Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V
1996-01-01
Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland.
Pankovics, Péter; Simmonds, Peter
2011-01-01
A novel positive-sense, single-stranded RNA (+ssRNA) virus (Halastavi árva RNA virus, HalV; JN000306) with di-cistronic genome organization was serendipitously identified in intestinal contents of freshwater carps (Cyprinus carpio) fished by line-fishing from fishpond “Lőrinte halastó” located in Veszprém County, Hungary. The complete nucleotide (nt) sequence of the genomic RNA is 9565 nt in length and contains two long - non-in-frame - open reading frames (ORFs), which are separated by an intergenic region. The ORF1 (replicase) is preceded by an untranslated sequence of 827 nt, while an untranslated region of 139 nt follows the ORF2 (capsid proteins). The deduced amino acid (aa) sequences of the ORFs showed only low (less than 32%) and partial similarity to the non-structural (2C-like helicase, 3C-like cystein protease and 3D-like RNA dependent RNA polymerase) and structural proteins (VP2/VP4/VP3) of virus families in Picornavirales especially to members of the viruses with dicistronic genome. Halastavi árva RNA virus is present in intestinal contents of omnivorous freshwater carps but the origin and the host species of this virus remains unknown. The unique viral sequence and the actual position indicate that Halastavi árva RNA virus seems to be the first member of a new di-cistronic ssRNA virus. Further studies are required to investigate the specific host species (and spectrum), ecology and role of Halastavi árva RNA virus in the nature. PMID:22195010
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
Directory of Open Access Journals (Sweden)
Harold S Bernhardt
2015-11-01
Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.
RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.
Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L
1990-07-01
The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.
Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V
1996-01-01
Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland. Methods—TEC nucleoli were investigated in fine needle biopsy specimens from 10 controls, 39 patients with Grave's disease, 15 with Hashimoto's thyroiditis, 56 with benign, and 15 with malignant tumours of the thyroid. A one step silver staining method was applied. In most cases serum concentrations of thyroxine and triiodothyronine as well as goitre size were determined. In every case 100 TECs were evaluated for the mean numbers of nucleoli and for the average number of argyrophilic nucleolar organiser regions (AgNORs) per nucleus. Results—NORs were activated in all patients, but not in controls. The numbers of AgNORs in patients with Grave's disease were closely correlated with thyroxine or triiodothyronine, or both, concentrations and with the size of the thyroid. In patients with Hashimoto's thyroiditis about 30% of TECs nucleoli did not contain AgNORs, whereas others were heavily impregnated with silver. Compared with controls and benign tumours, the nucleoli of carcinomatous TECs were larger and irregular in shape. The mean number of AgNORs per nucleus in malignant cells was higher than that in their benign counterparts. Conclusions—The mechanism by which NORs are activated in TECs varies depending on the type of lesion. The higher AgNOR score in TECs from malignant tumours can be used to distinguish them from their benign counterparts. Images PMID:16696083
Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.
Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger
2010-07-15
The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.
O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.
2013-01-01
Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...
The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.
Rodnina, Marina V; Wintermeyer, Wolfgang
2011-04-01
Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.
Interaction of tRNA with Eukaryotic Ribosome
Directory of Open Access Journals (Sweden)
Dmitri Graifer
2015-03-01
Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.
Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes
International Nuclear Information System (INIS)
Singh, H.; Bishop, J.
1984-01-01
It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)
Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.
Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V
2007-04-01
During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.
The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes
International Nuclear Information System (INIS)
Mori, Tomohiko; Fukuda, Mitsuru
1975-01-01
The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)
The ribosome uses two active mechanisms to unwind messenger RNA during translation.
Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio
2011-07-06
The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
International Nuclear Information System (INIS)
Gorelic, L.; Parker, D.
1978-01-01
The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques
2017-12-05
Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.
Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli
International Nuclear Information System (INIS)
Gravel, M.; Melancon, P.; Barkier-Gingras, L.
1987-01-01
[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance
The ribosome structure controls and directs mRNA entry, translocation and exit dynamics
International Nuclear Information System (INIS)
Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej
2008-01-01
The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit
Proto-ribosome: a theoretical approach based on RNA relics
Demongeot, Jacques
2017-01-01
We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.
rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.
Directory of Open Access Journals (Sweden)
Gisela Pöll
Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.
The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes
Directory of Open Access Journals (Sweden)
Mickey R. Miller
2014-09-01
Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.
International Nuclear Information System (INIS)
Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.
1982-01-01
The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)
Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.
Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila
2012-07-13
Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.
Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel
2003-08-01
Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
Andreeva, Irena
2018-01-01
During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian
2016-02-01
Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Directory of Open Access Journals (Sweden)
Nerea Irigoyen
2016-02-01
Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the
Xie, Ping
2015-10-09
Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
Production of RNA-protein cross links in γ irradiated E. Coli ribosomes
International Nuclear Information System (INIS)
Ekert, Bernard; Giocanti, Nicole
1976-01-01
γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr
DEFF Research Database (Denmark)
He, Yangzi
and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...
Simulating movement of tRNA through the ribosome during hybrid-state formation.
Whitford, Paul C; Sanbonmatsu, Karissa Y
2013-09-28
Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the
Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.
Directory of Open Access Journals (Sweden)
Pierre Bonnin
2017-05-01
Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling
Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.
Nikolaitchik, Olga A; Hu, Wei-Shau
2014-04-01
A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development
International Nuclear Information System (INIS)
Dessen, E.M.B.; Perondini, A.L.P.
1979-01-01
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants
Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter
2004-01-01
Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…
Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.
Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V
2009-01-01
Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.
Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome
Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.
2015-06-01
The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1993-01-01
RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Milbury Coren A
2010-09-01
Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell
Directory of Open Access Journals (Sweden)
Hyouta eHimeno
2014-04-01
Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.
Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins
Directory of Open Access Journals (Sweden)
Gayani N. P. Dedduwa-Mudalige
2015-09-01
Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.
Wang, Xun; Ji, Sang Chun; Yun, Sang Hoon; Jeon, Heung Jin; Kim, Si Wouk
2014-01-01
The gal operon of Escherichia coli has 4 cistrons, galE, galT, galK, and galM. In our previous report (H. J. Lee, H. J. Jeon, S. C. Ji, S. H. Yun, H. M. Lim, J. Mol. Biol. 378:318–327, 2008), we identified 6 different mRNA species, mE1, mE2, mT1, mK1, mK2, and mM1, in the gal operon and mapped these mRNAs. The mRNA map suggests a gradient of gene expression known as natural polarity. In this study, we investigated how the mRNAs are generated to understand the cause of natural polarity. Results indicated that mE1, mT1, mK1, and mM1, whose 3′ ends are located at the end of each cistron, are generated by transcription termination. Since each transcription termination is operating with a certain frequency and those 4 mRNAs have 5′ ends at the transcription initiation site(s), these transcription terminations are the basic cause of natural polarity. Transcription terminations at galE-galT and galT-galK junctions, making mE1 and mT1, are Rho dependent. However, the terminations to make mK1 and mM1 are partially Rho dependent. The 5′ ends of mK2 are generated by an endonucleolytic cleavage of a pre-mK2 by RNase P, and the 3′ ends are generated by Rho termination 260 nucleotides before the end of the operon. The 5′ portion of pre-mK2 is likely to become mE2. These results also suggested that galK expression could be regulated through mK2 production independent from natural polarity. PMID:24794565
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
Distribution of protein and RNA in the 30S ribosomal subunit
International Nuclear Information System (INIS)
Ramakrishnan, V.
1986-01-01
In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Directory of Open Access Journals (Sweden)
Jennifer L Houmani
Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.
DEFF Research Database (Denmark)
Douthwaite, S; Powers, T; Lee, J Y
1989-01-01
The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...
2016-02-11
unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was
Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.
Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M
2015-10-01
Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage
DEFF Research Database (Denmark)
Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A
2014-01-01
Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...
The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.
Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P
2007-01-01
The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.
18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA
Directory of Open Access Journals (Sweden)
Cory Ann Leonard
2016-01-01
Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.
Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction
DEFF Research Database (Denmark)
Recht, M I; Douthwaite, S; Dahlquist, K D
1999-01-01
antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
The functional half-life of an mRNA depends on the ribosome spacing in an early coding region
DEFF Research Database (Denmark)
Pedersen, Margit; Nissen, Søren; Mitarai, Namiko
2011-01-01
Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M
2014-08-01
5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Spirin, Alexander S
2009-11-17
A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis
International Nuclear Information System (INIS)
Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.
1990-01-01
Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated
Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle
Energy Technology Data Exchange (ETDEWEB)
Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)
1976-01-01
An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.
Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P
2010-08-01
Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.
mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Stevens, A.
1980-01-01
By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed
SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.
Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver
2012-07-15
In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.
In situ DNA-RNA hybridization using in vitro 125I-labeled ribosomal RNA of higher plant
International Nuclear Information System (INIS)
Sato, Seiichi; Kikuchi, Tadatoshi; Ishida, M.R.; Tanaka, Ryuso.
1975-01-01
In situ hybridization using 125 I-labeled ribosomal RNA was applied to plant cells. Cytoplasmic 25 s rRNA, which was eluted from acrylamide gels after electrophoretic separation, was labeled in vitro with carrier-free 125 I and hybridized with the interphase nuclei in root tips of Vicia faba. In most of the preparations, the nucleoli were more heavily labeled than the other regions within nuclei, and several types of grain distribution were observed on the nucleoli. From these results, it was confirmed that in situ hybridization using 125 I-labeled rRNA can be used very effectively to detect the annealing sites of different molecular species of rRNA within the nuclei of plant cells, for which it is not as easy to obtain high specific radioactive rRNA in vivo as it is in the case of cultured animal cells. (auth.)
