WorldWideScience

Sample records for ribosomal rna structures

  1. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  2. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  3. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  4. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  6. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  7. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  8. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Science.gov (United States)

    Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo

    2012-01-01

    Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  9. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Directory of Open Access Journals (Sweden)

    Christiane Rodriguez Gutierrez Madalena

    Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  10. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  11. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  12. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

    International Nuclear Information System (INIS)

    Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.

    1991-01-01

    An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

  15. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  16. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  17. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  18. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  19. Variability in secondary structure of 18S ribosomal RNA as topological marker for identification of Paramecium species.

    Science.gov (United States)

    Shakoori, Farah R; Tasneem, Fareeda; Al-Ghanim, K; Mahboob, S; Al-Misned, F; Jahan, Nusrat; Shakoori, Abdul Rauf

    2014-12-01

    Besides cytological and molecular applications, Paramecium is being used in water quality assessment and for determination of saprobic levels. An unambiguous identification of these unicellular eukaryotes is not only essential, but its ecological diversity must also be explored in the local environment. 18SrRNA genes of all the strains of Paramecium species isolated from waste water were amplified, cloned and sequenced. Phylogenetic comparison of the nucleotide sequences of these strains with 23 closely related Paramecium species from GenBank Database enabled identification of Paramecium multimicronucleatum and Paramecium jenningsi. Some isolates did not show significant close association with other Paramecium species, and because of their unique position in the phylogenetic tree, they were considered new to the field. In the present report, these isolates are being designated as Paramecium caudatum pakistanicus. In this article, secondary structure of 18SrRNA has also been analyzed as an additional and perhaps more reliable topological marker for species discrimination and for determining possible phylogenetic relationship between the ciliate species. On the basis of comparison of secondary structure of 18SrRNA of various isolated Paramacium strains, and among Paramecium caudatum pakistanicus, Tetrahymena thermophila, Drosophila melanogaster, and Homo sapiens, it can be deduced that variable regions are more helpful in differentiating the species at interspecific level rather than at intraspecific level. It was concluded that V3 was the least variable region in all the organisms, V2 and V7 were the longest expansion segments of D. melanogaster and there was continuous mutational bias towards G.C base pairing in H. sapiens. © 2014 Wiley Periodicals, Inc.

  20. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  1. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  2. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  3. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  4. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  5. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  6. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  7. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  8. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  9. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  10. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  11. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  12. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  13. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  14. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  15. Phylogeography, genetic variability and structure of Acanthamoeba metapopulations in Iran inferred by 18S ribosomal RNA sequences: A systematic review and meta-analysis.

    Science.gov (United States)

    Spotin, Adel; Moslemzadeh, Hamid Reza; Mahami-Oskouei, Mahmoud; Ahmadpour, Ehsan; Niyyati, Maryam; Hejazi, Seyed Hossein; Memari, Fatemeh; Noori, Jafar

    2017-09-01

    To verify phylogeography and genetic structure of Acanthamoeba populations among the Iranian clinical isolates and natural/artificial environments distributed in various regions of the country. We searched electronic databases including Medline, PubMed, Science Direct, Scopus and Google Scholar from 2005 to 2016. To explore the genetic variability of Acanthamoeba sp, 205 sequences were retrieved from keratitis patients, immunosuppressed cases and environmental sources as of various geographies of Iran. T4 genotype was the predominant strain in Iran, and the rare genotypes belonged to T2, T3, T5 (Acanthamoeba lenticulata), T6, T9, T11, T13 and T15 (Acanthamoeba jacobsi). A total of 47 unique haplotypes of T4 were identified. A parsimonious network of the sequence haplotypes demonstrated star-like feature containing haplogroups IR6 (34.1%) and IR7 (31.2%) as the most common haplotypes. In accordance with the analysis of molecular variance, the high value of haplotype diversity (0.612-0.848) of Acanthamoeba T4 represented genetic variability within populations. Neutrality indices of the 18S ribosomal RNA demonstrated negative values in all populations which represented a considerable divergence from neutrality. The majority of genetic diversity belonged to the infected contact lens and dust samples in immunodeficiency and ophthalmology wards, which indicated potential routes for exposure to a pathogenic Acanthamoeba sp. in at-risk individuals. A pairwise fixation index (F ST ) was from low to high values (0.02433-0.41892). The statistically F ST points out that T4 is genetically differentiated between north-west, north-south and central-south metapopulations, but not differentiated between west-central, west-south, central-south, and north-central isolates. An occurrence of IR6 and IR7 displays that possibly a gene flow of Acanthamoeba T4 occurred after the founder effect or bottleneck experience through ecological changes or host mobility. This is the first

  16. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  19. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  20. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  1. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  2. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  3. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  4. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  5. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  6. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  7. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  8. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  9. Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

    Science.gov (United States)

    Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

    2007-04-01

    During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

  10. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  11. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  12. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  13. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  14. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  15. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  17. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  18. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  19. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  20. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  1. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  2. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  3. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  4. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  5. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  6. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  7. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  8. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  9. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  10. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  11. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  12. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  13. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  14. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  15. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  16. Initiation of ribosomal RNA synthesis in Escherichia coli

    NARCIS (Netherlands)

    Hamming, Jantina

    1981-01-01

    Het E. coli chromosoom is éên lang circulair dubbelstrengs DNA molecuul en beslaat ongeveer 3000 genen. Het enzym RNA polymerase is verantwoordelijk voor de transcriptie in RNA van alle genetische informatie in de ce1. Er zijn 2 soorten transcripten: de ribosomale en transfer RNAs die deel uitmaken

  17. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  18. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  19. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  20. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  1. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  2. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  3. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  4. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  5. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  6. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  7. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  8. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  9. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  10. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  11. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  12. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  13. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  14. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  15. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  16. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  17. Selective inhibition of precursor incorporation into ribosomal RNA in gamma-irradiated Tetrahymena pyriformis

    International Nuclear Information System (INIS)

    Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.

    1979-01-01

    Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)

  18. Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

    Science.gov (United States)

    Letsch, Harald O; Kjer, Karl M

    2011-05-27

    Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

  19. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

    Science.gov (United States)

    Xie, Ping

    2015-10-09

    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  20. Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

    Science.gov (United States)

    Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

    2015-10-01

    Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  1. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  2. Advances in RNA Structure Determination | Center for Cancer Research

    Science.gov (United States)

    The recent years have witnessed a revolution in the field of RNA structure and function. Until recently the main contribution of RNA in cellular and disease functions was considered to be a role defined by the central dogma, namely DNA codes for mRNAs, which in turn encode for proteins, a notion facilitated by non-coding ribosomal RNA and tRNA. It was also assumed at the time

  3. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  4. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  5. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  6. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  7. In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant

    International Nuclear Information System (INIS)

    Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.

    1975-01-01

    In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)

  8. Ribosomal incorporation of backbone modified amino acids via an editing-deficient aminoacyl-tRNA synthetase.

    Science.gov (United States)

    Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T

    2018-02-14

    The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.

  9. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  10. A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

    Directory of Open Access Journals (Sweden)

    Saurav Mallik

    Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

  11. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  12. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  13. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  14. Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

    Science.gov (United States)

    Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

    2017-06-30

    Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

  15. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  16. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  17. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

  18. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  19. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  20. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...

  2. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  3. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  4. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  5. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  6. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  7. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  8. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  9. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  10. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  11. RNA secondary structure diagrams for very large molecules: RNAfdl

    DEFF Research Database (Denmark)

    Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E.

    2013-01-01

    There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10 3 bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments...

  12. Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

    Science.gov (United States)

    Liphardt, J; Napthine, S; Kontos, H; Brierley, I

    1999-05-07

    RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

  13. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  14. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  15. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  16. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  17. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  18. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  19. Protein Structure and the Sequential Structure of mRNA

    DEFF Research Database (Denmark)

    Brunak, Søren; Engelbrecht, Jacob

    1996-01-01

    entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment, By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets, These signals do not originate from......A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed, We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting...... protein, The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain, A complete search for GenBank nucleotide sequences coding for structural...

  20. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  1. High-throughput determination of RNA structure by proximity ligation.

    Science.gov (United States)

    Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

    2015-09-01

    We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

  2. Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

    Science.gov (United States)

    Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

    2014-12-01

    Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

  3. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  4. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  5. Structural imprints in vivo decode RNA regulatory mechanisms.

    Science.gov (United States)

    Spitale, Robert C; Flynn, Ryan A; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y; Batista, Pedro J; Torre, Eduardo A; Kool, Eric T; Chang, Howard Y

    2015-03-26

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N(6)-methyladenosine (m(6)A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  6. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  7. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  8. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  9. Determination of low-energy structures of a small RNA hairpin using ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... such as water clusters, Argon clusters and different biomo- lecules. ... Keywords. Energy landscape; Monte Carlo; optimization; RNA; tertiary structure .... tui large ribosomal subunit (Residues 310–321, PDB ID: 1JJ2).

  10. An automated procedure for covariation-based detection of RNA structure

    International Nuclear Information System (INIS)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

  11. An automated procedure for covariation-based detection of RNA structure

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

  12. RNA Thermodynamic Structural Entropy.

    Science.gov (United States)

    Garcia-Martin, Juan Antonio; Clote, Peter

    2015-01-01

    Conformational entropy for atomic-level, three dimensional biomolecules is known experimentally to play an important role in protein-ligand discrimination, yet reliable computation of entropy remains a difficult problem. Here we describe the first two accurate and efficient algorithms to compute the conformational entropy for RNA secondary structures, with respect to the Turner energy model, where free energy parameters are determined from UV absorption experiments. An algorithm to compute the derivational entropy for RNA secondary structures had previously been introduced, using stochastic context free grammars (SCFGs). However, the numerical value of derivational entropy depends heavily on the chosen context free grammar and on the training set used to estimate rule probabilities. Using data from the Rfam database, we determine that both of our thermodynamic methods, which agree in numerical value, are substantially faster than the SCFG method. Thermodynamic structural entropy is much smaller than derivational entropy, and the correlation between length-normalized thermodynamic entropy and derivational entropy is moderately weak to poor. In applications, we plot the structural entropy as a function of temperature for known thermoswitches, such as the repression of heat shock gene expression (ROSE) element, we determine that the correlation between hammerhead ribozyme cleavage activity and total free energy is improved by including an additional free energy term arising from conformational entropy, and we plot the structural entropy of windows of the HIV-1 genome. Our software RNAentropy can compute structural entropy for any user-specified temperature, and supports both the Turner'99 and Turner'04 energy parameters. It follows that RNAentropy is state-of-the-art software to compute RNA secondary structure conformational entropy. Source code is available at https://github.com/clotelab/RNAentropy/; a full web server is available at http

  13. RNA Thermodynamic Structural Entropy.

    Directory of Open Access Journals (Sweden)

    Juan Antonio Garcia-Martin

    Full Text Available Conformational entropy for atomic-level, three dimensional biomolecules is known experimentally to play an important role in protein-ligand discrimination, yet reliable computation of entropy remains a difficult problem. Here we describe the first two accurate and efficient algorithms to compute the conformational entropy for RNA secondary structures, with respect to the Turner energy model, where free energy parameters are determined from UV absorption experiments. An algorithm to compute the derivational entropy for RNA secondary structures had previously been introduced, using stochastic context free grammars (SCFGs. However, the numerical value of derivational entropy depends heavily on the chosen context free grammar and on the training set used to estimate rule probabilities. Using data from the Rfam database, we determine that both of our thermodynamic methods, which agree in numerical value, are substantially faster than the SCFG method. Thermodynamic structural entropy is much smaller than derivational entropy, and the correlation between length-normalized thermodynamic entropy and derivational entropy is moderately weak to poor. In applications, we plot the structural entropy as a function of temperature for known thermoswitches, such as the repression of heat shock gene expression (ROSE element, we determine that the correlation between hammerhead ribozyme cleavage activity and total free energy is improved by including an additional free energy term arising from conformational entropy, and we plot the structural entropy of windows of the HIV-1 genome. Our software RNAentropy can compute structural entropy for any user-specified temperature, and supports both the Turner'99 and Turner'04 energy parameters. It follows that RNAentropy is state-of-the-art software to compute RNA secondary structure conformational entropy. Source code is available at https://github.com/clotelab/RNAentropy/; a full web server is available at http

  14. Structural Basis for Linezolid Binding Site Rearrangement in the Staphylococcus aureus Ribosome.

    Science.gov (United States)

    Belousoff, Matthew J; Eyal, Zohar; Radjainia, Mazdak; Ahmed, Tofayel; Bamert, Rebecca S; Matzov, Donna; Bashan, Anat; Zimmerman, Ella; Mishra, Satabdi; Cameron, David; Elmlund, Hans; Peleg, Anton Y; Bhushan, Shashi; Lithgow, Trevor; Yonath, Ada

    2017-05-09

    An unorthodox, surprising mechanism of resistance to the antibiotic linezolid was revealed by cryo-electron microscopy (cryo-EM) in the 70S ribosomes from a clinical isolate of Staphylococcus aureus This high-resolution structural information demonstrated that a single amino acid deletion in ribosomal protein uL3 confers linezolid resistance despite being located 24 Å away from the linezolid binding pocket in the peptidyl-transferase center. The mutation induces a cascade of allosteric structural rearrangements of the rRNA that ultimately results in the alteration of the antibiotic binding site. IMPORTANCE The growing burden on human health caused by various antibiotic resistance mutations now includes prevalent Staphylococcus aureus resistance to last-line antimicrobial drugs such as linezolid and daptomycin. Structure-informed drug modification represents a frontier with respect to designing advanced clinical therapies, but success in this strategy requires rapid, facile means to shed light on the structural basis for drug resistance (D. Brown, Nat Rev Drug Discov 14:821-832, 2015, https://doi.org/10.1038/nrd4675). Here, detailed structural information demonstrates that a common mechanism is at play in linezolid resistance and provides a step toward the redesign of oxazolidinone antibiotics, a strategy that could thwart known mechanisms of linezolid resistance. Copyright © 2017 Belousoff et al.

  15. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez

    2017-10-01

    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  16. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Science.gov (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

    2017-10-01

    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  17. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Directory of Open Access Journals (Sweden)

    Paul C Whitford

    Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  18. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  19. Topology of RNA-RNA interaction structures

    DEFF Research Database (Denmark)

    Andersen, Jørgen Ellegaard; Huang, Fenix Wenda; Penner, Robert

    2012-01-01

    Abstract The topological filtration of interacting RNA complexes is studied, and the role is analyzed of certain diagrams called irreducible shadows, which form suitable building blocks for more general structures. We prove that, for two interacting RNAs, called interaction structures, there exist...

  20. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  1. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  2. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Science.gov (United States)

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

    2017-07-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

  3. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Directory of Open Access Journals (Sweden)

    Chelsea Herdman

    2017-07-01

    Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

  4. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  6. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    . In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  7. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  8. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  9. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  10. Solving the RNA polymerase I structural puzzle

    Energy Technology Data Exchange (ETDEWEB)

    Moreno-Morcillo, María [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Taylor, Nicholas M. I. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Gruene, Tim [Georg-August-University, Tammannstrasse 4, 37077 Göttingen (Germany); Legrand, Pierre [SOLEIL Synchrotron, L’Orme de Merisiers, Saint Aubin, Gif-sur-Yvette (France); Rashid, Umar J. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Ruiz, Federico M. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Steuerwald, Ulrich; Müller, Christoph W. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Fernández-Tornero, Carlos, E-mail: cftornero@cib.csic.es [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany)

    2014-10-01

    Details of the RNA polymerase I crystal structure determination provide a framework for solution of the structures of other multi-subunit complexes. Simple crystallographic experiments are described to extract relevant biological information such as the location of the enzyme active site. Knowing the structure of multi-subunit complexes is critical to understand basic cellular functions. However, when crystals of these complexes can be obtained they rarely diffract beyond 3 Å resolution, which complicates X-ray structure determination and refinement. The crystal structure of RNA polymerase I, an essential cellular machine that synthesizes the precursor of ribosomal RNA in the nucleolus of eukaryotic cells, has recently been solved. Here, the crucial steps that were undertaken to build the atomic model of this multi-subunit enzyme are reported, emphasizing how simple crystallographic experiments can be used to extract relevant biological information. In particular, this report discusses the combination of poor molecular replacement and experimental phases, the application of multi-crystal averaging and the use of anomalous scatterers as sequence markers to guide tracing and to locate the active site. The methods outlined here will likely serve as a reference for future structural determination of large complexes at low resolution.

  11. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  12. Modeling of the structure of ribosomal protein L1 from the archaeon Haloarcula marismortui

    Science.gov (United States)

    Nevskaya, N. A.; Kljashtorny, V. G.; Vakhrusheva, A. V.; Garber, M. B.; Nikonov, S. V.

    2017-07-01

    The halophilic archaeon Haloarcula marismortui proliferates in the Dead Sea at extremely high salt concentrations (higher than 3 M). This is the only archaeon, for which the crystal structure of the ribosomal 50S subunit was determined. However, the structure of the functionally important side protuberance containing the abnormally negatively charged protein L1 (HmaL1) was not visualized. Attempts to crystallize HmaL1 in the isolated state or as its complex with RNA using normal salt concentrations (≤500 mM) failed. A theoretical model of HmaL1 was built based on the structural data for homologs of the protein L1 from other organisms, and this model was refined by molecular dynamics methods. Analysis of this model showed that the protein HmaL1 can undergo aggregation due to the presence of a cluster of positive charges unique for proteins L1. This cluster is located at the RNA-protein interface, which interferes with the crystallization of HmaL1 and the binding of the latter to RNA.

