milk whey, but some were expressed equally. And mRNA expression levels of some cytokines and hormones did not reflect the protein levels. It is still unknown whether RNAs in milk play biological roles in neonates. However, our data will help guide future in vivo studies using experimental animals such as rats. PMID:24533154
International Nuclear Information System (INIS)
Gorelic, L.; Parker, D.
1978-01-01
The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage
cDNA, genomic sequence cloning and analysis of the ribosomal ...
African Journals Online (AJOL)
Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...
Miesen, P.; Ivens, A.; Buck, A.H.; Rij, R.P. van
2016-01-01
In Aedes mosquitoes, infections with arthropod-borne viruses (arboviruses) trigger or modulate the expression of various classes of viral and host-derived small RNAs, including small interfering RNAs (siRNAs), PIWI interacting RNAs (piRNAs), and microRNAs (miRNAs). Viral siRNAs are at the core of
Interplay of noncoding RNAs, mRNAs, and proteins during the growth of eukaryotic cells
International Nuclear Information System (INIS)
Zhdanov, V. P.
2010-01-01
Numerous biological functions of noncoding RNAs (ncRNAs) in eukaryotic cells are based primarily on their ability to pair with target mRNAs and then either to prevent translation or to result in rapid degradation of the mRNA-ncRNA complex. Using a general model describing this scenario, we show that ncRNAs may help to maintain constant mRNA and protein concentrations during the growth of cells. The possibility of observation of this effect on the global scale is briefly discussed.
Annotation of mammalian primary microRNAs
Directory of Open Access Journals (Sweden)
Enright Anton J
2008-11-01
Full Text Available Abstract Background MicroRNAs (miRNAs are important regulators of gene expression and have been implicated in development, differentiation and pathogenesis. Hundreds of miRNAs have been discovered in mammalian genomes. Approximately 50% of mammalian miRNAs are expressed from introns of protein-coding genes; the primary transcript (pri-miRNA is therefore assumed to be the host transcript. However, very little is known about the structure of pri-miRNAs expressed from intergenic regions. Here we annotate transcript boundaries of miRNAs in human, mouse and rat genomes using various transcription features. The 5' end of the pri-miRNA is predicted from transcription start sites, CpG islands and 5' CAGE tags mapped in the upstream flanking region surrounding the precursor miRNA (pre-miRNA. The 3' end of the pri-miRNA is predicted based on the mapping of polyA signals, and supported by cDNA/EST and ditags data. The predicted pri-miRNAs are also analyzed for promoter and insulator-associated regulatory regions. Results We define sets of conserved and non-conserved human, mouse and rat pre-miRNAs using bidirectional BLAST and synteny analysis. Transcription features in their flanking regions are used to demarcate the 5' and 3' boundaries of the pri-miRNAs. The lengths and boundaries of primary transcripts are highly conserved between orthologous miRNAs. A significant fraction of pri-miRNAs have lengths between 1 and 10 kb, with very few introns. We annotate a total of 59 pri-miRNA structures, which include 82 pre-miRNAs. 36 pri-miRNAs are conserved in all 3 species. In total, 18 of the confidently annotated transcripts express more than one pre-miRNA. The upstream regions of 54% of the predicted pri-miRNAs are found to be associated with promoter and insulator regulatory sequences. Conclusion Little is known about the primary transcripts of intergenic miRNAs. Using comparative data, we are able to identify the boundaries of a significant proportion of
Genomic Organization of Zebrafish microRNAs
Directory of Open Access Journals (Sweden)
Paydar Ima
2008-05-01
Full Text Available Abstract Background microRNAs (miRNAs are small (~22 nt non-coding RNAs that regulate cell movement, specification, and development. Expression of miRNAs is highly regulated, both spatially and temporally. Based on direct cloning, sequence conservation, and predicted secondary structures, a large number of miRNAs have been identified in higher eukaryotic genomes but whether these RNAs are simply a subset of a much larger number of noncoding RNA families is unknown. This is especially true in zebrafish where genome sequencing and annotation is not yet complete. Results We analyzed the zebrafish genome to identify the number and location of proven and predicted miRNAs resulting in the identification of 35 new miRNAs. We then grouped all 415 zebrafish miRNAs into families based on seed sequence identity as a means to identify possible functional redundancy. Based on genomic location and expression analysis, we also identified those miRNAs that are likely to be encoded as part of polycistronic transcripts. Lastly, as a resource, we compiled existing zebrafish miRNA expression data and, where possible, listed all experimentally proven mRNA targets. Conclusion Current analysis indicates the zebrafish genome encodes 415 miRNAs which can be grouped into 44 families. The largest of these families (the miR-430 family contains 72 members largely clustered in two main locations along chromosome 4. Thus far, most zebrafish miRNAs exhibit tissue specific patterns of expression.
Small silencing RNAs: an expanding universe.
Ghildiyal, Megha; Zamore, Phillip D
2009-02-01
Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.
DEFF Research Database (Denmark)
Meister, Björn; Herzer, Silke; Silahtaroglu, Asli
2013-01-01
MicroRNAs (miRNAs) are short (∼22 nucleotides) non-coding ribonucleic acid (RNA) molecules that negatively regulate the expression of protein-coding genes. Posttranscriptional silencing of target genes by miRNA is initiated by binding to the 3'-untranslated regions of target mRNAs, resulting...... of the hypothalamus and miRNAs have recently been shown to be important regulators of hypothalamic control functions. The aim of this review is to summarize some of the current knowledge regarding the expression and role of miRNAs in the hypothalamus.......RNA molecules are abundantly expressed in tissue-specific and regional patterns and have been suggested as potential biomarkers, disease modulators and drug targets. The central nervous system is a prominent site of miRNA expression. Within the brain, several miRNAs are expressed and/or enriched in the region...
Control of ribosome traffic by position-dependent choice of synonymous codons
DEFF Research Database (Denmark)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...
International Nuclear Information System (INIS)
Pereira, Larissa Miranda
2009-01-01
The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
GTPases and the origin of the ribosome
Directory of Open Access Journals (Sweden)
Smith Temple F
2010-05-01
Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.
Retrotransposons and non-protein coding RNAs
DEFF Research Database (Denmark)
Mourier, Tobias; Willerslev, Eske
2009-01-01
does not merely represent spurious transcription. We review examples of functional RNAs transcribed from retrotransposons, and address the collection of non-protein coding RNAs derived from transposable element sequences, including numerous human microRNAs and the neuronal BC RNAs. Finally, we review...
Directory of Open Access Journals (Sweden)
Chong Kang
2009-09-01
Full Text Available Abstract Background MicroRNAs (miRNAs are endogenous small RNAs having large-scale regulatory effects on plant development and stress responses. Extensive studies of miRNAs have only been performed in a few model plants. Although miRNAs are proved to be involved in plant cold stress responses, little is known for winter-habit monocots. Brachypodium distachyon, with close evolutionary relationship to cool-season cereals, has recently emerged as a novel model plant. There are few reports of Brachypodium miRNAs. Results High-throughput sequencing and whole-genome-wide data mining led to the identification of 27 conserved miRNAs, as well as 129 predicted miRNAs in Brachypodium. For multiple-member conserved miRNA families, their sizes in Brachypodium were much smaller than those in rice and Populus. The genome organization of miR395 family in Brachypodium was quite different from that in rice. The expression of 3 conserved miRNAs and 25 predicted miRNAs showed significant changes in response to cold stress. Among these miRNAs, some were cold-induced and some were cold-suppressed, but all the conserved miRNAs were up-regulated under cold stress condition. Conclusion Our results suggest that Brachypodium miRNAs are composed of a set of conserved miRNAs and a large proportion of non-conserved miRNAs with low expression levels. Both kinds of miRNAs were involved in cold stress response, but all the conserved miRNAs were up-regulated, implying an important role for cold-induced miRNAs. The different size and genome organization of miRNA families in Brachypodium and rice suggest that the frequency of duplication events or the selection pressure on duplicated miRNAs are different between these two closely related plant species.
Novel meiotic miRNAs and indications for a role of phasiRNAs in meiosis
Small RNAs (sRNA) add additional layers to the regulation of gene expression, with siRNAs directing gene silencing at the DNA level by RdDM (RNA-directed DNA methylation), and miRNAs directing post-transcriptional regulation of specific target genes, mostly by mRNA cleavage. We used manually isolate...
Walter, Nils G; Batey, Robert T
2009-01-01
This book assembles chapters from experts in the Biophysics of RNA to provide a broadly accessible snapshot of the current status of this rapidly expanding field. The 2006 Nobel Prize in Physiology or Medicine was awarded to the discoverers of RNA interference, highlighting just one example of a large number of non-protein coding RNAs. Because non-protein coding RNAs outnumber protein coding genes in mammals and other higher eukaryotes, it is now thought that the complexity of organisms is correlated with the fraction of their genome that encodes non-protein coding RNAs. Essential biological processes as diverse as cell differentiation, suppression of infecting viruses and parasitic transposons, higher-level organization of eukaryotic chromosomes, and gene expression itself are found to largely be directed by non-protein coding RNAs. The biophysical study of these RNAs employs X-ray crystallography, NMR, ensemble and single molecule fluorescence spectroscopy, optical tweezers, cryo-electron microscopy, and ot...
Wallace, Adam; Filbin, Megan E; Veo, Bethany; McFarland, Craig; Stepinski, Janusz; Jankowska-Anyszka, Marzena; Darzynkiewicz, Edward; Davis, Richard E
2010-04-01
Eukaryotic mRNA translation begins with recruitment of the 40S ribosome complex to the mRNA 5' end through the eIF4F initiation complex binding to the 5' m(7)G-mRNA cap. Spliced leader (SL) RNA trans splicing adds a trimethylguanosine (TMG) cap and a sequence, the SL, to the 5' end of mRNAs. Efficient translation of TMG-capped mRNAs in nematodes requires the SL sequence. Here we define a core set of nucleotides and a stem-loop within the 22-nucleotide nematode SL that stimulate translation of mRNAs with a TMG cap. The structure and core nucleotides are conserved in other nematode SLs and correspond to regions of SL1 required for early Caenorhabditis elegans development. These SL elements do not facilitate translation of m(7)G-capped RNAs in nematodes or TMG-capped mRNAs in mammalian or plant translation systems. Similar stem-loop structures in phylogenetically diverse SLs are predicted. We show that the nematode eukaryotic translation initiation factor 4E/G (eIF4E/G) complex enables efficient translation of the TMG-SL RNAs in diverse in vitro translation systems. TMG-capped mRNA translation is determined by eIF4E/G interaction with the cap and the SL RNA, although the SL does not increase the affinity of eIF4E/G for capped RNA. These results suggest that the mRNA 5' untranslated region (UTR) can play a positive and novel role in translation initiation through interaction with the eIF4E/G complex in nematodes and raise the issue of whether eIF4E/G-RNA interactions play a role in the translation of other eukaryotic mRNAs.
Modulation of microRNA activity by semi-microRNAs (smiRNAs
Directory of Open Access Journals (Sweden)
Isabelle ePlante
2012-06-01
Full Text Available The ribonuclease Dicer plays a central role in the microRNA pathway by catalyzing the formation of 19 to 24-nucleotide (nt long microRNAs. Subsequently incorporated into Ago2 effector complexes, microRNAs are known to regulate messenger RNA (mRNA translation. Whether shorter RNA species derived from microRNAs exist and play a role in mRNA regulation remains unknown. Here, we report the serendipitous discovery of a 12-nt long RNA species corresponding to the 5’ region of the microRNA let-7, and tentatively termed semi-microRNA, or smiRNA. Using a smiRNA derived from the precursor of miR-223 as a model, we show that 12-nt long smiRNA species are devoid of any direct mRNA regulatory activity, as assessed in a reporter gene activity assay in transfected cultured human cells. However, smiR-223 was found to modulate the ability of the microRNA from which it derives to mediate translational repression or cleavage of reporter mRNAs. Our findings suggest that smiRNAs may be generated along the microRNA pathway and participate to the control of gene expression by regulating the activity of the related full-length mature microRNA in vivo.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L
2015-10-08
Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.
Ribosomal trafficking is reduced in Schwann cells following induction of myelination
Directory of Open Access Journals (Sweden)
James M. Love
2015-08-01
Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following
Yin, Dan-Dan; Li, Shan-Shan; Shu, Qing-Yan; Gu, Zhao-Yu; Wu, Qian; Feng, Cheng-Yong; Xu, Wen-Zhong; Wang, Liang-Sheng
2018-08-05
MicroRNAs (miRNAs) and long noncoding RNAs (lncRNAs) act as important molecular regulators in a wide range of biological processes during plant development and seed formation, including oil production. Tree peony seeds contain >90% unsaturated fatty acids (UFAs) and high proportions of α-linolenic acid (ALA, > 40%). To dissect the non-coding RNAs (ncRNAs) pathway involved in fatty acids synthesis in tree peony seeds, we construct six small RNA libraries and six transcriptome libraries from developing seeds of two cultivars (J and S) containing different content of fatty acid compositions. After deep sequencing the RNA libraries, the ncRNA expression profiles of tree peony seeds in two cultivars were systematically and comparatively analyzed. A total of 318 known and 153 new miRNAs and 22,430 lncRNAs were identified, among which 106 conserved and 9 novel miRNAs and 2785 lncRNAs were differentially expressed between the two cultivars. In addition, potential target genes of the microRNA and lncRNAs were also predicted and annotated. Among them, 9 miRNAs and 39 lncRNAs were predicted to target lipid related genes. Results showed that all of miR414, miR156b, miR2673b, miR7826, novel-m0027-5p, TR24651|c0_g1, TR24544|c0_g15, and TR27305|c0_g1 were up-regulated and expressed at a higher level in high-ALA cultivar J when compared to low-ALA cultivar S, suggesting that these ncRNAs and target genes are possibly involved in different fatty acid synthesis and lipid metabolism through post-transcriptional regulation. These results provide a better understanding of the roles of ncRNAs during fatty acid biosynthesis and metabolism in tree peony seeds. Copyright © 2018 Elsevier B.V. All rights reserved.
Expanding the ribosomal universe.
Dinman, Jonathan D; Kinzy, Terri Goss
2009-12-09
In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.
van Bruggen, A H; Jochimsen, K N; Steinberger, E M; Segers, P; Gillis, M
1993-01-01
Thermal melting profiles of hybrids between 3H-labeled rRNA of Rhizomonas suberifaciens, the causal agent of corky root of lettuce, and chromosomal DNAs from 27 species of gram-negative bacteria indicated that the genus Rhizomonas belongs to superfamily IV of De Ley. On the basis of the melting temperatures of DNA hybrids with rRNAs from the type strains of R. suberifaciens, Sphingomonas paucimobilis, and Sphingomonas capsulata, Rhizomonas strains constitute a separate branch in superfamily IV, which is closely related to but separate from branches containing Zymomonas mobilis, Sphingomonas spp., and S. capsulata. Sphingomonas yanoikuyae and Rhizomonas sp. strain WI4 are located toward the base of the Rhizomonas rRNA branch. DNA-DNA hybridization indicated that S. yanoikuyae is equidistant from Rhizomonas sp. strain WI4 and S. paucimobilis. Sequences of 270 bp of 16S ribosomal DNAs from eight strains of Rhizomonas spp., eight strains of Sphingomonas spp., and Agrobacterium tumefaciens indicated that S. yanoikuyae and Rhizomonas sp. strains WI4 and CA16 are genetically more closely related to R. suberifaciens than to Sphingomonas spp. Thus, S. yanoikuyae may need to be transferred to the genus Rhizomonas on the basis of the results of further study.
Panning for Long Noncoding RNAs
Directory of Open Access Journals (Sweden)
Li Yang
2013-02-01
Full Text Available The recent advent of high-throughput approaches has revealed widespread transcription of the human genome, leading to a new appreciation of transcription regulation, especially from noncoding regions. Distinct from most coding and small noncoding RNAs, long noncoding RNAs (lncRNAs are generally expressed at low levels, are less conserved and lack protein-coding capacity. These intrinsic features of lncRNAs have not only hampered their full annotation in the past several years, but have also generated controversy concerning whether many or most of these lncRNAs are simply the result of transcriptional noise. Here, we assess these intrinsic features that have challenged lncRNA discovery and further summarize recent progress in lncRNA discovery with integrated methodologies, from which new lessons and insights can be derived to achieve better characterization of lncRNA expression regulation. Full annotation of lncRNA repertoires and the implications of such annotation will provide a fundamental basis for comprehensive understanding of pervasive functions of lncRNAs in biological regulation.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome
Directory of Open Access Journals (Sweden)
Jendrik Hentschel
2017-07-01
Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.
Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad
2017-07-05
The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Control of ribosome traffic by position-dependent choice of synonymous codons
International Nuclear Information System (INIS)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)
Miesen, Pascal; Ivens, Alasdair; Buck, Amy H; van Rij, Ronald P
2016-02-01
In Aedes mosquitoes, infections with arthropod-borne viruses (arboviruses) trigger or modulate the expression of various classes of viral and host-derived small RNAs, including small interfering RNAs (siRNAs), PIWI interacting RNAs (piRNAs), and microRNAs (miRNAs). Viral siRNAs are at the core of the antiviral RNA interference machinery, one of the key pathways that limit virus replication in invertebrates. Besides siRNAs, Aedes mosquitoes and cells derived from these insects produce arbovirus-derived piRNAs, the best studied examples being viruses from the Togaviridae or Bunyaviridae families. Host miRNAs modulate the expression of a large number of genes and their levels may change in response to viral infections. In addition, some viruses, mostly with a DNA genome, express their own miRNAs to regulate host and viral gene expression. Here, we perform a comprehensive analysis of both viral and host-derived small RNAs in Aedes aegypti Aag2 cells infected with dengue virus 2 (DENV), a member of the Flaviviridae family. Aag2 cells are competent in producing all three types of small RNAs and provide a powerful tool to explore the crosstalk between arboviral infection and the distinct RNA silencing pathways. Interestingly, besides the well-characterized DENV-derived siRNAs, a specific population of viral piRNAs was identified in infected Aag2 cells. Knockdown of Piwi5, Ago3 and, to a lesser extent, Piwi6 results in reduction of vpiRNA levels, providing the first genetic evidence that Aedes PIWI proteins produce DENV-derived small RNAs. In contrast, we do not find convincing evidence for the production of virus-derived miRNAs. Neither do we find that host miRNA expression is strongly changed upon DENV2 infection. Finally, our deep-sequencing analyses detect 30 novel Aedes miRNAs, complementing the repertoire of regulatory small RNAs in this important vector species.