Damiano, Fabrizio; Testini, Mariangela; Tocci, Romina; Gnoni, Gabriele V; Siculella, Luisa
2018-04-01
Acetyl-CoA carboxylase 1 (ACC1) is a cytosolic enzyme catalyzing the rate limiting step in de novo fatty acid biosynthesis. There is mounting evidence showing that ACC1 is susceptible to dysregulation and that it is over-expressed in liver diseases associated with lipid accumulation and in several cancers. In the present study, ACC1 regulation at the translational level is reported. Using several experimental approaches, the presence of an internal ribosome entry site (IRES) has been established in the 5' untranslated region (5' UTR) of the ACC1 mRNA. Transfection experiments with the ACC1 5' UTR inserted in a dicistronic reporter vector show a remarkable increase in the downstream cistron translation, through a cap-independent mechanism. The endoplasmic reticulum (ER) stress condition and the related unfolded protein response (UPR), triggered by treatment with thapsigargin and tunicamycin, cause an increase of the cap-independent translation of ACC1 mRNA in HepG2 cells, despite the overall reduction in global protein synthesis. Other stress conditions, such as serum starvation and incubation with hypoxia mimetic agent CoCl 2 , up-regulate ACC1 expression in HepG2 cells at the translational level. Overall, these findings indicate that the presence of an IRES in the ACC1 5' UTR allows ACC1 mRNA translation in conditions that are inhibitory to cap-dependent translation. A potential involvement of the cap-independent translation of ACC1 in several pathologies, such as obesity and cancer, has been discussed. Copyright © 2018 Elsevier B.V. All rights reserved.
Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template
International Nuclear Information System (INIS)
Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.
1987-01-01
Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA
Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S
2004-12-01
The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.
Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip
2018-04-21
Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Directory of Open Access Journals (Sweden)
Bani Kumar Pathak
Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.
Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy
International Nuclear Information System (INIS)
Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.
1986-01-01
The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-01-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...
Control of ribosome formation in rat heart
International Nuclear Information System (INIS)
Russo, L.A.
1987-01-01
Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation
DEFF Research Database (Denmark)
Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig
2007-01-01
The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...
Ernawati; Carnia, E.; Supriatna, A. K.
2018-03-01
Eigenvalues and eigenvectors in max-plus algebra have the same important role as eigenvalues and eigenvectors in conventional algebra. In max-plus algebra, eigenvalues and eigenvectors are useful for knowing dynamics of the system such as in train system scheduling, scheduling production systems and scheduling learning activities in moving classes. In the translation of proteins in which the ribosome move uni-directionally along the mRNA strand to recruit the amino acids that make up the protein, eigenvalues and eigenvectors are used to calculate protein production rates and density of ribosomes on the mRNA. Based on this, it is important to examine the eigenvalues and eigenvectors in the process of protein translation. In this paper an eigenvector formula is given for a ribosome dynamics during mRNA translation by using the Kleene star algorithm in which the resulting eigenvector formula is simpler and easier to apply to the system than that introduced elsewhere. This paper also discusses the properties of the matrix {B}λ \\otimes n of model. Among the important properties, it always has the same elements in the first column for n = 1, 2,… if the eigenvalue is the time of initiation, λ = τin , and the column is the eigenvector of the model corresponding to λ.
Post-transcriptional regulation of ribosome biogenesis in yeast
Directory of Open Access Journals (Sweden)
Isabelle C. Kos-Braun
2017-05-01
Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.
The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN
Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth
2015-01-01
Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078
Ribosomal history reveals origins of modern protein synthesis.
Directory of Open Access Journals (Sweden)
Ajith Harish
Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.
International Nuclear Information System (INIS)
Stahl, J.; Boehm, H.; Voderberg, M.
1981-01-01
Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations
Energy Technology Data Exchange (ETDEWEB)
Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum
1984-12-01
Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.
Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R
2008-02-22
The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.
Directory of Open Access Journals (Sweden)
Jean-Clement Mars
2018-01-01
Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.
International Nuclear Information System (INIS)
Ernst, S.G.; Oleinick, N.L.; Rustad, R.C.; Greenblatt, R.M.
1979-01-01
Sublethal doses of γ radiation are known to inhibit total RNA synthesis in the ciliate protozoan Tetrahymena. To determine if the synthesis of a particular class of RNA is preferentially inhibited, pulse-labeled RNA was isolated from normal exponentially growing cells, irradiated cells, and cells in which total RNA synthesis had recovered to the pre-irradiation level. The RNAs were analyzed by SDS-polyacrylamide gel electrphoresis and oligo(dT)-cellulose column chromatography. Inhibition of RNA synthesis primarily involves ribosomal RNA. However, radiation does not cause a delay in the processing of precursor rRNA or a preferential loss of either of the mature rRNAs. Following irradiation, poly(A)-containing RNA [poly(A+)RNA] is synthesized at a rate up to three times greater than the control rate. The elevated poly(A+)RNA synthesis occurs during the period of depressed rRNA synthesis and even after rRNA synthesis has recovered to its pre-irradiation rate. While the sizes of the total cellular ribonucleoside triphosphate pools are depressed in the irradiated cells, these pools probably do not represent the actual compartments containing the precursors for RNA synthesis, and the observed changes cannot explain the modifications in macromolecular synthesis in irradiated Tetrahymena. (Auth.)
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
An approach to analyse the specific impact of rapamycin on mRNA-ribosome association
Directory of Open Access Journals (Sweden)
Jaquier-Gubler Pascale
2008-08-01
Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of
International Nuclear Information System (INIS)
Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.
1977-01-01
The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes
Keller, Alexander; Förster, Frank; Müller, Tobias; Dandekar, Thomas; Schultz, Jörg; Wolf, Matthias
2010-01-15
In several studies, secondary structures of ribosomal genes have been used to improve the quality of phylogenetic reconstructions. An extensive evaluation of the benefits of secondary structure, however, is lacking. This is the first study to counter this deficiency. We inspected the accuracy and robustness of phylogenetics with individual secondary structures by simulation experiments for artificial tree topologies with up to 18 taxa and for divergency levels in the range of typical phylogenetic studies. We chose the internal transcribed spacer 2 of the ribosomal cistron as an exemplary marker region. Simulation integrated the coevolution process of sequences with secondary structures. Additionally, the phylogenetic power of marker size duplication was investigated and compared with sequence and sequence-structure reconstruction methods. The results clearly show that accuracy and robustness of Neighbor Joining trees are largely improved by structural information in contrast to sequence only data, whereas a doubled marker size only accounts for robustness. Individual secondary structures of ribosomal RNA sequences provide a valuable gain of information content that is useful for phylogenetics. Thus, the usage of ITS2 sequence together with secondary structure for taxonomic inferences is recommended. Other reconstruction methods as maximum likelihood, bayesian inference or maximum parsimony may equally profit from secondary structure inclusion. This article was reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber) and Eugene V. Koonin. Reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber) and Eugene V. Koonin. For the full reviews, please go to the Reviewers' comments section.
Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei
2013-10-22
The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V
2015-10-01
Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.
Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli
2017-05-27
Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis
Essers, P.B.M.
2013-01-01
Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.
Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon
2017-06-30
Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.
Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B
2001-09-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.
MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.
Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn
2016-01-08
Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Miscoding-induced stalling of substrate translocation on the bacterial ribosome.
Alejo, Jose L; Blanchard, Scott C
2017-10-10
Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.
Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria
2017-12-01
In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
DEFF Research Database (Denmark)
Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef
2007-01-01
The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...
DEFF Research Database (Denmark)
Poulsen, S M; Karlsson, M; Johansson, L B
2001-01-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....
Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan
2017-06-01
Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.
International Nuclear Information System (INIS)
Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry
2008-01-01
The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library
DEFF Research Database (Denmark)
Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne
2010-01-01
An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...
In vitro degradation of ribosomes.
Mora, G; Rivas, A
1976-12-01
The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering
International Nuclear Information System (INIS)
Burkhardt, N.
1997-01-01
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de
Directory of Open Access Journals (Sweden)
Dandekar Thomas
2010-01-01
Full Text Available Abstract Background In several studies, secondary structures of ribosomal genes have been used to improve the quality of phylogenetic reconstructions. An extensive evaluation of the benefits of secondary structure, however, is lacking. Results This is the first study to counter this deficiency. We inspected the accuracy and robustness of phylogenetics with individual secondary structures by simulation experiments for artificial tree topologies with up to 18 taxa and for divergency levels in the range of typical phylogenetic studies. We chose the internal transcribed spacer 2 of the ribosomal cistron as an exemplary marker region. Simulation integrated the coevolution process of sequences with secondary structures. Additionally, the phylogenetic power of marker size duplication was investigated and compared with sequence and sequence-structure reconstruction methods. The results clearly show that accuracy and robustness of Neighbor Joining trees are largely improved by structural information in contrast to sequence only data, whereas a doubled marker size only accounts for robustness. Conclusions Individual secondary structures of ribosomal RNA sequences provide a valuable gain of information content that is useful for phylogenetics. Thus, the usage of ITS2 sequence together with secondary structure for taxonomic inferences is recommended. Other reconstruction methods as maximum likelihood, bayesian inference or maximum parsimony may equally profit from secondary structure inclusion. Reviewers This article was reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber and Eugene V. Koonin. Open peer review Reviewed by Shamil Sunyaev, Andrea Tanzer (nominated by Frank Eisenhaber and Eugene V. Koonin. For the full reviews, please go to the Reviewers' comments section.
Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy
2015-01-01
Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851
Placeholder factors in ribosome biogenesis: please, pave my way
Directory of Open Access Journals (Sweden)
Francisco J. Espinar-Marchena
2017-04-01
Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.