  13. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  14. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  15. Crystal Structure of the 30S Ribosomal Subunit from Thermus Thermophilus: Purification, Crystallization and Structure Determination

    International Nuclear Information System (INIS)

    Clemons, William M. Jr.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki

    2001-01-01

    We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 (angstrom) resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 (angstrom) resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.

  16. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  17. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  18. Free-energy landscape of reverse tRNA translocation through the ribosome analyzed by electron microscopy density maps and molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Hisashi Ishida

    Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.

  19. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  20. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Ying [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan (China); Mao, Yingji [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); Jin, Shan; Hou, Jinyan; Du, Hua [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Yang, Minglei, E-mail: yml888@mail.ustc.edu.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Wu, Lifang, E-mail: lfwu@ipp.ac.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China)

    2015-08-07

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.

  1. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    International Nuclear Information System (INIS)

    Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted

  2. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  3. Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

    Science.gov (United States)

    Liang, Xue-Hai; Crooke, Stanley T

    2011-06-01

    Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

  4. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  5. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

  6. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  7. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom

    2011-03-01

    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  8. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  9. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  10. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  11. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  12. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  13. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  14. Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

    Science.gov (United States)

    Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

    1971-01-01

    Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

  15. Eigenvectors determination of the ribosome dynamics model during mRNA translation using the Kleene Star algorithm

    Science.gov (United States)

    Ernawati; Carnia, E.; Supriatna, A. K.

    2018-03-01

    Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.

  16. On topological RNA interaction structures.

    Science.gov (United States)

    Qin, Jing; Reidys, Christian M

    2013-07-01

    Recently a folding algorithm of topological RNA pseudoknot structures was presented in Reidys et al. (2011). This algorithm folds single-stranded γ-structures, that is, RNA structures composed by distinct motifs of bounded topological genus. In this article, we set the theoretical foundations for the folding of the two backbone analogues of γ structures: the RNA γ-interaction structures. These are RNA-RNA interaction structures that are constructed by a finite number of building blocks over two backbones having genus at most γ. Combinatorial properties of γ-interaction structures are of practical interest since they have direct implications for the folding of topological interaction structures. We compute the generating function of γ-interaction structures and show that it is algebraic, which implies that the numbers of interaction structures can be computed recursively. We obtain simple asymptotic formulas for 0- and 1-interaction structures. The simplest class of interaction structures are the 0-interaction structures, which represent the two backbone analogues of secondary structures.

  17. Involvement of Arabidopsis thaliana ribosomal protein S27 in mRNA degradation triggered by genotoxic stress

    International Nuclear Information System (INIS)

    Revenkova, E.; Masson, J.; Koncz, C.; Afsar, K.; Jakovleva, L.; Paszkowski, J.

    1999-01-01

    A recessive Arabidopsis mutant with elevated sensitivity to DNA damaging treatments was identified in one out of 800 families generated by T-DNA insertion mutagenesis. The T-DNA generated a chromosomal deletion of 1287 bp in the promoter of one of three S27 ribosomal protein genes (ARS27A) preventing its expression. Seedlings of ars27A developed normally under standard growth conditions, suggesting wildtype proficiency of translation. However, growth was strongly inhibited in media supplemented with methyl methane sulfate (MMS) at a concentration not affecting the wild type. This inhibition was accompanied by the formation of tumor–like structures instead of auxiliary roots. Wild-type seedlings treated with increasing concentrations of MMS up to a lethal dose never displayed such a trait, neither was this phenotype observed in ars27A plants in the absence of MMS or under other stress conditions. Thus, the hypersensitivity and tumorous growth are mutant-specific responses to the genotoxic MMS treatment. Another important feature of the mutant is its inability to perform rapid degradation of transcripts after UV treatment, as seen in wild-type plants. Therefore, we propose that the ARS27A protein is dispensable for protein synthesis under standard conditions but is required for the elimination of possibly damaged mRNA after UV irradiation. (author)

  18. Efficient RNA structure comparison algorithms.

    Science.gov (United States)

    Arslan, Abdullah N; Anandan, Jithendar; Fry, Eric; Monschke, Keith; Ganneboina, Nitin; Bowerman, Jason

    2017-12-01

    Recently proposed relative addressing-based ([Formula: see text]) RNA secondary structure representation has important features by which an RNA structure database can be stored into a suffix array. A fast substructure search algorithm has been proposed based on binary search on this suffix array. Using this substructure search algorithm, we present a fast algorithm that finds the largest common substructure of given multiple RNA structures in [Formula: see text] format. The multiple RNA structure comparison problem is NP-hard in its general formulation. We introduced a new problem for comparing multiple RNA structures. This problem has more strict similarity definition and objective, and we propose an algorithm that solves this problem efficiently. We also develop another comparison algorithm that iteratively calls this algorithm to locate nonoverlapping large common substructures in compared RNAs. With the new resulting tools, we improved the RNASSAC website (linked from http://faculty.tamuc.edu/aarslan ). This website now also includes two drawing tools: one specialized for preparing RNA substructures that can be used as input by the search tool, and another one for automatically drawing the entire RNA structure from a given structure sequence.

  19. The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

    DEFF Research Database (Denmark)

    Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

    2006-01-01

    potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...

  20. Initiation of translation in bacteria by a structured eukaryotic IRES RNA.

    Science.gov (United States)

    Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S

    2015-03-05

    The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.

  1. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  2. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  3. Structure of the Human Mitochondrial Ribosome Studied In Situ by Cryoelectron Tomography.

    Science.gov (United States)

    Englmeier, Robert; Pfeffer, Stefan; Förster, Friedrich

    2017-10-03

    Mitochondria maintain their own genome and its corresponding protein synthesis machine, the mitochondrial ribosome (mitoribosome). Mitoribosomes primarily synthesize highly hydrophobic proteins of the inner mitochondrial membrane. Recent studies revealed the complete structure of the isolated mammalian mitoribosome, but its mode of membrane association remained hypothetical. In this study, we used cryoelectron tomography to visualize human mitoribosomes in isolated mitochondria. The subtomogram average of the membrane-associated human mitoribosome reveals a single major contact site with the inner membrane, mediated by the mitochondria-specific protein mL45. A second rRNA-mediated contact site that is present in yeast is absent in humans, resulting in a more variable association of the human mitoribosome with the inner membrane. Despite extensive structural differences of mammalian and fungal mitoribosomal structure, the principal organization of peptide exit tunnel and the mL45 homolog remains invariant, presumably to align the mitoribosome with the membrane-embedded insertion machinery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

    International Nuclear Information System (INIS)

    Pereira, Larissa Miranda

    2009-01-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

  5. RNA STRAND: The RNA Secondary Structure and Statistical Analysis Database

    Directory of Open Access Journals (Sweden)

    Andronescu Mirela

    2008-08-01

    Full Text Available Abstract Background The ability to access, search and analyse secondary structures of a large set of known RNA molecules is very important for deriving improved RNA energy models, for evaluating computational predictions of RNA secondary structures and for a better understanding of RNA folding. Currently there is no database that can easily provide these capabilities for almost all RNA molecules with known secondary structures. Results In this paper we describe RNA STRAND – the RNA secondary STRucture and statistical ANalysis Database, a curated database containing known secondary structures of any type and organism. Our new database provides a wide collection of known RNA secondary structures drawn from public databases, searchable and downloadable in a common format. Comprehensive statistical information on the secondary structures in our database is provided using the RNA Secondary Structure Analyser, a new tool we have developed to analyse RNA secondary structures. The information thus obtained is valuable for understanding to which extent and with which probability certain structural motifs can appear. We outline several ways in which the data provided in RNA STRAND can facilitate research on RNA structure, including the improvement of RNA energy models and evaluation of secondary structure prediction programs. In order to keep up-to-date with new RNA secondary structure experiments, we offer the necessary tools to add solved RNA secondary structures to our database and invite researchers to contribute to RNA STRAND. Conclusion RNA STRAND is a carefully assembled database of trusted RNA secondary structures, with easy on-line tools for searching, analyzing and downloading user selected entries, and is publicly available at http://www.rnasoft.ca/strand.

  6. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  7. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  9. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  10. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  11. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

    2013-01-01

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

  12. Fatgraph models of RNA structure

    Directory of Open Access Journals (Sweden)

    Huang Fenix

    2017-01-01

    Full Text Available In this review paper we discuss fatgraphs as a conceptual framework for RNA structures. We discuss various notions of coarse-grained RNA structures and relate them to fatgraphs.We motivate and discuss the main intuition behind the fatgraph model and showcase its applicability to canonical as well as noncanonical base pairs. Recent discoveries regarding novel recursions of pseudoknotted (pk configurations as well as their translation into context-free grammars for pk-structures are discussed. This is shown to allow for extending the concept of partition functions of sequences w.r.t. a fixed structure having non-crossing arcs to pk-structures. We discuss minimum free energy folding of pk-structures and combine these above results outlining how to obtain an inverse folding algorithm for PK structures.

  13. Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

    Science.gov (United States)

    Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

    2016-06-01

    Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

  14. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  15. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  16. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  17. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  18. RNA-SSPT: RNA Secondary Structure Prediction Tools.

    Science.gov (United States)

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad

    2013-01-01

    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes.

  19. Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

    Science.gov (United States)

    Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

    2007-06-01

    Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

  20. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  1. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  2. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  3. RNA Structural Alignments, Part I

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Gorodkin, Jan

    2014-01-01

    Simultaneous alignment and secondary structure prediction of RNA sequences is often referred to as "RNA structural alignment." A class of the methods for structural alignment is based on the principles proposed by Sankoff more than 25 years ago. The Sankoff algorithm simultaneously folds and aligns...... is so high that it took more than a decade before the first implementation of a Sankoff style algorithm was published. However, with the faster computers available today and the improved heuristics used in the implementations the Sankoff-based methods have become practical. This chapter describes...... the methods based on the Sankoff algorithm. All the practical implementations of the algorithm use heuristics to make them run in reasonable time and memory. These heuristics are also described in this chapter....

  4. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  5. Graphical representation of ribosomal RNA probe accessibility data using ARB software package

    Directory of Open Access Journals (Sweden)

    Amann Rudolf

    2005-03-01

    Full Text Available Abstract Background Taxon specific hybridization probes in combination with a variety of commonly used hybridization formats nowadays are standard tools in microbial identification. A frequently applied technology, fluorescence in situ hybridization (FISH, besides single cell identification, allows the localization and functional studies of the microbial community composition. Careful in silico design and evaluation of potential oligonucleotide probe targets is therefore crucial for performing successful hybridization experiments. Results The PROBE Design tools of the ARB software package take into consideration several criteria such as number, position and quality of diagnostic sequence differences while designing oligonucleotide probes. Additionally, new visualization tools were developed to enable the user to easily examine further sequence associated criteria such as higher order structure, conservation, G+C content, transition-transversion profiles and in situ target accessibility patterns. The different types of sequence associated information (SAI can be visualized by user defined background colors within the ARB primary and secondary structure editors as well as in the PROBE Match tool. Conclusion Using this tool, in silico probe design and evaluation can be performed with respect to in situ probe accessibility data. The evaluation of proposed probe targets with respect to higher-order rRNA structure is of importance for successful design and performance of in situ hybridization experiments. The entire ARB software package along with the probe accessibility data is available from the ARB home page http://www.arb-home.de.

  6. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  7. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  8. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  9. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  10. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  11. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Science.gov (United States)

    Fernández-Miragall, Olga; Hernández, Carmen

    2011-01-01

    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  12. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  13. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  14. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  15. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    Science.gov (United States)

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

  16. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    DEFF Research Database (Denmark)

    Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...

  17. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  18. Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.

    2008-01-01

    The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.

  19. Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them.

    Science.gov (United States)

    Leppek, Kathrin; Das, Rhiju; Barna, Maria

    2018-03-01

    RNA molecules can fold into intricate shapes that can provide an additional layer of control of gene expression beyond that of their sequence. In this Review, we discuss the current mechanistic understanding of structures in 5' untranslated regions (UTRs) of eukaryotic mRNAs and the emerging methodologies used to explore them. These structures may regulate cap-dependent translation initiation through helicase-mediated remodelling of RNA structures and higher-order RNA interactions, as well as cap-independent translation initiation through internal ribosome entry sites (IRESs), mRNA modifications and other specialized translation pathways. We discuss known 5' UTR RNA structures and how new structure probing technologies coupled with prospective validation, particularly compensatory mutagenesis, are likely to identify classes of structured RNA elements that shape post-transcriptional control of gene expression and the development of multicellular organisms.

  20. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  1. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    ; there was no silver staining at the sites of the rRNA genes and nucleolus precursor bodies. From 30 hpc onwards, most 4-cell embryos had medium size to large clusters of FITC-labeled areas colocalized with silver staining of rRNA gene clusters and fibrillogranular nucleoli. These observations indicate that r...

  2. 5-Methyldeoxycytidine in the Physarum minichromosome containing the ribosomal RNA genes.

    Science.gov (United States)

    Cooney, C A; Matthews, H R; Bradbury, E M

    1984-01-01

    5-Methyldeoxycytidine (5MC) was analyzed by high pressure liquid chromatography (HPLC) and by restriction enzyme digestion in rDNA isolated from Physarum polycephalum. rDNA from Physarum M3C strain microplasmodia has a significant 5MC content (about half that of the whole genomic DNA). This rDNA contains many C5MCGG sites because it is clearly digested further by Msp I than by Hpa II. However, most 5MC is in other sites. In particular, alternating CG sequences appear to be highly methylated. HPLC of deoxyribonucleosides shows tha most of the transcribed regions contain little or no 5MC. Restriction digestion indicates that there is little or no 5MC in any of the transcribed regions including the transcription origin and adjacent sequences. Over 90% of the total 5MC is in or near the central nontranscribed spacer and most methylated restriction sites are in inverted repeats of this spacer. rDNA is very heterogeneous with respect to 5MC. The 5MC pattern doesn't appear to change with inactivation of the rRNA genes during reversible differentiation from microplasmodia (growing) to microsclerotia (dormant), showing that inactivation is due to changes in other chromatin variables. The 5MC pattern is different between Physarum strains. The possible involvement of this 5MC in rDNA chromatin structure and in cruciform and Z-DNA formation is discussed. Images PMID:6322108

  3. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  4. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  5. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  6. Atomic resolution structure of cucurmosin, a novel type 1 ribosome-inactivating protein from the sarcocarp of Cucurbita moschata

    Energy Technology Data Exchange (ETDEWEB)

    Hou, Xiaomin; Meehan, Edward J.; Xie, Jieming; Huang, Mingdong; Chen, Minghuang; Chen, Liqing (UAH); (Fujian); (Chinese Aca. Sci.)

    2008-10-27

    A novel type 1 ribosome-inactivating protein (RIP) designated cucurmosin was isolated from the sarcocarp of Cucurbita moschata (pumpkin). Besides rRNA N-glycosidase activity, cucurmosin exhibits strong cytotoxicities to three cancer cell lines of both human and murine origins, but low toxicity to normal cells. Plant genomic DNA extracted from the tender leaves was amplified by PCR between primers based on the N-terminal sequence and X-ray sequence of the C-terminal. The complete mature protein sequence was obtained from N-terminal protein sequencing and partial DNA sequencing, confirmed by high resolution crystal structure analysis. The crystal structure of cucurmosin has been determined at 1.04 {angstrom}, a resolution that has never been achieved before for any RIP. The structure contains two domains: a large N-terminal domain composed of seven {alpha}-helices and eight {beta}-strands, and a smaller C-terminal domain consisting of three {alpha}-helices and two {beta}-strands. The high resolution structure established a glycosylation pattern of GlcNAc{sub 2}Man3Xyl. Asn225 was identified as a glycosylation site. Residues Tyr70, Tyr109, Glu158 and Arg161 define the active site of cucurmosin as an RNA N-glycosidase. The structural basis of cytotoxicity difference between cucurmosin and trichosanthin is discussed.

  7. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

    Science.gov (United States)

    Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

    2004-12-01

    Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

  8. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  9. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

    International Nuclear Information System (INIS)

    Zhang, H.; Wang, J.C.; Liu, L.F.

    1988-01-01

    Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

  10. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  11. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  12. Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  13. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  14. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  15. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    OpenAIRE

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  17. Analysis of ribosomal RNA stability in dead cells of wine yeast by quantitative PCR.

    Science.gov (United States)

    Sunyer-Figueres, Merce; Wang, Chunxiao; Mas, Albert

    2018-04-02

    During wine production, some yeasts enter a Viable But Not Culturable (VBNC) state, which may influence the quality and stability of the final wine through remnant metabolic activity or by resuscitation. Culture-independent techniques are used for obtaining an accurate estimation of the number of live cells, and quantitative PCR could be the most accurate technique. As a marker of cell viability, rRNA was evaluated by analyzing its stability in dead cells. The species-specific stability of rRNA was tested in Saccharomyces cerevisiae, as well as in three species of non-Saccharomyces yeast (Hanseniaspora uvarum, Torulaspora delbrueckii and Starmerella bacillaris). High temperature and antimicrobial dimethyl dicarbonate (DMDC) treatments were efficient in lysing the yeast cells. rRNA gene and rRNA (as cDNA) were analyzed over 48 h after cell lysis by quantitative PCR. The results confirmed the stability of rRNA for 48 h after the cell lysis treatments. To sum up, rRNA may not be a good marker of cell viability in the wine yeasts that were tested. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. tRNA-like structure regulates translation of Brome mosaic virus RNA.