Crystal structures of two eukaryotic nucleases involved in RNA metabolism
DEFF Research Database (Denmark)
Jonstrup, Anette Thyssen; Midtgaard, Søren Fuglsang; Van, Lan Bich
RNA serves a number of functions in the cell: mRNAs are the carriers of information between gene and protein, tRNAs and rRNAs are involved in the synthesis of proteins, whereas a number of additional RNA species are responsible for other functions in the cell. The quality of the different RNAs...... RNAs. We have solved the structures of two nucleases involved in 3'-5' degradation of RNA; the S. pombe Pop2p and the S. cerevisiae Rrp6p. Pop2p is part of the main cytoplasmatic deadenylation complex in yeast, which also contains the nuclease Ccr4p. Deadenylation, where the poly(A)-tail is removed...... specific transcripts. Here, we present the crystal structure of the S. pombe Pop2p protein to 1.4 Å resolution. The high resolution structure provides a clear picture of the active site architecture. Structural alignment of single nucleotides and poly(A)-oligonucleotides from earlier co-crystal structures...
Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.
Wang, Hao; Kingsford, Carl; McManus, C Joel
2018-03-15
Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhifen Liu
Full Text Available LncRNAs, which represent one of the most highly expressed classes of ncRNAs in the brain, are becoming increasingly interesting with regard to brain functions and disorders. However, changes in the expression of regulatory lncRNAs in Major Depressive Disorder (MDD have not yet been reported. Using microarrays, we profiled the expression of 34834 lncRNAs and 39224 mRNAs in peripheral blood sampled from MDD patients as well as demographically-matched controls. Among these, we found that 2007 lncRNAs and 1667 mRNAs were differentially expressed, 17 of which were documented as depression-related gene in previous studies. Gene Ontology (GO and pathway analyses indicated that the biological functions of differentially expressed mRNAs were related to fundamental metabolic processes and neurodevelopment diseases. To investigate the potential regulatory roles of the differentially expressed lncRNAs on the mRNAs, we also constructed co-expression networks composed of the lncRNAs and mRNAs, which shows significant correlated patterns of expression. In the MDD-derived network, there were a greater number of nodes and connections than that in the control-derived network. The lncRNAs located at chr10:874695-874794, chr10:75873456-75873642, and chr3:47048304-47048512 may be important factors regulating the expression of mRNAs as they have previously been reported associations with MDD. This study is the first to explore genome-wide lncRNA expression and co-expression with mRNA patterns in MDD using microarray technology. We identified circulating lncRNAs that are aberrantly expressed in MDD and the results suggest that lncRNAs may contribute to the molecular pathogenesis of MDD.
Long non-coding RNAs and mRNAs profiling during spleen development in pig.
Che, Tiandong; Li, Diyan; Jin, Long; Fu, Yuhua; Liu, Yingkai; Liu, Pengliang; Wang, Yixin; Tang, Qianzi; Ma, Jideng; Wang, Xun; Jiang, Anan; Li, Xuewei; Li, Mingzhou
2018-01-01
Genome-wide transcriptomic studies in humans and mice have become extensive and mature. However, a comprehensive and systematic understanding of protein-coding genes and long non-coding RNAs (lncRNAs) expressed during pig spleen development has not been achieved. LncRNAs are known to participate in regulatory networks for an array of biological processes. Here, we constructed 18 RNA libraries from developing fetal pig spleen (55 days before birth), postnatal pig spleens (0, 30, 180 days and 2 years after birth), and the samples from the 2-year-old Wild Boar. A total of 15,040 lncRNA transcripts were identified among these samples. We found that the temporal expression pattern of lncRNAs was more restricted than observed for protein-coding genes. Time-series analysis showed two large modules for protein-coding genes and lncRNAs. The up-regulated module was enriched for genes related to immune and inflammatory function, while the down-regulated module was enriched for cell proliferation processes such as cell division and DNA replication. Co-expression networks indicated the functional relatedness between protein-coding genes and lncRNAs, which were enriched for similar functions over the series of time points examined. We identified numerous differentially expressed protein-coding genes and lncRNAs in all five developmental stages. Notably, ceruloplasmin precursor (CP), a protein-coding gene participating in antioxidant and iron transport processes, was differentially expressed in all stages. This study provides the first catalog of the developing pig spleen, and contributes to a fuller understanding of the molecular mechanisms underpinning mammalian spleen development.
Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?
Directory of Open Access Journals (Sweden)
Ilana C. Agmon
2016-12-01
Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.
Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues
International Nuclear Information System (INIS)
Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.
1990-01-01
The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins
Role of Small RNAs in Trypanosomatid Infections
Linhares-Lacerda, Leandra; Morrot, Alexandre
2016-01-01
Trypanosomatid parasites survive and replicate in the host by using mechanisms that aim to establish a successful infection and ensure parasite survival. Evidence points to microRNAs as new players in the host-parasite interplay. MicroRNAs are small non-coding RNAs that control proteins levels via post-transcriptional gene down-regulation, either within the cells where they were produced or in other cells via intercellular transfer. These microRNAs can be modulated in host cells during infection and are among the growing group of small regulatory RNAs, for which many classes have been described, including the transfer RNA-derived small RNAs. Parasites can either manipulate microRNAs to evade host-driven damage and/or transfer small RNAs to host cells. In this mini-review, we present evidence for the involvement of small RNAs, such as microRNAs, in trypanosomatid infections which lack RNA interference. We highlight both microRNA profile alterations in host cells during those infections and the horizontal transfer of small RNAs and proteins from parasites to the host by membrane-derived extracellular vesicles in a cell communication mechanism. PMID:27065454
Association of RNAs with Bacillus subtilis Hfq.
Directory of Open Access Journals (Sweden)
Michael Dambach
Full Text Available The prevalence and characteristics of small regulatory RNAs (sRNAs have not been well characterized for Bacillus subtilis, an important model system for Gram-positive bacteria. However, B. subtilis was recently found to synthesize many candidate sRNAs during stationary phase. In the current study, we performed deep sequencing on Hfq-associated RNAs and found that a small subset of sRNAs associates with Hfq, an enigmatic RNA-binding protein that stabilizes sRNAs in Gram-negatives, but whose role is largely unknown in Gram-positive bacteria. We also found that Hfq associated with antisense RNAs, antitoxin transcripts, and many mRNA leaders. Several new candidate sRNAs and mRNA leader regions were also discovered by this analysis. Additionally, mRNA fragments overlapping with start or stop codons associated with Hfq, while, in contrast, relatively few full-length mRNAs were recovered. Deletion of hfq reduced the intracellular abundance of several representative sRNAs, suggesting that B. subtilis Hfq-sRNA interactions may be functionally significant in vivo. In general, we anticipate this catalog of Hfq-associated RNAs to serve as a resource in the functional characterization of Hfq in B. subtilis.
miRNAs in Normal and Malignant Hematopoiesis
Directory of Open Access Journals (Sweden)
Ryutaro Kotaki
2017-07-01
Full Text Available Lineage specification is primarily regulated at the transcriptional level and lineage-specific transcription factors determine cell fates. MicroRNAs (miRNAs are 18–24 nucleotide-long non-coding RNAs that post-transcriptionally decrease the translation of target mRNAs and are essential for many cellular functions. miRNAs also regulate lineage specification during hematopoiesis. This review highlights the roles of miRNAs in B-cell development and malignancies, and discusses how miRNA expression profiles correlate with disease prognoses and phenotypes. We also discuss the potential for miRNAs as therapeutic targets and diagnostic tools for B-cell malignancies.
Housekeeping Genes as Internal Standards: Use and Limits
Thellin, Olivier; Zorzi, Willy; Lakaye, Bernard; De Borman, B.; Coumans, Bernard; Hennen, Georges; Grisar, Thierry; Igout, Ahmed; Heinen, Ernst
1999-01-01
Quantitative studies are commonly realised in the biomedical research to compare RNA expression in different experimental or clinical conditions. These quantifications are performed through their comparison to the expression of the housekeeping gene transcripts like glyceraldehyde-3-phosphate dehydrogenase (G3PDH), albumin, actins, tubulins, cyclophilin, hypoxantine phsophoribosyltransferase (HRPT), L32. 28S, and 18S rRNAs are also used as internal standards. In this paper, it is recalled tha...
An expanding universe of noncoding RNAs.
Storz, Gisela
2002-05-17
Noncoding RNAs (ncRNAs) have been found to have roles in a great variety of processes, including transcriptional regulation, chromosome replication, RNA processing and modification, messenger RNA stability and translation, and even protein degradation and translocation. Recent studies indicate that ncRNAs are far more abundant and important than initially imagined. These findings raise several fundamental questions: How many ncRNAs are encoded by a genome? Given the absence of a diagnostic open reading frame, how can these genes be identified? How can all the functions of ncRNAs be elucidated?
DEFF Research Database (Denmark)
Taipaleenmäki, H.; Hokland, L. B.; Chen, Li
2012-01-01
Osteoblast differentiation and bone formation (osteogenesis) are regulated by transcriptional and post-transcriptional mechanisms. Recently, a novel class of regulatory factors termed microRNAs has been identified as playing an important role in the regulation of many aspects of osteoblast biology...... including proliferation, differentiation, metabolism and apoptosis. Also, preliminary data from animal disease models suggest that targeting miRNAs in bone can be a novel approach to increase bone mass. This review highlights the current knowledge of microRNA biology and their role in bone formation...
Directory of Open Access Journals (Sweden)
Jing-Yi Lin
Full Text Available EV71 (enterovirus 71 RNA contains an internal ribosomal entry site (IRES that directs cap-independent initiation of translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs. We reported recently that mRNA decay factor AUF1 is a negative-acting ITAF that binds IRES stem-loop II. We also reported that the small RNA-processing enzyme Dicer produces at least four small RNAs (vsRNAs from the EV71 IRES. One of these, vsRNA1, derived from IRES stem-loop II, reduces IRES activity and virus replication. Since its mechanism of action is unknown, we hypothesized that it might control association of ITAFs with the IRES. Here, we identified the mRNA stability factor HuR and the RISC subunit Argonaute 2 (Ago2 as two ITAFs that bind stem-loop II. In contrast to AUF1, HuR and Ago2 promote EV71 IRES activity and virus replication. In vitro RNA-binding assays revealed that vsRNA1 can alter association of Ago2, HuR, and AUF1 with stem-loop II. This presents a possible mechanism by which vsRNA1 could control viral translation and replication.
Complete plastid genome of Astragalus mongholicus var. nakaianus (Fabaceae).
Choi, In-Su; Kim, Joo-Hwan; Choi, Byoung-Hee
2016-07-01
The first complete plastid genome (plastome) of the largest angiosperm genus, Astragalus, was sequenced for the Korean endangered endemic species A. mongholicus var. nakaianus. Its genome is relatively short (123,633 bp) because it lacks an Inverted Repeat (IR) region. It comprises 110 genes, including four unique rRNAs, 30 tRNAs, and 76 protein-coding genes. Similar to other closely related plastomes, rpl22 and rps16 are absent. The putative pseudogene with abnormal stop codons is atpE. This plastome has no additional inversions when compared with highly variable plastomes from IRLC tribes Fabeae and Trifolieae. Our phylogenetic analysis confirms the non-monophyly of Galegeae.
Directory of Open Access Journals (Sweden)
Pilla Sankara Krishna
2015-12-01
Full Text Available We report the 4.86-Mb draft genome sequence of Bacillus okhensis strain Kh10-101T, a halo-alkali tolerant rod shaped bacterium isolated from a salt pan near port of Okha, India. This bacterium is a potential model to study the molecular response of bacteria to salt as well as alkaline stress, as it thrives under both high salt and high pH conditions. The draft genome consist of 4,865,284 bp with 38.2% G + C, 4952 predicted CDS, 157 tRNAs and 8 rRNAs. Sequence was deposited at DDBJ/EMBL/GenBank under the project accession JRJU00000000.
Li, Gengmi; Hu, Zonghai; Zeng, Ping; Zhu, Bing; Wu, Lijuan
2015-04-01
Enterobacter ludwigii strain EN-119(T) is the type strain of E. ludwigii, which belongs to the E. cloacae complex (Ecc). This strain was first reported and nominated in 2005 and later been found in many hospitals. In this paper, the whole genome sequencing of this strain was carried out. The total genome size of EN-119(T) is 4952,770 bp with 4578 coding sequences, 88 tRNAs and 10 rRNAs. The genome sequence of EN-119(T) is the first whole genome sequence of E. ludwigii, which will further our understanding of Ecc. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Non-Coding RNAs in Hodgkin Lymphoma
Directory of Open Access Journals (Sweden)
Anna Cordeiro
2017-05-01
Full Text Available MicroRNAs (miRNAs, small non-coding RNAs that regulate gene expression by binding to the 3’-UTR of their target genes, can act as oncogenes or tumor suppressors. Recently, other types of non-coding RNAs—piwiRNAs and long non-coding RNAs—have also been identified. Hodgkin lymphoma (HL is a B cell origin disease characterized by the presence of only 1% of tumor cells, known as Hodgkin and Reed-Stenberg (HRS cells, which interact with the microenvironment to evade apoptosis. Several studies have reported specific miRNA signatures that can differentiate HL lymph nodes from reactive lymph nodes, identify histologic groups within classical HL, and distinguish HRS cells from germinal center B cells. Moreover, some signatures are associated with survival or response to chemotherapy. Most of the miRNAs in the signatures regulate genes related to apoptosis, cell cycle arrest, or signaling pathways. Here we review findings on miRNAs in HL, as well as on other non-coding RNAs.
Energy Technology Data Exchange (ETDEWEB)
Yoshikatsu, Yuki [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Ishida, Yo-ichi; Sudo, Haruka [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan); Yuasa, Keizo; Tsuji, Akihiko [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan)
2015-08-28
Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. - Highlights: • ATPase-deficient mutants of NVL2 have decreased pre-rRNA processing. • NVL2 associates with the nuclear exosome through interactions with MTR4 and RRP6. • MPP6 stabilizes MTR4-RRP6 interaction and allows NVL2 to interact with the complex.
A survey of small RNAs in human sperm
Krawetz, Stephen A.; Kruger, Adele; Lalancette, Claudia; Tagett, Rebecca; Anton, Ester; Draghici, Sorin; Diamond, Michael P.
2011-01-01
BACKGROUND There has been substantial interest in assessing whether RNAs (mRNAs and sncRNAs, i.e. small non-coding) delivered from mammalian spermatozoa play a functional role in early embryo development. While the cadre of spermatozoal mRNAs has been characterized, comparatively little is known about the distribution or function of the estimated 24 000 sncRNAs within each normal human spermatozoon. METHODS RNAs of libraries for Next Generation Sequencing. Known sncRNAs that uniquely mapped to a single location in the human genome were identified. RESULTS Bioinformatic analysis revealed the presence of multiple classes of small RNAs in human spermatozoa. The primary classes resolved included microRNA (miRNAs) (≈7%), Piwi-interacting piRNAs (≈17%), repeat-associated small RNAs (≈65%). A minor subset of short RNAs within the transcription start site/promoter fraction (≈11%) frames the histone promoter-associated regions enriched in genes of early embryonic development. These have been termed quiescent RNAs. CONCLUSIONS A complex population of male derived sncRNAs that are available for delivery upon fertilization was revealed. Sperm miRNA-targeted enrichment in the human oocyte is consistent with their role as modifiers of early post-fertilization. The relative abundance of piRNAs and repeat-associated RNAs suggests that they may assume a role in confrontation and consolidation. This may ensure the compatibility of the genomes at fertilization. PMID:21989093
Wallace, Adam; Filbin, Megan E.; Veo, Bethany; McFarland, Craig; Stepinski, Janusz; Jankowska-Anyszka, Marzena; Darzynkiewicz, Edward; Davis, Richard E.
2010-01-01
Eukaryotic mRNA translation begins with recruitment of the 40S ribosome complex to the mRNA 5′ end through the eIF4F initiation complex binding to the 5′ m7G-mRNA cap. Spliced leader (SL) RNA trans splicing adds a trimethylguanosine (TMG) cap and a sequence, the SL, to the 5′ end of mRNAs. Efficient translation of TMG-capped mRNAs in nematodes requires the SL sequence. Here we define a core set of nucleotides and a stem-loop within the 22-nucleotide nematode SL that stimulate translation of mRNAs with a TMG cap. The structure and core nucleotides are conserved in other nematode SLs and correspond to regions of SL1 required for early Caenorhabditis elegans development. These SL elements do not facilitate translation of m7G-capped RNAs in nematodes or TMG-capped mRNAs in mammalian or plant translation systems. Similar stem-loop structures in phylogenetically diverse SLs are predicted. We show that the nematode eukaryotic translation initiation factor 4E/G (eIF4E/G) complex enables efficient translation of the TMG-SL RNAs in diverse in vitro translation systems. TMG-capped mRNA translation is determined by eIF4E/G interaction with the cap and the SL RNA, although the SL does not increase the affinity of eIF4E/G for capped RNA. These results suggest that the mRNA 5′ untranslated region (UTR) can play a positive and novel role in translation initiation through interaction with the eIF4E/G complex in nematodes and raise the issue of whether eIF4E/G-RNA interactions play a role in the translation of other eukaryotic mRNAs. PMID:20154140
Miscoding-induced stalling of substrate translocation on the bacterial ribosome.
Alejo, Jose L; Blanchard, Scott C
2017-10-10
Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.
Mechanism of recycling of post-termination ribosomal complexes in ...
Indian Academy of Sciences (India)
Madhu
all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Computational resources for ribosome profiling: from database to Web server and software.
Wang, Hongwei; Wang, Yan; Xie, Zhi
2017-08-14
Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number
Directory of Open Access Journals (Sweden)
Katherine I. Farley-Barnes
2018-02-01
Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.
Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli
2017-05-27
Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1993-01-01
RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....
Endogenous small RNAs and antibacterial immunity in plants.
Jin, Hailing
2008-08-06
Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.
Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin
International Nuclear Information System (INIS)
Boehm, H.; Stahl, J.; Bielka, H.
1979-01-01
N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)
Directory of Open Access Journals (Sweden)
Silar Philippe
2000-11-01
Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.
Lalucque, Hervé; Silar, Philippe
2000-01-01
Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985
MicroRNAs in Cardiometabolic Diseases
Directory of Open Access Journals (Sweden)
Anna Meiliana
2013-08-01
Full Text Available BACKGROUND: MicroRNAs (miRNAs are ~22-nucleotide noncoding RNAs with critical functions in multiple physiological and pathological processes. An explosion of reports on the discovery and characterization of different miRNA species and their involvement in almost every aspect of cardiac biology and diseases has established an exciting new dimension in gene regulation networks for cardiac development and pathogenesis. CONTENT: Alterations in the metabolic control of lipid and glucose homeostasis predispose an individual to develop cardiometabolic diseases, such as type 2 diabetes mellitus and atherosclerosis. Work over the last years has suggested that miRNAs play an important role in regulating these physiological processes. Besides a cell-specific transcription factor profile, cell-specific miRNA-regulated gene expression is integral to cell fate and activation decisions. Thus, the cell types involved in atherosclerosis, vascular disease, and its myocardial sequelae may be differentially regulated by distinct miRNAs, thereby controlling highly complex processes, for example, smooth muscle cell phenotype and inflammatory responses of endothelial cells or macrophages. The recent advancements in using miRNAs as circulating biomarkers or therapeutic modalities, will hopefully be able to provide a strong basis for future research to further expand our insights into miRNA function in cardiovascular biology. SUMMARY: MiRNAs are small, noncoding RNAs that function as post-transcriptional regulators of gene expression. They are potent modulators of diverse biological processes and pathologies. Recent findings demonstrated the importance of miRNAs in the vasculature and the orchestration of lipid metabolism and glucose homeostasis. MiRNA networks represent an additional layer of regulation for gene expression that absorbs perturbations and ensures the robustness of biological systems. A detailed understanding of the molecular and cellular mechanisms of mi
LncRNAs in vertebrates: advances and challenges.
Mallory, Allison C; Shkumatava, Alena
2015-10-01
Beyond the handful of classic and well-characterized long noncoding RNAs (lncRNAs), more recently, hundreds of thousands of lncRNAs have been identified in multiple species including bacteria, plants and vertebrates, and the number of newly annotated lncRNAs continues to increase as more transcriptomes are analyzed. In vertebrates, the expression of many lncRNAs is highly regulated, displaying discrete temporal and spatial expression patterns, suggesting roles in a wide range of developmental processes and setting them apart from classic housekeeping ncRNAs. In addition, the deregulation of a subset of these lncRNAs has been linked to the development of several diseases, including cancers, as well as developmental anomalies. However, the majority of vertebrate lncRNA functions remain enigmatic. As such, a major task at hand is to decipher the biological roles of lncRNAs and uncover the regulatory networks upon which they impinge. This review focuses on our emerging understanding of lncRNAs in vertebrate animals, highlighting some recent advances in their functional analyses across several species and emphasizing the current challenges researchers face to characterize lncRNAs and identify their in vivo functions. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
International Nuclear Information System (INIS)
Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.
1987-01-01
The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation
2013-01-01
Background Small non-coding RNAs (ncRNAs) are important regulators of gene expression in eukaryotes. Previously, only microRNAs (miRNAs) and piRNAs have been identified in the silkworm, Bombyx mori. Furthermore, only ncRNAs (50-500nt) of intermediate size have been systematically identified in the silkworm. Results Here, we performed a systematic identification and analysis of small RNAs (18-50nt) associated with the Bombyx mori argonaute2 (BmAgo2) protein. Using RIP-seq, we identified various types of small ncRNAs associated with BmAGO2. These ncRNAs showed a multimodal length distribution, with three peaks at ~20nt, ~27nt and ~33nt, which included tRNA-, transposable element (TE)-, rRNA-, snoRNA- and snRNA-derived small RNAs as well as miRNAs and piRNAs. The tRNA-derived fragments (tRFs) were found at an extremely high abundance and accounted for 69.90% of the BmAgo2-associated small RNAs. Northern blotting confirmed that many tRFs were expressed or up-regulated only in the BmNPV-infected cells, implying that the tRFs play a prominent role by binding to BmAgo2 during BmNPV infection. Additional evidence suggested that there are potential cleavage sites on the D, anti-codon and TψC loops of the tRNAs. TE-derived small RNAs and piRNAs also accounted for a significant proportion of the BmAgo2-associated small RNAs, suggesting that BmAgo2 could be involved in the maintenance of genome stability by suppressing the activities of transposons guided by these small RNAs. Finally, Northern blotting was also used to confirm the Bombyx 5.8 s rRNA-derived small RNAs, demonstrating that various novel small RNAs exist in the silkworm. Conclusions Using an RIP-seq method in combination with Northern blotting, we identified various types of small RNAs associated with the BmAgo2 protein, including tRNA-, TE-, rRNA-, snoRNA- and snRNA-derived small RNAs as well as miRNAs and piRNAs. Our findings provide new clues for future functional studies of the role of small RNAs in insect
Hepatitis A virus-encoded miRNAs attenuate the accumulation of viral genomic RNAs in infected cells.
Shi, Jiandong; Sun, Jing; Wu, Meini; Hu, Ningzhu; Hu, Yunzhang
2016-06-01
The establishment of persistent infection with hepatitis A virus (HAV) is the common result of most HAV/cell culture systems. Previous observations show that the synthesis of viral RNAs is reduced during infection. However, the underlying mechanism is poorly understood. We characterized three HAV-encoded miRNAs in our previous study. In this study, we aim to investigate the impact of these miRNAs on the accumulation of viral RNAs. The results indicated that the synthesis of viral genomic RNAs was dramatically reduced (more than 75 % reduction, P viral miRNA mimics. Conversely, they were significantly increased (more than 3.3-fold addition, P viral miRNA inhibitors. The luciferase reporter assay of miRNA targets showed that viral miRNAs were fully complementary to specific sites of the viral plus or minus strand RNA and strongly inhibited their expressions. Further data showed that the relative abundance of viral genomic RNA fragments that contain miRNA targets was also dramatically reduced (more than 80 % reduction, P viral miRNAs were overexpressed with miRNA mimics. In contrast, they were significantly increased (approximately 2-fold addition, P viral miRNAs were inhibited with miRNA inhibitors. In conclusion, these data suggest a possible mechanism for the reduction of viral RNA synthesis during HAV infection. Thus, we propose that it is likely that RNA virus-derived miRNA could serve as a self-mediated feedback regulator during infection.
Ruggero, D; Londei, P
1996-01-01
Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.
Noncoding RNAs in Cancer Medicine
Directory of Open Access Journals (Sweden)
Laura Cerchia
2006-01-01
Full Text Available Several signalling proteins involved in cell growth and differentiation represent attractive candidate targets for cancer diagnosis and/or therapy since they can act as oncogenes. Because of their high specificity and low immunogeneicity, using artificial small noncoding RNA (ncRNAs as therapeutics has recently become a highly promising and rapidly expanding field of interest. Indeed, ncRNAs may either interfere with RNA transcription, stability, translation or directly hamper the function of the targets by binding to their surface. The recent finding that the expression of several genes is under the control of small single-stranded regulatory RNAs, including miRNAs, makes these genes as appropriate targets for ncRNA gene silencing. Furthermore, another class of small ncRNA, aptamers, act as high-affinity ligands and potential antagonists of disease-associated proteins. We will review here the recent and innovative methods that have been developed and the possible applications of ncRNAs as inhibitors or tracers in cancer medicine.
Whole cell probing with fluorescently labelled probes for in situ analysis of microbial populations
International Nuclear Information System (INIS)
Blackall, L.L.
2005-01-01
Until 1965, microbiologists struggled with simplicity of bacterial morphology and phenotypic characters in an attempt to construct a phylogenetic division for the prokaryotes. Then, it was found that molecular sequences were the source of much evolutionary information. Consequently, the way from phenotypic to genotypic characteristics for evolutionary inference was clear. Ribosomes within biological cells are the sites of protein synthesis. They are composed of a mixture of nucleic acids [ribosomal RiboNucleic Acids (rRNA)] and proteins and have an average size of 70s in bacteria. Because of their role in cell survival, maintenance and reproduction, rRNAs and their genes are described as being evolutionally conserved. Other genes can also be used to infer evolutionary relationships, and phylogenies inferred from all these molecules tend to concur. Comparative analyses of small subunit rRNA gene sequences were used in the 1980s to create a phylogeny or natural division for life on earth. It is composed of three domains - Bacteria, Archaea and Eucarya. The database of small subunit rRNA sequences is very large and allowed this broad comparative analysis to be done. In addition, the databases of these gene sequences are cumulative and constitute a growing resource available by modern communication channels to all researchers. The phylogenetic information has been used to clarify classification and taxonomic anomalies in the Bacteria and Archaea. Within the Bacteria, the small subunit rRNA is the 16S rRNA and the genes that code for this molecule are 16S rDNAs. In most cases, the 16S rDNA is exactly transcribed to form the 16S rRNA - i.e. the primary nucleic acid sequences of these two molecules are the same. Additionally, ribosomes of Bacteria contain the larger 23S rRNA (genes = 23R rDNAs), and sequence information from 23S rDNAs is also used to address evolutionary relationships between different Bacteria
The Host RNAs in Retroviral Particles
Directory of Open Access Journals (Sweden)
Alice Telesnitsky
2016-08-01
Full Text Available As they assemble, retroviruses encapsidate both their genomic RNAs and several types of host RNA. Whereas limited amounts of messenger RNA (mRNA are detectable within virion populations, the predominant classes of encapsidated host RNAs do not encode proteins, but instead include endogenous retroelements and several classes of non-coding RNA (ncRNA, some of which are packaged in significant molar excess to the viral genome. Surprisingly, although the most abundant host RNAs in retroviruses are also abundant in cells, unusual forms of these RNAs are packaged preferentially, suggesting that these RNAs are recruited early in their biogenesis: before associating with their cognate protein partners, and/or from transient or rare RNA populations. These RNAs’ packaging determinants differ from the viral genome’s, and several of the abundantly packaged host ncRNAs serve cells as the scaffolds of ribonucleoprotein particles. Because virion assembly is equally efficient whether or not genomic RNA is available, yet RNA appears critical to the structural integrity of retroviral particles, it seems possible that the selectively encapsidated host ncRNAs might play roles in assembly. Indeed, some host ncRNAs appear to act during replication, as some transfer RNA (tRNA species may contribute to nuclear import of human immunodeficiency virus 1 (HIV-1 reverse transcription complexes, and other tRNA interactions with the viral Gag protein aid correct trafficking to plasma membrane assembly sites. However, despite high conservation of packaging for certain host RNAs, replication roles for most of these selectively encapsidated RNAs—if any—have remained elusive.
Schmidt, Ulrike; Keck, Martin E; Buell, Dominik R
2015-06-01
In the last couple of years, non-coding (nc) RNAs like micro-RNAs (miRNAs), small interference RNAs (siRNAs) and long ncRNAs (lncRNAs) have emerged as promising candidates for biomarkers and drug-targets in a variety of psychiatric disorders. In contrast to reports on ncRNAs in affective disorders, schizophrenia and anxiety disorders, manuscripts on ncRNAs in posttraumatic stress disorder (PTSD) and associated animal models are scarce. Aiming to stimulate ncRNA research in PTSD and to identify the hitherto most promising ncRNA candidates and associated pathways for psychotrauma research, we conducted the first review on ncRNAs in PTSD. We aimed to identify studies reporting on the expression, function and regulation of ncRNAs in PTSD patients and in animals exhibiting a PTSD-like syndrome. Following the PRISMA guidelines for systematic reviews, we systematically screened the PubMed database for clinical and animal studies on ncRNAs in PTSD, animal models for PTSD and animal models employing a classical fear conditioning paradigm. Using 112 different combinations of search terms, we retrieved 523 articles of which we finally included and evaluated three clinical and 12 animal studies. In addition, using the web-based tool DIANA miRPath v2.0, we searched for molecular pathways shared by the predicted targets of the here-evaluated miRNA candidates. Our findings suggest that mir-132, which has been found to be regulated in three of the here included studies, as well as miRNAs with an already established role in Alzheimer's disease (AD) seem to be particularly promising candidates for future miRNA studies in PTSD. These results are limited by the low number of human trials and by the heterogeneity of included animal studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Role of Exosomal Noncoding RNAs in Lung Carcinogenesis
Directory of Open Access Journals (Sweden)
Tao Sun
2015-01-01
Full Text Available Lung cancer is the major cause of cancer death worldwide. Novel, recently discovered classes of noncoding RNAs (ncRNAs have diverse functional and regulatory activities and increasing evidence suggests crucial roles for deregulated ncRNAs in the onset and progression of cancer, including lung cancer. Exosomes are small extracellular membrane vesicles of endocytic origin that are released by many cells and are found in most body fluids. Tumor-derived exosomes mediate tumorigenesis by facilitating tumor growth and metastasis. MicroRNAs (miRNAs are a subclass of ncRNAs that are present in exosomes. miRNAs are taken up by neighboring or distant cells and modulate various functions of recipient cells. Here, we review exosome-derived ncRNAs with a focus on miRNAs and their role in lung cancer biology.
Protein-protein interactions within late pre-40S ribosomes.
Directory of Open Access Journals (Sweden)
Melody G Campbell
2011-01-01
Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
Cerebellar neurodegeneration in the absence of microRNAs
Schaefer, Anne; O'Carroll, Dónal; Tan, Chan Lek; Hillman, Dean; Sugimori, Mutsuyuki; Llinas, Rodolfo; Greengard, Paul
2007-01-01
Genome-encoded microRNAs (miRNAs) are potent regulators of gene expression. The significance of miRNAs in various biological processes has been suggested by studies showing an important role of these small RNAs in regulation of cell differentiation. However, the role of miRNAs in regulation of differentiated cell physiology is not well established. Mature neurons express a large number of distinct miRNAs, but the role of miRNAs in postmitotic neurons has not been examined. Here, we provide evidence for an essential role of miRNAs in survival of differentiated neurons. We show that conditional Purkinje cell–specific ablation of the key miRNA-generating enzyme Dicer leads to Purkinje cell death. Deficiency in Dicer is associated with progressive loss of miRNAs, followed by cerebellar degeneration and development of ataxia. The progressive neurodegeneration in the absence of Dicer raises the possibility of an involvement of miRNAs in neurodegenerative disorders. PMID:17606634
Regulatory Role of Circular RNAs and Neurological Disorders.
Floris, Gabriele; Zhang, Longbin; Follesa, Paolo; Sun, Tao
2017-09-01
Circular RNAs (circRNAs) are a class of long noncoding RNAs that are characterized by the presence of covalently linked ends and have been found in all life kingdoms. Exciting studies in regulatory roles of circRNAs are emerging. Here, we summarize classification, characteristics, biogenesis, and regulatory functions of circRNAs. CircRNAs are found to be preferentially expressed along neural genes and in neural tissues. We thus highlight the association of circRNA dysregulation with neurodegenerative diseases such as Alzheimer's disease. Investigation of regulatory role of circRNAs will shed novel light in gene expression mechanisms during development and under disease conditions and may identify circRNAs as new biomarkers for aging and neurodegenerative disorders.
Extracellular small RNAs: what, where, why?
Hoy, Anna M.; Buck, Amy H.
2012-01-01
miRNAs (microRNAs) are a class of small RNA that regulate gene expression by binding to mRNAs and modulating the precise amount of proteins that get expressed in a cell at a given time. This form of gene regulation plays an important role in developmental systems and is critical for the proper function of numerous biological pathways. Although miRNAs exert their functions inside the cell, these and other classes of RNA are found in body fluids in a cell-free form that is resistant to degradation by RNases. A broad range of cell types have also been shown to secrete miRNAs in association with components of the RISC (RNA-induced silencing complex) and/or encapsulation within vesicles, which can be taken up by other cells. In the present paper, we provide an overview of the properties of extracellular miRNAs in relation to their capacity as biomarkers, stability against degradation and mediators of cell–cell communication. PMID:22817753
Hidden layers of human small RNAs
DEFF Research Database (Denmark)
Kawaji, Hideya; Nakamura, Mari; Takahashi, Yukari
2008-01-01
small RNA have focused on miRNA and/or siRNA rather than on the exploration of additional classes of RNAs. RESULTS: Here, we explored human small RNAs by unbiased sequencing of RNAs with sizes of 19-40 nt. We provide substantial evidences for the existence of independent classes of small RNAs. Our data......BACKGROUND: Small RNA attracts increasing interest based on the discovery of RNA silencing and the rapid progress of our understanding of these phenomena. Although recent studies suggest the possible existence of yet undiscovered types of small RNAs in higher organisms, many studies to profile...... shows that well-characterized non-coding RNA, such as tRNA, snoRNA, and snRNA are cleaved at sites specific to the class of ncRNA. In particular, tRNA cleavage is regulated depending on tRNA type and tissue expression. We also found small RNAs mapped to genomic regions that are transcribed in both...
MicroRNAs as regulatory elements in psoriasis
Directory of Open Access Journals (Sweden)
Liu Yuan
2016-01-01
Full Text Available Psoriasis is a chronic, autoimmune, and complex genetic disorder that affects 23% of the European population. The symptoms of Psoriatic skin are inflammation, raised and scaly lesions. microRNA, which is short, nonprotein-coding, regulatory RNAs, plays critical roles in psoriasis. microRNA participates in nearly all biological processes, such as cell differentiation, development and metabolism. Recent researches reveal that multitudinous novel microRNAs have been identified in skin. Some of these substantial novel microRNAs play as a class of posttranscriptional gene regulator in skin disease, such as psoriasis. In order to insight into microRNAs biological functions and verify microRNAs biomarker, we review diverse references about characterization, profiling and subtype of microRNAs. Here we will share our opinions about how and which microRNAs are as regulatory in psoriasis.
Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S
2012-11-01
Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.
Proto-ribosome: a theoretical approach based on RNA relics
Demongeot, Jacques
2017-01-01
We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.