International Nuclear Information System (INIS)
Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo
2006-01-01
Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1997-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1998-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Studies on the catalytic rate constant of ribosomal peptidyltransferase.
Synetos, D; Coutsogeorgopoulos, C
1987-02-20
A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.
Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O
1995-01-01
Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.
Directory of Open Access Journals (Sweden)
Brittany Burton
Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.
Letsch, Harald O; Kjer, Karl M
2011-05-27
Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates
Structure based hypothesis of a mitochondrial ribosome rescue mechanism
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2012-05-01
Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.
2011-07-01
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.
Energy Technology Data Exchange (ETDEWEB)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)
2011-07-15
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.
Further characterization of ribosome binding to thylakoid membranes
International Nuclear Information System (INIS)
Hurewitz, J.; Jagendorf, A.T.
1987-01-01
Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins
Control of ribosome traffic by position-dependent choice of synonymous codons
DEFF Research Database (Denmark)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...
International Nuclear Information System (INIS)
Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya
2013-01-01
Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-05-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.
International Nuclear Information System (INIS)
Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary
2013-01-01
Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN
Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad
2013-01-01
Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461
Ishida, Hisashi; Matsumoto, Atsushi
2014-01-01
To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999
Directory of Open Access Journals (Sweden)
Hisashi Ishida
Full Text Available To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA.
Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.
Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C
2016-04-01
Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.
The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation
Alejo, Jose Luis
In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami
2017-01-01
Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...
Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R
2013-02-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.
DEFF Research Database (Denmark)
Douthwaite, S; Prince, J B; Noller, H F
1985-01-01
A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...
Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T
2016-06-01
Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied
DEFF Research Database (Denmark)
Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne
2013-01-01
of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...
On the control of ribosomal protein biosynthesis in Escherichia coli
International Nuclear Information System (INIS)
Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.
1977-01-01
The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene
Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number
Directory of Open Access Journals (Sweden)
Katherine I. Farley-Barnes
2018-02-01
Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.
Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9
Directory of Open Access Journals (Sweden)
Arava Yoav
2007-08-01
Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.
Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.
Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S
2018-03-15
Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.
Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria
2014-01-01
We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.
GTPases and the origin of the ribosome
Directory of Open Access Journals (Sweden)
Smith Temple F
2010-05-01
Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.
Iqbal, Emil S; Dods, Kara K; Hartman, Matthew C T
2018-02-14
The ability to incorporate non-canonical amino acids (ncAA) using translation offers researchers the ability to extend the functionality of proteins and peptides for many applications including synthetic biology, biophysical and structural studies, and discovery of novel ligands. Here we describe the high promiscuity of an editing-deficient valine-tRNA synthetase (ValRS T222P). Using this enzyme, we demonstrate ribosomal translation of 11 ncAAs including those with novel side chains, α,α-disubstitutions, and cyclic β-amino acids.
Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation
Xie, Ping
2014-12-01
We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.
Ribosome evolution: Emergence of peptide synthesis machinery
Indian Academy of Sciences (India)
suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.
DEFF Research Database (Denmark)
Sogin, M L; Ingold, A; Karlok, M
1986-01-01
. In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...
Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA
Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.
2015-01-01
Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222
Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A
2016-07-01
The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Porse, B T; Kirillov, S V; Awayez, M J
1999-01-01
of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.
Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad
2012-03-23
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.
Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*
Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad
2012-01-01
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031
Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.
Wang, Hao; Kingsford, Carl; McManus, C Joel
2018-03-15
Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.
Control of ribosome traffic by position-dependent choice of synonymous codons
International Nuclear Information System (INIS)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)
Ribosome-catalyzed formation of an abnormal peptide analogue
International Nuclear Information System (INIS)
Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.
1986-01-01
The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue
Protein-protein interactions within late pre-40S ribosomes.
Directory of Open Access Journals (Sweden)
Melody G Campbell
2011-01-01
Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
Directory of Open Access Journals (Sweden)
Azat Gabdulkhakov
2017-02-01
Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.
Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira
2014-12-01
Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.
Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.
Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise
2006-03-15
Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1982-01-01
The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.
Directory of Open Access Journals (Sweden)
Paul C Whitford
Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.
Differential Stoichiometry among Core Ribosomal Proteins
Directory of Open Access Journals (Sweden)
Nikolai Slavov
2015-11-01
Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.
A new version of the RDP (Ribosomal Database Project)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.
Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T
2007-06-01
Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.
Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel
2007-12-07
The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.
Trapping the ribosome to control gene expression.
Boehringer, Daniel; Ban, Nenad
2007-09-21
Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.
Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion
DEFF Research Database (Denmark)
Beuchert Kallehauge, Thomas; Li, Shangzhong; Pedersen, Lasse Ebdrup
2017-01-01
Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as effici......Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated...... as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated...... as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we...
International Nuclear Information System (INIS)
Ciesiolka, J.; Nurse, K.; Klein, J.; Ofengand, J.
1985-01-01
The complex of Artemia salina ribosomes and Escherichia coli acetylvalyl-tRNA could be cross-linked by irradiation with near-UV light. Cross-linking required the presence of the codon GUU, GUA being ineffective. The acetylvalyl group could be released from the cross-linked tRNA by treatment with puromycin, demonstrating that cross-linking had occurred at the P site. This was true both for pGUU- and also for poly(U2,G)-dependent cross-linking. All of the cross-linking was to the 18S rRNA of the small ribosomal subunit. Photolysis of the cross-link at 254 nm occurred with the same kinetics as that for the known cyclobutane dimer between this tRNA and Escherichia coli 16S rRNA. T1 RNase digestion of the cross-linked tRNA yielded an oligonucleotide larger in molecular weight than any from un-cross-linked rRNA or tRNA or from a prephotolyzed complex. Extended electrophoresis showed this material to consist of two oligomers of similar mobility, a faster one-third component and a slower two-thirds component. Each oligomer yielded two components on 254-nm photolysis. The slower band from each was the tRNA T1 oligomer CACCUCCCUVACAAGp, which includes the anticodon. The faster band was the rRNA 9-mer UACACACCGp and its derivative UACACACUG. Unexpectedly, the dephosphorylated and slower moving 9-mer was derived from the faster moving dimer. Deamination of the penultimate C to U is probably due to cyclobutane dimer formation and was evidence for that nucleotide being the site of cross-linking. Direct confirmation of the cross-linking site was obtained by Z-gel analysis
Fluctuations and synchrony of RNA synthesis in nucleoli.
Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N
2015-06-01
Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.
de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.
2006-01-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Assembly constraints drive co-evolution among ribosomal constituents.
Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip
2015-06-23
Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong
2016-12-06
Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.
Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D
2011-04-01
Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Katayama, Masafumi; Hirayama, Takashi; Tani, Tetsuya; Nishimori, Katsuhiko; Onuma, Manabu; Fukuda, Tomokazu
2018-02-01
Induced pluripotent stem (iPS) cell technology lead terminally differentiated cells into the pluripotent stem cells through the expression of defined reprogramming factors. Although, iPS cells have been established in a number of mammalian species, including mouse, human, and monkey, studies on iPS cells in avian species are still very limited. To establish chick iPS cells, six factors were used within the poly-cistronic reprogramming vector (PB-R6F), containing M3O (MyoD derived transactivation domain fused with Oct3/4), Sox2, Klf4, c-Myc, Lin28, and Nanog. The PB-R6F derived iPS cells were alkaline-phosphatase and SSEA-1 positive, which are markers of pluripotency. Elevated levels of endogenous Oct3/4 and Nanog genes were detected in the established iPS cells, suggesting the activation of the FGF signaling pathway is critical for the pluripotent status. Histological analysis of teratoma revealed that the established chick iPS cells have differentiation ability into three-germ-layer derived tissues. This is the first report of establishment of avian derived iPS cells with a single poly-cistronic transposon based expression system. The establishment of avian derived iPS cells could contribute to the genetic conservation and modification of avian species. © 2017 Wiley Periodicals, Inc.
The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.
Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong
2013-03-01
Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.
Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei
2010-02-01
We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
1975-01-01
In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969
Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom
2017-07-01
Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin
Directory of Open Access Journals (Sweden)
Chelsea Herdman
2017-07-01
Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state
Emerging functions of ribosomal proteins in gene-specific transcription and translation
International Nuclear Information System (INIS)
Lindstroem, Mikael S.
2009-01-01
Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.
Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.
Mustafi, Mainak; Weisshaar, James C
2018-01-16
In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid
Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?
Directory of Open Access Journals (Sweden)
Ilana C. Agmon
2016-12-01
Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.
Ribosomal RNA: a key to phylogeny
Olsen, G. J.; Woese, C. R.
1993-01-01
As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.
Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo
2012-01-01
Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.
Directory of Open Access Journals (Sweden)
Christiane Rodriguez Gutierrez Madalena
Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.
Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center
DEFF Research Database (Denmark)
Long, K. S.; Hansen, L. K.; Jakobsen, L.
2006-01-01
Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...
Institute of Scientific and Technical Information of China (English)
Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao
2017-01-01
As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.
Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard
2015-04-07
During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.
Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.
Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek
2017-06-29
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.
Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis
DEFF Research Database (Denmark)
Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.
2009-01-01
In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...
International Nuclear Information System (INIS)
Oesterberg, R.; Garrett, A.
1977-01-01
The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de
International Nuclear Information System (INIS)
Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.
1987-01-01
The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly
gamma. radiation effect on the functional properties of the cotton ribosomes
Energy Technology Data Exchange (ETDEWEB)
Ibragimov, A P; Safarov, Sh
1973-01-01
A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.
Crossland, Hannah; Timmons, James A; Atherton, Philip J
2017-12-01
Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).