    Science.gov (United States)

    Barends, Sharief; Rudinger-Thirion, Joëlle; Florentz, Catherine; Giegé, Richard; Pleij, Cornelis W A; Kraal, Barend

    2004-04-01

    For various groups of plant viruses, the genomic RNAs end with a tRNA-like structure (TLS) instead of the 3' poly(A) tail of common mRNAs. The actual function of these TLSs has long been enigmatic. Recently, however, it became clear that for turnip yellow mosaic virus, a tymovirus, the valylated TLS(TYMV) of the single genomic RNA functions as a bait for host ribosomes and directs them to the internal initiation site of translation (with N-terminal valine) of the second open reading frame for the polyprotein. This discovery prompted us to investigate whether the much larger TLSs of a different genus of viruses have a comparable function in translation. Brome mosaic virus (BMV), a bromovirus, has a tripartite RNA genome with a subgenomic RNA4 for coat protein expression. All four RNAs carry a highly conserved and bulky 3' TLS(BMV) (about 200 nucleotides) with determinants for tyrosylation. We discovered TLS(BMV)-catalyzed self-tyrosylation of the tyrosyl-tRNA synthetase but could not clearly detect tyrosine incorporation into any virus-encoded protein. We established that BMV proteins do not need TLS(BMV) tyrosylation for their initiation. However, disruption of the TLSs strongly reduced the translation of genomic RNA1, RNA2, and less strongly, RNA3, whereas coat protein expression from RNA4 remained unaffected. This aberrant translation could be partially restored by providing the TLS(BMV) in trans. Intriguingly, a subdomain of the TLS(BMV) could even almost fully restore translation to the original pattern. We discuss here a model with a central and dominant role for the TLS(BMV) during the BMV infection cycle.

  19. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  20. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

    Science.gov (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

    2013-05-01

    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  1. On RNA-RNA interaction structures of fixed topological genus.

    Science.gov (United States)

    Fu, Benjamin M M; Han, Hillary S W; Reidys, Christian M

    2015-04-01

    Interacting RNA complexes are studied via bicellular maps using a filtration via their topological genus. Our main result is a new bijection for RNA-RNA interaction structures and a linear time uniform sampling algorithm for RNA complexes of fixed topological genus. The bijection allows to either reduce the topological genus of a bicellular map directly, or to lose connectivity by decomposing the complex into a pair of single stranded RNA structures. Our main result is proved bijectively. It provides an explicit algorithm of how to rewire the corresponding complexes and an unambiguous decomposition grammar. Using the concept of genus induction, we construct bicellular maps of fixed topological genus g uniformly in linear time. We present various statistics on these topological RNA complexes and compare our findings with biological complexes. Furthermore we show how to construct loop-energy based complexes using our decomposition grammar. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.

    Directory of Open Access Journals (Sweden)

    Lieke A van Gijtenbeek

    2016-12-01

    Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.

  3. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. The 2009 Nobel Prize in Chemistry: Thomas A. Steitz and the structure of the ribosome.

    Science.gov (United States)

    Zhao, Peter

    2011-06-01

    Over the past 200 years, there have been countless groundbreaking discoveries in biology and medicine at Yale University. However, one particularly noteworthy discovery with profoundly important and broad consequences happened here in just the past two decades. In 2009, Thomas Steitz, the Sterling Professor of Molecular Biophysics & Biochemistry, was awarded the Nobel Prize in Chemistry for "studies of the structure and function of the ribosome," along with Venkatraman Ramakrishnan of the MRC Laboratory of Molecular Biology and Ada E. Yonath of the Weizmann Institute of Science. This article covers the historical context of Steitz's important discovery, the techniques his laboratory used to study the ribosome, and the impact that this research has had, and will have, on the future of biological and medical research.

  5. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  6. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  7. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming

    2008-01-01

    causes confusion in the phylogeny, taxonomy and the debate on cosmopolitanism of free-living protists. Here we present a SSU rRNA-based phylogeny of the Hyalospheniidae including the most common species. Similar to the filose testate amoebae of the order Euglyphida the most basal clades have a terminal...

  8. Development of molecular cytogenetics and physical mapping of ribosomal RNA genes in Lupinus

    Czech Academy of Sciences Publication Activity Database

    Naganowska, B.; Doležel, Jaroslav; Swiecicki, W. K.

    2003-01-01

    Roč. 46, - (2003), s. 211-215 ISSN 0006-3134 R&D Projects: GA ČR GA521/03/0595 Institutional research plan: CEZ:AV0Z5038910 Keywords : fluorescent in situ hybridization * Lupinus sp. * rRNA genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  9. Structural Features of the Seneca Valley Virus Internal Ribosome Entry Site (IRES) Element: a Picornavirus with a Pestivirus-Like IRES

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Locker, Nicolas; Gomwalk, Zarmwa

    2011-01-01

    The RNA genome of Seneca Valley virus (SVV), a recently identified picornavirus, contains an internal ribosome entry site (IRES) element which has structural and functional similarity to that from classical swine fever virus (CSFV) and hepatitis C virus, members of the FLAVIVIRIDAE: The SVV IRES...... has an absolute requirement for the presence of a short region of virus-coding sequence to allow it to function either in cells or in rabbit reticulocyte lysate. The IRES activity does not require the translation initiation factor eIF4A or intact eIF4G. The predicted secondary structure indicates...

  10. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  11. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    Energy Technology Data Exchange (ETDEWEB)

    Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)

    1994-12-31

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.

  12. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    International Nuclear Information System (INIS)

    Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.

    1994-01-01

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA

  13. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Cryo-EM structure of the E. coli translating ribosome in complex with SRP and its receptor

    Science.gov (United States)

    Estrozi, Leandro F.; Boehringer, Daniel; Shan, Shu-ou; Ban, Nenad; Schaffitzel, Christiane

    2013-01-01

    We report the early conformation of the E. coli signal recognition particle (SRP) and its receptor FtsY bound to the translating ribosome by cryo-electron microscopy. FtsY binds to the tetraloop of the SRP RNA whereas the NG-domains of the SRP protein and FtsY interact weakly in this conformation. Our results suggest that optimal positioning of the SRP RNA tetraloop and the Ffh NG-domain leads to FtsY recruitment. PMID:21151118

  15. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  16. Characteristics and Prediction of RNA Structure

    Directory of Open Access Journals (Sweden)

    Hengwu Li

    2014-01-01

    Full Text Available RNA secondary structures with pseudoknots are often predicted by minimizing free energy, which is NP-hard. Most RNAs fold during transcription from DNA into RNA through a hierarchical pathway wherein secondary structures form prior to tertiary structures. Real RNA secondary structures often have local instead of global optimization because of kinetic reasons. The performance of RNA structure prediction may be improved by considering dynamic and hierarchical folding mechanisms. This study is a novel report on RNA folding that accords with the golden mean characteristic based on the statistical analysis of the real RNA secondary structures of all 480 sequences from RNA STRAND, which are validated by NMR or X-ray. The length ratios of domains in these sequences are approximately 0.382L, 0.5L, 0.618L, and L, where L is the sequence length. These points are just the important golden sections of sequence. With this characteristic, an algorithm is designed to predict RNA hierarchical structures and simulate RNA folding by dynamically folding RNA structures according to the above golden section points. The sensitivity and number of predicted pseudoknots of our algorithm are better than those of the Mfold, HotKnots, McQfold, ProbKnot, and Lhw-Zhu algorithms. Experimental results reflect the folding rules of RNA from a new angle that is close to natural folding.

  17. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  20. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  1. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  2. Advancing viral RNA structure prediction: measuring the thermodynamics of pyrimidine-rich internal loops.

    Science.gov (United States)

    Phan, Andy; Mailey, Katherine; Saeki, Jessica; Gu, Xiaobo; Schroeder, Susan J

    2017-05-01

    Accurate thermodynamic parameters improve RNA structure predictions and thus accelerate understanding of RNA function and the identification of RNA drug binding sites. Many viral RNA structures, such as internal ribosome entry sites, have internal loops and bulges that are potential drug target sites. Current models used to predict internal loops are biased toward small, symmetric purine loops, and thus poorly predict asymmetric, pyrimidine-rich loops with >6 nucleotides (nt) that occur frequently in viral RNA. This article presents new thermodynamic data for 40 pyrimidine loops, many of which can form UU or protonated CC base pairs. Uracil and protonated cytosine base pairs stabilize asymmetric internal loops. Accurate prediction rules are presented that account for all thermodynamic measurements of RNA asymmetric internal loops. New loop initiation terms for loops with >6 nt are presented that do not follow previous assumptions that increasing asymmetry destabilizes loops. Since the last 2004 update, 126 new loops with asymmetry or sizes greater than 2 × 2 have been measured. These new measurements significantly deepen and diversify the thermodynamic database for RNA. These results will help better predict internal loops that are larger, pyrimidine-rich, and occur within viral structures such as internal ribosome entry sites. © 2017 Phan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  4. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  5. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  6. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  7. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    International Nuclear Information System (INIS)

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-01-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  8. Inverse folding of RNA pseudoknot structures

    Directory of Open Access Journals (Sweden)

    Li Linda YM

    2010-06-01

    Full Text Available Abstract Background RNA exhibits a variety of structural configurations. Here we consider a structure to be tantamount to the noncrossing Watson-Crick and G-U-base pairings (secondary structure and additional cross-serial base pairs. These interactions are called pseudoknots and are observed across the whole spectrum of RNA functionalities. In the context of studying natural RNA structures, searching for new ribozymes and designing artificial RNA, it is of interest to find RNA sequences folding into a specific structure and to analyze their induced neutral networks. Since the established inverse folding algorithms, RNAinverse, RNA-SSD as well as INFO-RNA are limited to RNA secondary structures, we present in this paper the inverse folding algorithm Inv which can deal with 3-noncrossing, canonical pseudoknot structures. Results In this paper we present the inverse folding algorithm Inv. We give a detailed analysis of Inv, including pseudocodes. We show that Inv allows to design in particular 3-noncrossing nonplanar RNA pseudoknot 3-noncrossing RNA structures-a class which is difficult to construct via dynamic programming routines. Inv is freely available at http://www.combinatorics.cn/cbpc/inv.html. Conclusions The algorithm Inv extends inverse folding capabilities to RNA pseudoknot structures. In comparison with RNAinverse it uses new ideas, for instance by considering sets of competing structures. As a result, Inv is not only able to find novel sequences even for RNA secondary structures, it does so in the context of competing structures that potentially exhibit cross-serial interactions.

  9. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  10. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  11. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

  12. Exploring RNA structure by integrative molecular modelling

    DEFF Research Database (Denmark)

    Masquida, Benoît; Beckert, Bertrand; Jossinet, Fabrice

    2010-01-01

    RNA molecular modelling is adequate to rapidly tackle the structure of RNA molecules. With new structured RNAs constituting a central class of cellular regulators discovered every year, the need for swift and reliable modelling methods is more crucial than ever. The pragmatic method based...... on interactive all-atom molecular modelling relies on the observation that specific structural motifs are recurrently found in RNA sequences. Once identified by a combination of comparative sequence analysis and biochemical data, the motifs composing the secondary structure of a given RNA can be extruded...

  13. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil.

    Science.gov (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk

    2006-03-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  14. Predicting RNA Structure Using Mutual Information

    DEFF Research Database (Denmark)

    Freyhult, E.; Moulton, V.; Gardner, P. P.

    2005-01-01

    , to display and predict conserved RNA secondary structure (including pseudoknots) from an alignment. Results: We show that MIfold can be used to predict simple pseudoknots, and that the performance can be adjusted to make it either more sensitive or more selective. We also demonstrate that the overall...... package. Conclusion: MIfold provides a useful supplementary tool to programs such as RNA Structure Logo, RNAalifold and COVE, and should be useful for automatically generating structural predictions for databases such as Rfam. Availability: MIfold is freely available from http......Background: With the ever-increasing number of sequenced RNAs and the establishment of new RNA databases, such as the Comparative RNA Web Site and Rfam, there is a growing need for accurately and automatically predicting RNA structures from multiple alignments. Since RNA secondary structure...

  15. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015

  16. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  17. Four RNA families with functional transient structures.

    Science.gov (United States)

    Zhu, Jing Yun A; Meyer, Irmtraud M

    2015-01-01

    Protein-coding and non-coding RNA transcripts perform a wide variety of cellular functions in diverse organisms. Several of their functional roles are expressed and modulated via RNA structure. A given transcript, however, can have more than a single functional RNA structure throughout its life, a fact which has been previously overlooked. Transient RNA structures, for example, are only present during specific time intervals and cellular conditions. We here introduce four RNA families with transient RNA structures that play distinct and diverse functional roles. Moreover, we show that these transient RNA structures are structurally well-defined and evolutionarily conserved. Since Rfam annotates one structure for each family, there is either no annotation for these transient structures or no such family. Thus, our alignments either significantly update and extend the existing Rfam families or introduce a new RNA family to Rfam. For each of the four RNA families, we compile a multiple-sequence alignment based on experimentally verified transient and dominant (dominant in terms of either the thermodynamic stability and/or attention received so far) RNA secondary structures using a combination of automated search via covariance model and manual curation. The first alignment is the Trp operon leader which regulates the operon transcription in response to tryptophan abundance through alternative structures. The second alignment is the HDV ribozyme which we extend to the 5' flanking sequence. This flanking sequence is involved in the regulation of the transcript's self-cleavage activity. The third alignment is the 5' UTR of the maturation protein from Levivirus which contains a transient structure that temporarily postpones the formation of the final inhibitory structure to allow translation of maturation protein. The fourth and last alignment is the SAM riboswitch which regulates the downstream gene expression by assuming alternative structures upon binding of SAM. All

  18. Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chengliang [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Zhang, Qiongdi [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Hang, Tianrong [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Tao, Yue [Shanghai Children’s Medical Center, 1678 Dongfang Road, Pudong, Shanghai 200120, People’s Republic of (China); Ma, Xukai [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Wu, Minhao; Zhang, Xuan, E-mail: xuanzbin@ustc.edu.cn; Zang, Jianye, E-mail: xuanzbin@ustc.edu.cn [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China)

    2015-08-28

    The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66{sup 176–C} complexed with Rpl8{sup 204–224} in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity.

  19. Small catalytic RNA: Structure, function and application

    Energy Technology Data Exchange (ETDEWEB)

    Monforte, Joseph Albert [Univ. of California, Berkeley, CA (United States)

    1991-04-01

    We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the ``paperclip`` and ``hammerhead`` RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a ``hammerhead,`` to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 121±s are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus_minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.

  20. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  1. Secondary structural entropy in RNA switch (Riboswitch) identification.

    Science.gov (United States)

    Manzourolajdad, Amirhossein; Arnold, Jonathan

    2015-04-28

    RNA regulatory elements play a significant role in gene regulation. Riboswitches, a widespread group of regulatory RNAs, are vital components of many bacterial genomes. These regulatory elements generally function by forming a ligand-induced alternative fold that controls access to ribosome binding sites or other regulatory sites in RNA. Riboswitch-mediated mechanisms are ubiquitous across bacterial genomes. A typical class of riboswitch has its own unique structural and biological complexity, making de novo riboswitch identification a formidable task. Traditionally, riboswitches have been identified through comparative genomics based on sequence and structural homology. The limitations of structural-homology-based approaches, coupled with the assumption that there is a great diversity of undiscovered riboswitches, suggests the need for alternative methods for riboswitch identification, possibly based on features intrinsic to their structure. As of yet, no such reliable method has been proposed. We used structural entropy of riboswitch sequences as a measure of their secondary structural dynamics. Entropy values of a diverse set of riboswitches were compared to that of their mutants, their dinucleotide shuffles, and their reverse complement sequences under different stochastic context-free grammar folding models. Significance of our results was evaluated by comparison to other approaches, such as the base-pairing entropy and energy landscapes dynamics. Classifiers based on structural entropy optimized via sequence and structural features were devised as riboswitch identifiers and tested on Bacillus subtilis, Escherichia coli, and Synechococcus elongatus as an exploration of structural entropy based approaches. The unusually long untranslated region of the cotH in Bacillus subtilis, as well as upstream regions of certain genes, such as the sucC genes were associated with significant structural entropy values in genome-wide examinations. Various tests show that there

  2. Characterization of an internal ribosomal entry segment within the 5' leader of avian reticuloendotheliosis virus type A RNA and development of novel MLV-REV-based retroviral vectors.

    Science.gov (United States)

    López-Lastra, M; Gabus, C; Darlix, J L

    1997-11-01

    The murine leukemia virus (MLV)-related type C viruses constitute a major class of retroviruses that includes numerous endogenous and exogenous mammalian viruses and the related avian spleen necrosis virus (SNV). The MLV-related viruses possess a long and multifunctional 5' untranslated leader involved in key steps of the viral life cycle--splicing, translation, RNA dimerization, encapsidation, and reverse transcription. Recent studies have shown that the 5' leader of Friend murine leukemia virus and Moloney murine leukemia virus can direct cap independent translation of gag precursor proteins (Berlioz et al., 1995; Vagner et al., 1995b). These data, together with structural homology studies (Koning et al., 1992), prompted us to undertake a search for new internal ribosome entry segment (IRES) of retroviral origin. Here we describe an IRES element within the 5' leader of avian reticuloendotheliosis virus type A (REV-A) genomic RNA. Data show that the REV-A 5' IRES element maps downstream of the packaging/dimerization (E/DLS) sequence (Watanabe and Temin, 1982; Darlix et al., 1992) and the minimal IRES sequence appears to be within a 129 nt fragment (nucleotides 452-580) of the 5' leader, immediately upstream of the gag AUG codon. The REV-A IRES has been successfully utilized in the construction of novel high titer MLV-based retroviral vectors, containing one or more IRES elements of retroviral origin. These retroviral constructs, which represent a starting point for the design of novel vectors suitable for gene therapy, are also of interest as a model system of internal translation initiation and its possible regulation during development, cancer, or virus infection.