Non-Coding RNAs: Multi-Tasking Molecules in the Cell
Directory of Open Access Journals (Sweden)
Anita Quintal Gomes
2013-07-01
Full Text Available In the last years it has become increasingly clear that the mammalian transcriptome is highly complex and includes a large number of small non-coding RNAs (sncRNAs and long noncoding RNAs (lncRNAs. Here we review the biogenesis pathways of the three classes of sncRNAs, namely short interfering RNAs (siRNAs, microRNAs (miRNAs and PIWI-interacting RNAs (piRNAs. These ncRNAs have been extensively studied and are involved in pathways leading to specific gene silencing and the protection of genomes against virus and transposons, for example. Also, lncRNAs have emerged as pivotal molecules for the transcriptional and post-transcriptional regulation of gene expression which is supported by their tissue-specific expression patterns, subcellular distribution, and developmental regulation. Therefore, we also focus our attention on their role in differentiation and development. SncRNAs and lncRNAs play critical roles in defining DNA methylation patterns, as well as chromatin remodeling thus having a substantial effect in epigenetics. The identification of some overlaps in their biogenesis pathways and functional roles raises the hypothesis that these molecules play concerted functions in vivo, creating complex regulatory networks where cooperation with regulatory proteins is necessary. We also highlighted the implications of biogenesis and gene expression deregulation of sncRNAs and lncRNAs in human diseases like cancer.
Base Composition Characteristics of Mammalian miRNAs
Directory of Open Access Journals (Sweden)
Bin Wang
2013-01-01
Full Text Available MicroRNAs (miRNAs are short RNA sequences that repress protein synthesis by either inhibiting the translation of messenger RNA (mRNA or increasing mRNA degradation. Endogenous miRNAs have been found in various organisms, including animals, plants, and viruses. Mammalian miRNAs are evolutionarily conserved, are scattered throughout chromosomes, and play an important role in the immune response and the onset of cancer. For this study, the author explored the base composition characteristics of miRNA genes from the six mammalian species that contain the largest number of known miRNAs. It was found that mammalian miRNAs are evolutionarily conserved and GU-rich. Interestingly, in the miRNA sequences investigated, A residues are clearly the most frequent occupants of positions 2 and 3 of the 5′ end of miRNAs. Unlike G and U residues that may pair with C/U and A/G, respectively, A residues can only pair with U residues of target mRNAs, which may augment the recognition specificity of the 5′ seed region.
Directory of Open Access Journals (Sweden)
Paola Guglielmelli
Full Text Available Myeloproliferative neoplasms (MPN are chronic myeloid cancers thought to arise at the level of CD34+ hematopoietic stem/progenitor cells. They include essential thrombocythemia (ET, polycythemia vera (PV and primary myelofibrosis (PMF. All can progress to acute leukemia, but PMF carries the worst prognosis. Increasing evidences indicate that deregulation of microRNAs (miRNAs might plays an important role in hematologic malignancies, including MPN. To attain deeper knowledge of short RNAs (sRNAs expression pattern in CD34+ cells and of their possible role in mediating post-transcriptional regulation in PMF, we sequenced with Illumina HiSeq2000 technology CD34+ cells from healthy subjects and PMF patients. We detected the expression of 784 known miRNAs, with a prevalence of miRNA up-regulation in PMF samples, and discovered 34 new miRNAs and 99 new miRNA-offset RNAs (moRNAs, in CD34+ cells. Thirty-seven small RNAs were differentially expressed in PMF patients compared with healthy subjects, according to microRNA sequencing data. Five miRNAs (miR-10b-5p, miR-19b-3p, miR-29a-3p, miR-379-5p, and miR-543 were deregulated also in PMF granulocytes. Moreover, 3'-moR-128-2 resulted consistently downregulated in PMF according to RNA-seq and qRT-PCR data both in CD34+ cells and granulocytes. Target predictions of these validated small RNAs de-regulated in PMF and functional enrichment analyses highlighted many interesting pathways involved in tumor development and progression, such as signaling by FGFR and DAP12 and Oncogene Induced Senescence. As a whole, data obtained in this study deepened the knowledge of miRNAs and moRNAs altered expression in PMF CD34+ cells and allowed to identify and validate a specific small RNA profile that distinguishes PMF granulocytes from those of normal subjects. We thus provided new information regarding the possible role of miRNAs and, specifically, of new moRNAs in this disease.
Exploiting tRNAs to Boost Virulence
Directory of Open Access Journals (Sweden)
Suki Albers
2016-01-01
Full Text Available Transfer RNAs (tRNAs are powerful small RNA entities that are used to translate nucleotide language of genes into the amino acid language of proteins. Their near-uniform length and tertiary structure as well as their high nucleotide similarity and post-transcriptional modifications have made it difficult to characterize individual species quantitatively. However, due to the central role of the tRNA pool in protein biosynthesis as well as newly emerging roles played by tRNAs, their quantitative assessment yields important information, particularly relevant for virus research. Viruses which depend on the host protein expression machinery have evolved various strategies to optimize tRNA usage—either by adapting to the host codon usage or encoding their own tRNAs. Additionally, several viruses bear tRNA-like elements (TLE in the 5′- and 3′-UTR of their mRNAs. There are different hypotheses concerning the manner in which such structures boost viral protein expression. Furthermore, retroviruses use special tRNAs for packaging and initiating reverse transcription of their genetic material. Since there is a strong specificity of different viruses towards certain tRNAs, different strategies for recruitment are employed. Interestingly, modifications on tRNAs strongly impact their functionality in viruses. Here, we review those intersection points between virus and tRNA research and describe methods for assessing the tRNA pool in terms of concentration, aminoacylation and modification.
Kim, Min Jee; Wang, Ah Rha; Park, Jeong Sun; Kim, Iksoo
2014-10-01
We sequenced mitogenomes of five skippers (family Hesperiidae, Lepidoptera) to obtain further insight into the characteristics of butterfly mitogenomes and performed phylogenetic reconstruction using all available gene sequences (PCGs, rRNAs, and tRNAs) from 85 species (20 families in eight superfamilies). The general genomic features found in the butterflies also were found in the five skippers: a high A+T composition (79.3%-80.9%), dominant usage of TAA stop codon, similar skewness pattern in both strands, consistently length intergenic spacer sequence between tRNA(Gln) and ND2 (64-87 bp), conserved ATACTAA motif between tRNA(Ser (UCN)) and ND1, and characteristic features of the A+T-rich region (the ATAGA motif, varying length of poly-T stretch, and poly-A stretch). The start codon for COI was CGA in four skippers as typical, but Lobocla bifasciatus evidently possessed canonical ATG as start codon. All species had the ancestral arrangement tRNA(Asn)/tRNA(Ser (AGN)), instead of the rearrangement tRNA(Ser (AGN))/tRNA(Asn), found in another skipper species (Erynnis). Phylogenetic analyses using all available genes (PCGs, rRNAS, and tRNAs) yielded the consensus superfamilial relationships ((((((Bombycoidea+Noctuoidea+Geometroidea)+Pyraloidea)+Papilionoidea)+Tortricoidea)+Yponomeutoidea)+Hepialoidea), confirming the validity of Macroheterocera (Bombycoidea, Noctuoidea, and Geometroidea in this study) and its sister relationship to Pyraloidea. Within Rhopalocera (butterflies and skippers) the familial relationships (Papilionidae+(Hesperiidae+(Pieridae+((Lycaenidae+Riodinidae)+Nymphalidae)))) were strongly supported in all analyses (0.98-1 by BI and 96-100 by ML methods), rendering invalid the superfamily status for Hesperioidea. On the other hand, current mitogenome-based phylogeny did not find consistent superfamilial relationships among Noctuoidea, Geometroidea, and Bombycoidea and the familial relationships within Bombycoidea between analyses, requiring further
The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.
MacConnell, W P; Kaplan, N O
1982-05-25
The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.
MicroRNA-encoding long non-coding RNAs
Directory of Open Access Journals (Sweden)
Zhu Xiaopeng
2008-05-01
Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.
The Roles of MicroRNAs in Breast Cancer
International Nuclear Information System (INIS)
Takahashi, Ryou-u; Miyazaki, Hiroaki; Ochiya, Takahiro
2015-01-01
MicroRNAs (miRNAs) constitute a large family of small, approximately 20–22 nucleotide, non-coding RNAs that regulate the expression of target genes, mainly at the post-transcriptional level. Accumulating lines of evidence have indicated that miRNAs play important roles in the maintenance of biological homeostasis and that aberrant expression levels of miRNAs are associated with the onset of many diseases, including cancer. In various cancers, miRNAs play important roles in tumor initiation, drug resistance and metastasis. Recent studies reported that miRNAs could also be secreted via small endosome-derived vesicles called exosomes, which are derived from multiple cell types, including dendritic cells, lymphocytes, and tumor cells. Exosomal miRNAs play an important role in cell-to-cell communication and have been investigated as prognostic and diagnostic biomarkers. In this review, we summarize the major findings related to the functions of miRNAs in breast cancer, which is the most frequent cancer in women, and discuss the potential clinical uses of miRNAs, including their roles as therapeutic targets and diagnostic markers
The Roles of MicroRNAs in Breast Cancer
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Ryou-u [Division of Molecular and Cellular Medicine, National Cancer Center Research Institute 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045 (Japan); Miyazaki, Hiroaki [Division of Molecular and Cellular Medicine, National Cancer Center Research Institute 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045 (Japan); Department of Oral and Maxillofacial Surgery, Showa University School of Dentistry, 1-5-8 Hatanodai Shinagawa-ku, Tokyo 142-8555 (Japan); Ochiya, Takahiro, E-mail: tochiya@ncc.go.jp [Division of Molecular and Cellular Medicine, National Cancer Center Research Institute 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045 (Japan)
2015-04-09
MicroRNAs (miRNAs) constitute a large family of small, approximately 20–22 nucleotide, non-coding RNAs that regulate the expression of target genes, mainly at the post-transcriptional level. Accumulating lines of evidence have indicated that miRNAs play important roles in the maintenance of biological homeostasis and that aberrant expression levels of miRNAs are associated with the onset of many diseases, including cancer. In various cancers, miRNAs play important roles in tumor initiation, drug resistance and metastasis. Recent studies reported that miRNAs could also be secreted via small endosome-derived vesicles called exosomes, which are derived from multiple cell types, including dendritic cells, lymphocytes, and tumor cells. Exosomal miRNAs play an important role in cell-to-cell communication and have been investigated as prognostic and diagnostic biomarkers. In this review, we summarize the major findings related to the functions of miRNAs in breast cancer, which is the most frequent cancer in women, and discuss the potential clinical uses of miRNAs, including their roles as therapeutic targets and diagnostic markers.
Horizontal Transfer of Small RNAs To and From Plants
Directory of Open Access Journals (Sweden)
Lu eHan
2015-12-01
Full Text Available Genetic information is traditionally thought to be transferred from parents to offspring. However, there is evidence indicating that gene transfer can also occur from microbes to higher species, such as plants, invertebrates and vertebrates. This horizontal transfer can be carried out by small RNAs (sRNAs. sRNAs have been recently reported to move across kingdoms as mobile signals, spreading silencing information toward targeted genes. sRNAs, especially microRNAs (miRNAs and small interfering RNAs (siRNAs, are non-coding molecules that control gene expression at the transcriptional or post-transcriptional level. Some sRNAs act in a cross-kingdom manner between animals and their parasites, but little is known about such sRNAs associated with plants. In this report, we provide a brief introduction to miRNAs that are transferred from plants to mammals/viruses and siRNAs that are transferred from microbes to plants. Both miRNAs and siRNAs can exert corresponding functions in the target organisms. Additionally, we provide information concerning a host-induced gene silencing (HIGS system as a potential application that utilizes the transgenic trafficking of RNA molecules to silence the genes of interacting organisms. Moreover, we lay out the controversial views regarding cross-kingdom miRNAs and call for better methodology and experimental design to confirm this unique function of miRNAs.
International Nuclear Information System (INIS)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi
2016-01-01
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Energy Technology Data Exchange (ETDEWEB)
Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)
2016-04-22
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
MicroRNAs in Human Placental Development and Pregnancy Complications
Directory of Open Access Journals (Sweden)
Chun Peng
2013-03-01
Full Text Available MicroRNAs (miRNAs are small non-coding RNAs, which function as critical posttranscriptional regulators of gene expression by promoting mRNA degradation and translational inhibition. Placenta expresses many ubiquitous as well as specific miRNAs. These miRNAs regulate trophoblast cell differentiation, proliferation, apoptosis, invasion/migration, and angiogenesis, suggesting that miRNAs play important roles during placental development. Aberrant miRNAs expression has been linked to pregnancy complications, such as preeclampsia. Recent research of placental miRNAs focuses on identifying placental miRNA species, examining differential expression of miRNAs between placentas from normal and compromised pregnancies, and uncovering the function of miRNAs in the placenta. More studies are required to further understand the functional significance of miRNAs in placental development and to explore the possibility of using miRNAs as biomarkers and therapeutic targets for pregnancy-related disorders. In this paper, we reviewed the current knowledge about the expression and function of miRNAs in placental development, and propose future directions for miRNA studies.
MicroRNAs: regulators of oncogenesis and stemness
Directory of Open Access Journals (Sweden)
Papagiannakopoulos Thales
2008-06-01
Full Text Available Abstract MicroRNAs (miRNAs are essential post-transcriptional regulators that determine cell identity and fate. Aberrant expression of miRNAs can lead to diseases, including cancer. Expression of many miRNAs in the de-differentiated brain tumor cancer stem cells resembles that of neural stem cells. In this issue of BMC Medicine, Silber et al provide evidence of the expression of such miRNAs and their potential to mediate differentiation in both stem cell populations. In this commentary, we discuss the known functions of miRNAs in cancer and stem cells, their therapeutic potential and how the findings of Silber et al provide insight into the role of miR-124/miR-137 dysregulation in glioblastomas.
Senescent changes in the ribosomes of animal cells in vivo and in vitro
Miquel, J.; Johnson, J. E., Jr.
1979-01-01
The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.
Diverse microRNAs with convergent functions regulate tumorigenesis.
Zhu, Min-Yan; Zhang, Wei; Yang, Tao
2016-02-01
MicroRNAs (miRNAs) regulate several biological processes, including tumorigenesis. In order to comprehend the roles of miRNAs in cancer, various screens were performed to investigate the changes in the expression levels of miRNAs that occur in different types of cancer. The present review focuses on the results of five recent screens, whereby a number of overlapping miRNAs were identified to be downregulated or differentially regulated, whereas no miRNAs were observed to be frequently upregulated. Furthermore, the majority of the miRNAs that were common to >1 screen were involved in signaling networks, including wingless-related integration site, receptor tyrosine kinase and transforming growth factor-β, or in cell cycle checkpoint control. The present review will discuss the aforementioned miRNAs implicated in cell cycle checkpoint control and signaling networks.
Villota, Claudio; Campos, América; Vidaurre, Soledad; Oliveira-Cruz, Luciana; Boccardo, Enrique; Burzio, Verónica A.; Varas, Manuel; Villegas, Jaime; Villa, Luisa L.; Valenzuela, Pablo D. T.; Socías, Miguel; Roberts, Sally; Burzio, Luis O.
2012-01-01
The study of RNA and DNA oncogenic viruses has proved invaluable in the discovery of key cellular pathways that are rendered dysfunctional during cancer progression. An example is high risk human papillomavirus (HPV), the etiological agent of cervical cancer. The role of HPV oncogenes in cellular immortalization and transformation has been extensively investigated. We reported the differential expression of a family of human mitochondrial non-coding RNAs (ncRNAs) between normal and cancer cells. Normal cells express a sense mitochondrial ncRNA (SncmtRNA) that seems to be required for cell proliferation and two antisense transcripts (ASncmtRNAs). In contrast, the ASncmtRNAs are down-regulated in cancer cells. To shed some light on the mechanisms that trigger down-regulation of the ASncmtRNAs, we studied human keratinocytes (HFK) immortalized with HPV. Here we show that immortalization of HFK with HPV-16 or 18 causes down-regulation of the ASncmtRNAs and induces the expression of a new sense transcript named SncmtRNA-2. Transduction of HFK with both E6 and E7 is sufficient to induce expression of SncmtRNA-2. Moreover, E2 oncogene is involved in down-regulation of the ASncmtRNAs. Knockdown of E2 in immortalized cells reestablishes in a reversible manner the expression of the ASncmtRNAs, suggesting that endogenous cellular factors(s) could play functions analogous to E2 during non-HPV-induced oncogenesis. PMID:22539350
Villota, Claudio; Campos, América; Vidaurre, Soledad; Oliveira-Cruz, Luciana; Boccardo, Enrique; Burzio, Verónica A; Varas, Manuel; Villegas, Jaime; Villa, Luisa L; Valenzuela, Pablo D T; Socías, Miguel; Roberts, Sally; Burzio, Luis O
2012-06-15
The study of RNA and DNA oncogenic viruses has proved invaluable in the discovery of key cellular pathways that are rendered dysfunctional during cancer progression. An example is high risk human papillomavirus (HPV), the etiological agent of cervical cancer. The role of HPV oncogenes in cellular immortalization and transformation has been extensively investigated. We reported the differential expression of a family of human mitochondrial non-coding RNAs (ncRNAs) between normal and cancer cells. Normal cells express a sense mitochondrial ncRNA (SncmtRNA) that seems to be required for cell proliferation and two antisense transcripts (ASncmtRNAs). In contrast, the ASncmtRNAs are down-regulated in cancer cells. To shed some light on the mechanisms that trigger down-regulation of the ASncmtRNAs, we studied human keratinocytes (HFK) immortalized with HPV. Here we show that immortalization of HFK with HPV-16 or 18 causes down-regulation of the ASncmtRNAs and induces the expression of a new sense transcript named SncmtRNA-2. Transduction of HFK with both E6 and E7 is sufficient to induce expression of SncmtRNA-2. Moreover, E2 oncogene is involved in down-regulation of the ASncmtRNAs. Knockdown of E2 in immortalized cells reestablishes in a reversible manner the expression of the ASncmtRNAs, suggesting that endogenous cellular factors(s) could play functions analogous to E2 during non-HPV-induced oncogenesis.