DEFF Research Database (Denmark)
Vester, Birte; Garrett, Roger Antony
1988-01-01
in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...
Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation
Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.
2016-01-01
Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia
2016-10-01
Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Directory of Open Access Journals (Sweden)
Joseph C Sanchez
2017-10-01
Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.
Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J
2017-10-01
A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.
An automated procedure for covariation-based detection of RNA structure
International Nuclear Information System (INIS)
Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.
1989-12-01
This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs
An automated procedure for covariation-based detection of RNA structure
Energy Technology Data Exchange (ETDEWEB)
Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.
1989-12-01
This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.
Is The Ribosome Targeted By Adaptive Mutations
DEFF Research Database (Denmark)
Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh
2015-01-01
Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping
2017-05-01
The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.
Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.
Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad
2015-04-17
Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.
Architecture of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad
2014-01-23
Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J
2013-08-08
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.
A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel
DEFF Research Database (Denmark)
Long, Katherine S; Porse, Bo T
2003-01-01
, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....
Directory of Open Access Journals (Sweden)
Lieke A van Gijtenbeek
2016-12-01
Full Text Available By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at the cell poles, whereas transcripts of a well-expressed homologous membrane protein show membrane-proximal localization in a translation-dependent fashion. The presence of the aberrant polar mRNA foci correlates with cessation of cell division, which is restored once these bodies are cleared. In addition, activation of the heat-shock response and a loss of nucleoid-occluded ribosomes are observed. We show that the presence of a native-like N-terminal domain is key to SRP-dependent membrane localization and successful production of membrane proteins. The work presented gives new insights and detailed understanding of aberrant membrane protein biogenesis, which can be used for strategies to optimize membrane protein production.
DEFF Research Database (Denmark)
Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim
2014-01-01
A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel
DEFF Research Database (Denmark)
Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen
2017-01-01
Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...
Time of action of 4.5 S RNA in Escherichia coli translation
DEFF Research Database (Denmark)
Brown, S
1989-01-01
A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
The complete structure of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad
2014-11-13
Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.
Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan
2005-10-10
The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.
He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J
2009-12-31
We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.
Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae
Directory of Open Access Journals (Sweden)
Larisa Gunderina
2015-05-01
Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.
Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W
2006-01-01
The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome
Directory of Open Access Journals (Sweden)
Jendrik Hentschel
2017-07-01
Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.
Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad
2017-07-05
The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A
2006-01-01
potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...
CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.
Bai, Baoyan; Moore, Henna M; Laiho, Marikki
2013-01-01
CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.
Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.
Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad
2015-07-08
Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.
Choe, Junho; Oh, Nara; Park, Sungjin; Lee, Ye Kyung; Song, Ok-Kyu; Locker, Nicolas; Chi, Sung-Gil; Kim, Yoon Ki
2012-05-25
In the cytoplasm of mammalian cells, either cap-binding proteins 80 and 20 (CBP80/20) or eukaryotic translation initiation factor (eIF) 4E can direct the initiation of translation. Although the recruitment of ribosomes to mRNAs during eIF4E-dependent translation (ET) is well characterized, the molecular mechanism for CBP80/20-dependent translation (CT) remains obscure. Here, we show that CBP80/20-dependent translation initiation factor (CTIF), which has been shown to be preferentially involved in CT but not ET, specifically interacts with eIF3g, a component of the eIF3 complex involved in ribosome recruitment. By interacting with eIF3g, CTIF serves as an adaptor protein to bridge the CBP80/20 and the eIF3 complex, leading to efficient ribosome recruitment during CT. Accordingly, down-regulation of CTIF using a small interfering RNA causes a redistribution of CBP80 from polysome fractions to subpolysome fractions, without significant consequence to eIF4E distribution. In addition, down-regulation of eIF3g inhibits the efficiency of nonsense-mediated mRNA decay, which is tightly coupled to CT but not to ET. Moreover, the artificial tethering of CTIF to an intercistronic region of dicistronic mRNA results in translation of the downstream cistron in an eIF3-dependent manner. These findings support the idea that CT mechanistically differs from ET.
The effect of tRNA levels on decoding times of mRNA codons.
Dana, Alexandra; Tuller, Tamir
2014-08-01
The possible effect of transfer ribonucleic acid (tRNA) concentrations on codons decoding time is a fundamental biomedical research question; however, due to a large number of variables affecting this process and the non-direct relation between them, a conclusive answer to this question has eluded so far researchers in the field. In this study, we perform a novel analysis of the ribosome profiling data of four organisms which enables ranking the decoding times of different codons while filtering translational phenomena such as experimental biases, extreme ribosomal pauses and ribosome traffic jams. Based on this filtering, we show for the first time that there is a significant correlation between tRNA concentrations and the codons estimated decoding time both in prokaryotes and in eukaryotes in natural conditions (-0.38 to -0.66, all P values decoding times are not correlated with aminoacyl-tRNA levels. The reported results support the conjecture that translation efficiency is directly influenced by the tRNA levels in the cell. Thus, they should help to understand the evolution of synonymous aspects of coding sequences via the adaptation of their codons to the tRNA pool. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.
Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad
2017-02-15
Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.
TruSeq Stranded mRNA and Total RNA Sample Preparation Kits
Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.
Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S
2003-09-01
The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.
Tomecki, Rafal; Sikorski, Pawel J; Zakrzewska-Placzek, Monika
2017-07-01
Proper regulation of ribosome biosynthesis is mandatory for cellular adaptation, growth and proliferation. Ribosome biogenesis is the most energetically demanding cellular process, which requires tight control. Abnormalities in ribosome production have severe consequences, including developmental defects in plants and genetic diseases (ribosomopathies) in humans. One of the processes occurring during eukaryotic ribosome biogenesis is processing of the ribosomal RNA precursor molecule (pre-rRNA), synthesized by RNA polymerase I, into mature rRNAs. It must not only be accurate but must also be precisely coordinated with other phenomena leading to the synthesis of functional ribosomes: RNA modification, RNA folding, assembly with ribosomal proteins and nucleocytoplasmic RNP export. A multitude of ribosome biogenesis factors ensure that these events take place in a correct temporal order. Among them are endo- and exoribonucleases involved in pre-rRNA processing. Here, we thoroughly present a wide spectrum of ribonucleases participating in rRNA maturation, focusing on their biochemical properties, regulatory mechanisms and substrate specificity. We also discuss cooperation between various ribonucleolytic activities in particular stages of pre-rRNA processing, delineating major similarities and differences between three representative groups of eukaryotes: yeast, plants and humans. © 2017 Federation of European Biochemical Societies.
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Directory of Open Access Journals (Sweden)
Sayaka Tsuji
2017-07-01
Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.
Directory of Open Access Journals (Sweden)
Yun-Chieh Tasi
2015-04-01
Full Text Available Overexpression of the amyloid precursor protein (APP and the hyperphosphorylation of the tau protein are vital in the understanding of the cause of Alzheimer’s disease (AD. As a consequence, regulation of the expression of both APP and tau proteins is one important approach in combating AD. The APP and tau proteins can be targeted at the levels of transcription, translation and protein structural integrity. This paper reports the utilization of a bi-cistronic vector containing either APP or tau internal ribosome entry site (IRES elements flanked by β-galactosidase gene (cap-dependent and secreted alkaline phosphatase (SEAP (cap-independent to discern the mechanism of action of memantine, an N-methyl-d-aspartate (NMDA receptor antagonist. Results indicate that memantine could reduce the activity of both the APP and tau IRES at a concentration of ~10 μM (monitored by SEAP activity without interfering with the cap-dependent translation as monitored by the β-galactosidase assay. Western blot analysis of the tau protein in neuroblastoma (N2A and rat hippocampal cells confirmed the halting of the expression of the tau proteins. We also employed this approach to identify a preparation named NB34, extracts of Boussingaultia baselloides (madeira-vine fermented with Lactobacillus spp., which can function similarly to memantine in both IRES of APP and Tau. The water maze test demonstrated that NB34 could improve the spatial memory of a high fat diet induced neurodegeneration in apolipoprotein E-knockout (ApoE−/− mice. These results revealed that the bi-cistronic vector provided a simple, and effective platform in screening and establishing the mechanistic action of potential compounds for the treatment and management of AD.
Initiation of translation in bacteria by a structured eukaryotic IRES RNA.
Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S
2015-03-05
The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.
Increased 5S rRNA oxidation in Alzheimer's disease.
Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R
2012-01-01
It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr
2014-04-01
Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.
The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.
Chan, Y L; Paz, V; Olvera, J; Wool, I G
1993-04-30
The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.
International Nuclear Information System (INIS)
Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.
1991-01-01
An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins
International Nuclear Information System (INIS)
Timmins, P.A.; Langowski, J.; Brown, R.S.
1988-01-01
The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
Hellen, Christopher U T; de Breyne, Sylvain
2007-06-01
The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
DEFF Research Database (Denmark)
Long, Katherine S.; Vester, Birte
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...
Architecture of the E.coli 70S ribosome
DEFF Research Database (Denmark)
Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.
1997-01-01
The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...
Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M
2004-01-01
Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
Senescent changes in the ribosomes of animal cells in vivo and in vitro
Miquel, J.; Johnson, J. E., Jr.
1979-01-01
The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.
Cukras, Anthony R; Green, Rachel
2005-05-27
The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.
Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.
Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou
2015-06-01
Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.
Hellen, Christopher U. T.; de Breyne, Sylvain
2007-01-01
The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358
Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms
DEFF Research Database (Denmark)
Christensen-Dalsgaard, Mikkel; Gerdes, Kenn
2008-01-01
Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro bu...