  3. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  4. Facilitating RNA structure prediction with microarrays.

    Science.gov (United States)

    Kierzek, Elzbieta; Kierzek, Ryszard; Turner, Douglas H; Catrina, Irina E

    2006-01-17

    Determining RNA secondary structure is important for understanding structure-function relationships and identifying potential drug targets. This paper reports the use of microarrays with heptamer 2'-O-methyl oligoribonucleotides to probe the secondary structure of an RNA and thereby improve the prediction of that secondary structure. When experimental constraints from hybridization results are added to a free-energy minimization algorithm, the prediction of the secondary structure of Escherichia coli 5S rRNA improves from 27 to 92% of the known canonical base pairs. Optimization of buffer conditions for hybridization and application of 2'-O-methyl-2-thiouridine to enhance binding and improve discrimination between AU and GU pairs are also described. The results suggest that probing RNA with oligonucleotide microarrays can facilitate determination of secondary structure.

  5. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  6. From DNA to proteins via the ribosome: Structural insights into the workings of the translation machinery

    Directory of Open Access Journals (Sweden)

    Agirrezabala Xabier

    2010-04-01

    Full Text Available Abstract Understanding protein synthesis in bacteria and humans is important for understanding the origin of many human diseases and devising treatments for them. Over the past decade, the field of structural biology has made significant advances in the visualisation of the molecular machinery involved in protein synthesis. It is now possible to discern, at least in outline, the way that interlocking ribosomal components and factors adapt their conformations throughout this process. The determination of structures in various functional contexts, along with the application of kinetic and fluorescent resonance energy transfer approaches to the problem, has given researchers the frame of reference for what remains as the greatest challenge: the complete dynamic portrait of protein synthesis in the cell.

  7. Functional 5′ UTR mRNA structures in eukaryotic translation regulation and how to find them

    Science.gov (United States)

    Leppek, Kathrin; Das, Rhiju; Barna, Maria

    2017-01-01

    RNA molecules can fold into intricate shapes that can provide an additional layer of control of gene expression beyond that of their sequence. In this Review, we discuss the current mechanistic understanding of structures in 5′ untranslated regions (UTRs) of eukaryotic mRNAs and the emerging methodologies used to explore them. These structures may regulate cap-dependent translation initiation through helicase-mediated remodelling of RNA structures and higher-order RNA interactions, as well as cap-independent translation initiation through internal ribosome entry sites (IRESs), mRNA modifications and other specialized translation pathways. We discuss known 5′ UTR RNA structures and how new structure probing technologies coupled with prospective validation, particularly compensatory mutagenesis, are likely to identify classes of structured RNA elements that shape post-transcriptional control of gene expression and the development of multicellular organisms. PMID:29165424

  8. New windows into retroviral RNA structures.

    Science.gov (United States)

    Jayaraman, Dhivya; Kenyon, Julia Claire

    2018-01-25

    The multiple roles of both viral and cellular RNAs have become increasingly apparent in recent years, and techniques to model them have become significantly more powerful, enabling faster and more accurate visualization of RNA structures. Techniques such as SHAPE (selective 2'OH acylation analysed by primer extension) have revolutionized the field, and have been used to examine RNAs belonging to many and diverse retroviruses. Secondary structure probing reagents such as these have been aided by the development of faster methods of analysis either via capillary or next-generation sequencing, allowing the analysis of entire genomes, and of retroviral RNA structures within virions. Techniques to model the three-dimensional structures of these large RNAs have also recently developed. The flexibility of retroviral RNAs, both structural and functional, is clear from the results of these new experimental techniques. Retroviral RNA structures and structural changes control many stages of the lifecycle, and both the RNA structures themselves and their interactions with ligands are potential new drug targets. In addition, our growing understanding of retroviral RNA structures is aiding our knowledge of cellular RNA form and function.

  9. MicroRNA-target binding structures mimic microRNA duplex structures in humans.

    Directory of Open Access Journals (Sweden)

    Xi Chen

    Full Text Available Traditionally, researchers match a microRNA guide strand to mRNA sequences using sequence comparisons to predict its potential target genes. However, many of the predictions can be false positives due to limitations in sequence comparison alone. In this work, we consider the association of two related RNA structures that share a common guide strand: the microRNA duplex and the microRNA-target binding structure. We have analyzed thousands of such structure pairs and found many of them share high structural similarity. Therefore, we conclude that when predicting microRNA target genes, considering just the microRNA guide strand matches to gene sequences may not be sufficient--the microRNA duplex structure formed by the guide strand and its companion passenger strand must also be considered. We have developed software to translate RNA binding structure into encoded representations, and we have also created novel automatic comparison methods utilizing such encoded representations to determine RNA structure similarity. Our software and methods can be utilized in the other RNA secondary structure comparisons as well.

  10. An image processing approach to computing distances between RNA secondary structures dot plots

    Directory of Open Access Journals (Sweden)

    Sapiro Guillermo

    2009-02-01

    Full Text Available Abstract Background Computing the distance between two RNA secondary structures can contribute in understanding the functional relationship between them. When used repeatedly, such a procedure may lead to finding a query RNA structure of interest in a database of structures. Several methods are available for computing distances between RNAs represented as strings or graphs, but none utilize the RNA representation with dot plots. Since dot plots are essentially digital images, there is a clear motivation to devise an algorithm for computing the distance between dot plots based on image processing methods. Results We have developed a new metric dubbed 'DoPloCompare', which compares two RNA structures. The method is based on comparing dot plot diagrams that represent the secondary structures. When analyzing two diagrams and motivated by image processing, the distance is based on a combination of histogram correlations and a geometrical distance measure. We introduce, describe, and illustrate the procedure by two applications that utilize this metric on RNA sequences. The first application is the RNA design problem, where the goal is to find the nucleotide sequence for a given secondary structure. Examples where our proposed distance measure outperforms others are given. The second application locates peculiar point mutations that induce significant structural alternations relative to the wild type predicted secondary structure. The approach reported in the past to solve this problem was tested on several RNA sequences with known secondary structures to affirm their prediction, as well as on a data set of ribosomal pieces. These pieces were computationally cut from a ribosome for which an experimentally derived secondary structure is available, and on each piece the prediction conveys similarity to the experimental result. Our newly proposed distance measure shows benefit in this problem as well when compared to standard methods used for assessing

  11. Small catalytic RNA: Structure, function and application

    Energy Technology Data Exchange (ETDEWEB)

    Monforte, J.A.

    1991-04-01

    We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the paperclip'' and hammerhead'' RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a hammerhead,'' to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 12{plus minus}1 nucleotides are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.

  12. Including RNA secondary structures improves accuracy and robustness in reconstruction of phylogenetic trees.

    Science.gov (United States)

    Keller, Alexander; Förster, Frank; Müller, Tobias; Dandekar, Thomas; Schultz, Jörg; Wolf, Matthias

    2010-01-15

    In several studies, secondary structures of ribosomal genes have been used to improve the quality of phylogenetic reconstructions. An extensive evaluation of the benefits of secondary structure, however, is lacking. This is the first study to counter this deficiency. We inspected the accuracy and robustness of phylogenetics with individual secondary structures by simulation experiments for artificial tree topologies with up to 18 taxa and for divergency levels in the range of typical phylogenetic studies. We chose the internal transcribed spacer 2 of the ribosomal cistron as an exemplary marker region. Simulation integrated the coevolution process of sequences with secondary structures. Additionally, the phylogenetic power of marker size duplication was investigated and compared with sequence and sequence-structure reconstruction methods. The results clearly show that accuracy and robustness of Neighbor Joining trees are largely improved by structural information in contrast to sequence only data, whereas a doubled marker size only accounts for robustness. Individual secondary structures of ribosomal RNA sequences provide a valuable gain of information content that is useful for phylogenetics. Thus, the usage of ITS2 sequence together with secondary structure for taxonomic inferences is recommended. Other reconstruction methods as maximum likelihood, bayesian inference or maximum parsimony may equally profit from secondary structure inclusion. This article was reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber) and Eugene V. Koonin. Reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber) and Eugene V. Koonin. For the full reviews, please go to the Reviewers' comments section.

  13. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  14. ConStruct: Improved construction of RNA consensus structures

    Directory of Open Access Journals (Sweden)

    Steger Gerhard

    2008-04-01

    Full Text Available Abstract Background Aligning homologous non-coding RNAs (ncRNAs correctly in terms of sequence and structure is an unresolved problem, due to both mathematical complexity and imperfect scoring functions. High quality alignments, however, are a prerequisite for most consensus structure prediction approaches, homology searches, and tools for phylogeny inference. Automatically created ncRNA alignments often need manual corrections, yet this manual refinement is tedious and error-prone. Results We present an extended version of CONSTRUCT, a semi-automatic, graphical tool suitable for creating RNA alignments correct in terms of both consensus sequence and consensus structure. To this purpose CONSTRUCT combines sequence alignment, thermodynamic data and various measures of covariation. One important feature is that the user is guided during the alignment correction step by a consensus dotplot, which displays all thermodynamically optimal base pairs and the corresponding covariation. Once the initial alignment is corrected, optimal and suboptimal secondary structures as well as tertiary interaction can be predicted. We demonstrate CONSTRUCT's ability to guide the user in correcting an initial alignment, and show an example for optimal secondary consensus structure prediction on very hard to align SECIS elements. Moreover we use CONSTRUCT to predict tertiary interactions from sequences of the internal ribosome entry site of CrP-like viruses. In addition we show that alignments specifically designed for benchmarking can be easily be optimized using CONSTRUCT, although they share very little sequence identity. Conclusion CONSTRUCT's graphical interface allows for an easy alignment correction based on and guided by predicted and known structural constraints. It combines several algorithms for prediction of secondary consensus structure and even tertiary interactions. The CONSTRUCT package can be downloaded from the URL listed in the Availability and

  15. RNA secondary structure prediction using soft computing.

    Science.gov (United States)

    Ray, Shubhra Sankar; Pal, Sankar K

    2013-01-01

    Prediction of RNA structure is invaluable in creating new drugs and understanding genetic diseases. Several deterministic algorithms and soft computing-based techniques have been developed for more than a decade to determine the structure from a known RNA sequence. Soft computing gained importance with the need to get approximate solutions for RNA sequences by considering the issues related with kinetic effects, cotranscriptional folding, and estimation of certain energy parameters. A brief description of some of the soft computing-based techniques, developed for RNA secondary structure prediction, is presented along with their relevance. The basic concepts of RNA and its different structural elements like helix, bulge, hairpin loop, internal loop, and multiloop are described. These are followed by different methodologies, employing genetic algorithms, artificial neural networks, and fuzzy logic. The role of various metaheuristics, like simulated annealing, particle swarm optimization, ant colony optimization, and tabu search is also discussed. A relative comparison among different techniques, in predicting 12 known RNA secondary structures, is presented, as an example. Future challenging issues are then mentioned.

  16. RNA Structural Dynamics As Captured by Molecular Simulations: A Comprehensive Overview

    Science.gov (United States)

    2018-01-01

    With both catalytic and genetic functions, ribonucleic acid (RNA) is perhaps the most pluripotent chemical species in molecular biology, and its functions are intimately linked to its structure and dynamics. Computer simulations, and in particular atomistic molecular dynamics (MD), allow structural dynamics of biomolecular systems to be investigated with unprecedented temporal and spatial resolution. We here provide a comprehensive overview of the fast-developing field of MD simulations of RNA molecules. We begin with an in-depth, evaluatory coverage of the most fundamental methodological challenges that set the basis for the future development of the field, in particular, the current developments and inherent physical limitations of the atomistic force fields and the recent advances in a broad spectrum of enhanced sampling methods. We also survey the closely related field of coarse-grained modeling of RNA systems. After dealing with the methodological aspects, we provide an exhaustive overview of the available RNA simulation literature, ranging from studies of the smallest RNA oligonucleotides to investigations of the entire ribosome. Our review encompasses tetranucleotides, tetraloops, a number of small RNA motifs, A-helix RNA, kissing-loop complexes, the TAR RNA element, the decoding center and other important regions of the ribosome, as well as assorted others systems. Extended sections are devoted to RNA–ion interactions, ribozymes, riboswitches, and protein/RNA complexes. Our overview is written for as broad of an audience as possible, aiming to provide a much-needed interdisciplinary bridge between computation and experiment, together with a perspective on the future of the field. PMID:29297679

  17. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    The secondary structure of the large-subunit ribosomal RNA (24-26S rRNA) has been studied with emphasis on comparative analysis of the folding patterns of the divergent domains in the available protist sequences, that is Prorocentrum micans (dinoflagellate), Saccharomyces carlsbergensis (yeast......), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  18. Accelerated probabilistic inference of RNA structure evolution

    Directory of Open Access Journals (Sweden)

    Holmes Ian

    2005-03-01

    Full Text Available Abstract Background Pairwise stochastic context-free grammars (Pair SCFGs are powerful tools for evolutionary analysis of RNA, including simultaneous RNA sequence alignment and secondary structure prediction, but the associated algorithms are intensive in both CPU and memory usage. The same problem is faced by other RNA alignment-and-folding algorithms based on Sankoff's 1985 algorithm. It is therefore desirable to constrain such algorithms, by pre-processing the sequences and using this first pass to limit the range of structures and/or alignments that can be considered. Results We demonstrate how flexible classes of constraint can be imposed, greatly reducing the computational costs while maintaining a high quality of structural homology prediction. Any score-attributed context-free grammar (e.g. energy-based scoring schemes, or conditionally normalized Pair SCFGs is amenable to this treatment. It is now possible to combine independent structural and alignment constraints of unprecedented general flexibility in Pair SCFG alignment algorithms. We outline several applications to the bioinformatics of RNA sequence and structure, including Waterman-Eggert N-best alignments and progressive multiple alignment. We evaluate the performance of the algorithm on test examples from the RFAM database. Conclusion A program, Stemloc, that implements these algorithms for efficient RNA sequence alignment and structure prediction is available under the GNU General Public License.

  19. Retroviral RNA Dimerization: From Structure to Functions

    Directory of Open Access Journals (Sweden)

    Noé Dubois

    2018-03-01

    Full Text Available The genome of the retroviruses is a dimer composed by two homologous copies of genomic RNA (gRNA molecules of positive polarity. The dimerization process allows two gRNA molecules to be non-covalently linked together through intermolecular base-pairing. This step is critical for the viral life cycle and is highly conserved among retroviruses with the exception of spumaretroviruses. Furthermore, packaging of two gRNA copies into viral particles presents an important evolutionary advantage for immune system evasion and drug resistance. Recent studies reported RNA switches models regulating not only gRNA dimerization, but also translation and packaging, and a spatio-temporal characterization of viral gRNA dimerization within cells are now at hand. This review summarizes our current understanding on the structural features of the dimerization signals for a variety of retroviruses (HIVs, MLV, RSV, BLV, MMTV, MPMV…, the mechanisms of RNA dimer formation and functional implications in the retroviral cycle.

  20. Structure of eEF3 and the mechanism of transfer RNA release from the E-site

    DEFF Research Database (Denmark)

    Andersen, Christian Brix Folsted; Becker, T.; Blau, M.

    2006-01-01

    Elongation factor eEF3 is an ATPase, which, in addition to the two canonical factors eEF1A and eEF2, serves an essential function in the translation cycle of fungi. eEF3 is required for the binding of the aatRNA-eEF1A-GTP ternary complex to the ribosomal A-site and has been suggested to facilitate...... the clearance of deacyl-tRNA from the E-site. Here, we present the crystal structure of eEF3 showing that it consists of an N-terminal HEAT repeat domain, followed by a four-helix bundle and two ABC-type ATPase domains with a chromo-domain inserted in ABC2. Moreover, we present the cryo-EM structure of the ATP......-bound form of eEF3 in complex with the post-translocational state 80S ribosome from yeast. eEF3 uses an entirely new factor binding site near the ribosomal E-site, with the chromodomain stabilizing the ribosomal L1 stalk in an open conformation, thus, allowing tRNA release....

  1. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  2. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  3. The art of editing RNA structural alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth

    2014-01-01

    Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious, it is re......Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious...

  4. Crystal structure analysis reveals functional flexibility in the selenocysteine-specific tRNA from mouse.

    Directory of Open Access Journals (Sweden)

    Oleg M Ganichkin

    Full Text Available Selenocysteine tRNAs (tRNA(Sec exhibit a number of unique identity elements that are recognized specifically by proteins of the selenocysteine biosynthetic pathways and decoding machineries. Presently, these identity elements and the mechanisms by which they are interpreted by tRNA(Sec-interacting factors are incompletely understood.We applied rational mutagenesis to obtain well diffracting crystals of murine tRNA(Sec. tRNA(Sec lacking the single-stranded 3'-acceptor end ((ΔGCCARNA(Sec yielded a crystal structure at 2.0 Å resolution. The global structure of (ΔGCCARNA(Sec resembles the structure of human tRNA(Sec determined at 3.1 Å resolution. Structural comparisons revealed flexible regions in tRNA(Sec used for induced fit binding to selenophosphate synthetase. Water molecules located in the present structure were involved in the stabilization of two alternative conformations of the anticodon stem-loop. Modeling of a 2'-O-methylated ribose at position U34 of the anticodon loop as found in a sub-population of tRNA(Secin vivo showed how this modification favors an anticodon loop conformation that is functional during decoding on the ribosome. Soaking of crystals in Mn(2+-containing buffer revealed eight potential divalent metal ion binding sites but the located metal ions did not significantly stabilize specific structural features of tRNA(Sec.We provide the most highly resolved structure of a tRNA(Sec molecule to date and assessed the influence of water molecules and metal ions on the molecule's conformation and dynamics. Our results suggest how conformational changes of tRNA(Sec support its interaction with proteins.