MicroRNAs and toxicology: A love marriage
Directory of Open Access Journals (Sweden)
Elisabeth Schraml
Full Text Available With the dawn of personalized medicine, secreted microRNAs (miRNAs have come into the very focus of biomarker development for various diseases. MiRNAs fulfil key requirements of diagnostic tools such as i non or minimally invasive accessibility, ii robust, standardized and non-expensive quantitative analysis, iii rapid turnaround of the test result and iv most importantly because they provide a comprehensive snapshot of the ongoing physiologic processes in cells and tissues that package and release miRNAs into cell-free space. These characteristics have also established circulating miRNAs as promising biomarker candidates for toxicological studies, where they are used as biomarkers of drug-, or chemical-induced tissue injury for safety assessment. The tissue-specificity and early release of circulating miRNAs upon tissue injury, when damage is still reversible, are main factors for their clinical utility in toxicology. Here we summarize in brief, current knowledge of this field. Keywords: microRNAs, Biomarker, Toxicology, Minimal-invasive, DILI
Structural and Functional Motifs in Influenza Virus RNAs
Directory of Open Access Journals (Sweden)
Damien Ferhadian
2018-03-01
Full Text Available Influenza A viruses (IAV are responsible for recurrent influenza epidemics and occasional devastating pandemics in humans and animals. They belong to the Orthomyxoviridae family and their genome consists of eight (- sense viral RNA (vRNA segments of different lengths coding for at least 11 viral proteins. A heterotrimeric polymerase complex is bound to the promoter consisting of the 13 5′-terminal and 12 3′-terminal nucleotides of each vRNA, while internal parts of the vRNAs are associated with multiple copies of the viral nucleoprotein (NP, thus forming ribonucleoproteins (vRNP. Transcription and replication of vRNAs result in viral mRNAs (vmRNAs and complementary RNAs (cRNAs, respectively. Complementary RNAs are the exact positive copies of vRNAs; they also form ribonucleoproteins (cRNPs and are intermediate templates in the vRNA amplification process. On the contrary, vmRNAs have a 5′ cap snatched from cellular mRNAs and a 3′ polyA tail, both gained by the viral polymerase complex. Hence, unlike vRNAs and cRNAs, vmRNAs do not have a terminal promoter able to recruit the viral polymerase. Furthermore, synthesis of at least two viral proteins requires vmRNA splicing. Except for extensive analysis of the viral promoter structure and function and a few, mostly bioinformatics, studies addressing the vRNA and vmRNA structure, structural studies of the influenza A vRNAs, cRNAs, and vmRNAs are still in their infancy. The recent crystal structures of the influenza polymerase heterotrimeric complex drastically improved our understanding of the replication and transcription processes. The vRNA structure has been mainly studied in vitro using RNA probing, but its structure has been very recently studied within native vRNPs using crosslinking and RNA probing coupled to next generation RNA sequencing. Concerning vmRNAs, most studies focused on the segment M and NS splice sites and several structures initially predicted by bioinformatics analysis
The expanding universe of noncoding RNAs.
Hannon, G J; Rivas, F V; Murchison, E P; Steitz, J A
2006-01-01
The 71st Cold Spring Harbor Symposium on Quantitative Biology celebrated the numerous and expanding roles of regulatory RNAs in systems ranging from bacteria to mammals. It was clearly evident that noncoding RNAs are undergoing a renaissance, with reports of their involvement in nearly every cellular process. Previously known classes of longer noncoding RNAs were shown to function by every possible means-acting catalytically, sensing physiological states through adoption of complex secondary and tertiary structures, or using their primary sequences for recognition of target sites. The many recently discovered classes of small noncoding RNAs, generally less than 35 nucleotides in length, most often exert their effects by guiding regulatory complexes to targets via base-pairing. With the ability to analyze the RNA products of the genome in ever greater depth, it has become clear that the universe of noncoding RNAs may extend far beyond the boundaries we had previously imagined. Thus, as much as the Symposium highlighted exciting progress in the field, it also revealed how much farther we must go to understand fully the biological impact of noncoding RNAs.
MicroRNAs as a selective channel of communication between competing RNAs: a steady-state theory.
Figliuzzi, Matteo; Marinari, Enzo; De Martino, Andrea
2013-03-05
It has recently been suggested that the competition for a finite pool of microRNAs (miRNA) gives rise to effective interactions among their common targets (competing endogenous RNAs or ceRNAs) that could prove to be crucial for posttranscriptional regulation. We have studied a minimal model of posttranscriptional regulation where the emergence and the nature of such interactions can be characterized in detail at steady state. Sensitivity analysis shows that binding free energies and repression mechanisms are the key ingredients for the cross-talk between ceRNAs to arise. Interactions emerge in specific ranges of repression values, can be symmetrical (one ceRNA influences another and vice versa) or asymmetrical (one ceRNA influences another but not the reverse), and may be highly selective, while possibly limited by noise. In addition, we show that nontrivial correlations among ceRNAs can emerge in experimental readouts due to transcriptional fluctuations even in the absence of miRNA-mediated cross-talk. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system
International Nuclear Information System (INIS)
Suessmuth, R.; Widmann, A.
1979-01-01
γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de
Directory of Open Access Journals (Sweden)
Rodney Owusu-Darko
2017-06-01
Full Text Available Bacillus oleronius strain DSM 9356 isolated from the termite Reticulitermes santonensis was sequenced to gain insights in relation to its closest phylogenetic neighbor Bacillus sporothermodurans. The draft genome of strain DSM 9356 contains 5,083,966 bp with an estimated G + C content of 35%, 4899 protein-coding genes, 116 tRNAs and 18 rRNAs. The RAST annotation assigned these genes into 462 subsystems, with the maximum number of genes associated with amino acids and derivatives metabolism (14.84%, followed by carbohydrates (13.89% and protein metabolism subsystems (9.10%. The draft genome sequence and annotation has been deposited at NCBI under the accession number MTLA00000000.
Complete mitochondrial genome of the spadenose shark (Scoliodon macrorhynchos).
Chen, Xiao; Peng, Xin; Zhang, Peng; Yang, Shenyun; Liu, Min
2014-04-01
We firstly presented the complete mitogenome of the spadenose shark Scoliodon macrorhynchos (Carcharhinidae, Carcharhiniformes). The mitogenome is 16,693 bp long and contains 13 protein-coding genes, two rRNAs, 22 tRNAs and one control region, a typical vertebrate arrangement. The codon usage bias was different between the H-strand and L-strand encoded protein genes. All tRNA genes have the typical cloverleaf secondary structure excepting tRNA-Ser2, in which the dihydrouridine (DHU) arm is replaced by a simple loop with 12 unpaired nucleotides. A termination associated sequence and three conserved sequence blocks (CSB I-III) were identified in the control region, which were considered associating with the replication and transcription of mitogenome.
Hu, Guang Fu; Liu, Xiang Jiang; Zou, Gui Wei; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na
2016-01-01
We sequenced the complete mitogenomes of (Cyprinus carpio haematopterus) and Russian scattered scale mirror carp (Cyprinus carpio carpio). Comparison of these two mitogenomes revealed that the mitogenomes of these two common carp strains were remarkably similar in genome length, gene order and content, and AT content. There were only 55 bp variations in 16,581 nucleotides. About 1 bp variation was located in rRNAs, 2 bp in tRNAs, 9 bp in the control region and 43 bp in protein-coding genes. Furthermore, forty-three variable nucleotides in the protein-coding genes of the two strains led to four variable amino acids, which were located in the ND2, ATPase 6, ND5 and ND6 genes, respectively.
Non-coding RNAs in the Ovarian Follicle
Directory of Open Access Journals (Sweden)
Rosalia Battaglia
2017-05-01
Full Text Available The mammalian ovarian follicle is the complex reproductive unit comprising germ cell, somatic cells (Cumulus and Granulosa cells, and follicular fluid (FF: paracrine communication among the different cell types through FF ensures the development of a mature oocyte ready for fertilization. This paper is focused on non-coding RNAs in ovarian follicles and their predicted role in the pathways involved in oocyte growth and maturation. We determined the expression profiles of microRNAs in human oocytes and FF by high-throughput analysis and identified 267 microRNAs in FF and 176 in oocytes. Most of these were FF microRNAs, while 9 were oocyte specific. By bioinformatic analysis, independently performed on FF and oocyte microRNAs, we identified the most significant Biological Processes and the pathways regulated by their validated targets. We found many pathways shared between the two compartments and some specific for oocyte microRNAs. Moreover, we found 41 long non-coding RNAs able to interact with oocyte microRNAs and potentially involved in the regulation of folliculogenesis. These data are important in basic reproductive research and could also be useful for clinical applications. In fact, the characterization of non-coding RNAs in ovarian follicles could improve reproductive disease diagnosis, provide biomarkers of oocyte quality in Assisted Reproductive Treatment, and allow the development of therapies for infertility disorders.
A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death
Directory of Open Access Journals (Sweden)
Bruce R. Levin
2017-02-01
Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
DEFF Research Database (Denmark)
Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne
2011-01-01
Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...
Regulatory RNAs derived from transfer RNA?
Pederson, Thoru
2010-10-01
Four recent studies suggest that cleavages of transfer RNAs generate products with microRNA-like features, with some evidence of function. If their regulatory functions were to be confirmed, these newly revealed RNAs would add to the expanding repertoire of small noncoding RNAs and would also provide new perspectives on the coevolution of transfer RNA and messenger RNA.
MicroRNAs Expression Profiles in Cardiovascular Diseases
Directory of Open Access Journals (Sweden)
Elsa Bronze-da-Rocha
2014-01-01
Full Text Available The current search for new markers of cardiovascular diseases (CVDs is explained by the high morbidity and mortality still observed in developed and developing countries due to cardiovascular events. Recently, microRNAs (miRNAs or miRs have emerged as potential new biomarkers and are small sequences of RNAs that regulate gene expression at posttranscriptional level by inhibiting translation or inducing degradation of the target mRNAs. Circulating miRNAs are involved in the regulation of signaling pathways associated to aging and can be used as novel diagnostic markers for acute and chronic diseases such as cardiovascular pathologies. This review summarizes the biogenesis, maturation, and stability of miRNAs and their use as potential biomarkers for coronary artery disease (CAD, myocardial infarction (MI, and heart failure (HF.
Studies on the catalytic rate constant of ribosomal peptidyltransferase.
Synetos, D; Coutsogeorgopoulos, C
1987-02-20
A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.
Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros
2014-01-01
Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589
Identification of novel sRNAs in mycobacterial species.
Directory of Open Access Journals (Sweden)
Chen-Hsun Tsai
Full Text Available Bacterial small RNAs (sRNAs are short transcripts that typically do not encode proteins and often act as regulators of gene expression through a variety of mechanisms. Regulatory sRNAs have been identified in many species, including Mycobacterium tuberculosis, the causative agent of tuberculosis. Here, we use a computational algorithm to predict sRNA candidates in the mycobacterial species M. smegmatis and M. bovis BCG and confirmed the expression of many sRNAs using Northern blotting. Thus, we have identified 17 and 23 novel sRNAs in M. smegmatis and M. bovis BCG, respectively. We have also applied a high-throughput technique (Deep-RACE to map the 5' and 3' ends of many of these sRNAs and identified potential regulators of sRNAs by analysis of existing ChIP-seq datasets. The sRNAs identified in this work likely contribute to the unique biology of mycobacteria.
microRNAs and lipid metabolism
Aryal, Binod; Singh, Abhishek K.; Rotllan, Noemi; Price, Nathan; Fernández-Hernando, Carlos
2017-01-01
Purpose of review Work over the last decade has identified the important role of microRNAs (miRNAS) in regulating lipoprotein metabolism and associated disorders including metabolic syndrome, obesity and atherosclerosis. This review summarizes the most recent findings in the field, highlighting the contribution of miRNAs in controlling low-density lipoprotein (LDL) and high-density lipoprotein (HDL) metabolism. Recent findings A number of miRNAs have emerged as important regulators of lipid metabolism, including miR-122 and miR-33. Work over the last two years has identified additional functions of miR-33 including the regulation of macrophage activation and mitochondrial metabolism. Moreover, it has recently been shown that miR-33 regulates vascular homeostasis and cardiac adaptation in response to pressure overload. In addition to miR-33 and miR-122, recent GWAS have identified single nucleotide polymorphisms (SNP) in the proximity of miRNAs genes associated with abnormal levels of circulating lipids in humans. Several of these miRNA, such as miR-148a and miR-128-1, target important proteins that regulate cellular cholesterol metabolism, including the low-density lipoprotein receptor (LDLR) and the ATP-binding cassette A1 (ABCA1). Summary microRNAs have emerged as critical regulators of cholesterol metabolism and promising therapeutic targets for treating cardiometabolic disorders including atherosclerosis. Here, we discuss the recent findings in the field highlighting the novel mechanisms by which miR-33 controls lipid metabolism and atherogenesis and the identification of novel miRNAs that regulate LDL metabolism. Finally, we summarize the recent findings that identified miR-33 as an important non-coding RNA that controls cardiovascular homeostasis independent of its role in regulating lipid metabolism. PMID:28333713
Further characterization of ribosome binding to thylakoid membranes
International Nuclear Information System (INIS)
Hurewitz, J.; Jagendorf, A.T.
1987-01-01
Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins
Structure of Vibrio cholerae ribosome hibernation promoting factor
International Nuclear Information System (INIS)
De Bari, Heather; Berry, Edward A.
2013-01-01
The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding
Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B
1987-08-01
The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.
Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics
Yonath, Ada
An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.
López-Lastra, M; Ulrici, S; Gabus, C; Darlix, J L
1999-10-01
Mouse virus-like 30S RNAs (VL30m) constitute a family of retrotransposons, present at 100 to 200 copies, dispersed in the mouse genome. They display little sequence homology to Moloney murine leukemia virus (MoMLV), do not encode virus-like proteins, and have not been implicated in retroviral carcinogenesis. However, VL30 RNAs are efficiently packaged into MLV particles that are propagated in cell culture. In this study, we addressed whether the 5' region of VL30m could replace the 5' leader of MoMLV functionally in a recombinant vector construct. Our data confirm that the putative packaging sequence of VL30 is located within the 5' region (nucleotides 362 to 1149 with respect to the cap structure) and that it can replace the packaging sequence of MoMLV. We also show that VL30m contains an internal ribosome entry segment (IRES) in the 5' region, as do MoMLV, Friend murine leukemia virus, Harvey murine sarcoma virus, and avian reticuloendotheliosis virus type A. Our data show that both the packaging and IRES functions of the 5' region of VL30m RNA can be efficiently used to develop retrotransposon-based vectors.
Directory of Open Access Journals (Sweden)
Alves Leonardo
2010-03-01
Full Text Available Abstract Background microRNAs (miRNAs are endogenous small non-coding RNAs that post-transcriptionally regulate gene expression. In plants, they typically show high complementarity to a single sequence motif within their target mRNAs and act by catalyzing specific mRNA cleavage and degradation. miRNAs are processed from much longer primary transcripts via precursor miRNAs containing fold-back structures. Leaving these secondary structures intact, miRNAs can be re-designed experimentally to target mRNAs of choice. Results We designed primary synthetic miRNAs (pri-smiRNAs on the basis of the primary transcript of the Arabidopsis MIR159A gene by replacing the original miR159a and the corresponding miR159a* with novel sequences, keeping the overall secondary structure as predicted by the program RNAfold. We used the program RNAhybrid to optimize smiRNA design and to screen the complete Arabidopsis transcriptome for potential off-targets. To improve the molecular cloning of the pri-smiRNA we inserted restriction sites in the original MIR159A primary transcript to easily accommodate the smiRNA/smiRNA* DNA fragment. As a proof-of-concept, we targeted the single gene encoding chalcone synthase (CHS in Arabidopsis. We demonstrate smiRNA(CHS expression and CHS mRNA cleavage in different transgenic lines. Phenotypic changes in these lines were observed for seed color and flavonol derivatives, and quantified with respect to anthocyanin content. We also tested the effect of mismatches and excess G:U base pairs on knockdown efficiency. Conclusions RNAhybrid-assisted design of smiRNAs and generation of pri-smiRNAs using a novel vector containing restriction sites greatly improves specificity and speed of the generation of stable knockdown lines for functional analyses in plants.
Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.
Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C
2016-04-01
Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.
Purification and properties of a ribosomal casein kinase from rabbit reticulocytes
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...
Immunomodulating microRNAs of mycobacterial infections.
Bettencourt, Paulo; Pires, David; Anes, Elsa
2016-03-01
MicroRNAs are a class of small non-coding RNAs that have emerged as key regulators of gene expression at the post-transcriptional level by sequence-specific binding to target mRNAs. Some microRNAs block translation, while others promote mRNA degradation, leading to a reduction in protein availability. A single miRNA can potentially regulate the expression of multiple genes and their encoded proteins. Therefore, miRNAs can influence molecular signalling pathways and regulate many biological processes in health and disease. Upon infection, host cells rapidly change their transcriptional programs, including miRNA expression, as a response against the invading microorganism. Not surprisingly, pathogens can also alter the host miRNA profile to their own benefit, which is of major importance to scientists addressing high morbidity and mortality infectious diseases such as tuberculosis. In this review, we present recent findings on the miRNAs regulation of the host response against mycobacterial infections, providing new insights into host-pathogen interactions. Understanding these findings and its implications could reveal new opportunities for designing better diagnostic tools, therapies and more effective vaccines. Copyright © 2015 Elsevier Ltd. All rights reserved.
MicroRNAs in right ventricular remodelling.
Batkai, Sandor; Bär, Christian; Thum, Thomas
2017-10-01
Right ventricular (RV) remodelling is a lesser understood process of the chronic, progressive transformation of the RV structure leading to reduced functional capacity and subsequent failure. Besides conditions concerning whole hearts, some pathology selectively affects the RV, leading to a distinct RV-specific clinical phenotype. MicroRNAs have been identified as key regulators of biological processes that drive the progression of chronic diseases. The role of microRNAs in diseases affecting the left ventricle has been studied for many years, however there is still limited information on microRNAs specific to diseases in the right ventricle. Here, we review recently described details on the expression, regulation, and function of microRNAs in the pathological remodelling of the right heart. Recently identified strategies using microRNAs as pharmacological targets or biomarkers will be highlighted. Increasing knowledge of pathogenic microRNAs will finally help improve our understanding of underlying distinct mechanisms and help utilize novel targets or biomarkers to develop treatments for patients suffering from right heart diseases. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions, please email: journals.permissions@oup.com.