Directory of Open Access Journals (Sweden)
Saurav Mallik
Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.
Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose
2017-07-25
Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.
Björk, G R; Neidhardt, F C
1975-10-01
Matched pairs of transductant strains differing by the presence of absence of 5-methyluridine (ribothymidine) (m5U) in their transfer ribonucleic acid (tRNA) were used to study the function of this modified nucleoside in Escherichia coli. Ordinary measurements of growth rate in different media revealed no effect of the loss of m5U in tRNA. A gene located close to trmA (the structural cistron for the methyltransferase that produces m5U in tRNA), however, was found to reduce the growth rates significantly, depending on the medium and the temperature of cultivation. Measurement of codon recognition, macromolecular composition, tRNA binding to the ribosome, and the rate of protein chain elongation in vivo indicated no disadvantage caused by the lack of m5U. The regulation of ilv and his operons seemed also to be unaffected by the absence of m5U in the tRNA. In a mixed population experiment, however, cells possessing m5U in their tRNA seemed to have a distinct advantage over cells lacking this modified nucleoside. This experiment provides the first indication of the overall value of m5U in tRNA.
The role of upstream sequences in selecting the reading frame on tmRNA
Directory of Open Access Journals (Sweden)
Dewey Jonathan D
2008-06-01
Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.
Ditzler, Mark A.
2014-01-01
RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.
Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen
2016-07-01
Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
Long, Katherine S.
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525
Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria
2005-01-01
It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and
Origins and Early Evolution of the tRNA Molecule
Directory of Open Access Journals (Sweden)
Koji Tamura
2015-12-01
Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.
Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil
2014-03-01
Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.
Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T
2015-02-01
Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.
Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T
2015-01-01
Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895
Directory of Open Access Journals (Sweden)
Aaron R. Poole
2017-09-01
Full Text Available Many ribonucleoproteins (RNPs, which are comprised of noncoding RNA and associated proteins, are involved in essential cellular processes such as translation and pre-mRNA splicing. One class of RNP is the small Cajal body-specific RNP (scaRNP, which contributes to the biogenesis of small nuclear RNPs (snRNPs that are central components of the spliceosome. Three scaRNAs are internally processed, generating stable nucleolus-enriched RNAs of unknown function. Here, we provide data that show that these RNAs become part of RNPs we term regulatory RNPs (regRNPs. Most modifications within rRNA (predominantly pseudouridylation and ribose 2′-O-methylation are conducted by small nucleolar RNPs (snoRNPs, and we provide evidence that the activity of at least some of these snoRNPs is under the control of regRNPs. Because modifications within rRNA can vary in different physiological or pathological situations, rRNA modifications are thought to be the major source of ribosome heterogeneity. Our identification of regRNPs thus provides a potential mechanism for how ribosome heterogeneity may be accomplished. This work also provides additional functional connections between the Cajal body and the nucleolus.
MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW
Directory of Open Access Journals (Sweden)
Tobias von der Haar
2012-04-01
Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.
Biochemistry and Function of the RNA Exosomes
DEFF Research Database (Denmark)
Lubas, Michal Szymon; Chlebowski, Aleksander; Dziembowski, Andrzej
2012-01-01
Discovery of the evolutionary conserved RNA exosome was a milestone in RNA biology. First identified as an activity essential for the processing of ribosomal RNA, the exosome has since proved to be central for RNA processing and degradation in both the nucleus and the cytoplasm of eukaryotic cell...
Directory of Open Access Journals (Sweden)
John N Griffin
2015-03-01
Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Directory of Open Access Journals (Sweden)
Abhishek Ghosh
2014-10-01
Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Simulation and analysis of single-ribosome translation
International Nuclear Information System (INIS)
Tinoco, Ignacio Jr; Wen, Jin-Der
2009-01-01
In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation
Sotelo, José Roberto; Canclini, Lucía; Kun, Alejandra; Sotelo-Silveira, José Roberto; Calliari, Aldo; Cal, Karina; Bresque, Mariana; Dipaolo, Andrés; Farias, Joaquina; Mercer, John A
2014-03-01
The existence of RNA in axons has been a matter of dispute for decades. Evidence for RNA and ribosomes has now accumulated to a point at which it is difficult to question, much of the disputes turned to the origin of these axonal RNAs. In this review, we focus on studies addressing the origin of axonal RNAs and ribosomes. The neuronal soma as the source of most axonal RNAs has been demonstrated and is indisputable. However, the surrounding glial cells may be a supplemental source of axonal RNAs, a matter scarcely investigated in the literature. Here, we review the few papers that have demonstrated that glial-to-axon RNA transfer is not only feasible, but likely. We describe this process in both invertebrate axons and vertebrate axons. Schwann cell to axon ribosomes transfer was conclusively demonstrated (Court et al. [2008]: J. Neurosci 28:11024-11029; Court et al. [2011]: Glia 59:1529-1539). However, mRNA transfer still remains to be demonstrated in a conclusive way. The intercellular transport of mRNA has interesting implications, particularly with respect to the integration of glial and axonal function. This evolving field is likely to impact our understanding of the cell biology of the axon in both normal and pathological conditions. Most importantly, if the synthesis of proteins in the axon can be controlled by interacting glia, the possibilities for clinical interventions in injury and neurodegeneration are greatly increased. Copyright © 2013 Wiley Periodicals, Inc.
Trans-acting translational regulatory RNA binding proteins.
Harvey, Robert F; Smith, Tom S; Mulroney, Thomas; Queiroz, Rayner M L; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa; Lilley, Kathryn S; Willis, Anne E
2018-05-01
The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans-acting regulatory RNA-binding proteins (RBPs) are necessary to provide mRNA-specific translation, and these interact with 5' and 3' untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans-acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans-acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans-acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes Translation > Translation Regulation Translation > Translation Mechanisms. © 2018 Medical Research Council and University of Cambridge. WIREs RNA published by Wiley Periodicals, Inc.
Roles of the nucleolus in the CAG RNA-mediated toxicity.
Tsoi, Ho; Chan, Ho Yin Edwin
2014-06-01
The nucleolus is a subnuclear compartment within the cell nucleus that serves as the site for ribosomal RNA (rRNA) transcription and the assembly of ribosome subunits. Apart from its classical role in ribosomal biogenesis, a number of cellular regulatory roles have recently been assigned to the nucleolus, including governing the induction of apoptosis. "Nucleolar stress" is a term that is used to describe a signaling pathway through which the nucleolus communicates with other subcellular compartments, including the mitochondria, to induce apoptosis. It is an effective mechanism for eliminating cells that are incapable of performing protein synthesis efficiently due to ribosome biogenesis defects. The down-regulation of rRNA transcription is a common cause of nucleolar function disruption that subsequently triggers nucleolar stress, and has been associated with the pathogenesis of neurological disorders such as spinocerebellar ataxias (SCAs) and Huntington's diseases (HD). This article discusses recent advances in mechanistic studies of how expanded CAG trinucleotide repeat RNA transcripts trigger nucleolar stress in SCAs, HD and other trinucleotide repeat disorders. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. Copyright © 2013 Elsevier B.V. All rights reserved.
Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V
2016-09-06
Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Czech Academy of Sciences Publication Activity Database
Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.
2015-01-01
Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.
Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger
2005-11-01
Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.
Directory of Open Access Journals (Sweden)
Jeffrey A Hussmann
2015-12-01
Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.
Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function
Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars
2012-01-01
Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...
Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas
2017-12-15
Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano
2018-01-04
A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Olga Fernández-Miragall
Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.
Fernández-Miragall, Olga; Hernández, Carmen
2011-01-01
Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.
Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y
2000-07-01
The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the
Energy Technology Data Exchange (ETDEWEB)
Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)
2016-11-01
Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.
Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli
DEFF Research Database (Denmark)
Aagaard, C; Rosendahl, G; Dam, M
1991-01-01
The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...
International Nuclear Information System (INIS)
Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.
2010-01-01
Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.
Directory of Open Access Journals (Sweden)
Ian M Willis
2008-07-01
Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.
Reconstruction of ribosomal RNA genes from metagenomic data.
Directory of Open Access Journals (Sweden)
Lu Fan
Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.
Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk
2003-01-01
Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413
Branciamore, Sergio; Di Giulio, Massimo
2012-04-01
The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.
Initiation of ribosomal RNA synthesis in Escherichia coli
Hamming, Jantina
1981-01-01
Het E. coli chromosoom is éên lang circulair dubbelstrengs DNA molecuul en beslaat ongeveer 3000 genen. Het enzym RNA polymerase is verantwoordelijk voor de transcriptie in RNA van alle genetische informatie in de ce1. Er zijn 2 soorten transcripten: de ribosomale en transfer RNAs die deel uitmaken
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen
2016-09-16
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.
Antibiotic inhibition of the movement of tRNA substrates through a peptidyl transferase cavity
DEFF Research Database (Denmark)
Porse, B T; Rodriguez-Fonseca, C; Leviev, I
1996-01-01
The present review attempts to deal with movement of tRNA substrates through the peptidyl transferase centre on the large ribosomal subunit and to explain how this movement is interrupted by antibiotics. It builds on the concept of hybrid tRNA states forming on ribosomes and on the observed movem...
A Specific Hepatic Transfer RNA for Phosphoserine*
Mäenpää, Pekka H.; Bernfield, Merton R.