  5. UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

    Energy Technology Data Exchange (ETDEWEB)

    Rao, K.N.; Swaminathan, S.; Burley, S. K.

    2008-12-11

    We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

  6. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  7. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  8. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

    Science.gov (United States)

    Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

    2010-01-01

    N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

  10. Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

    Science.gov (United States)

    Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

    2007-02-23

    N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

  11. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Science.gov (United States)

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  12. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  13. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  14. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  15. Identification of RNA species in the RNA-toxin complex and structure of the complex in Clostridium botulinum type E.

    Science.gov (United States)

    Kitamura, Masaru

    2002-02-15

    Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).

  16. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  17. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  18. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  19. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  20. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  1. Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability

    NARCIS (Netherlands)

    Fernandez, J.; Yaman, I.; Mishra, R.; Merrick, W. C.; Snider, M. D.; Lamers, W. H.; Hatzoglou, M.

    2001-01-01

    The cationic amino acid transporter, Cat-1, facilitates the uptake of the essential amino acids arginine and lysine. Amino acid starvation causes accumulation and increased translation of cat-1 mRNA, resulting in a 58-fold increase in protein levels and increased arginine uptake. A bicistronic mRNA

  2. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  3. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  4. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  5. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  6. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  7. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  8. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  9. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  10. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank

    1988-01-01

    UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate...... transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells...

  11. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  12. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  13. Including RNA secondary structures improves accuracy and robustness in reconstruction of phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dandekar Thomas

    2010-01-01

    Full Text Available Abstract Background In several studies, secondary structures of ribosomal genes have been used to improve the quality of phylogenetic reconstructions. An extensive evaluation of the benefits of secondary structure, however, is lacking. Results This is the first study to counter this deficiency. We inspected the accuracy and robustness of phylogenetics with individual secondary structures by simulation experiments for artificial tree topologies with up to 18 taxa and for divergency levels in the range of typical phylogenetic studies. We chose the internal transcribed spacer 2 of the ribosomal cistron as an exemplary marker region. Simulation integrated the coevolution process of sequences with secondary structures. Additionally, the phylogenetic power of marker size duplication was investigated and compared with sequence and sequence-structure reconstruction methods. The results clearly show that accuracy and robustness of Neighbor Joining trees are largely improved by structural information in contrast to sequence only data, whereas a doubled marker size only accounts for robustness. Conclusions Individual secondary structures of ribosomal RNA sequences provide a valuable gain of information content that is useful for phylogenetics. Thus, the usage of ITS2 sequence together with secondary structure for taxonomic inferences is recommended. Other reconstruction methods as maximum likelihood, bayesian inference or maximum parsimony may equally profit from secondary structure inclusion. Reviewers This article was reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber and Eugene V. Koonin. Open peer review Reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber and Eugene V. Koonin. For the full reviews, please go to the Reviewers' comments section.

  14. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  15. RNA2DMut: a web tool for the design and analysis of RNA structure mutations.

    Science.gov (United States)

    Moss, Walter N

    2018-03-01

    With the widespread application of high-throughput sequencing, novel RNA sequences are being discovered at an astonishing rate. The analysis of function, however, lags behind. In both the cis - and trans -regulatory functions of RNA, secondary structure (2D base-pairing) plays essential regulatory roles. In order to test RNA function, it is essential to be able to design and analyze mutations that can affect structure. This was the motivation for the creation of the RNA2DMut web tool. With RNA2DMut, users can enter in RNA sequences to analyze, constrain mutations to specific residues, or limit changes to purines/pyrimidines. The sequence is analyzed at each base to determine the effect of every possible point mutation on 2D structure. The metrics used in RNA2DMut rely on the calculation of the Boltzmann structure ensemble and do not require a robust 2D model of RNA structure for designing mutations. This tool can facilitate a wide array of uses involving RNA: for example, in designing and evaluating mutants for biological assays, interrogating RNA-protein interactions, identifying key regions to alter in SELEX experiments, and improving RNA folding and crystallization properties for structural biology. Additional tools are available to help users introduce other mutations (e.g., indels and substitutions) and evaluate their effects on RNA structure. Example calculations are shown for five RNAs that require 2D structure for their function: the MALAT1 mascRNA, an influenza virus splicing regulatory motif, the EBER2 viral noncoding RNA, the Xist lncRNA repA region, and human Y RNA 5. RNA2DMut can be accessed at https://rna2dmut.bb.iastate.edu/. © 2018 Moss; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  16. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  17. Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression in vivo

    International Nuclear Information System (INIS)

    Jones, M.H.; Learned, R.M.; Tjian, R.

    1988-01-01

    The authors have mapped the cis regulatory elements required in vivo for initiation at the human rRNA promoter by RNA polymerase I. Transient expression in COS-7 cells was used to evaluate the transcription phenotype of clustered base substitution mutations in the human rRNA promoter. The promoter consists of two major elements: a large upstream region, composed of several domains, that lies between nucleotides -234 and -107 relative to the transcription initiation site and affects transcription up to 100-fold and a core element that lies between nucleotides -45 and +20 and affects transcription up to 1000-fold. The upstream regions is able to retain partial function when positioned within 100-160 nucleotides of the transcription initiation site, but it cannot stimulate transcription from distances of ≥ 600 nucleotides. In addition, they demonstrate, using mouse-human hybrid rRNA promoters, that the sequences responsible for human species-specific transcription in vivo appear to reside in both the core and upstream elements, and sequences from the mouse rRNA promoter cannot be substituted for them

  18. Structural Chemistry of Human RNA Methyltransferases.

    Science.gov (United States)

    Schapira, Matthieu

    2016-03-18

    RNA methyltransferases (RNMTs) play important roles in RNA stability, splicing, and epigenetic mechanisms. They constitute a promising target class that is underexplored by the medicinal chemistry community. Information of relevance to drug design can be extracted from the rich structural coverage of human RNMTs. In this work, the structural chemistry of this protein family is analyzed in depth. Unlike most methyltransferases, RNMTs generally feature a substrate-binding site that is largely open on the cofactor-binding pocket, favoring the design of bisubstrate inhibitors. Substrate purine or pyrimidines are often sandwiched between hydrophobic walls that can accommodate planar ring systems. When the substrate base is laying on a shallow surface, a 5' flanking base is sometimes anchored in a druggable cavity. The cofactor-binding site is structurally more diverse than in protein methyltransferases and more druggable in SPOUT than in Rossman-fold enzymes. Finally, conformational plasticity observed both at the substrate and cofactor binding sites may be a challenge for structure-based drug design. The landscape drawn here may inform ongoing efforts toward the discovery of the first human RNMT inhibitors.

  19. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru.

  20. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C. Miguel; Vallejo, Gustavo A.

    2015-01-01

    Abstract Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(−)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru. PMID:26645579

  1. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  2. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  3. Regulatory effects of cotranscriptional RNA structure formation and transitions.

    Science.gov (United States)

    Liu, Sheng-Rui; Hu, Chun-Gen; Zhang, Jin-Zhi

    2016-09-01

    RNAs, which play significant roles in many fundamental biological processes of life, fold into sophisticated and precise structures. RNA folding is a dynamic and intricate process, which conformation transition of coding and noncoding RNAs form the primary elements of genetic regulation. The cellular environment contains various intrinsic and extrinsic factors that potentially affect RNA folding in vivo, and experimental and theoretical evidence increasingly indicates that the highly flexible features of the RNA structure are affected by these factors, which include the flanking sequence context, physiochemical conditions, cis RNA-RNA interactions, and RNA interactions with other molecules. Furthermore, distinct RNA structures have been identified that govern almost all steps of biological processes in cells, including transcriptional activation and termination, transcriptional mutagenesis, 5'-capping, splicing, 3'-polyadenylation, mRNA export and localization, and translation. Here, we briefly summarize the dynamic and complex features of RNA folding along with a wide variety of intrinsic and extrinsic factors that affect RNA folding. We then provide several examples to elaborate RNA structure-mediated regulation at the transcriptional and posttranscriptional levels. Finally, we illustrate the regulatory roles of RNA structure and discuss advances pertaining to RNA structure in plants. WIREs RNA 2016, 7:562-574. doi: 10.1002/wrna.1350 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  4. Automated and fast building of three-dimensional RNA structures.

    Science.gov (United States)

    Zhao, Yunjie; Huang, Yangyu; Gong, Zhou; Wang, Yanjie; Man, Jianfen; Xiao, Yi

    2012-01-01

    Building tertiary structures of non-coding RNA is required to understand their functions and design new molecules. Current algorithms of RNA tertiary structure prediction give satisfactory accuracy only for small size and simple topology and many of them need manual manipulation. Here, we present an automated and fast program, 3dRNA, for RNA tertiary structure prediction with reasonable accuracy for RNAs of larger size and complex topology.

  5. RNA structure alignment by a unit-vector approach.

    Science.gov (United States)

    Capriotti, Emidio; Marti-Renom, Marc A

    2008-08-15

    The recent discovery of tiny RNA molecules such as microRNAs and small interfering RNA are transforming the view of RNA as a simple information transfer molecule. Similar to proteins, the native three-dimensional structure of RNA determines its biological activity. Therefore, classifying the current structural space is paramount for functionally annotating RNA molecules. The increasing numbers of RNA structures deposited in the PDB requires more accurate, automatic and benchmarked methods for RNA structure comparison. In this article, we introduce a new algorithm for RNA structure alignment based on a unit-vector approach. The algorithm has been implemented in the SARA program, which results in RNA structure pairwise alignments and their statistical significance. The SARA program has been implemented to be of general applicability even when no secondary structure can be calculated from the RNA structures. A benchmark against the ARTS program using a set of 1275 non-redundant pairwise structure alignments results in inverted approximately 6% extra alignments with at least 50% structurally superposed nucleotides and base pairs. A first attempt to perform RNA automatic functional annotation based on structure alignments indicates that SARA can correctly assign the deepest SCOR classification to >60% of the query structures. The SARA program is freely available through a World Wide Web server http://sgu.bioinfo.cipf.es/services/SARA/. Supplementary data are available at Bioinformatics online.

  6. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  7. The crystal structure of tRNA

    Indian Academy of Sciences (India)

    Madhu

    of yeast alanine tRNA by Robert Holley's group at Cornell. University ... decode nonsense codons) with John Smith and Brenner. However, my ... tRNA from 10 g of unfractionated tRNA. ... tRNA crystals were, in fact, protein (Hendrikson et al.

  8. Probing of RNA structures in a positive sense RNA virus reveals selection pressures for structural elements

    Science.gov (United States)

    Watters, Kyle E; Choudhary, Krishna; Aviran, Sharon; Perry, Keith L

    2018-01-01

    Abstract In single stranded (+)-sense RNA viruses, RNA structural elements (SEs) play essential roles in the infection process from replication to encapsidation. Using selective 2′-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) and covariation analysis, we explore the structural features of the third genome segment of cucumber mosaic virus (CMV), RNA3 (2216 nt), both in vitro and in plant cell lysates. Comparing SHAPE-Seq and covariation analysis results revealed multiple SEs in the coat protein open reading frame and 3′ untranslated region. Four of these SEs were mutated and serially passaged in Nicotiana tabacum plants to identify biologically selected changes to the original mutated sequences. After passaging, loop mutants showed partial reversion to their wild-type sequence and SEs that were structurally disrupted by mutations were restored to wild-type-like structures via synonymous mutations in planta. These results support the existence and selection of virus open reading frame SEs in the host organism and provide a framework for further studies on the role of RNA structure in viral infection. Additionally, this work demonstrates the applicability of high-throughput chemical probing in plant cell lysates and presents a new method for calculating SHAPE reactivities from overlapping reverse transcriptase priming sites. PMID:29294088

  9. Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes.

    Science.gov (United States)

    Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V

    2017-12-28

    The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the

  10. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  11. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10; Clonagem, expressao, purificacao e caracterizacao estrutural da proteina ribossomal L10 humana recombinante

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Larissa Miranda

    2009-07-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813{sub Q}M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by {beta}- sheet feature. (author)

  12. A folding algorithm for extended RNA secondary structures.

    Science.gov (United States)

    Höner zu Siederdissen, Christian; Bernhart, Stephan H; Stadler, Peter F; Hofacker, Ivo L

    2011-07-01

    RNA secondary structure contains many non-canonical base pairs of different pair families. Successful prediction of these structural features leads to improved secondary structures with applications in tertiary structure prediction and simultaneous folding and alignment. We present a theoretical model capturing both RNA pair families and extended secondary structure motifs with shared nucleotides using 2-diagrams. We accompany this model with a number of programs for parameter optimization and structure prediction. All sources (optimization routines, RNA folding, RNA evaluation, extended secondary structure visualization) are published under the GPLv3 and available at www.tbi.univie.ac.at/software/rnawolf/.

  13. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  14. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W

    1993-01-01

    between three domains (terminal spacer, transcribed region and central spacer) as defined by restriction enzyme analysis (BamHI and ClaI). It is furthermore shown that a dosage resulting in approximately one cross-link per rDNA molecule (21 kbp, two genes) is sufficient to block RNA synthesis. Finally......, it is shown that the cross-links in the rDNA molecules are repaired at equal rate in all three domains within 24 h and that RNA synthesis is partly restored during this repair period. The majority of the cells also go through one to two cell divisions in this period but do not survive....

  15. Transcriptional Regulation of Mouse Ribosomal RNA Synthesis by Pathways Involving Protein Kinase C, Calcium, Insulin and Serum

    Science.gov (United States)

    1992-05-08

    Southern California 1ha.iITRINUTIONI AVAILASILITY STATEMENT 12b. DITIUINCCD1 This document has been approved { OSRUTO for public release and sale ...and 500 gIl of CHCI3 : Isoamyl alcohol (24 : 1), and 2X with 1ml of CHCI 3 : Iso amyl alcohol (24 : 1). RNA was precipitated at -200C overnight in the...control. Plasmid constructions. Plasmids pMrA and pMrD (Kuhn and Grummt, 1987) were kind gifts of Dr. Ingrid Grummt. Plasmid p119 and p123 (Arnhiem

  16. High-throughput SHAPE analysis reveals structures in HIV-1 genomic RNA strongly conserved across distinct biological states.

    Directory of Open Access Journals (Sweden)

    Kevin A Wilkinson

    2008-04-01

    Full Text Available Replication and pathogenesis of the human immunodeficiency virus (HIV is tightly linked to the structure of its RNA genome, but genome structure in infectious virions is poorly understood. We invent high-throughput SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension technology, which uses many of the same tools as DNA sequencing, to quantify RNA backbone flexibility at single-nucleotide resolution and from which robust structural information can be immediately derived. We analyze the structure of HIV-1 genomic RNA in four biologically instructive states, including the authentic viral genome inside native particles. Remarkably, given the large number of plausible local structures, the first 10% of the HIV-1 genome exists in a single, predominant conformation in all four states. We also discover that noncoding regions functioning in a regulatory role have significantly lower (p-value < 0.0001 SHAPE reactivities, and hence more structure, than do viral coding regions that function as the template for protein synthesis. By directly monitoring protein binding inside virions, we identify the RNA recognition motif for the viral nucleocapsid protein. Seven structurally homologous binding sites occur in a well-defined domain in the genome, consistent with a role in directing specific packaging of genomic RNA into nascent virions. In addition, we identify two distinct motifs that are targets for the duplex destabilizing activity of this same protein. The nucleocapsid protein destabilizes local HIV-1 RNA structure in ways likely to facilitate initial movement both of the retroviral reverse transcriptase from its tRNA primer and of the ribosome in coding regions. Each of the three nucleocapsid interaction motifs falls in a specific genome domain, indicating that local protein interactions can be organized by the long-range architecture of an RNA. High-throughput SHAPE reveals a comprehensive view of HIV-1 RNA genome structure, and further

  17. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  18. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  19. Ribosomal RNA analysis indicates a benthic pennate diatom ancestry for the endosymbionts of the dinoflagellates Peridinium foliaceum and Peridinium balticum (Pyrrhophyta).

    Science.gov (United States)

    Chesnick, J M; Kooistra, W H; Wellbrock, U; Medlin, L K

    1997-01-01

    The establishment of chloroplasts as cellular organelles in the dinoflagellate, heterokont (stramenopile), haptophyte, and cryptophyte algae is widely accepted to have been the result of secondary endosymbiotic events, that is, the uptake of a photosynthetic eukaryote by a phagotrophic eukaryote. However, the circumstances that promote such associations between two phylogenetically distinct organisms and result in the integration of their genomes to form a single functional photosynthetic cell is unclear. The dinoflagellates Peridinium foliaceum and Peridinium balticum are unusual in that each contains a membrane-bound eukaryotic heterokont endosymbiont. These symbioses have been interpreted, through data derived from ultrastructural and biochemical investigations, to represent an intermediate stage of secondary endosymbiotic chloroplast acquisition. In this study we have examined the phylogenetic origin of the P. foliaceum and P. balticum heterokont endosymbionts through analysis of their nuclear small subunit ribosomal RNA genes. Our analyses clearly demonstrate both endosymbionts are pennate diatoms belonging to the family Bacillariaceae. Since members of the Bacillariaceae are usually benthic, living on shallow marine sediments, the manner in which establishment of a symbiosis between a planktonic flagellated dinoflagellate and a bottom-dwelling diatom is discussed. In particular, specific environmentally-associated life strategy stages of the host and symbiont, coupled with diatom food preferences by the dinoflagellate, may have been vital to the formation of this association.