Simulation and analysis of single-ribosome translation
International Nuclear Information System (INIS)
Tinoco, Ignacio Jr; Wen, Jin-Der
2009-01-01
In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation
The therapeutic potential of MicroRNAs in cancer
DEFF Research Database (Denmark)
Thorsen, Stine Buch; Obad, Susanna; Jensen, Niels Frank
2012-01-01
MicroRNAs (miRNAs) have been uncovered as important posttranscriptional regulators of nearly every biological process in the cell. Furthermore, mounting evidence implies that miRNAs play key roles in the pathogenesis of cancer and that many miRNAs can function either as oncogenes or tumor...
Origins and Early Evolution of the tRNA Molecule
Directory of Open Access Journals (Sweden)
Koji Tamura
2015-12-01
Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.
Rethinking the central dogma: noncoding RNAs are biologically relevant.
Robinson, Victoria L
2009-01-01
Non-coding RNAs (ncRNAs) are a large class of functional molecules with over 100 unique classes described to date. ncRNAs are diverse in terms of their function and size. A relatively new class of small ncRNA, called microRNAs (miRNA), have received a great deal of attention in the literature in recent years. miRNAs are endogenously encoded gene families that demonstrate striking evolutionary conservation. miRNAs serve essential and diverse physiological functions such as differentiation and development, proliferation, maintaining cell type phenotypes, and many others. The discovery and ongoing investigation of miRNAs is part of a revolution in biology that is changing the basic concepts of gene expression and RNA functionality. A single miRNA can participate in controlling the expression of up to several hundred protein-coding genes by interacting with mRNAs, generally in 3' untranslated regions. Our new and developing understanding of miRNAs, and other ncRNAs, promises to lead to significant contributions to medicine. Specifically, miRNAs are likely to serve as the basis for novel therapies and diagnostic tools.
An Easy Method for Plant Polysome Profiling.
Lecampion, Cécile; Floris, Maïna; Fantino, Jean Raphaël; Robaglia, Christophe; Laloi, Christophe
2016-08-28
Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.
Circular RNAs as Promising Biomarkers: A mini-review
Directory of Open Access Journals (Sweden)
Nadiah Abu
2016-08-01
Full Text Available The interest in circular RNAs has resurfaced in the past few years. What was considered as junk for nearly two decades is now one of the most interesting molecules. Circular RNAs are non-coding RNAs that are formed by back-splicing events and have covalently closed loops with no poly-adenylated tails. The regulation of circular RNAs is distinctive and they are selectively abundant in different types of tissues. Based on the current knowledge of circular RNAs, these molecules have the potential to be the next big thing especially as biomarkers for different diseases. This mini-review attempts to concisely look at the biology of circular RNAs, the putative functional activities, the prevalence of circular RNAs, and the possible role of circular RNA as biomarkers for diagnosis or measuring drug response.
The Potential of MicroRNAs as Prostate Cancer Biomarkers
L. Fabris (Linda); Y. Ceder (Yvonne); A.M. Chinnaiyan (Arul); G.W. Jenster (Guido); K.D. Sorensen (Karina D.); S.A. Tomlins (Scott A); T. Visakorpi (Tapio); G.A. Calin (George)
2016-01-01
textabstractContext: Short noncoding RNAs known as microRNAs (miRNAs) control protein expression through the degradation of RNA or the inhibition of protein translation. The miRNAs influence a wide range of biologic processes and are often deregulated in cancer. This family of small RNAs constitutes
MicroRNAs Change the Landscape of Cancer Resistance.
Zhu, Jun; Zhu, Wei; Wu, Wei
2018-01-01
One of the major challenges in the cancer treatment is the development of drug resistance. It represents a major obstacle to curing cancer with constrained efficacy of both conventional chemotherapy and targeted therapies, even recent immune checkpoint blockade therapy. Deciphering the mechanisms of resistance is critical to further understanding the multifactorial pathways involved, and developing more specific targeted treatments. To date, numerous studies have reported the potential role of microRNAs (miRNAs) in the resistance to various cancer treatments. MicroRNAs are a family of small noncoding RNAs that regulate gene expression by sequence-specific targeting of mRNAs causing translational repression or mRNA degradation. More than 1200 validated human miRNAs have been identified in human genome. While one miRNA can regulate hundreds of targets, a single target can also be affected by multiple miRNAs. Evidence suggests that dysregulation of specific miRNAs may be involved in the acquisition of resistance, thereby modulating the sensitivity of cancer cells to treatment. Therefore, manipulation of miRNAs may be an attractive strategy for more effective individualized therapies through reprograming resistant network in cancer cells.
Andreeva, Irena
2018-01-01
During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209
DEFF Research Database (Denmark)
Gutierrez, Belen; Douthwaite, Stephen Roger; Gonzalez-Zorn, Bruno
2013-01-01
(housekeeping) modifications at m (4)Cm1402, m (3)U1498, m (2)G1516, m (6) 2A1518, and m (6) 2A1519; helix 69 is modified at m (3)Ψ1915, with m (5)U1939 and m (5)C1962 modification in adjacent sequences. All modifications were close to stoichiometric, with the exception of m (3)Ψ1915, where about 80% of r...
MicroRNAs: A Puzzling Tool in Cancer Diagnostics and Therapy.
D'Angelo, Barbara; Benedetti, Elisabetta; Cimini, Annamaria; Giordano, Antonio
2016-11-01
MicroRNAs (miRNAs) constitute a dominating class of small RNAs that regulate diverse cellular functions. Due the pivotal role of miRNAs in biological processes, a deregulated miRNA expression is likely involved in human cancers. MicroRNAs possess tumor suppressor capability, as well as display oncogenic characteristics. Interestingly, miRNAs exist in various biological fluids as circulating entities. Changes in the profile of circulating miRNAs are indicative of pathophysiological conditions in human cancer. This concept has led to consider circulating miRNAs valid biomarkers in cancer diagnostics. Furthermore, current research promotes the use of miRNAs as a target in cancer therapy. However, miRNAs are an evolving research field. Although miRNAs have been demonstrated to be potentially valuable tools both in cancer diagnosis and treatment, a greater effort should be made to improve our understanding of miRNAs biology. This review describes the biology of microRNAs, emphasizing on the use of miRNAs in cancer diagnostics and therapy. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Characterization of piRNAs across postnatal development in mouse brain
Ghosheh, Yanal; Seridi, Loqmane; Ryu, Tae Woo; Takahashi, Hazuki; Orlando, Valerio; Carninci, Piero; Ravasi, Timothy
2016-01-01
PIWI-interacting RNAs (piRNAs) are responsible for maintaining the genome stability by silencing retrotransposons in germline tissues– where piRNAs were first discovered and thought to be restricted. Recently, novel functions were reported for piRNAs in germline and somatic cells. Using deep sequencing of small RNAs and CAGE of postnatal development of mouse brain, we identified piRNAs only in adult mouse brain. These piRNAs have similar sequence length as those of MILI-bound piRNAs. In addition, we predicted novel candidate regulators and putative targets of adult brain piRNAs.
Characterization of piRNAs across postnatal development in mouse brain
Ghosheh, Yanal
2016-04-26
PIWI-interacting RNAs (piRNAs) are responsible for maintaining the genome stability by silencing retrotransposons in germline tissues– where piRNAs were first discovered and thought to be restricted. Recently, novel functions were reported for piRNAs in germline and somatic cells. Using deep sequencing of small RNAs and CAGE of postnatal development of mouse brain, we identified piRNAs only in adult mouse brain. These piRNAs have similar sequence length as those of MILI-bound piRNAs. In addition, we predicted novel candidate regulators and putative targets of adult brain piRNAs.
Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.
2016-01-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417
Structural basis for precursor protein-directed ribosomal peptide macrocyclization.
Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D
2016-11-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.
Directory of Open Access Journals (Sweden)
Chaoqun Li
2018-01-01
Full Text Available Although studies provide insights into the neurobiology of stress and depression, the exact molecular mechanisms underlying their pathologies remain largely unknown. Long non-coding RNA (lncRNA has been implicated in brain functions and behavior. A potential link between lncRNA and psychiatric disorders has been proposed. However, it remains undetermined whether IncRNA regulation, in the brain, contributes to stress or depression pathologies. In this study, we used a valid animal model of depression-like symptoms; namely learned helplessness, RNA-seq, Gene Ontology and co-expression network analyses to profile the expression pattern of lncRNA and mRNA in the hippocampus of mice. We identified 6346 differentially expressed transcripts. Among them, 340 lncRNAs and 3559 protein coding mRNAs were differentially expressed in helpless mice in comparison with control and/or non-helpless mice (inescapable stress resilient mice. Gene Ontology and pathway enrichment analyses indicated that induction of helplessness altered expression of mRNAs enriched in fundamental biological functions implicated in stress/depression neurobiology such as synaptic, metabolic, cell survival and proliferation, developmental and chromatin modification functions. To explore the possible regulatory roles of the altered lncRNAs, we constructed co-expression networks composed of the lncRNAs and mRNAs. Among our differentially expressed lncRNAs, 17% showed significant correlation with genes. Functional co-expression analysis linked the identified lncRNAs to several cellular mechanisms implicated in stress/depression neurobiology. Importantly, 57% of the identified regulatory lncRNAs significantly correlated with 18 different synapse-related functions. Thus, the current study identifies for the first time distinct groups of lncRNAs regulated by induction of learned helplessness in the mouse brain. Our results suggest that lncRNA-directed regulatory mechanisms might contribute to
Li, Chaoqun; Cao, Feifei; Li, Shengli; Huang, Shenglin; Li, Wei; Abumaria, Nashat
2017-01-01
Although studies provide insights into the neurobiology of stress and depression, the exact molecular mechanisms underlying their pathologies remain largely unknown. Long non-coding RNA (lncRNA) has been implicated in brain functions and behavior. A potential link between lncRNA and psychiatric disorders has been proposed. However, it remains undetermined whether IncRNA regulation, in the brain, contributes to stress or depression pathologies. In this study, we used a valid animal model of depression-like symptoms; namely learned helplessness, RNA-seq, Gene Ontology and co-expression network analyses to profile the expression pattern of lncRNA and mRNA in the hippocampus of mice. We identified 6346 differentially expressed transcripts. Among them, 340 lncRNAs and 3559 protein coding mRNAs were differentially expressed in helpless mice in comparison with control and/or non-helpless mice (inescapable stress resilient mice). Gene Ontology and pathway enrichment analyses indicated that induction of helplessness altered expression of mRNAs enriched in fundamental biological functions implicated in stress/depression neurobiology such as synaptic, metabolic, cell survival and proliferation, developmental and chromatin modification functions. To explore the possible regulatory roles of the altered lncRNAs, we constructed co-expression networks composed of the lncRNAs and mRNAs. Among our differentially expressed lncRNAs, 17% showed significant correlation with genes. Functional co-expression analysis linked the identified lncRNAs to several cellular mechanisms implicated in stress/depression neurobiology. Importantly, 57% of the identified regulatory lncRNAs significantly correlated with 18 different synapse-related functions. Thus, the current study identifies for the first time distinct groups of lncRNAs regulated by induction of learned helplessness in the mouse brain. Our results suggest that lncRNA-directed regulatory mechanisms might contribute to stress
Nicolas, Francisco Esteban; Moxon, Simon; de Haro, Juan P.; Calo, Silvia; Grigoriev, Igor V.; Torres-Martínez, Santiago; Moulton, Vincent; Ruiz-Vázquez, Rosa M.; Dalmay, Tamas
2010-01-01
Endogenous short RNAs (esRNAs) play diverse roles in eukaryotes and usually are produced from double-stranded RNA (dsRNA) by Dicer. esRNAs are grouped into different classes based on biogenesis and function but not all classes are present in all three eukaryotic kingdoms. The esRNA register of fungi is poorly described compared to other eukaryotes and it is not clear what esRNA classes are present in this kingdom and whether they regulate the expression of protein coding genes. However, evidence that some dicer mutant fungi display altered phenotypes suggests that esRNAs play an important role in fungi. Here, we show that the basal fungus Mucor circinelloides produces new classes of esRNAs that map to exons and regulate the expression of many protein coding genes. The largest class of these exonic-siRNAs (ex-siRNAs) are generated by RNA-dependent RNA Polymerase 1 (RdRP1) and dicer-like 2 (DCL2) and target the mRNAs of protein coding genes from which they were produced. Our results expand the range of esRNAs in eukaryotes and reveal a new role for esRNAs in fungi. PMID:20427422
Energy Technology Data Exchange (ETDEWEB)
Grigoriev, Igor; Nicolas, Francisco; Moxon, Simon; Haro, Juan de; Calo, Silvia; Torres-Martinez, Santiago; Moulton, Vincent; Ruiz-Vazquez, Rosa; Dalmay, Tamas
2011-09-01
Endogenous short RNAs (esRNAs) play diverse roles in eukaryotes and usually are produced from double-stranded RNA (dsRNA) by Dicer. esRNAs are grouped into different classes based on biogenesis and function but not all classes are present in all three eukaryotic kingdoms. The esRNA register of fungi is poorly described compared to other eukaryotes and it is not clear what esRNA classes are present in this kingdom and whether they regulate the expression of protein coding genes. However, evidence that some dicer mutant fungi display altered phenotypes suggests that esRNAs play an important role in fungi. Here, we show that the basal fungus Mucor circinelloides produces new classes of esRNAs that map to exons and regulate the expression of many protein coding genes. The largest class of these exonic-siRNAs (ex-siRNAs) are generated by RNA-dependent RNA Polymerase 1 (RdRP1) and dicer-like 2 (DCL2) and target the mRNAs of protein coding genes from which they were produced. Our results expand the range of esRNAs in eukaryotes and reveal a new role for esRNAs in fungi
Exosomal miRNAs as biomarkers for prostate cancer
Directory of Open Access Journals (Sweden)
Nina Pettersen Hessvik
2013-03-01
Full Text Available miRNAs are small non-coding RNAs that finely regulate gene expression in cells. Alterations in miRNA expression have been associated with development of cancer, and miRNAs are now being investigated as biomarkers for cancer as well as other diseases. Recently, miRNAs have been found outside cells in body fluids. Extracellular miRNAs exist in different forms - associated with Ago2 proteins, loaded into extracellular vesicles (exosomes, microvesicles or apoptotic bodies or into high density lipoprotein particles. These extracellular miRNAs are probably products of distinct cellular processes, and might therefore play different roles. However, their functions in vivo are currently unknown. In spite of this, they are considered as promising, noninvasive diagnostic and prognostic tools. Prostate cancer is the most common cancer in men in the Western world, but the currently used biomarker (prostate specific antigen has low specificity. Therefore, novel biomarkers are highly needed. In this review we will discuss possible biological functions of extracellular miRNAs, as well as the potential use of miRNAs from extracellular vesicles as biomarkers for prostate cancer.
Identification of Bacterial Small RNAs by RNA Sequencing
DEFF Research Database (Denmark)
Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren
2014-01-01
sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....
Smoking-related microRNAs and mRNAs in human peripheral blood mononuclear cells
International Nuclear Information System (INIS)
Su, Ming-Wei; Yu, Sung-Liang; Lin, Wen-Chang; Tsai, Ching-Hui; Chen, Po-Hua; Lee, Yungling Leo
2016-01-01
Teenager smoking is of great importance in public health. Functional roles of microRNAs have been documented in smoke-induced gene expression changes, but comprehensive mechanisms of microRNA-mRNA regulation and benefits remained poorly understood. We conducted the Teenager Smoking Reduction Trial (TSRT) to investigate the causal association between active smoking reduction and whole-genome microRNA and mRNA expression changes in human peripheral blood mononuclear cells (PBMC). A total of 12 teenagers with a substantial reduction in smoke quantity and a decrease in urine cotinine/creatinine ratio were enrolled in genomic analyses. In Gene Set Enrichment Analysis (GSEA) and Ingenuity Pathway Analysis (IPA), differentially expressed genes altered by smoke reduction were mainly associated with glucocorticoid receptor signaling pathway. The integrative analysis of microRNA and mRNA found eleven differentially expressed microRNAs negatively correlated with predicted target genes. CD83 molecule regulated by miR-4498 in human PBMC, was critical for the canonical pathway of communication between innate and adaptive immune cells. Our data demonstrated that microRNAs could regulate immune responses in human PBMC after habitual smokers quit smoking and support the potential translational value of microRNAs in regulating disease-relevant gene expression caused by tobacco smoke. - Highlights: • We conducted a smoke reduction trial program and investigated the causal relationship between smoke and gene regulation. • MicroRNA and mRNA expression changes were examined in human PBMC. • MicroRNAs are important in regulating disease-causal genes after tobacco smoke reduction.
Smoking-related microRNAs and mRNAs in human peripheral blood mononuclear cells
Energy Technology Data Exchange (ETDEWEB)
Su, Ming-Wei [Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan (China); Yu, Sung-Liang [Department of Clinical Laboratory Sciences and Medical Biotechnology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Lin, Wen-Chang [Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan (China); Tsai, Ching-Hui [Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chen, Po-Hua [School of Medicine, National Taiwan University, Taipei, Taiwan (China); Lee, Yungling Leo, E-mail: leolee@ntu.edu.tw [Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan (China)
2016-08-15
Teenager smoking is of great importance in public health. Functional roles of microRNAs have been documented in smoke-induced gene expression changes, but comprehensive mechanisms of microRNA-mRNA regulation and benefits remained poorly understood. We conducted the Teenager Smoking Reduction Trial (TSRT) to investigate the causal association between active smoking reduction and whole-genome microRNA and mRNA expression changes in human peripheral blood mononuclear cells (PBMC). A total of 12 teenagers with a substantial reduction in smoke quantity and a decrease in urine cotinine/creatinine ratio were enrolled in genomic analyses. In Gene Set Enrichment Analysis (GSEA) and Ingenuity Pathway Analysis (IPA), differentially expressed genes altered by smoke reduction were mainly associated with glucocorticoid receptor signaling pathway. The integrative analysis of microRNA and mRNA found eleven differentially expressed microRNAs negatively correlated with predicted target genes. CD83 molecule regulated by miR-4498 in human PBMC, was critical for the canonical pathway of communication between innate and adaptive immune cells. Our data demonstrated that microRNAs could regulate immune responses in human PBMC after habitual smokers quit smoking and support the potential translational value of microRNAs in regulating disease-relevant gene expression caused by tobacco smoke. - Highlights: • We conducted a smoke reduction trial program and investigated the causal relationship between smoke and gene regulation. • MicroRNA and mRNA expression changes were examined in human PBMC. • MicroRNAs are important in regulating disease-causal genes after tobacco smoke reduction.