1970-01-01
Radioactive O-phosphoryl-L-serine was detected after alkaline deacylation of rat and rooster liver [3H]seryl-tRNA acylated in vitro with homologous synthetases. Ribonuclease treatment of this tRNA yielded a compound with the properties of phosphoseryl-adenosine. Benzoylated DEAE-cellulose chromatography of seryl-tRNA yielded four distinct peaks, only one of which contained phosphoserine. A unique fraction for phosphoserine was also found on chromatography of nonacylated tRNA. In ribosome binding studies, this fraction responded very slightly with poly(U,C), but not with any of the known serine trinucleotide codons. Substantial incorporation of [3H]-serine into protein from this tRNA species was observed in an aminoacyl-tRNA dependent polysomal system derived from chick oviducts. No phosphoserine was found in Escherichia coli or yeast seryl-tRNA acylated with homologous enzymes, nor in E. coli seryl-tRNA acylated with liver synthetase. In the absence of tRNA, free phosphoserine was not formed in reaction mixtures, which suggests that phosphoseryl-tRNA arises by phosphorylation of the unique seryl-tRNA species. These results demonstrate a discrete tRNASer species in rat and rooster liver containing phosphoserine and suggest that this tRNA is involved in ribosomal polypeptide synthesis. PMID:4943179
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Control of Ribosome Synthesis in Escherichia coli
DEFF Research Database (Denmark)
Molin, Søren; Meyenburg, K. von; Måløe, O.
1977-01-01
The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
International Nuclear Information System (INIS)
Denslow, N.D.; O'Brien, T.W.
1984-01-01
To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles
Pactamycin binding site on archaebacterial and eukaryotic ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.G.
1987-01-01
The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics
Directory of Open Access Journals (Sweden)
Hong Jun-Jie
2009-05-01
Full Text Available Abstract Background Internal ribosomal entry sites (IRESs provide alternative, cap-independent translation initiation sites in eukaryotic cells. IRES elements are important factors in viral genomes and are also useful tools for bi-cistronic expression vectors. Most existing RNA structure prediction programs are unable to deal with IRES elements. Results We designed an IRES search system, named IRSS, to obtain better results for IRES prediction. RNA secondary structure prediction and comparison software programs were implemented to construct our two-stage strategy for the IRSS. Two software programs formed the backbone of IRSS: the RNAL fold program, used to predict local RNA secondary structures by minimum free energy method; and the RNA Align program, used to compare predicted structures. After complete viral genome database search, the IRSS have low error rate and up to 72.3% sensitivity in appropriated parameters. Conclusion IRSS is freely available at this website http://140.135.61.9/ires/. In addition, all source codes, precompiled binaries, examples and documentations are downloadable for local execution. This new search approach for IRES elements will provide a useful research tool on IRES related studies.
Increased efficiency of exogenous messenger RNA translation in a Krebs ascites cell lysate.
Metafora, S; Terada, M; Dow, L W; Marks, P A; Bank, A
1972-05-01
Addition of a 0.5 M KCl wash fraction from rabbit reticulocyte ribosomes causes a 3- to 10-fold increase in the extent of translation of natural mRNAs by Krebs-cell lysates. In the presence of the wash fraction, 1 pmol of rabbit or mouse 10S RNA directs the incorporation of 80 pmol of leucine into rabbit globin. The addition of human 10S RNA results in the synthesis of equal amounts of human alpha and beta chains, identified by column chromatography. The stimulation by the wash fraction is almost completely dependent on added mammalian tRNA. In contrast to the wash fraction from rabbit reticulocytes, the wash fraction isolated from Krebs-cell ribosomes is inhibitory to both endogenous and exogenous mRNA translation. The stimulation by the wash fraction from rabbit ribosomes is not specific for globin mRNAs, but also increases endogenous, phage Qbeta, and viral RNA-directed protein synthesis.
The rRNA evolution and procaryotic phylogeny
Fox, G. E.
1986-01-01
Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.
Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L
2017-11-01
Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In
A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death
Directory of Open Access Journals (Sweden)
Bruce R. Levin
2017-02-01
Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.
Fu, Rao; Gong, Jun
2017-11-01
Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center
Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte
2006-01-01
Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865
Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra
2010-01-01
Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
International Nuclear Information System (INIS)
Noerholm, Mikkel; Balaj, Leonora; Limperg, Tobias; Salehi, Afshin; Zhu, Lin Dan; Hochberg, Fred H; Breakefield, Xandra O; Carter, Bob S; Skog, Johan
2012-01-01
RNA from exosomes and other microvesicles contain transcripts of tumour origin. In this study we sought to identify biomarkers of glioblastoma multiforme in microvesicle RNA from serum of affected patients. Microvesicle RNA from serum from patients with de-novo primary glioblastoma multiforme (N = 9) and normal controls (N = 7) were analyzed by microarray analysis. Samples were collected according to protocols approved by the Institutional Review Board. Differential expressions were validated by qRT-PCR in a separate set of samples (N = 10 in both groups). Expression profiles of microvesicle RNA correctly separated individuals in two groups by unsupervised clustering. The most significant differences pertained to down-regulated genes (121 genes > 2-fold down) in the glioblastoma multiforme patient microvesicle RNA, validated by qRT-PCR on several genes. Overall, yields of microvesicle RNA from patients was higher than from normal controls, but the additional RNA was primarily of size < 500 nt. Gene ontology of the down-regulated genes indicated these are coding for ribosomal proteins and genes related to ribosome production. Serum microvesicle RNA from patients with glioblastoma multiforme has significantly down-regulated levels of RNAs coding for ribosome production, compared to normal healthy controls, but a large overabundance of RNA of unknown origin with size < 500 nt
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.
1985-01-01
Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis
In silico modelling and analysis of ribosome kinetics and aa-tRNA competition
Bošnački, D.; Pronk, T.E.; de Vink, E.P.
2008-01-01
We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the
International Nuclear Information System (INIS)
Yang Yongmin; Barankiewicz, Teresa J.; He Mingyue; Taussig, Michael J.; Chen, Swey-Shen
2007-01-01
Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (Cκ) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or Cκ (3') were selected by anti-GFP or anti-Cκ antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins
DEFF Research Database (Denmark)
Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E
2015-01-01
Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...
Directory of Open Access Journals (Sweden)
Derek L Lindstrom
2011-03-01
Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.
Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin
2017-12-01
The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Energy Technology Data Exchange (ETDEWEB)
Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)
1991-11-01
This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.
Energy Technology Data Exchange (ETDEWEB)
Taylor, R.C.
1991-11-01
This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.
Energy Technology Data Exchange (ETDEWEB)
Wu, Ying [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan (China); Mao, Yingji [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); Jin, Shan; Hou, Jinyan; Du, Hua [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Yang, Minglei, E-mail: yml888@mail.ustc.edu.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Wu, Lifang, E-mail: lfwu@ipp.ac.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China)
2015-08-07
Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.
International Nuclear Information System (INIS)
Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang
2015-01-01
Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted
Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K
2014-07-08
Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.
Energy Technology Data Exchange (ETDEWEB)
Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)
2015-05-15
PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.
Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism
Directory of Open Access Journals (Sweden)
Deborah Chiabrando
2010-01-01
Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.
Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T
1998-09-25
A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.
Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad
2017-05-19
During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.
Energy Technology Data Exchange (ETDEWEB)
Yongmin, Yang [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Barankiewicz, Teresa J [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Mingyue, He [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Taussig, Michael J [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Chen, Swey-Shen [Institute of Genetics, San Diego, CA 92121-2233 (United States) and IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States)
2007-07-27
Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.
Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3
Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.
2003-01-01
The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...
The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel
DEFF Research Database (Denmark)
Wekselman, I.; Zimmerman, E.; Davidovich, C.
2017-01-01
in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...
Replication and meiotic transmission of yeast ribosomal RNA genes.
Brewer, B J; Zakian, V A; Fangman, W L
1980-11-01
The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.
Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.
Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C
2015-11-05
The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.
Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M
2004-12-01
Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.
International Nuclear Information System (INIS)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi
2016-01-01
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Energy Technology Data Exchange (ETDEWEB)
Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)
2016-04-22
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
A poly (U) polymerase in ribosome preparations from Ehrlich ascites tumor cells
International Nuclear Information System (INIS)
Guimaraes, R.C.; Bloch, D.P.
1981-01-01
A ribosome-bound poly (U) polymerase from Ehrlich ascites tumor cells is partially characterized. It adds UMPs to RNAs terminating in U-(3')-OH. The UMP-rich segments added reach average sizes of up to 18 nucleotides. CTP is strongly inhibitory to the enzyme. The main endogenous primers are low molecular weight RNAs which are found, after the addition of UMPs, mostly in the 6-8 S range. Some evidence suggests that a 5 S rRNA or polysome-associated 7 S RNA could be the main endogenous primers. (Author) [pt
Can we estimate bacterial growth rates from ribosomal RNA content?
Energy Technology Data Exchange (ETDEWEB)
Kemp, P.F.
1995-12-31
Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.
Directory of Open Access Journals (Sweden)
Jun-ichi Kakehi
Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.
Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W; Grubert, Fabian; Candille, Sophie I; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L; Tang, Hua; Ricci, Emiliano; Snyder, Michael P
2015-11-01
Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy--many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. © 2015 Cenik et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Timmerman Stephanie
2008-10-01
Full Text Available Abstract Background Regulating synthesis of the Fragile X gene (FMR1 product, FMRP alters neural plasticity potentially through its role in the microRNA pathway. Cap-dependent translation of the FMR1 mRNA, a process requiring ribosomal scanning through the 5' leader, is likely impeded by the extensive secondary structure generated by the high guanosine/cytosine nucleotide content including the CGG triplet nucleotide repeats in the 5' leader. An alternative mechanism to initiate translation – internal initiation often utilizes secondary structure to recruit the translational machinery. Consequently, studies were undertaken to confirm and extend a previous observation that the FMR1 5' leader contains an internal ribosomal entry site (IRES. Results Cellular transfection of a dicistronic DNA construct containing the FMR1 5' leader inserted into the intercistronic region yielded significant translation of the second cistron, but the FMR1 5' leader was also found to contain a cryptic promoter possibly confounding interpretation of these results. However, transfection of dicistronic and monocistronic RNA ex vivo or in vitro confirmed that the FMR1 5' leader contains an IRES. Moreover, inhibiting cap-dependent translation ex vivo did not affect the expression level of endogenous FMRP indicating a role for IRES-dependent translation of FMR1 mRNA. Analysis of the FMR1 5' leader revealed that the CGG repeats and the 5' end of the leader were vital for internal initiation. Functionally, exposure to potassium chloride or intracellular acidification and addition of polyinosinic:polycytidylic acid as mimics of neural activity and double stranded RNA, respectively, differentially affected FMR1 IRES activity. Conclusion Our results indicate that multiple stimuli influence IRES-dependent translation of the FMR1 mRNA and suggest a functional role for the CGG nucleotide repeats.
DEFF Research Database (Denmark)
Hansen, M.C.; Nielsen, A.K.; Molin, Søren
2001-01-01
obtained by these techniques are compared between experiments in which differences in growth rates, strains, or stress treatments occur, the normalization procedure may have a significant impact on the results. In this report we present a solution to the normalization problem in RNA slot blotting...... the relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell...... decreased to 30% in the course of the heat shock. This lowered ribosome level led to a decrease in the total RNA content, resulting in a gradually increasing overestimation of the mRNA levels throughout the experiment. Using renormalized cellular mRNA levels, the HrcA-mediated regulation of the genes...
Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.
Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J
2010-11-01
MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.
Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.
2014-01-01
The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
The flavoprotein Mcap0476 (RlmFO) catalyzes m5U1939 modification in Mycoplasma capricolum 23S rRNA
DEFF Research Database (Denmark)
Lartigue, Carole; Lebaudy, Anne; Blanchard, Alain
2014-01-01
Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl g...... specifically modifies m5U1939 in 23S rRNA, a conserved methylation catalyzed by AdoMet-dependent enzymes in all other characterized bacteria. The Mcap0476 methyltransferase (renamed RlmFO) represents the first folate-dependent flavoprotein seen to modify ribosomal RNA.......Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl...... group donor. One noteworthy exception is seen in some bacteria, where the conserved tRNA methylation at m5U54 is added by the enzyme TrmFO using flavin adenine dinucleotide together with N5,N10-methylenetetrahydrofolate as the one-carbon donor. The minimalist bacterium Mycoplasma capricolum possesses...
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun
2017-11-21
A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.
The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer
Directory of Open Access Journals (Sweden)
Shunfei Yan
2017-01-01
Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.
RNA Export through the NPC in Eukaryotes.
Okamura, Masumi; Inose, Haruko; Masuda, Seiji
2015-03-20
In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.
International Nuclear Information System (INIS)
Revenkova, E.; Masson, J.; Koncz, C.; Afsar, K.; Jakovleva, L.; Paszkowski, J.
1999-01-01
A recessive Arabidopsis mutant with elevated sensitivity to DNA damaging treatments was identified in one out of 800 families generated by T-DNA insertion mutagenesis. The T-DNA generated a chromosomal deletion of 1287 bp in the promoter of one of three S27 ribosomal protein genes (ARS27A) preventing its expression. Seedlings of ars27A developed normally under standard growth conditions, suggesting wildtype proficiency of translation. However, growth was strongly inhibited in media supplemented with methyl methane sulfate (MMS) at a concentration not affecting the wild type. This inhibition was accompanied by the formation of tumor–like structures instead of auxiliary roots. Wild-type seedlings treated with increasing concentrations of MMS up to a lethal dose never displayed such a trait, neither was this phenotype observed in ars27A plants in the absence of MMS or under other stress conditions. Thus, the hypersensitivity and tumorous growth are mutant-specific responses to the genotoxic MMS treatment. Another important feature of the mutant is its inability to perform rapid degradation of transcripts after UV treatment, as seen in wild-type plants. Therefore, we propose that the ARS27A protein is dispensable for protein synthesis under standard conditions but is required for the elimination of possibly damaged mRNA after UV irradiation. (author)
DEFF Research Database (Denmark)
Dam, M; Douthwaite, S; Tenson, T
1996-01-01
Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...
Kitamura, Masaru
2002-02-15
Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).
Advances in RNA Structure Determination | Center for Cancer Research
The recent years have witnessed a revolution in the field of RNA structure and function. Until recently the main contribution of RNA in cellular and disease functions was considered to be a role defined by the central dogma, namely DNA codes for mRNAs, which in turn encode for proteins, a notion facilitated by non-coding ribosomal RNA and tRNA. It was also assumed at the time
An exit cavity was crucial to the polymerase activity of the early ribosome.
Fox, George E; Tran, Quyen; Yonath, Ada
2012-01-01
The emergence of an RNA entity capable of synthesizing peptides was a key prebiotic development. It is hypothesized that a precursor of the modern ribosomal exit tunnel was associated with this RNA entity (e.g., "protoribosome" or "bonding entity") from the earliest time and played an essential role. Various compounds that can bind and activate amino acids, including extremely short RNA chains carrying amino acids, and possibly di- or tripeptides, would have associated with the internal cavity of the protoribosome. This cavity hosts the site for peptide bond formation and adjacent to it a relatively elongated feature that could have evolved to the modern ribosomal exit tunnel, as it is wide enough to allow passage of an oligopeptide. When two of the compounds carrying amino acids or di- or tripeptides (to which we refer, for simplicity, as small aminoacylated RNAs) were in proximity within the heart of the protoribosome, a peptide bond could form spontaneously. The growing peptide would enter the nearby cavity and would not disrupt the attachment of the substrates to the protoribosome or interfere with the subsequent attachment of additional small aminoacylated RNAs. Additionally, the presence of the peptide in the cavity would increase the lifetime of the oligopeptide in the protoribosome. Thus, subsequent addition of another amino acid would be more likely than detachment from the protoribosome, and synthesis could continue. The early ability to synthesize peptides may have resulted in an abbreviated RNA World.
Energy Technology Data Exchange (ETDEWEB)
Ekert, B; Giocanti, N [Institut du Radium, 91 - Orsay (France)
1977-04-01
Gamma irradiation of E.coli MRE 600 ribosomes in aqueous suspensions led to covalent linkages between the RNA and some ribosomal proteins. The presence of oxygen during the irradiation strongly inhibited this phenomenon. It appears clearly that only a few proteins were able to participate in these cross-linking reactions, which occurred simultaneously in the two sub-units. The radiochemical yield was determined at several concentrations and was relatively low.
Ribosomal elongation factor 4 promotes cell death associated with lethal stress.
Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin
2014-12-09
Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has
Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.
Directory of Open Access Journals (Sweden)
Elena eIlina
2013-07-01
Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.
Zhang, Yan; Hong, Samuel; Ruangprasert, Ajchareeya; Skiniotis, Georgios; Dunham, Christine M
2018-03-06
Structured mRNAs positioned downstream of the ribosomal decoding center alter gene expression by slowing protein synthesis. Here, we solved the cryo-EM structure of the bacterial ribosome bound to an mRNA containing a 3' stem loop that regulates translation. Unexpectedly, the E-site tRNA adopts two distinct orientations. In the first structure, normal interactions with the 50S and 30S E site are observed. However, in the second structure, although the E-site tRNA makes normal interactions with the 50S E site, its anticodon stem loop moves ∼54 Å away from the 30S E site to interact with the 30S head domain and 50S uL5. This position of the E-site tRNA causes the uL1 stalk to adopt a more open conformation that likely represents an intermediate state during E-site tRNA dissociation. These results suggest that structured mRNAs at the entrance channel restrict 30S subunit movement required during translation to slow E-site tRNA dissociation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi
2017-07-01
Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji
2007-01-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21
Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.
Cortes, Teresa; Cox, Robert Ashley
2015-04-01
Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.
Liphardt, J; Napthine, S; Kontos, H; Brierley, I
1999-05-07
RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those
Defining the bacteroides ribosomal binding site.
Wegmann, Udo; Horn, Nikki; Carding, Simon R
2013-03-01
The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.
Directory of Open Access Journals (Sweden)
Fucini Paola
2004-04-01
Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this rRNA
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B
1994-08-02
Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.
Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo
2016-09-27
Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.
Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo
2016-01-01
Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515
Structure of eEF3 and the mechanism of transfer RNA release from the E-site
DEFF Research Database (Denmark)
Andersen, Christian Brix Folsted; Becker, T.; Blau, M.
2006-01-01
Elongation factor eEF3 is an ATPase, which, in addition to the two canonical factors eEF1A and eEF2, serves an essential function in the translation cycle of fungi. eEF3 is required for the binding of the aatRNA-eEF1A-GTP ternary complex to the ribosomal A-site and has been suggested to facilitate...... the clearance of deacyl-tRNA from the E-site. Here, we present the crystal structure of eEF3 showing that it consists of an N-terminal HEAT repeat domain, followed by a four-helix bundle and two ABC-type ATPase domains with a chromo-domain inserted in ABC2. Moreover, we present the cryo-EM structure of the ATP......-bound form of eEF3 in complex with the post-translocational state 80S ribosome from yeast. eEF3 uses an entirely new factor binding site near the ribosomal E-site, with the chromodomain stabilizing the ribosomal L1 stalk in an open conformation, thus, allowing tRNA release....
Imaging of RNA in situ hybridization by atomic force microscopy
Kalle, W.H.J.; Macville, M.V.E.; van de Corput, M.P.C.; de Grooth, B.G.; Tanke, H.J.; Raap, A.K.