  20. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Reconstruction of ancestral RNA sequences under multiple structural constraints

    OpenAIRE

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me

    2016-01-01

    Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...

  2. Conservation of RNA sequence and cross-linking ability in ribosomes from a higher eukaryote: photochemical cross-linking of the anticodon of P site bound tRNA to the penultimate cytidine of the UACACACG sequence in Artemia salina 18S rRNA

    International Nuclear Information System (INIS)

    Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.

    1985-01-01

    The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis

  3. Structural basis of the non-coding RNA RsmZ acting as a protein sponge.

    Science.gov (United States)

    Duss, Olivier; Michel, Erich; Yulikov, Maxim; Schubert, Mario; Jeschke, Gunnar; Allain, Frédéric H-T

    2014-05-29

    MicroRNA and protein sequestration by non-coding RNAs (ncRNAs) has recently generated much interest. In the bacterial Csr/Rsm system, which is considered to be the most general global post-transcriptional regulatory system responsible for bacterial virulence, ncRNAs such as CsrB or RsmZ activate translation initiation by sequestering homodimeric CsrA-type proteins from the ribosome-binding site of a subset of messenger RNAs. However, the mechanism of ncRNA-mediated protein sequestration is not understood at the molecular level. Here we show for Pseudomonas fluorescens that RsmE protein dimers assemble sequentially, specifically and cooperatively onto the ncRNA RsmZ within a narrow affinity range. This assembly yields two different native ribonucleoprotein structures. Using a powerful combination of nuclear magnetic resonance and electron paramagnetic resonance spectroscopy we elucidate these 70-kilodalton solution structures, thereby revealing the molecular mechanism of the sequestration process and how RsmE binding protects the ncRNA from RNase E degradation. Overall, our findings suggest that RsmZ is well-tuned to sequester, store and release RsmE and therefore can be viewed as an ideal protein 'sponge'.

  4. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar

    2010-09-01

    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  5. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  6. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  7. Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

    Science.gov (United States)

    van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

    1993-01-01

    Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

  8. Visualization of RNA structure models within the Integrative Genomics Viewer.

    Science.gov (United States)

    Busan, Steven; Weeks, Kevin M

    2017-07-01

    Analyses of the interrelationships between RNA structure and function are increasingly important components of genomic studies. The SHAPE-MaP strategy enables accurate RNA structure probing and realistic structure modeling of kilobase-length noncoding RNAs and mRNAs. Existing tools for visualizing RNA structure models are not suitable for efficient analysis of long, structurally heterogeneous RNAs. In addition, structure models are often advantageously interpreted in the context of other experimental data and gene annotation information, for which few tools currently exist. We have developed a module within the widely used and well supported open-source Integrative Genomics Viewer (IGV) that allows visualization of SHAPE and other chemical probing data, including raw reactivities, data-driven structural entropies, and data-constrained base-pair secondary structure models, in context with linear genomic data tracks. We illustrate the usefulness of visualizing RNA structure in the IGV by exploring structure models for a large viral RNA genome, comparing bacterial mRNA structure in cells with its structure under cell- and protein-free conditions, and comparing a noncoding RNA structure modeled using SHAPE data with a base-pairing model inferred through sequence covariation analysis. © 2017 Busan and Weeks; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. Rapid NMR screening of RNA secondary structure and binding

    International Nuclear Information System (INIS)

    Helmling, Christina; Keyhani, Sara; Sochor, Florian; Fürtig, Boris; Hengesbach, Martin; Schwalbe, Harald

    2015-01-01

    Determination of RNA secondary structures by NMR spectroscopy is a useful tool e.g. to elucidate RNA folding space or functional aspects of regulatory RNA elements. However, current approaches of RNA synthesis and preparation are usually time-consuming and do not provide analysis with single nucleotide precision when applied for a large number of different RNA sequences. Here, we significantly improve the yield and 3′ end homogeneity of RNA preparation by in vitro transcription. Further, by establishing a native purification procedure with increased throughput, we provide a shortcut to study several RNA constructs simultaneously. We show that this approach yields μmol quantities of RNA with purities comparable to PAGE purification, while avoiding denaturation of the RNA

  10. Rapid NMR screening of RNA secondary structure and binding

    Energy Technology Data Exchange (ETDEWEB)

    Helmling, Christina; Keyhani, Sara; Sochor, Florian; Fürtig, Boris; Hengesbach, Martin; Schwalbe, Harald, E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe-Universität, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)

    2015-09-15

    Determination of RNA secondary structures by NMR spectroscopy is a useful tool e.g. to elucidate RNA folding space or functional aspects of regulatory RNA elements. However, current approaches of RNA synthesis and preparation are usually time-consuming and do not provide analysis with single nucleotide precision when applied for a large number of different RNA sequences. Here, we significantly improve the yield and 3′ end homogeneity of RNA preparation by in vitro transcription. Further, by establishing a native purification procedure with increased throughput, we provide a shortcut to study several RNA constructs simultaneously. We show that this approach yields μmol quantities of RNA with purities comparable to PAGE purification, while avoiding denaturation of the RNA.

  11. ncRNA consensus secondary structure derivation using grammar strings.

    Science.gov (United States)

    Achawanantakun, Rujira; Sun, Yanni; Takyar, Seyedeh Shohreh

    2011-04-01

    Many noncoding RNAs (ncRNAs) function through both their sequences and secondary structures. Thus, secondary structure derivation is an important issue in today's RNA research. The state-of-the-art structure annotation tools are based on comparative analysis, which derives consensus structure of homologous ncRNAs. Despite promising results from existing ncRNA aligning and consensus structure derivation tools, there is a need for more efficient and accurate ncRNA secondary structure modeling and alignment methods. In this work, we introduce a consensus structure derivation approach based on grammar string, a novel ncRNA secondary structure representation that encodes an ncRNA's sequence and secondary structure in the parameter space of a context-free grammar (CFG) and a full RNA grammar including pseudoknots. Being a string defined on a special alphabet constructed from a grammar, grammar string converts ncRNA alignment into sequence alignment. We derive consensus secondary structures from hundreds of ncRNA families from BraliBase 2.1 and 25 families containing pseudoknots using grammar string alignment. Our experiments have shown that grammar string-based structure derivation competes favorably in consensus structure quality with Murlet and RNASampler. Source code and experimental data are available at http://www.cse.msu.edu/~yannisun/grammar-string.

  12. On the importance of cotranscriptional RNA structure formation

    Science.gov (United States)

    Lai, Daniel; Proctor, Jeff R.; Meyer, Irmtraud M.

    2013-01-01

    The expression of genes, both coding and noncoding, can be significantly influenced by RNA structural features of their corresponding transcripts. There is by now mounting experimental and some theoretical evidence that structure formation in vivo starts during transcription and that this cotranscriptional folding determines the functional RNA structural features that are being formed. Several decades of research in bioinformatics have resulted in a wide range of computational methods for predicting RNA secondary structures. Almost all state-of-the-art methods in terms of prediction accuracy, however, completely ignore the process of structure formation and focus exclusively on the final RNA structure. This review hopes to bridge this gap. We summarize the existing evidence for cotranscriptional folding and then review the different, currently used strategies for RNA secondary-structure prediction. Finally, we propose a range of ideas on how state-of-the-art methods could be potentially improved by explicitly capturing the process of cotranscriptional structure formation. PMID:24131802

  13. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  14. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  15. Histone and Ribosomal RNA Repetitive Gene Clusters of the Boll Weevil are Linked in a Tandem Array

    Science.gov (United States)

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and ...

  16. Solving RNA's structural secrets: interaction with antibodies and crystal structure of a nuclease resistant RNA

    International Nuclear Information System (INIS)

    Wallace, S.T.

    1998-10-01

    This Ph.D. thesis concerns the structural characterization of RNA. The work is split into two sections: 1) in vitro selection and characterization of RNAs which bind antibiotics and 2) crystal structure of a nuclease resistant RNA molecule used in antisense applications. Understanding antibiotic-RNA interactions is crucial in aiding rational drug design. We were interested in studying antibiotic interactions with RNAs small enough to characterize at the molecular and possibly at the atomic level. In order to do so, we previously performed in vitro selection to find small RNAs which bind to the peptide antibiotic viomycin and the aminoglycoside antibiotic streptomycin. The characterization of the viomycin-binding RNAs revealed the necessity of a pseudoknot-structure in order to interact with the antibiotic. The RNAs which were selected to interact with streptomycin require the presence of magnesium to bind the antibiotic. One of the RNAs, upon interacting with streptomycin undergoes a significant conformational change spanning the entire RNA sequence needed to bind the antibiotic. In a quest to design oligodeoxynucleotides (ODNs) which are able to specifically bid and inactivate the mRNA of a gene, it is necessary to fulfill two criteria: 1) increase binding affinity between the ODN and the target RNA and 2) increase the ODN's resistance to nuclease degradation. An ODN with an aminopropyl modification at the 2' position of its ribose has emerged as the most successful candidate at fulfilling both criteria. It is the most nuclease resistant modification known to date. We were interested in explaining how this modification is able to circumvent degradation by nucleases. A dodecamer containing a single 2'-O-aminopropyl modified nucleotide was crystallized and the structure was solved to a resolution of 1.6 A. In an attempt to explain the nuclease resistance, the crystal coordinates were modeled into the active exonuclease site of DNA polymerase I. We propose the

  17. RNA folding: structure prediction, folding kinetics and ion electrostatics.

    Science.gov (United States)

    Tan, Zhijie; Zhang, Wenbing; Shi, Yazhou; Wang, Fenghua

    2015-01-01

    Beyond the "traditional" functions such as gene storage, transport and protein synthesis, recent discoveries reveal that RNAs have important "new" biological functions including the RNA silence and gene regulation of riboswitch. Such functions of noncoding RNAs are strongly coupled to the RNA structures and proper structure change, which naturally leads to the RNA folding problem including structure prediction and folding kinetics. Due to the polyanionic nature of RNAs, RNA folding structure, stability and kinetics are strongly coupled to the ion condition of solution. The main focus of this chapter is to review the recent progress in the three major aspects in RNA folding problem: structure prediction, folding kinetics and ion electrostatics. This chapter will introduce both the recent experimental and theoretical progress, while emphasize the theoretical modelling on the three aspects in RNA folding.

  18. RNA 3D modules in genome-wide predictions of RNA 2D structure

    DEFF Research Database (Denmark)

    Theis, Corinna; Zirbel, Craig L; Zu Siederdissen, Christian Höner

    2015-01-01

    . These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D......Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational...... approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution...

  19. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

    Science.gov (United States)

    Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

    2017-01-01

    Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

  20. A Method to Predict the Structure and Stability of RNA/RNA Complexes.

    Science.gov (United States)

    Xu, Xiaojun; Chen, Shi-Jie

    2016-01-01

    RNA/RNA interactions are essential for genomic RNA dimerization and regulation of gene expression. Intermolecular loop-loop base pairing is a widespread and functionally important tertiary structure motif in RNA machinery. However, computational prediction of intermolecular loop-loop base pairing is challenged by the entropy and free energy calculation due to the conformational constraint and the intermolecular interactions. In this chapter, we describe a recently developed statistical mechanics-based method for the prediction of RNA/RNA complex structures and stabilities. The method is based on the virtual bond RNA folding model (Vfold). The main emphasis in the method is placed on the evaluation of the entropy and free energy for the loops, especially tertiary kissing loops. The method also uses recursive partition function calculations and two-step screening algorithm for large, complicated structures of RNA/RNA complexes. As case studies, we use the HIV-1 Mal dimer and the siRNA/HIV-1 mutant (T4) to illustrate the method.

  1. Global Analysis of RNA Secondary Structure in Two Metazoans

    Directory of Open Access Journals (Sweden)

    Fan Li

    2012-01-01

    Full Text Available The secondary structure of RNA is necessary for its maturation, regulation, processing, and function. However, the global influence of RNA folding in eukaryotes is still unclear. Here, we use a high-throughput, sequencing-based, structure-mapping approach to identify the paired (double-stranded RNA [dsRNA] and unpaired (single-stranded RNA [ssRNA] components of the Drosophila melanogaster and Caenorhabditis elegans transcriptomes, which allows us to identify conserved features of RNA secondary structure in metazoans. From this analysis, we find that ssRNAs and dsRNAs are significantly correlated with specific epigenetic modifications. Additionally, we find key structural patterns across protein-coding transcripts that indicate that RNA folding demarcates regions of protein translation and likely affects microRNA-mediated regulation of mRNAs in animals. Finally, we identify and characterize 546 mRNAs whose folding pattern is significantly correlated between these metazoans, suggesting that their structure has some function. Overall, our findings provide a global assessment of RNA folding in animals.

  2. Functional RNA structures throughout the Hepatitis C Virus genome.

    Science.gov (United States)

    Adams, Rebecca L; Pirakitikulr, Nathan; Pyle, Anna Marie

    2017-06-01

    The single-stranded Hepatitis C Virus (HCV) genome adopts a set of elaborate RNA structures that are involved in every stage of the viral lifecycle. Recent advances in chemical probing, sequencing, and structural biology have facilitated analysis of RNA folding on a genome-wide scale, revealing novel structures and networks of interactions. These studies have underscored the active role played by RNA in every function of HCV and they open the door to new types of RNA-targeted therapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and Kelp fly virus.

    Directory of Open Access Journals (Sweden)

    Steven M Valles

    Full Text Available Solenopsis invicta virus 3 (SINV-3 is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV, an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order.

  4. Computational RNA secondary structure design: empirical complexity and improved methods

    Directory of Open Access Journals (Sweden)

    Condon Anne

    2007-01-01

    Full Text Available Abstract Background We investigate the empirical complexity of the RNA secondary structure design problem, that is, the scaling of the typical difficulty of the design task for various classes of RNA structures as the size of the target structure is increased. The purpose of this work is to understand better the factors that make RNA structures hard to design for existing, high-performance algorithms. Such understanding provides the basis for improving the performance of one of the best algorithms for this problem, RNA-SSD, and for characterising its limitations. Results To gain insights into the practical complexity of the problem, we present a scaling analysis on random and biologically motivated structures using an improved version of the RNA-SSD algorithm, and also the RNAinverse algorithm from the Vienna package. Since primary structure constraints are relevant for designing RNA structures, we also investigate the correlation between the number and the location of the primary structure constraints when designing structures and the performance of the RNA-SSD algorithm. The scaling analysis on random and biologically motivated structures supports the hypothesis that the running time of both algorithms scales polynomially with the size of the structure. We also found that the algorithms are in general faster when constraints are placed only on paired bases in the structure. Furthermore, we prove that, according to the standard thermodynamic model, for some structures that the RNA-SSD algorithm was unable to design, there exists no sequence whose minimum free energy structure is the target structure. Conclusion Our analysis helps to better understand the strengths and limitations of both the RNA-SSD and RNAinverse algorithms, and suggests ways in which the performance of these algorithms can be further improved.

  5. The Р60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alternative mRNA translation

    Directory of Open Access Journals (Sweden)

    I. V. Zaiets

    2018-07-01

    Full Text Available Ribosomal protein S6 kinase 1 (S6K1 is a well-known downstream effector of mTORC1 (mechanistic target of rapamycin complex 1 participating primarily in the regulation of cell growth and metabolism. Deregulation of mTOR/S6K1 signaling can promote numerous human pathologies, including cancer, neurodegeneration, cardiovascular disease, and metabolic disorders. As existing data suggest, the S6K1 gene encodes several protein isoforms, including p85-S6K1, p70-S6K1, and p60-S6K1. The two of these isoforms, p85-S6K1 and p70-S6K1, were extensively studied to date. The origin and functional significance of the p60-S6K1 isoform remains a mystery, however, it was suggested that the isoform could be a product of alternative S6K1 mRNA translation. Herein we report the generation of HEK-293 cells exclusively expressing p60-S6K1 as a result of CRISPR/Cas9-mediated inactivation of p85/p70-S6K1 translation. Moreover, the generated modified cells displayed the elevated level of p60-S6K1 expression compared to that in wild-type HEK-293 cells. Our data confirm an assumption that p60-S6K1 is alternatively translated, most probably, from the common for both p70- and p85-S6K1 mRNA transcript and reveal a link between p60-S6K1 expression and such cellular processes as cell proliferation and motility. In addition, our findings indicate that the p60-S6K1 isoform of S6K1 may undergo a mode of regulation distinct from p70- and p85-S6K1 due to the absence of mTOR-regulated p60-S6K1 phosphorylation at T389 that is important for S6K1 activation.

  6. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  7. Interphase ribosomal RNA cistron staining in thyroid epithelial cells in Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland

    OpenAIRE

    Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V

    1996-01-01

    Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland.

  8. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. A Two-Way Street: Regulatory Interplay between RNA Polymerase and Nascent RNA Structure.

    Science.gov (United States)

    Zhang, Jinwei; Landick, Robert

    2016-04-01

    The vectorial (5'-to-3' at varying velocity) synthesis of RNA by cellular RNA polymerases (RNAPs) creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived, pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here, we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNAP and nascent RNA structure. We categorize and rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...