Circulating mRNAs and miRNAs as candidate markers for the diagnosis and prognosis of prostate cancer
DEFF Research Database (Denmark)
Souza, Marilesia Ferreira de; Kuasne, Hellen; Barros-Filho, Mateus de Camargo
2017-01-01
Circulating nucleic acids are found in free form in body fluids and may serve as minimally invasive tools for cancer diagnosis and prognosis. Only a few studies have investigated the potential application of circulating mRNAs and microRNAs (miRNAs) in prostate cancer (PCa). The Cancer Genome Atlas......RNA expression revealed eleven genes and eight miRNAs which were validated by RT-qPCR in plasma samples from 102 untreated PCa patients and 50 cancer-free individuals. Two genes, OR51E2 and SIM2, and two miRNAs, miR-200c and miR-200b, showed significant association with PCa. Expression levels...... of these transcripts distinguished PCa patients from controls (67% sensitivity and 75% specificity). PCa patients and controls with prostate-specific antigen (PSA) ≤ 4.0 ng/mL were discriminated based on OR51E2 and SIM2 expression levels. The miR-200c expression showed association with Gleason score and miR-200b...
International Nuclear Information System (INIS)
Denslow, N.D.; O'Brien, T.W.
1984-01-01
To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles
Molecular dynamics simulation of ribosome jam
Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu
2011-01-01
We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We
Dicer-independent processing of short hairpin RNAs
Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben
2013-01-01
Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that
Non-Coding RNAs in Arabidopsis
DEFF Research Database (Denmark)
van Wonterghem, Miranda
This work evolves around elucidating the mechanisms of micro RNAs (miRNAs) in Arabidopsis thaliana. I identified a new class of nuclear non-coding RNAs derived from protein coding genes. The genes are miRNA targets with extensive gene body methylation. The RNA species are nuclear localized and de...
N6-adenosine methylation in MiRNAs.
Directory of Open Access Journals (Sweden)
Tea Berulava
Full Text Available Methylation of N6-adenosine (m6A has been observed in many different classes of RNA, but its prevalence in microRNAs (miRNAs has not yet been studied. Here we show that a knockdown of the m6A demethylase FTO affects the steady-state levels of several miRNAs. Moreover, RNA immunoprecipitation with an anti-m6A-antibody followed by RNA-seq revealed that a significant fraction of miRNAs contains m6A. By motif searches we have discovered consensus sequences discriminating between methylated and unmethylated miRNAs. The epigenetic modification of an epigenetic modifier as described here adds a new layer to the complexity of the posttranscriptional regulation of gene expression.
Identifying and annotating human bifunctional RNAs reveals their versatile functions.
Chen, Geng; Yang, Juan; Chen, Jiwei; Song, Yunjie; Cao, Ruifang; Shi, Tieliu; Shi, Leming
2016-10-01
Bifunctional RNAs that possess both protein-coding and noncoding functional properties were less explored and poorly understood. Here we systematically explored the characteristics and functions of such human bifunctional RNAs by integrating tandem mass spectrometry and RNA-seq data. We first constructed a pipeline to identify and annotate bifunctional RNAs, leading to the characterization of 132 high-confidence bifunctional RNAs. Our analyses indicate that bifunctional RNAs may be involved in human embryonic development and can be functional in diverse tissues. Moreover, bifunctional RNAs could interact with multiple miRNAs and RNA-binding proteins to exert their corresponding roles. Bifunctional RNAs may also function as competing endogenous RNAs to regulate the expression of many genes by competing for common targeting miRNAs. Finally, somatic mutations of diverse carcinomas may generate harmful effect on corresponding bifunctional RNAs. Collectively, our study not only provides the pipeline for identifying and annotating bifunctional RNAs but also reveals their important gene-regulatory functions.
Diversity of small RNAs expressed in Pseudomonas species
DEFF Research Database (Denmark)
Gomez-Lozano, Mara; Marvig, Rasmus Lykke; Molina-Santiago, Carlos
2015-01-01
RNA sequencing (RNA-seq) has revealed several hundreds of previously undetected small RNAs (sRNAs) in all bacterial species investigated, including strains of Pseudomonas aeruginosa, Pseudomonas putida and Pseudomonas syringae. Nonetheless, only little is known about the extent of conservation...... of expressed sRNAs across strains and species. In this study, we have used RNA-seq to identify sRNAs in P.putidaDOT-T1E and Pseudomonas extremaustralis 14-3b. This is the first strain of P.extremaustralis and the second strain of P.putida to have their transcriptomes analysed for sRNAs, and we identify...... the presence of around 150 novel sRNAs in each strain. Furthermore, we provide a comparison based on sequence conservation of all the sRNAs detected by RNA-seq in the Pseudomonas species investigated so far. Our results show that the extent of sRNA conservation across different species is very limited...
A Stress-Induced Bias in the Reading of the Genetic Code in Escherichia coli
Directory of Open Access Journals (Sweden)
Adi Oron-Gottesman
2016-11-01
Full Text Available Escherichia coli mazEF is an extensively studied stress-induced toxin-antitoxin (TA system. The toxin MazF is an endoribonuclease that cleaves RNAs at ACA sites. Thereby, under stress, the induced MazF generates a stress-induced translation machinery (STM, composed of MazF-processed mRNAs and selective ribosomes that specifically translate the processed mRNAs. Here, we further characterized the STM system, finding that MazF cleaves only ACA sites located in the open reading frames of processed mRNAs, while out-of-frame ACAs are resistant. This in-frame ACA cleavage of MazF seems to depend on MazF binding to an extracellular-death-factor (EDF-like element in ribosomal protein bS1 (bacterial S1, apparently causing MazF to be part of STM ribosomes. Furthermore, due to the in-frame MazF cleavage of ACAs under stress, a bias occurs in the reading of the genetic code causing the amino acid threonine to be encoded only by its synonym codon ACC, ACU, or ACG, instead of by ACA.
Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S
2004-12-01
The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.
Trash or Treasure: extracellular microRNAs and cell-to-cell communication
Directory of Open Access Journals (Sweden)
Nobuyoshi eKosaka
2013-09-01
Full Text Available Circulating RNAs in human body fluids are promising candidates for diagnostic purposes. However, the biological significance of circulating RNAs remains elusive. Recently, small non-coding RNAs, microRNAs (miRNAs, were isolated from multiple human body fluids, and these circulating miRNAs have been implicated as novel disease biomarkers. Concurrently, miRNAs were also identified in the extracellular space associated with extracellular vesicles (EVs, which are small membrane vesicles secreted from various types of cells. The function of these secreted miRNAs has been revealed in several papers. Circulating miRNAs have been experimentally found to be associated with EVs, however, other types of extracellular miRNAs were also described. This review discusses studies related to extracellular miRNAs, including circulating miRNAs and secreted miRNAs, to highlight the importance of studying not only secreted miRNAs but also circulating miRNAs to determine the contribution of extracellular miRNAs especially in cancer development.
Identifying MicroRNAs and Transcript Targets in Jatropha Seeds
Galli, Vanessa; Guzman, Frank; de Oliveira, Luiz F. V.; Loss-Morais, Guilherme; Körbes, Ana P.; Silva, Sérgio D. A.; Margis-Pinheiro, Márcia M. A. N.; Margis, Rogério
2014-01-01
MicroRNAs, or miRNAs, are endogenously encoded small RNAs that play a key role in diverse plant biological processes. Jatropha curcas L. has received significant attention as a potential oilseed crop for the production of renewable oil. Here, a sRNA library of mature seeds and three mRNA libraries from three different seed development stages were generated by deep sequencing to identify and characterize the miRNAs and pre-miRNAs of J. curcas. Computational analysis was used for the identification of 180 conserved miRNAs and 41 precursors (pre-miRNAs) as well as 16 novel pre-miRNAs. The predicted miRNA target genes are involved in a broad range of physiological functions, including cellular structure, nuclear function, translation, transport, hormone synthesis, defense, and lipid metabolism. Some pre-miRNA and miRNA targets vary in abundance between the three stages of seed development. A search for sequences that produce siRNA was performed, and the results indicated that J. curcas siRNAs play a role in nuclear functions, transport, catalytic processes and disease resistance. This study presents the first large scale identification of J. curcas miRNAs and their targets in mature seeds based on deep sequencing, and it contributes to a functional understanding of these miRNAs. PMID:24551031
Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Galas, D J; Branscomb, E W
1976-08-12
The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.
Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J
2016-03-22
Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.
Systematic identification of long noncoding RNAs expressed during zebrafish embryogenesis
DEFF Research Database (Denmark)
Pauli, Andrea; Valen, Eivind; Lin, Michael F.
2012-01-01
Long non-coding RNAs (lncRNAs) comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome-wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues, but a systematic analysis of lncRNAs expressed during...... of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein-coding genes and are specifically enriched in early-stage embryos. In addition, several lncRNAs show tissue-specific expression...... and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions, ranging from cell cycle regulation to morphogenesis. Our study provides the first systematic identification of lncRNAs in a vertebrate embryo and forms...
MicroRNAs, epigenetics and disease
DEFF Research Database (Denmark)
Silahtaroglu, Asli; Stenvang, Jan
2010-01-01
Epigenetics is defined as the heritable chances that affect gene expression without changing the DNA sequence. Epigenetic regulation of gene expression can be through different mechanisms such as DNA methylation, histone modifications and nucleosome positioning. MicroRNAs are short RNA molecules...... which do not code for a protein but have a role in post-transcriptional silencing of multiple target genes by binding to their 3' UTRs (untranslated regions). Both epigenetic mechanisms, such as DNA methylation and histone modifications, and the microRNAs are crucial for normal differentiation...... diseases. In the present chapter we will mainly focus on microRNAs and methylation and their implications in human disease, mainly in cancer....
Detection and Analysis of Circular RNAs by RT-PCR.
Panda, Amaresh C; Gorospe, Myriam
2018-03-20
Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.
Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.
Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V
2009-01-01
Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.
DEFF Research Database (Denmark)
Kocerha, Jannet; Kauppinen, Sakari; Wahlestedt, Claes
2009-01-01
RNAs (miRNAs) have been identified in the mammalian central nervous system (CNS) and are reported to mediate pivotal roles in many aspects of neuronal functions. Disruption of miRNA-based post-transcriptional regulation has been implicated in a range of CNS disorders as one miRNA is predicted to impact...
Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh
2013-08-01
The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
Interfering Satellite RNAs of Bamboo mosaic virus
Directory of Open Access Journals (Sweden)
Kuan-Yu Lin
2017-05-01
Full Text Available Satellite RNAs (satRNAs are sub-viral agents that may interact with their cognate helper virus (HV and host plant synergistically and/or antagonistically. SatRNAs totally depend on the HV for replication, so satRNAs and HV usually evolve similar secondary or tertiary RNA structures that are recognized by a replication complex, although satRNAs and HV do not share an appreciable sequence homology. The satRNAs of Bamboo mosaic virus (satBaMV, the only satRNAs of the genus Potexvirus, have become one of the models of how satRNAs can modulate HV replication and virus-induced symptoms. In this review, we summarize the molecular mechanisms underlying the interaction of interfering satBaMV and BaMV. Like other satRNAs, satBaMV mimics the secondary structures of 5′- and 3′-untranslated regions (UTRs of BaMV as a molecular pretender. However, a conserved apical hairpin stem loop (AHSL in the 5′-UTR of satBaMV was found as the key determinant for downregulating BaMV replication. In particular, two unique nucleotides (C60 and C83 in the AHSL of satBaMVs determine the satBaMV interference ability by competing for the replication machinery. Thus, transgenic plants expressing interfering satBaMV could confer resistance to BaMV, and interfering satBaMV could be used as biological-control agent. Unlike two major anti-viral mechanisms, RNA silencing and salicylic acid-mediated immunity, our findings in plants by in vivo competition assay and RNA deep sequencing suggested replication competition is involved in this transgenic satBaMV-mediated BaMV interference. We propose how a single nucleotide of satBaMV can make a great change in BaMV pathogenicity and the underlying mechanism.
Directory of Open Access Journals (Sweden)
Ilona Patursky-Polischuk
Full Text Available TOP mRNAs encode components of the translational apparatus, and repression of their translation comprises one mechanism, by which cells encountering amino acid deprivation downregulate the biosynthesis of the protein synthesis machinery. This mode of regulation involves TSC as knockout of TSC1 or TSC2 rescued TOP mRNAs translation in amino acid-starved cells. The involvement of mTOR in translational control of TOP mRNAs is demonstrated by the ability of constitutively active mTOR to relieve the translational repression of TOP mRNA upon amino acid deprivation. Consistently, knockdown of this kinase as well as its inhibition by pharmacological means blocked amino acid-induced translational activation of these mRNAs. The signaling of amino acids to TOP mRNAs involves RagB, as overexpression of active RagB derepressed the translation of these mRNAs in amino acid-starved cells. Nonetheless, knockdown of raptor or rictor failed to suppress translational activation of TOP mRNAs by amino acids, suggesting that mTORC1 or mTORC2 plays a minor, if any, role in this mode of regulation. Finally, miR10a has previously been suggested to positively regulate the translation of TOP mRNAs. However, we show here that titration of this microRNA failed to downregulate the basal translation efficiency of TOP mRNAs. Moreover, Drosha knockdown or Dicer knockout, which carries out the first and second processing steps in microRNAs biosynthesis, respectively, failed to block the translational activation of TOP mRNAs by amino acid or serum stimulation. Evidently, these results are questioning the positive role of microRNAs in this mode of regulation.
Circular RNAs: Biogenesis, Function and Role in Human Diseases
Directory of Open Access Journals (Sweden)
John Greene
2017-06-01
Full Text Available Circular RNAs (circRNAs are currently classed as non-coding RNA (ncRNA that, unlike linear RNAs, form covalently closed continuous loops and act as gene regulators in mammals. They were originally thought to represent errors in splicing and considered to be of low abundance, however, there is now an increased appreciation of their important function in gene regulation. circRNAs are differentially generated by backsplicing of exons or from lariat introns. Unlike linear RNA, the 3′ and 5′ ends normally present in an RNA molecule have been joined together by covalent bonds leading to circularization. Interestingly, they have been found to be abundant, evolutionally conserved and relatively stable in the cytoplasm. These features confer numerous potential functions to circRNAs, such as acting as miRNA sponges, or binding to RNA-associated proteins to form RNA-protein complexes that regulate gene transcription. It has been proposed that circRNA regulate gene expression at the transcriptional or post-transcriptional level by interacting with miRNAs and that circRNAs may have a role in regulating miRNA function in cancer initiation and progression. circRNAs appear to be more often downregulated in tumor tissue compared to normal tissue and this may be due to (i errors in the back-splice machinery in malignant tissues, (ii degradation of circRNAs by deregulated miRNAs in tumor tissue, or (iii increasing cell proliferation leading to a reduction of circRNAs. circRNAs have been identified in exosomes and more recently, chromosomal translocations in cancer have been shown to generate aberrant fusion-circRNAs associated with resistance to drug treatments. In addition, though originally thought to be non-coding, there is now increasing evidence to suggest that select circRNAs can be translated into functional proteins. Although much remains to be elucidated about circRNA biology and mechanisms of gene regulation, these ncRNAs are quickly emerging as
The ribosome-associated complex antagonizes prion formation in yeast.
Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M
2015-01-01
The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.
Protein folding on the ribosome studied using NMR spectroscopy
Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John
2013-01-01
NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462
MicroRNAs in Obesity, Metabolic Syndrome and Diabetes Mellitus
Directory of Open Access Journals (Sweden)
Anna Meiliana
2011-04-01
Full Text Available BACKGROUND: MicroRNAs (miRNAs are small regulatory RNAs that play important roles in development of diseases. Several studies have provided evidences showing that miRNAs affect pathways that are fundamental for metabolic control in adipocyte and skeletal muscle differentiations. Some miRNAs have been implicated in lipid, amino acid, and glucose homeostasis. This leads to the possibility that miRNAs may contribute to common metabolic diseases and point to novel therapeutic opportunities based on targeting of miRNAs. CONTENT: miRNAs have been recognized as a class of epigenetic regulators of metabolism and energy homeostasis, primarily because the simultaneous regulation of a large number of target genes can be accomplished by a single miRNA. Emerging evidences suggest that miRNAs play a key role in the pathological development of obesity by affecting adipocyte differentiation. miRNAs have been implicated as novel protagonists in the pathogenesis of Diabetes Mellitus (DM, regulation of insulin production, secretion and action. They also appear to play a role in the development of diabetic complications such as nephropathy and cardiac hypertrophy. SUMMARY: Involvement of miRNAs in glucose and lipid metabolism has provided strong evidences to confirm their roles as key players in regulation of complex metabolic pathways. Additionally, it indicates potential outlook for novel therapeutic strategies in the management of obesity, metabolic syndrome and DM. Further research in this field is needed to ascertain the full potential of miRNAs as novel metabolic biomarkers and potent therapeutic agents against obesity and its metabolic disorders. KEYWORDS: obesity, metabolic syndrome, diabetes, miRNAs, adipogenesis, insulin, pancreatic cells.
Gene function analysis by artificial microRNAs in Physcomitrella patens.
Khraiwesh, Basel; Fattash, Isam; Arif, Muhammad Asif; Frank, Wolfgang
2011-01-01
MicroRNAs (miRNAs) are ~21 nt long small RNAs transcribed from endogenous MIR genes which form precursor RNAs with a characteristic hairpin structure. miRNAs control the expression of cognate target genes by binding to reverse complementary
The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins
DEFF Research Database (Denmark)
Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech
2003-01-01
The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
Hu, Guang-Fu; Liu, Xiang-Jiang; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na; Zou, Gui-Wei
2016-01-01
The complete mitochondrial genomes of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis) were sequenced. Comparison of these two mitochondrial genomes revealed that the mtDNAs of these two common carp varieties were remarkably similar in genome length, gene order and content, and AT content. However, size variation between these two mitochondrial genomes presented here showed 39 site differences in overall length. About 2 site differences were located in rRNAs, 3 in tRNAs, 3 in the control region, 31 in protein-coding genes. Thirty-one variable bases in the protein-coding regions between the two varieties mitochondrial sequences led to three variable amino acids, which were mainly located in the protein ND5 and ND4.