  11. On infrared spectroscopic analysis of transfer RNA secondary structure

    Energy Technology Data Exchange (ETDEWEB)

    Semenov, M A; Starikov, E B

    1987-07-14

    Various techniques of IR spectroscopy in the 1550-1750 cm/sup -1/ region employed to analyse the tRNA secondary structure are discussed and a novel improved method is proposed. The main novel features of this method are the approximation of tRNA helical region spectra by catalogue carbonyl absorption bands and approximation of tRNA nonhelical region spectra by those of homopolyribonucleotides. The IR spectra of tRNA/sub yeast//sup phe/ and tRNA/sub E.coli//sup fmet/ in the carbonyl vibration region are explained on the basis of calculated transition moment coupling.

  12. Structure of Escherichia coli Hfq bound to polyriboadenylate RNA

    DEFF Research Database (Denmark)

    Link, Todd M; Valentin-Hansen, Poul; Brennan, Richard G

    2009-01-01

    (A) RNA, A(15). The structure reveals a unique RNA binding mechanism. Unlike uridine-containing sequences, which bind to the "proximal" face, the poly(A) tract binds to the "distal" face of Hfq using 6 tripartite binding motifs. Each motif consists of an adenosine specificity site (A site), which......Hfq is a small, highly abundant hexameric protein that is found in many bacteria and plays a critical role in mRNA expression and RNA stability. As an "RNA chaperone," Hfq binds AU-rich sequences and facilitates the trans annealing of small RNAs (sRNAs) to their target mRNAs, typically resulting...... in the down-regulation of gene expression. Hfq also plays a key role in bacterial RNA decay by binding tightly to polyadenylate [poly(A)] tracts. The structural mechanism by which Hfq recognizes and binds poly(A) is unknown. Here, we report the crystal structure of Escherichia coli Hfq bound to the poly...

  13. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  14. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  15. A Viral RNA Structural Element Alters Host Recognition of Nonself RNA

    Energy Technology Data Exchange (ETDEWEB)

    Hyde, J. L.; Gardner, C. L.; Kimura, T.; White, J. P.; Liu, G.; Trobaugh, D. W.; Huang, C.; Tonelli, M.; Paessler, S.; Takeda, K.; Klimstra, W. B.; Amarasinghe, G. K.; Diamond, M. S.

    2014-01-30

    Although interferon (IFN) signaling induces genes that limit viral infection, many pathogenic viruses overcome this host response. As an example, 2'-O methylation of the 5' cap of viral RNA subverts mammalian antiviral responses by evading restriction of Ifit1, an IFN-stimulated gene that regulates protein synthesis. However, alphaviruses replicate efficiently in cells expressing Ifit1 even though their genomic RNA has a 5' cap lacking 2'-O methylation. We show that pathogenic alphaviruses use secondary structural motifs within the 5' untranslated region (UTR) of their RNA to alter Ifit1 binding and function. Mutations within the 5'-UTR affecting RNA structural elements enabled restriction by or antagonism of Ifit1 in vitro and in vivo. These results identify an evasion mechanism by which viruses use RNA structural motifs to avoid immune restriction.

  16. RNAstructure: software for RNA secondary structure prediction and analysis.

    Science.gov (United States)

    Reuter, Jessica S; Mathews, David H

    2010-03-15

    To understand an RNA sequence's mechanism of action, the structure must be known. Furthermore, target RNA structure is an important consideration in the design of small interfering RNAs and antisense DNA oligonucleotides. RNA secondary structure prediction, using thermodynamics, can be used to develop hypotheses about the structure of an RNA sequence. RNAstructure is a software package for RNA secondary structure prediction and analysis. It uses thermodynamics and utilizes the most recent set of nearest neighbor parameters from the Turner group. It includes methods for secondary structure prediction (using several algorithms), prediction of base pair probabilities, bimolecular structure prediction, and prediction of a structure common to two sequences. This contribution describes new extensions to the package, including a library of C++ classes for incorporation into other programs, a user-friendly graphical user interface written in JAVA, and new Unix-style text interfaces. The original graphical user interface for Microsoft Windows is still maintained. The extensions to RNAstructure serve to make RNA secondary structure prediction user-friendly. The package is available for download from the Mathews lab homepage at http://rna.urmc.rochester.edu/RNAstructure.html.

  17. Evolutionary rate variation and RNA secondary structure prediction

    DEFF Research Database (Denmark)

    Knudsen, B.; Andersen, E.S.; Damgaard, C.

    2004-01-01

    Predicting RNA secondary structure using evolutionary history can be carried out by using an alignment of related RNA sequences with conserved structure. Accurately determining evolutionary substitution rates for base pairs and single stranded nucleotides is a concern for methods based on this type...... by applying rates derived from tRNA and rRNA to the prediction of the much more rapidly evolving 5'-region of HIV-1. We find that the HIV-1 prediction is in agreement with experimental data, even though the relative evolutionary rate between A and G is significantly increased, both in stem and loop regions...

  18. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  19. Free energy minimization to predict RNA secondary structures and computational RNA design.

    Science.gov (United States)

    Churkin, Alexander; Weinbrand, Lina; Barash, Danny

    2015-01-01

    Determining the RNA secondary structure from sequence data by computational predictions is a long-standing problem. Its solution has been approached in two distinctive ways. If a multiple sequence alignment of a collection of homologous sequences is available, the comparative method uses phylogeny to determine conserved base pairs that are more likely to form as a result of billions of years of evolution than by chance. In the case of single sequences, recursive algorithms that compute free energy structures by using empirically derived energy parameters have been developed. This latter approach of RNA folding prediction by energy minimization is widely used to predict RNA secondary structure from sequence. For a significant number of RNA molecules, the secondary structure of the RNA molecule is indicative of its function and its computational prediction by minimizing its free energy is important for its functional analysis. A general method for free energy minimization to predict RNA secondary structures is dynamic programming, although other optimization methods have been developed as well along with empirically derived energy parameters. In this chapter, we introduce and illustrate by examples the approach of free energy minimization to predict RNA secondary structures.

  20. BEAM web server: a tool for structural RNA motif discovery.

    Science.gov (United States)

    Pietrosanto, Marco; Adinolfi, Marta; Casula, Riccardo; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela

    2018-03-15

    RNA structural motif finding is a relevant problem that becomes computationally hard when working on high-throughput data (e.g. eCLIP, PAR-CLIP), often represented by thousands of RNA molecules. Currently, the BEAM server is the only web tool capable to handle tens of thousands of RNA in input with a motif discovery procedure that is only limited by the current secondary structure prediction accuracies. The recently developed method BEAM (BEAr Motifs finder) can analyze tens of thousands of RNA molecules and identify RNA secondary structure motifs associated to a measure of their statistical significance. BEAM is extremely fast thanks to the BEAR encoding that transforms each RNA secondary structure in a string of characters. BEAM also exploits the evolutionary knowledge contained in a substitution matrix of secondary structure elements, extracted from the RFAM database of families of homologous RNAs. The BEAM web server has been designed to streamline data pre-processing by automatically handling folding and encoding of RNA sequences, giving users a choice for the preferred folding program. The server provides an intuitive and informative results page with the list of secondary structure motifs identified, the logo of each motif, its significance, graphic representation and information about its position in the RNA molecules sharing it. The web server is freely available at http://beam.uniroma2.it/ and it is implemented in NodeJS and Python with all major browsers supported. marco.pietrosanto@uniroma2.it. Supplementary data are available at Bioinformatics online.

  1. A comprehensive comparison of comparative RNA structure prediction approaches

    DEFF Research Database (Denmark)

    Gardner, P. P.; Giegerich, R.

    2004-01-01

    -finding and multiple-sequence-alignment algorithms. Results Here we evaluate a number of RNA folding algorithms using reliable RNA data-sets and compare their relative performance. Conclusions We conclude that comparative data can enhance structure prediction but structure-prediction-algorithms vary widely in terms......Background An increasing number of researchers have released novel RNA structure analysis and prediction algorithms for comparative approaches to structure prediction. Yet, independent benchmarking of these algorithms is rarely performed as is now common practice for protein-folding, gene...

  2. AtRH57, a DEAD-box RNA helicase, is involved in feedback inhibition of glucose-mediated abscisic acid accumulation during seedling development and additively affects pre-ribosomal RNA processing with high glucose.

    Science.gov (United States)

    Hsu, Yi-Feng; Chen, Yun-Chu; Hsiao, Yu-Chun; Wang, Bing-Jyun; Lin, Shih-Yun; Cheng, Wan-Hsing; Jauh, Guang-Yuh; Harada, John J; Wang, Co-Shine

    2014-01-01

    The Arabidopsis thaliana T-DNA insertion mutant rh57-1 exhibited hypersensitivity to glucose (Glc) and abscisic acid (ABA). The other two rh57 mutants also showed Glc hypersensitivity similar to rh57-1, strongly suggesting that the Glc-hypersensitive feature of these mutants results from mutation of AtRH57. rh57-1 and rh57-3 displayed severely impaired seedling growth when grown in Glc concentrations higher than 3%. The gene, AtRH57 (At3g09720), was expressed in all Arabidopsis organs and its transcript was significantly induced by ABA, high Glc and salt. The new AtRH57 belongs to class II DEAD-box RNA helicase gene family. Transient expression of AtRH57-EGFP (enhanced green fluorescent protein) in onion cells indicated that AtRH57 was localized in the nucleus and nucleolus. Purified AtRH57-His protein was shown to unwind double-stranded RNA independent of ATP in vitro. The ABA biosynthesis inhibitor fluridone profoundly redeemed seedling growth arrest mediated by sugar. rh57-1 showed increased ABA levels when exposed to high Glc. Quantitative real time polymerase chain reaction analysis showed that AtRH57 acts in a signaling network downstream of HXK1. A feedback inhibition of ABA accumulation mediated by AtRH57 exists within the sugar-mediated ABA signaling. AtRH57 mutation and high Glc conditions additively caused a severe defect in small ribosomal subunit formation. The accumulation of abnormal pre-rRNA and resistance to protein synthesis-related antibiotics were observed in rh57 mutants and in the wild-type Col-0 under high Glc conditions. These results suggested that AtRH57 plays an important role in rRNA biogenesis in Arabidopsis and participates in response to sugar involving Glc- and ABA signaling during germination and seedling growth. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  3. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction

    Science.gov (United States)

    Puton, Tomasz; Kozlowski, Lukasz P.; Rother, Kristian M.; Bujnicki, Janusz M.

    2013-01-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks. PMID:23435231

  4. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction.

    Science.gov (United States)

    Puton, Tomasz; Kozlowski, Lukasz P; Rother, Kristian M; Bujnicki, Janusz M

    2013-04-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks.

  5. RNA secondary structures of the bacteriophage phi6 packaging regions.

    OpenAIRE

    Pirttimaa, M J; Bamford, D H

    2000-01-01

    Bacteriophage phi6 genome consists of three segments of double-stranded RNA. During maturation, single-stranded copies of these segments are packaged into preformed polymerase complex particles. Only phi6 RNA is packaged, and each particle contains only one copy of each segment. An in vitro packaging and replication assay has been developed for phi6, and the packaging signals (pac sites) have been mapped to the 5' ends of the RNA segments. In this study, we propose secondary structure models ...

  6. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    OpenAIRE

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-01-01

    An oligonucleotide representing a regulatory element of human thymidylate synthase mRNA has been crystallized as a dimer. The structure of the asymmetric dimer has been determined at 1.97 Å resolution.

  7. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  8. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

    Directory of Open Access Journals (Sweden)

    Naito K

    2017-07-01

    Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The

  9. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  10. Structure and mechanical properties of the ribosomal L1 stalk three-way junction

    Czech Academy of Sciences Publication Activity Database

    Réblová, Kamila; Šponer, Jiří; Lankaš, Filip

    2012-01-01

    Roč. 40, č. 13 (2012), s. 6290-6303 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GAP208/12/1878; GA ČR(CZ) GBP305/12/G034; GA ČR GBP208/12/G016; GA AV ČR(CZ) KJB400040901 Institutional research plan: CEZ:AV0Z50040702; CEZ:AV0Z40550506 Institutional support: RVO:68081707 ; RVO:61388963 Keywords : three-way junction * molecular dynamics * RNA Subject RIV: BO - Biophysics Impact factor: 8.278, year: 2012

  11. Approaches to link RNA secondary structures with splicing regulation

    DEFF Research Database (Denmark)

    Plass, Mireya; Eyras, Eduardo

    2014-01-01

    In higher eukaryotes, alternative splicing is usually regulated by protein factors, which bind to the pre-mRNA and affect the recognition of splicing signals. There is recent evidence that the secondary structure of the pre-mRNA may also play an important role in this process, either by facilitat...... describes the steps in the analysis of the secondary structure of the pre-mRNA and its possible relation to splicing. As a working example, we use the case of yeast and the problem of the recognition of the 3' splice site (3'ss).......In higher eukaryotes, alternative splicing is usually regulated by protein factors, which bind to the pre-mRNA and affect the recognition of splicing signals. There is recent evidence that the secondary structure of the pre-mRNA may also play an important role in this process, either...

  12. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  13. Automated identification of RNA 3D modules with discriminative power in RNA structural alignments

    DEFF Research Database (Denmark)

    Theis, Corinna; Höner zu Siederdissen, Christian; Hofacker, Ivo L.

    2013-01-01

    Recent progress in predicting RNA structure is moving towards filling the 'gap' in 2D RNA structure prediction where, for example, predicted internal loops often form non-canonical base pairs. This is increasingly recognized with the steady increase of known RNA 3D modules. There is a general...... comparative evidence. Subsequently, the modules, initially represented by a graph, are turned into models for the RMDetect program, which allows to test their discriminative power using real and randomized Rfam alignments. An initial extraction of 22495 3D modules in all PDB files results in 977 internal loop...

  14. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  15. MultiSETTER: web server for multiple RNA structure comparison.

    Science.gov (United States)

    Čech, Petr; Hoksza, David; Svozil, Daniel

    2015-08-12

    Understanding the architecture and function of RNA molecules requires methods for comparing and analyzing their tertiary and quaternary structures. While structural superposition of short RNAs is achievable in a reasonable time, large structures represent much bigger challenge. Therefore, we have developed a fast and accurate algorithm for RNA pairwise structure superposition called SETTER and implemented it in the SETTER web server. However, though biological relationships can be inferred by a pairwise structure alignment, key features preserved by evolution can be identified only from a multiple structure alignment. Thus, we extended the SETTER algorithm to the alignment of multiple RNA structures and developed the MultiSETTER algorithm. In this paper, we present the updated version of the SETTER web server that implements a user friendly interface to the MultiSETTER algorithm. The server accepts RNA structures either as the list of PDB IDs or as user-defined PDB files. After the superposition is computed, structures are visualized in 3D and several reports and statistics are generated. To the best of our knowledge, the MultiSETTER web server is the first publicly available tool for a multiple RNA structure alignment. The MultiSETTER server offers the visual inspection of an alignment in 3D space which may reveal structural and functional relationships not captured by other multiple alignment methods based either on a sequence or on secondary structure motifs.

  16. A combinatorial enumeration problem of RNA secondary structures

    African Journals Online (AJOL)

    use

    2011-12-21

    Dec 21, 2011 ... interesting combinatorial questions (Chen et al., 2005;. Liu, 2006; Schmitt and Waterman 1994; Stein and. Waterman 1978). The research on the enumeration of. RNA secondary structures becomes one of the hot topics in Computational Molecular Biology. An RNA molecule is described by its sequences of.

  17. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  18. The RNA recognition motif of eukaryotic translation initiation factor 3g (eIF3g) is required for resumption of scanning of posttermination ribosomes for reinitiation on GCN4 and together with eIF3i stimulates linear scanning.

    Science.gov (United States)

    Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos

    2010-10-01

    Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.