The nuclear import of ribosomal proteins is regulated by mTOR
Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.
2014-01-01
Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810
The role of miRNAs in endometrial cancer.
Vasilatou, Diamantina; Sioulas, Vasileios D; Pappa, Vasiliki; Papageorgiou, Sotirios G; Vlahos, Nikolaos F
2015-01-01
miRNAs are small noncoding RNAs that regulate gene expression at the post-transcriptional level. Since their discovery, miRNAs have been associated with every cell function including malignant transformation and metastasis. Endometrial cancer is the most common gynecologic malignancy. However, improvement should be made in interobserver agreement on histological typing and individualized therapeutic approaches. This article summarizes the role of miRNAs in endometrial cancer pathogenesis and treatment.
Annotating functional RNAs in genomes using Infernal.
Nawrocki, Eric P
2014-01-01
Many different types of functional non-coding RNAs participate in a wide range of important cellular functions but the large majority of these RNAs are not routinely annotated in published genomes. Several programs have been developed for identifying RNAs, including specific tools tailored to a particular RNA family as well as more general ones designed to work for any family. Many of these tools utilize covariance models (CMs), statistical models of the conserved sequence, and structure of an RNA family. In this chapter, as an illustrative example, the Infernal software package and CMs from the Rfam database are used to identify RNAs in the genome of the archaeon Methanobrevibacter ruminantium, uncovering some additional RNAs not present in the genome's initial annotation. Analysis of the results and comparison with family-specific methods demonstrate some important strengths and weaknesses of this general approach.
MicroRNAs - A New Generation Molecular Targets for Treating Cellular Diseases
Paulmurugan, Ramasamy
2013-01-01
MicroRNAs (miRNAs) are a unique class of non-coding, small RNAs, similar to mRNAs, transcribed by cells, but for entirely different reasons. While mRNAs are transcribed to code for proteins, miRNAs are produced to regulate the production of proteins from mRNAs. miRNAs are central components that tightly and temporally regulating gene expression in cells. Dysregulation of miRNAs expressions in cellular pathogenesis, including cancer, has been reported, and it clearly supports the importance of...
MicroRNAs horizon in retinoblastoma.
Directory of Open Access Journals (Sweden)
Mojgan Mirakholi
2013-12-01
Full Text Available In the retinoblastoma research, it is of great interest to identify molecular markers associated with the genetics of tumorigenesis. microRNAs (miRNAs are small non-coding RNA molecules that play a regulatory role in many crucial cellular pathways such as differentiation, cell cycle progression, and apoptosis. A body of evidences showed dysregulation of miRNAs in tumor biology and many diseases. They potentially play a significant role in tumorigenesis processes and have been the subject of research in many types of cancers including retinal tumorigenesis. miRNA expression profiling was found to be associated with tumor development, progression and treatment. These associations demonstrate the putative applications of miRNAs in monitoring of different aspect of tumors consisting diagnostic, prognostic and therapeutic. Herein, we review the current literature concerning to the study of miRNA target recognition, function to tumorigenesis and treatment in retinoblastoma. Identification the specific miRNA biomarkers associated with retinoblastoma cancer may help to establish new therapeutic approaches for salvage affected eyes in patients.
The Role of MicroRNAs in Kidney Disease
Directory of Open Access Journals (Sweden)
Sydwell Mukhadi
2015-11-01
Full Text Available MicroRNAs (miRNAs are short noncoding RNAs that regulate pathophysiological processes that suppress gene expression by binding to messenger RNAs. These biomolecules can be used to study gene regulation and protein expression, which will allow better understanding of many biological processes such as cell cycle progression and apoptosis that control the fate of cells. Several pathways have also been implicated to be involved in kidney diseases such as Transforming Growth Factor-β, Mitogen-Activated Protein Kinase signaling, and Wnt signaling pathways. The discovery of miRNAs has provided new insights into kidney pathologies and may provide new innovative and effective therapeutic strategies. Research has demonstrated the role of miRNAs in a variety of kidney diseases including renal cell carcinoma, diabetic nephropathy, nephritic syndrome, renal fibrosis, lupus nephritis and acute pyelonephritis. MiRNAs are implicated as playing a role in these diseases due to their role in apoptosis, cell proliferation, differentiation and development. As miRNAs have been detected in a stable condition in different biological fluids, they have the potential to be tools to study the pathogenesis of human diseases with a great potential to be used in disease prognosis and diagnosis. The purpose of this review is to examine the role of miRNA in kidney disease.
The roles of non-coding RNAs in cardiac regenerative medicine
Directory of Open Access Journals (Sweden)
Oi Kuan Choong
2017-06-01
Full Text Available The emergence of non-coding RNAs (ncRNAs has challenged the central dogma of molecular biology that dictates that the decryption of genetic information starts from transcription of DNA to RNA, with subsequent translation into a protein. Large numbers of ncRNAs with biological significance have now been identified, suggesting that ncRNAs are important in their own right and their roles extend far beyond what was originally envisaged. ncRNAs do not only regulate gene expression, but are also involved in chromatin architecture and structural conformation. Several studies have pointed out that ncRNAs participate in heart disease; however, the functions of ncRNAs still remain unclear. ncRNAs are involved in cellular fate, differentiation, proliferation and tissue regeneration, hinting at their potential therapeutic applications. Here, we review the current understanding of both the biological functions and molecular mechanisms of ncRNAs in heart disease and describe some of the ncRNAs that have potential heart regeneration effects. Keywords: Non-coding RNAs, Cardiac regeneration, Cardiac fate, Proliferation, Differentiation, Reprograming
Viruses and miRNAs: More Friends than Foes.
Bruscella, Patrice; Bottini, Silvia; Baudesson, Camille; Pawlotsky, Jean-Michel; Feray, Cyrille; Trabucchi, Michele
2017-01-01
There is evidence that eukaryotic miRNAs (hereafter called host miRNAs) play a role in the replication and propagation of viruses. Expression or targeting of host miRNAs can be involved in cellular antiviral responses. Most times host miRNAs play a role in viral life-cycles and promote infection through complex regulatory pathways. miRNAs can also be encoded by a viral genome and be expressed in the host cell. Viral miRNAs can share common sequences with host miRNAs or have totally different sequences. They can regulate a variety of biological processes involved in viral infection, including apoptosis, evasion of the immune response, or modulation of viral life-cycle phases. Overall, virus/miRNA pathway interaction is defined by a plethora of complex mechanisms, though not yet fully understood. This article review summarizes recent advances and novel biological concepts related to the understanding of miRNA expression, control and function during viral infections. The article also discusses potential therapeutic applications of this particular host-pathogen interaction.
On the classification of long non-coding RNAs
Ma, Lina
2013-06-01
Long non-coding RNAs (lncRNAs) have been found to perform various functions in a wide variety of important biological processes. To make easier interpretation of lncRNA functionality and conduct deep mining on these transcribed sequences, it is convenient to classify lncRNAs into different groups. Here, we summarize classification methods of lncRNAs according to their four major features, namely, genomic location and context, effect exerted on DNA sequences, mechanism of functioning and their targeting mechanism. In combination with the presently available function annotations, we explore potential relationships between different classification categories, and generalize and compare biological features of different lncRNAs within each category. Finally, we present our view on potential further studies. We believe that the classifications of lncRNAs as indicated above are of fundamental importance for lncRNA studies, helpful for further investigation of specific lncRNAs, for formulation of new hypothesis based on different features of lncRNA and for exploration of the underlying lncRNA functional mechanisms. © 2013 Landes Bioscience.
The application of microRNAs in cancer diagnostics
DEFF Research Database (Denmark)
Sørensen, Karina Dalsgaard; Ostenfeld, Marie Stampe; Kristensen, Helle
2012-01-01
hallmark of human cancer. Furthermore, miRNAs have been found to be a new class of promising cancer biomarkers with potential to improve the accuracy of diagnosis and prognosis in several hematologic and solid malignancies, as well as to predict response to specific treatments. Recent studies have......MicroRNAs (miRNAs) play important biological roles in cancer development and progression. During the past decade, widespread use of novel high-throughput technologies for miRNA profiling (e.g., microarrays and next-generation sequencing) has revealed deregulation of miRNA expression as a common...... identified exosome-associated tumor-derived miRNAs in, e.g., blood samples from cancer patients, suggesting that miRNAs may be useful as circulation biomarkers for noninvasive diagnostic testing. In this chapter, we review the current state of development of miRNAs as cancer biomarkers with examples from...
Directory of Open Access Journals (Sweden)
Fengnian Wu
Full Text Available Potato psyllid (Bactericera cockerelli is an important pest of potato, tomato and pepper. Not only could a toxin secreted by nymphs results in serious phytotoxemia in some host plants, but also over the past few years B. cockerelli was shown to transmit "Candidatus Liberibacter solanacearum", the putative bacterial pathogen of potato zebra chip (ZC disease, to potato and tomato. ZC has caused devastating losses to potato production in the western U.S., Mexico, and elsewhere. New knowledge of the genetic diversity of the B. cockerelli is needed to develop improved strategies to manage pest populations. Mitochondrial genome (mitogenome sequencing provides important knowledge about insect evolution and diversity in and among populations. This report provides the first complete B. cockerelli mitogenome sequence as determined by next generation sequencing technology (Illumina MiSeq. The circular B. cockerelli mitogenome had a size of 15,220 bp with 13 protein-coding gene (PCGs, 2 ribosomal RNA genes (rRNAs, 22 transfer RNA genes (tRNAs, and a non-coding region of 975 bp. The overall gene order of the B. cockerelli mitogenome is identical to three other published Psylloidea mitogenomes: one species from the Triozidae, Paratrioza sinica; and two species from the Psyllidae, Cacopsylla coccinea and Pachypsylla venusta. This suggests all of these species share a common ancestral mitogenome. However, sequence analyses revealed differences between and among the insect families, in particular a unique region that can be folded into three stem-loop secondary structures present only within the B. cockerelli mitogenome. A phylogenetic tree based on the 13 PCGs matched an existing taxonomy scheme that was based on morphological characteristics. The available complete mitogenome sequence makes it accessible to all genes for future population diversity evaluation of B. cockerelli.
Urinary microRNAs as potential biomarkers of pesticide exposure
International Nuclear Information System (INIS)
Weldon, Brittany A.; Shubin, Sara Pacheco; Smith, Marissa N.; Workman, Tomomi; Artemenko, Alexander; Griffith, William C.; Thompson, Beti; Faustman, Elaine M.
2016-01-01
MicroRNAs (miRNAs) are post-transcriptional regulators that silence messenger RNAs. Because miRNAs are stable at room temperature and long-lived, they have been proposed as molecular biomarkers to monitor disease and exposure status. While urinary miRNAs have been used clinically as potential diagnostic markers for kidney and bladder cancers and other diseases, their utility in non-clinical settings has yet to be fully developed. Our goal was to investigate the potential for urinary miRNAs to act as biomarkers of pesticide exposure and early biological response by identifying the miRNAs present in urine from 27 parent/child, farmworker/non-farmworker pairs (16FW/11NFW) collected during two agricultural seasons (thinning and post-harvest) and characterizing the between- and within-individual variability of these miRNA epigenetic regulators. MiRNAs were isolated from archived urine samples and identified using PCR arrays. Comparisons were made between age, households, season, and occupation. Of 384 miRNAs investigated, 297 (77%) were detectable in at least one sample. Seven miRNAs were detected in at least 50% of the samples, and one miRNA was present in 96% of the samples. Principal components and hierarchical clustering analyses indicate significant differences in miRNA profiles between farmworker and non-farmworker adults as well as between seasons. Six miRNAs were observed to be positively associated with farmworkers status during the post-harvest season. Expression of five of these miRNA trended towards a positive dose response relationship with organophosphate pesticide metabolites in farmworkers. These results suggest that miRNAs may be novel biomarkers of pesticide exposure and early biological response. - Highlights: • A novel method to identify microRNA biomarkers in urinary samples is proposed. • Six miRNAs have been identified as associated with occupational farm work and pesticide exposure. • An observed seasonal difference suggests transient
Urinary microRNAs as potential biomarkers of pesticide exposure
Energy Technology Data Exchange (ETDEWEB)
Weldon, Brittany A.; Shubin, Sara Pacheco; Smith, Marissa N.; Workman, Tomomi; Artemenko, Alexander; Griffith, William C. [Institute for Risk Analysis and Risk Communication, University of Washington, Seattle, WA (United States); Department of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States); Thompson, Beti [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Faustman, Elaine M., E-mail: faustman@uw.edu [Institute for Risk Analysis and Risk Communication, University of Washington, Seattle, WA (United States); Department of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States)
2016-12-01
MicroRNAs (miRNAs) are post-transcriptional regulators that silence messenger RNAs. Because miRNAs are stable at room temperature and long-lived, they have been proposed as molecular biomarkers to monitor disease and exposure status. While urinary miRNAs have been used clinically as potential diagnostic markers for kidney and bladder cancers and other diseases, their utility in non-clinical settings has yet to be fully developed. Our goal was to investigate the potential for urinary miRNAs to act as biomarkers of pesticide exposure and early biological response by identifying the miRNAs present in urine from 27 parent/child, farmworker/non-farmworker pairs (16FW/11NFW) collected during two agricultural seasons (thinning and post-harvest) and characterizing the between- and within-individual variability of these miRNA epigenetic regulators. MiRNAs were isolated from archived urine samples and identified using PCR arrays. Comparisons were made between age, households, season, and occupation. Of 384 miRNAs investigated, 297 (77%) were detectable in at least one sample. Seven miRNAs were detected in at least 50% of the samples, and one miRNA was present in 96% of the samples. Principal components and hierarchical clustering analyses indicate significant differences in miRNA profiles between farmworker and non-farmworker adults as well as between seasons. Six miRNAs were observed to be positively associated with farmworkers status during the post-harvest season. Expression of five of these miRNA trended towards a positive dose response relationship with organophosphate pesticide metabolites in farmworkers. These results suggest that miRNAs may be novel biomarkers of pesticide exposure and early biological response. - Highlights: • A novel method to identify microRNA biomarkers in urinary samples is proposed. • Six miRNAs have been identified as associated with occupational farm work and pesticide exposure. • An observed seasonal difference suggests transient
Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik
2012-10-01
The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced. Computational analyses combined with experimental data reveal the expression of miRNAs, several of them exhibiting distinct expression patterns during development. To our knowledge, this is the first report of miRNAs in the Amoebozoa supergroup. We also show that overexpressed miRNA precursors generate miRNAs and, in most cases, miRNA* sequences, whose biogenesis is dependent on the Dicer-like protein DrnB, further supporting the presence of miRNAs in D. discoideum. In addition, we find miRNAs processed from hairpin structures originating from an intron as well as from a class of repetitive elements. We believe that these repetitive elements are sources for newly evolved miRNAs.
Directory of Open Access Journals (Sweden)
Sayaka Tsuji
2017-07-01
Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.
Wang, Lian-Kun; Chen, Xiao-Feng; He, Dan-Dan; Li, You; Fu, Jin
2017-04-08
Alzheimer's disease (AD) is a neurodegenerative disorder that is the most common cause of dementia in the elderly, and intracellular neurofibrillary tangles (NFTs) are one of the pathological features of AD. Recent studies have suggested long noncoding RNAs (lncRNAs) play important roles in AD. Competing endogenous RNAs (ceRNAs) is a mechanism that has recently been proposed, in which lncRNAs compete for common miRNA-binding sites with mRNAs. However, the roles of lncRNAs and ceRNA in AD NFTs is limited. In this study, we constructed a global triple network based on ceRNA theory, then an AD NFT lncRNA-mRNA network (NFTLMN) was generated. By analyzing the NFTLMN, three lncRNAs (AP000265.1, KB-1460A1.5 and RP11-145M9.4), which are highly related with AD NFTs were identified. To further explore the cross-talk between mRNAs and lncRNAs, a clustering module analysis was performed on the NFTLMN and two AD NFT related modules were identified. Our study provides a better understanding of the molecular basis of AD NFTs and may offer novel treatment strategies for AD. Copyright © 2016. Published by Elsevier Inc.
Circulating microRNAs in patients with active pulmonary tuberculosis.
Fu, Yurong; Yi, Zhengjun; Wu, Xiaoyan; Li, Jianhua; Xu, Fuliang
2011-12-01
Emerging evidence shows that microRNAs (miRNAs) play an important role in pathogen-host interactions. Circulating miRNAs have been repeatedly and stably detected in blood and hold promise to serve as molecular markers for diverse physiological and pathological conditions. To date, the relationship between circulating miRNAs and active pulmonary tuberculosis (TB) has not been reported. Using microarray-based expression profiling followed by real-time quantitative PCR validation, the levels of circulating miRNAs were compared between patients with active pulmonary tuberculosis and matched healthy controls. The receiver operating characteristic curve was used to evaluate the diagnostic effect of selected miRNA. Bioinformatic analysis was used to explore the potential roles of these circulating miRNAs in active pulmonary tuberculosis infection. Among 92 miRNAs significantly detected, 59 miRNAs were downregulated and 33 miRNAs were upregulated in the TB serum compared to their levels in the control serum. Interestingly, only two differentially expressed miRNAs were increased not only in the serum but also in the sputum of patients with active pulmonary tuberculosis compared to the levels for the healthy controls. Upregulated miR-29a could discriminate TB patients from healthy controls with reasonable sensitivity and specificity. A number of significantly enriched pathways regulated by these circulating miRNAs were predicted, and most of them were involved in acute-phase response, inflammatory response, and the regulation of the cytoskeleton. In all, for the first time our results revealed that a number of miRNAs were differentially expressed during active pulmonary tuberculosis infection, and circulating miR-29a has great potential to serve as a marker for the detection of active pulmonary tuberculosis infection.