  19. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  20. Computing the Partition Function for Kinetically Trapped RNA Secondary Structures

    Science.gov (United States)

    Lorenz, William A.; Clote, Peter

    2011-01-01

    An RNA secondary structure is locally optimal if there is no lower energy structure that can be obtained by the addition or removal of a single base pair, where energy is defined according to the widely accepted Turner nearest neighbor model. Locally optimal structures form kinetic traps, since any evolution away from a locally optimal structure must involve energetically unfavorable folding steps. Here, we present a novel, efficient algorithm to compute the partition function over all locally optimal secondary structures of a given RNA sequence. Our software, RNAlocopt runs in time and space. Additionally, RNAlocopt samples a user-specified number of structures from the Boltzmann subensemble of all locally optimal structures. We apply RNAlocopt to show that (1) the number of locally optimal structures is far fewer than the total number of structures – indeed, the number of locally optimal structures approximately equal to the square root of the number of all structures, (2) the structural diversity of this subensemble may be either similar to or quite different from the structural diversity of the entire Boltzmann ensemble, a situation that depends on the type of input RNA, (3) the (modified) maximum expected accuracy structure, computed by taking into account base pairing frequencies of locally optimal structures, is a more accurate prediction of the native structure than other current thermodynamics-based methods. The software RNAlocopt constitutes a technical breakthrough in our study of the folding landscape for RNA secondary structures. For the first time, locally optimal structures (kinetic traps in the Turner energy model) can be rapidly generated for long RNA sequences, previously impossible with methods that involved exhaustive enumeration. Use of locally optimal structure leads to state-of-the-art secondary structure prediction, as benchmarked against methods involving the computation of minimum free energy and of maximum expected accuracy. Web server

  1. Computing the partition function for kinetically trapped RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    William A Lorenz

    Full Text Available An RNA secondary structure is locally optimal if there is no lower energy structure that can be obtained by the addition or removal of a single base pair, where energy is defined according to the widely accepted Turner nearest neighbor model. Locally optimal structures form kinetic traps, since any evolution away from a locally optimal structure must involve energetically unfavorable folding steps. Here, we present a novel, efficient algorithm to compute the partition function over all locally optimal secondary structures of a given RNA sequence. Our software, RNAlocopt runs in O(n3 time and O(n2 space. Additionally, RNAlocopt samples a user-specified number of structures from the Boltzmann subensemble of all locally optimal structures. We apply RNAlocopt to show that (1 the number of locally optimal structures is far fewer than the total number of structures--indeed, the number of locally optimal structures approximately equal to the square root of the number of all structures, (2 the structural diversity of this subensemble may be either similar to or quite different from the structural diversity of the entire Boltzmann ensemble, a situation that depends on the type of input RNA, (3 the (modified maximum expected accuracy structure, computed by taking into account base pairing frequencies of locally optimal structures, is a more accurate prediction of the native structure than other current thermodynamics-based methods. The software RNAlocopt constitutes a technical breakthrough in our study of the folding landscape for RNA secondary structures. For the first time, locally optimal structures (kinetic traps in the Turner energy model can be rapidly generated for long RNA sequences, previously impossible with methods that involved exhaustive enumeration. Use of locally optimal structure leads to state-of-the-art secondary structure prediction, as benchmarked against methods involving the computation of minimum free energy and of maximum expected

  2. Ensemble-based prediction of RNA secondary structures.

    Science.gov (United States)

    Aghaeepour, Nima; Hoos, Holger H

    2013-04-24

    Accurate structure prediction methods play an important role for the understanding of RNA function. Energy-based, pseudoknot-free secondary structure prediction is one of the most widely used and versatile approaches, and improved methods for this task have received much attention over the past five years. Despite the impressive progress that as been achieved in this area, existing evaluations of the prediction accuracy achieved by various algorithms do not provide a comprehensive, statistically sound assessment. Furthermore, while there is increasing evidence that no prediction algorithm consistently outperforms all others, no work has been done to exploit the complementary strengths of multiple approaches. In this work, we present two contributions to the area of RNA secondary structure prediction. Firstly, we use state-of-the-art, resampling-based statistical methods together with a previously published and increasingly widely used dataset of high-quality RNA structures to conduct a comprehensive evaluation of existing RNA secondary structure prediction procedures. The results from this evaluation clarify the performance relationship between ten well-known existing energy-based pseudoknot-free RNA secondary structure prediction methods and clearly demonstrate the progress that has been achieved in recent years. Secondly, we introduce AveRNA, a generic and powerful method for combining a set of existing secondary structure prediction procedures into an ensemble-based method that achieves significantly higher prediction accuracies than obtained from any of its component procedures. Our new, ensemble-based method, AveRNA, improves the state of the art for energy-based, pseudoknot-free RNA secondary structure prediction by exploiting the complementary strengths of multiple existing prediction procedures, as demonstrated using a state-of-the-art statistical resampling approach. In addition, AveRNA allows an intuitive and effective control of the trade-off between

  3. DCJ-RNA - double cut and join for RNA secondary structures.

    Science.gov (United States)

    Badr, Ghada H; Al-Aqel, Haifa A

    2017-10-16

    Genome rearrangements are essential processes for evolution and are responsible for existing varieties of genome architectures. Many studies have been conducted to obtain an algorithm that identifies the minimum number of inversions that are necessary to transform one genome into another; this allows for genome sequence representation in polynomial time. Studies have not been conducted on the topic of rearranging a genome when it is represented as a secondary structure. Unlike sequences, the secondary structure preserves the functionality of the genome. Sequences can be different, but they all share the same structure and, therefore, the same functionality. This paper proposes a double cut and join for RNA secondary structures (DCJ-RNA) algorithm. This algorithm allows for the description of evolutionary scenarios that are based on secondary structures rather than sequences. The main aim of this paper is to suggest an efficient algorithm that can help researchers compare two ribonucleic acid (RNA) secondary structures based on rearrangement operations. The results, which are based on real datasets, show that the algorithm is able to count the minimum number of rearrangement operations, as well as to report an optimum scenario that can increase the similarity between the two structures. The algorithm calculates the distance between structures and reports a scenario based on the minimum rearrangement operations required to make the given structure similar to the other. DCJ-RNA can also be used to measure the distance between the two structures. This can help identify the common functionalities between different species.

  4. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Structural basis of RNA folding and recognition in an AMP-RNA aptamer complex.

    Science.gov (United States)

    Jiang, F; Kumar, R A; Jones, R A; Patel, D J

    1996-07-11

    The catalytic properties of RNA and its well known role in gene expression and regulation are the consequence of its unique solution structures. Identification of the structural determinants of ligand recognition by RNA molecules is of fundamental importance for understanding the biological functions of RNA, as well as for the rational design of RNA Sequences with specific catalytic activities. Towards this latter end, Szostak et al. used in vitro selection techniques to isolate RNA sequences ('aptamers') containing a high-affinity binding site for ATP, the universal currency of cellular energy, and then used this motif to engineer ribozymes with polynucleotide kinase activity. Here we present the solution structure, as determined by multidimensional NMR spectroscopy and molecular dynamics calculations, of both uniformly and specifically 13C-, 15N-labelled 40-mer RNA containing the ATP-binding motif complexed with AMP. The aptamer adopts an L-shaped structure with two nearly orthogonal stems, each capped proximally by a G x G mismatch pair, binding the AMP ligand at their junction in a GNRA-like motif.

  6. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  7. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  8. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  9. Topological classification and enumeration of RNA structures by genus

    DEFF Research Database (Denmark)

    Andersen, Joergen Ellegard; Penner, Robert C.; Reidys, Christian

    2013-01-01

    To an RNA pseudoknot structure is naturally associated a topological surface, which has its associated genus, and structures can thus be classified by the genus. Based on earlier work of Harer-Zagier, we compute the generating function for the number of those structures of fixed genus and minimum...

  10. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics: The sStructures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Gurel, G.; Blaha, G; Moore, P; Steitz,

    2009-01-01

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  11. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.

    Science.gov (United States)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B; Steitz, Thomas A

    2009-05-29

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 A. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  12. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics. The Structures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    Science.gov (United States)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.

    2009-01-01

    Structures have been obtained for the complexes tiamulin, homoharringtonine and bruceatin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.8 to 3.2 Å. They show that these inhibitors all block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl transferase center, which is universally conserved. In addition these structures support the hypothesis that the species-specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (E. coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms. PMID:19362093

  13. U2504 Determines the Species Specificity of the A-Site Cleft Antibiotics: The Structures of Tiamulin, Homoharringtonine, and Bruceantin Bound to the Ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.; Yale

    2009-06-30

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the Asite cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  14. HD-RNAS: An automated hierarchical database of RNA structures

    Directory of Open Access Journals (Sweden)

    Shubhra Sankar eRay

    2012-04-01

    Full Text Available One of the important goals of most biological investigations is to classify and organize the experimental findings so that they are readily useful for deriving generalized rules. Although there is a huge amount of information on RNA structures in PDB, there are redundant files, ambiguous synthetic sequences etc. Moreover, a systematic hierarchical organization, reflecting RNA classification, is missing in PDB. In this investigation, we have classified all the available RNA crystal structures from PDB through a programmatic approach. Hence, it would be now a simple assignment to regularly update the classification as and when new structures are released. The classification can further determine (i a non-redundant set of RNA structures and (ii if available, a set of structures of identical sequence and function, which can highlight structural polymorphism, ligand-induced conformational alterations etc. Presently, we have classified the available structures (2095 PDB entries having RNA chain longer than 9 nucleotides solved by X-ray crystallography or NMR spectroscopy into nine functional classes. The structures of same function and same source are mostly seen to be similar with subtle differences depending on their functional complexation. The web-server is available online at http://www.saha.ac.in/biop/www/HD-RNAS.html and is updated regularly.

  15. RNA secondary structures of the bacteriophage phi6 packaging regions.

    Science.gov (United States)

    Pirttimaa, M J; Bamford, D H

    2000-06-01

    Bacteriophage phi6 genome consists of three segments of double-stranded RNA. During maturation, single-stranded copies of these segments are packaged into preformed polymerase complex particles. Only phi6 RNA is packaged, and each particle contains only one copy of each segment. An in vitro packaging and replication assay has been developed for phi6, and the packaging signals (pac sites) have been mapped to the 5' ends of the RNA segments. In this study, we propose secondary structure models for the pac sites of phi6 single-stranded RNA segments. Our models accommodate data from structure-specific chemical modifications, free energy minimizations, and phylogenetic comparisons. Previously reported pac site deletion studies are also discussed. Each pac site possesses a unique architecture, that, however, contains common structural elements.

  16. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  17. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  18. Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.

    Science.gov (United States)

    Vacchi-Suzzi, Caterina; Hahne, Florian; Scheubel, Philippe; Marcellin, Magali; Dubost, Valerie; Westphal, Magdalena; Boeglen, Catherine; Büchmann-Møller, Stine; Cheung, Ming Sin; Cordier, André; De Benedetto, Christopher; Deurinck, Mark; Frei, Moritz; Moulin, Pierre; Oakeley, Edward; Grenet, Olivier; Grevot, Armelle; Stull, Robert; Theil, Diethilde; Moggs, Jonathan G; Marrer, Estelle; Couttet, Philippe

    2013-01-01

    MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves) in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*). The relative abundance of myocardium-enriched (miR-1) and valve-enriched (miR-125b-5p and miR-204) microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.

  19. Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.

    Directory of Open Access Journals (Sweden)

    Caterina Vacchi-Suzzi

    Full Text Available MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744 and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*. The relative abundance of myocardium-enriched (miR-1 and valve-enriched (miR-125b-5p and miR-204 microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.

  20. RNA secondary structure image - fRNAdb | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us fRNAdb RNA secondary structure image Data detail Data name RNA secondary structure image DOI... 10.18908/lsdba.nbdc00452-005 Description of data contents RNA secondary structure images - png.zip: RNA secondary structure image...s (PNG) - pdf.zip: RNA secondary structure images (PDF) - thumbnail.zip: Thumbnails of... RNA secondary structure images Data file File name: RNA_secondary_structure_image... File URL: ftp://ftp.biosciencedbc.jp/archive/frnadb/LATEST/RNA_secondary_structure_image File size: 9.6 GB

  1. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  2. Reconstruction of ancestral RNA sequences under multiple structural constraints

    Directory of Open Access Journals (Sweden)

    Olivier Tremblay-Savard

    2016-11-01

    Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  3. Reconstruction of ancestral RNA sequences under multiple structural constraints.

    Science.gov (United States)

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme

    2016-11-11

    Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  4. Strategies for measuring evolutionary conservation of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Hofacker Ivo L

    2008-02-01

    Full Text Available Abstract Background Evolutionary conservation of RNA secondary structure is a typical feature of many functional non-coding RNAs. Since almost all of the available methods used for prediction and annotation of non-coding RNA genes rely on this evolutionary signature, accurate measures for structural conservation are essential. Results We systematically assessed the ability of various measures to detect conserved RNA structures in multiple sequence alignments. We tested three existing and eight novel strategies that are based on metrics of folding energies, metrics of single optimal structure predictions, and metrics of structure ensembles. We find that the folding energy based SCI score used in the RNAz program and a simple base-pair distance metric are by far the most accurate. The use of more complex metrics like for example tree editing does not improve performance. A variant of the SCI performed particularly well on highly conserved alignments and is thus a viable alternative when only little evolutionary information is available. Surprisingly, ensemble based methods that, in principle, could benefit from the additional information contained in sub-optimal structures, perform particularly poorly. As a general trend, we observed that methods that include a consensus structure prediction outperformed equivalent methods that only consider pairwise comparisons. Conclusion Structural conservation can be measured accurately with relatively simple and intuitive metrics. They have the potential to form the basis of future RNA gene finders, that face new challenges like finding lineage specific structures or detecting mis-aligned sequences.

  5. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  6. RNA structure and scalar coupling constants

    Energy Technology Data Exchange (ETDEWEB)

    Tinoco, I. Jr.; Cai, Z.; Hines, J.V.; Landry, S.M.; SantaLucia, J. Jr.; Shen, L.X.; Varani, G. [Univ. of California, Berkeley, CA (United States)

    1994-12-01

    Signs and magnitudes of scalar coupling constants-spin-spin splittings-comprise a very large amount of data that can be used to establish the conformations of RNA molecules. Proton-proton and proton-phosphorus splittings have been used the most, but the availability of {sup 13}C-and {sup 15}N-labeled molecules allow many more coupling constants to be used for determining conformation. We will systematically consider the torsion angles that characterize a nucleotide unit and the coupling constants that depend on the values of these torsion angles. Karplus-type equations have been established relating many three-bond coupling constants to torsion angles. However, one- and two-bond coupling constants can also depend on conformation. Serianni and coworkers measured carbon-proton coupling constants in ribonucleosides and have calculated their values as a function of conformation. The signs of two-bond coupling can be very useful because it is easier to measure a sign than an accurate magnitude.

  7. Structure of Drosophila Oskar reveals a novel RNA binding protein

    Science.gov (United States)

    Yang, Na; Yu, Zhenyu; Hu, Menglong; Wang, Mingzhu; Lehmann, Ruth; Xu, Rui-Ming

    2015-01-01

    Oskar (Osk) protein plays critical roles during Drosophila germ cell development, yet its functions in germ-line formation and body patterning remain poorly understood. This situation contrasts sharply with the vast knowledge about the function and mechanism of osk mRNA localization. Osk is predicted to have an N-terminal LOTUS domain (Osk-N), which has been suggested to bind RNA, and a C-terminal hydrolase-like domain (Osk-C) of unknown function. Here, we report the crystal structures of Osk-N and Osk-C. Osk-N shows a homodimer of winged-helix–fold modules, but without detectable RNA-binding activity. Osk-C has a lipase-fold structure but lacks critical catalytic residues at the putative active site. Surprisingly, we found that Osk-C binds the 3′UTRs of osk and nanos mRNA in vitro. Mutational studies identified a region of Osk-C important for mRNA binding. These results suggest possible functions of Osk in the regulation of stability, regulation of translation, and localization of relevant mRNAs through direct interaction with their 3′UTRs, and provide structural insights into a novel protein–RNA interaction motif involving a hydrolase-related domain. PMID:26324911

  8. Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

    DEFF Research Database (Denmark)

    Helbo, Alexandra Søgaard; Lay, Fides D; Jones, Peter A

    2017-01-01

    Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high...

  9. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  10. Functional and Structural Analysis of a Highly-Expressed Yersinia pestis Small RNA following Infection of Cultured Macrophages.

    Directory of Open Access Journals (Sweden)

    Nan Li

    Full Text Available Non-coding small RNAs (sRNAs are found in practically all bacterial genomes and play important roles in regulating gene expression to impact bacterial metabolism, growth, and virulence. We performed transcriptomics analysis to identify sRNAs that are differentially expressed in Yersinia pestis that invaded the human macrophage cell line THP-1, compared to pathogens that remained extracellular in the presence of host. Using ultra high-throughput sequencing, we identified 37 novel and 143 previously known sRNAs in Y. pestis. In particular, the sRNA Ysr170 was highly expressed in intracellular Yersinia and exhibited a log2 fold change ~3.6 higher levels compared to extracellular bacteria. We found that knock-down of Ysr170 expression attenuated infection efficiency in cell culture and growth rate in response to different stressors. In addition, we applied selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE analysis to determine the secondary structure of Ysr170 and observed structural changes resulting from interactions with the aminoglycoside antibiotic gentamycin and the RNA chaperone Hfq. Interestingly, gentamicin stabilized helix 4 of Ysr170, which structurally resembles the native gentamicin 16S ribosomal binding site. Finally, we modeled the tertiary structure of Ysr170 binding to gentamycin using RNA motif modeling. Integration of these experimental and structural methods can provide further insight into the design of small molecules that can inhibit function of sRNAs required for pathogen virulence.

  11. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Directory of Open Access Journals (Sweden)

    Shenkar Noa

    2009-08-01

    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  12. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  13. Primary and secondary structure of U8 small nuclear RNA

    International Nuclear Information System (INIS)

    Reddy, R.; Henning, D.; Busch, H.

    1985-01-01

    U8 small nuclear RNA is a new, capped, 140 nucleotides long RNA species found in Novikoff hepatoma cells. Its sequence is: m3GpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCC UCCUUUCGGA GGGCAGAUAG AAAAUGAUGA UUGGAGCUUG CAUGAUCUGC UGAUUAUAGC AUUUCCGUGU AAUCAGGACC UGACAACAUC CUGAUUGCUU CUAUCUGAUUOH. This RNA is present in approximately 25,000 copies/cell, and it is enriched in nucleolar preparations. Like U1, U2, U4/U6, and U5 RNAs, U8 RNA was also present as a ribonucleoprotein associated with the Sm antigen. The rat U8 RNA was highly homologous (greater than 90%) to a recently characterized 5.4 S RNA from mouse cells infected with spleen focus-forming virus. In addition to the U8 RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells. Each of these contained a m3GpppAm cap structure; their apparent chain lengths were 60, 130, and 65 nucleotides. These U small nuclear RNAs are designated U7, U9, and U10 RNAs, respectively

  14. Use of tiling array data and RNA secondary structure predictions to identify noncoding