In this study we investigated the possibility of imaging internal cellular molecules after cytochemical detection with atomic force microscopy (AFM). To this end, rat 9G and HeLa cells were hybridized with haptenized probes for 28S ribosomal RNA, human elongation factor mRNA and cytomegalovirus
Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.
Ahuja, Richa; Kumar, Vijay
2017-07-01
RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.
International Nuclear Information System (INIS)
Takahashi, Noribumi; Takaiwa, Fumio; Fukuei, Keisuke; Sakamaki, Tadashi; Tanifuji, Shigeyuki
1977-01-01
Incorporation studies with 3 H-uridine or 3 H-adenosine showed that germinating pea embryos synthesize all types of poly A(+) RNA, rRNA and 4-5S RNA at the early stage of germination. After the pulse labeling for 30 min, only heterodisperse RNA and 4-5S RNA appeared in the cytoplasm as labeled RNA species. At this time the radioactivity was associated with cytoplasmic structures heavier than 80S and RNP particles of 68-70S, 52-55S, 36-38S and 20-22S which are presumed to be free mRNP particles in plants. When the pulse-labeled embryos were incubated for a further 60 min in an isotope-free medium, the labeled 17S and 25S rRNA emerged in the cytoplasm, together with labeled heterodisperse and 4-5S RNAs. More radioactivity accumulated in the regions of the polysome, 62-65S and 38-42S particles. The results of analysis of RNAs extracted from the whole cytoplasm, polysome or subribosomal fractions indicated that small subunits of newly formed ribosomes appear more rapidly in the cytoplasm than new large subunits, which accumulate for a while as free particles in the cytoplasm than are incorporated into polysomes. The actinomycin treatment which caused preferential inhibition of rRNA synthesis reduced the accumulation of free, newly formed ribosome subunits and partially permitted detection of the presumed mRNP particles in the subribosomal region even after the chase treatment. (auth.)
Huang, Shijie; Zhu, Xuechen; Melançon, Charles E
2016-01-15
The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.
Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette
2012-07-01
Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Cryo-EM structure of the E. coli translating ribosome in complex with SRP and its receptor
Estrozi, Leandro F.; Boehringer, Daniel; Shan, Shu-ou; Ban, Nenad; Schaffitzel, Christiane
2013-01-01
We report the early conformation of the E. coli signal recognition particle (SRP) and its receptor FtsY bound to the translating ribosome by cryo-electron microscopy. FtsY binds to the tetraloop of the SRP RNA whereas the NG-domains of the SRP protein and FtsY interact weakly in this conformation. Our results suggest that optimal positioning of the SRP RNA tetraloop and the Ffh NG-domain leads to FtsY recruitment. PMID:21151118
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
Recognition determinants for proteins and antibiotics within 23S rRNA
DEFF Research Database (Denmark)
Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup
1995-01-01
Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...
Energy Technology Data Exchange (ETDEWEB)
Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine
1930-06-16
The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.
Directory of Open Access Journals (Sweden)
Heather J Beck
Full Text Available Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs that contain a conventional untranslated leader and Shine-Dalgarno (SD sequence upstream of the gene's start codon while also containing an AUG triplet at the mRNA's 5'- terminus (5'-uAUG. Fusion of the coding sequence specified by the 5'-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5'-terminal upstream open reading frames (5'-uORFs tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5'-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5'-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5'-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5'-uORFs may play roles in downstream regulation. Since the 5'-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5'-uAUGs should be examined for their potential to function also as leaderless mRNAs.
2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.
Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D
2018-03-01
Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.
Weitemier, Kevin; Straub, Shannon C K; Fishbein, Mark; Liston, Aaron
2015-01-01
Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual's consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the "noncoding" ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming).
Energy Technology Data Exchange (ETDEWEB)
Rao, K.N.; Swaminathan, S.; Burley, S. K.
2008-12-11
We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.
Directory of Open Access Journals (Sweden)
Stefanie Gerstberger
2017-10-01
Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.
Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.
Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun
2018-05-03
The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.
Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos
DEFF Research Database (Denmark)
Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.
2006-01-01
Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...
Pakula, Kevin K; Hansen, Lykke H; Vester, Birte
2017-09-01
Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.
In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes
International Nuclear Information System (INIS)
Schubert, I.; Baeumlein, H.; Wobus, U.
1978-01-01
In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)
Czech Academy of Sciences Publication Activity Database
Krepl, Miroslav; Clery, A.; Blatter, M.; Allain, F.H.T.; Šponer, Jiří
2016-01-01
Roč. 44, č. 13 (2016), s. 6452-6470 ISSN 0305-1048 Institutional support: RVO:68081707 Keywords : molecular- dynamics simulations * particle mesh ewald * pre-ribosomal-rna Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016
Identifying and characterizing Hfq-RNA interactions.
Faner, M A; Feig, A L
2013-09-15
To regulate stress responses and virulence, bacteria use small regulatory RNAs (sRNAs). These RNAs can up or down regulate target mRNAs through base pairing by influencing ribosomal access and RNA decay. A large class of these sRNAs, called trans-encoded sRNAs, requires the RNA binding protein Hfq to facilitate base pairing between the regulatory RNA and its target mRNA. The resulting network of regulation is best characterized in Escherichia coli and Salmonella typhimurium, but the importance of Hfq dependent sRNA regulation is recognized in a diverse population of bacteria. In this review we present the approaches and methods used to discover Hfq binding RNAs, characterize their interactions and elucidate their functions. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
DEFF Research Database (Denmark)
Grankowski, N; Gasior, E; Issinger, O G
1993-01-01
Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...
Cross-species functionality of pararetroviral elements driving ribosome shunting.
Directory of Open Access Journals (Sweden)
Mikhail M Pooggin
Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.
Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.
Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J
2017-11-02
One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.
Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life
DEFF Research Database (Denmark)
Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J
2016-01-01
Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...
Directory of Open Access Journals (Sweden)
O’Farrell Heather C
2012-10-01
Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.
Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Garrett, R A
1981-01-01
The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry
DEFF Research Database (Denmark)
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-01-01
RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....
Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.
Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad
2018-04-20
Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Validation of two ribosomal RNA removal methods for microbial metatranscriptomics
Energy Technology Data Exchange (ETDEWEB)
He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip
2010-10-01
The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.
Hemmer, O; Greif, C; Dufourcq, P; Reinbolt, J; Fritsch, C
1995-01-10
Translation of tomato black ring virus (TBRV) RNA-1 in a rabbit reticulocyte lysate leads to the synthesis of a 250K polyprotein which cleaves itself into smaller proteins of 50, 60, 120, and 190K. Polypeptides synthesized from synthetic transcripts corresponding to different regions of TBRV RNA-1 are processed only when they encode the 23K protein delimited earlier by sequence homology with the cowpea mosaic virus 24K protease. The proteolytic activity of this protein is completely lost by mutating residues C170 (to I) or L188 (to H), residues which align with conserved residues of the viral serine-like proteases. The 120K protein is generated by cleavage of the dipeptide K/A localized in front of the VPg but is not further cleaved in vitro at the K/S site (at the C terminus of the VPg) or between the protease and polymerase domains. However, both the protein VPgProPol (120K) and the protein ProPol (117K) produced in vitro from synthetic transcripts can cleave in trans the RNA-2-encoded 150K polyprotein, but they cannot cleave in trans polypeptides containing a cleavage site expressed from RNA-1 transcripts in which the protease cistron is absent or modified.
Directory of Open Access Journals (Sweden)
Virginie Marcel
Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes
International Nuclear Information System (INIS)
Zhang, H.; Wang, J.C.; Liu, L.F.
1988-01-01
Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role
Directory of Open Access Journals (Sweden)
Jun-Jie Hong
Full Text Available The internal ribosomal entry site (IRES functions as cap-independent translation initiation sites in eukaryotic cells. IRES elements have been applied as useful tools for bi-cistronic expression vectors. Current RNA structure prediction programs are unable to predict precisely the potential IRES element. We have designed a viral IRES prediction system (VIPS to perform the IRES secondary structure prediction. In order to obtain better results for the IRES prediction, the VIPS can evaluate and predict for all four different groups of IRESs with a higher accuracy. RNA secondary structure prediction, comparison, and pseudoknot prediction programs were implemented to form the three-stage procedure for the VIPS. The backbone of VIPS includes: the RNAL fold program, aimed to predict local RNA secondary structures by minimum free energy method; the RNA Align program, intended to compare predicted structures; and pknotsRG program, used to calculate the pseudoknot structure. VIPS was evaluated by using UTR database, IRES database and Virus database, and the accuracy rate of VIPS was assessed as 98.53%, 90.80%, 82.36% and 80.41% for IRES groups 1, 2, 3, and 4, respectively. This advance useful search approach for IRES structures will facilitate IRES related studies. The VIPS on-line website service is available at http://140.135.61.250/vips/.
Directory of Open Access Journals (Sweden)
Yanan Sun
Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.
Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.
Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M
2018-06-08
Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2000-01-01
Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-02-01
We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.
Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M
2014-01-01
Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714
Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...
African Journals Online (AJOL)
Asdmin
2014-01-15
Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.
DEFF Research Database (Denmark)
Yadavalli, Srujana S; Ibba, Michael
2013-01-01
Mistranslation can follow two events during protein synthesis: production of non-cognate amino acid:transfer RNA (tRNA) pairs by aminoacyl-tRNA synthetases (aaRSs) and inaccurate selection of aminoacyl-tRNAs by the ribosome. Many aaRSs actively edit non-cognate amino acids, but editing mechanisms...
DEFF Research Database (Denmark)
Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios
2017-01-01
The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
Directory of Open Access Journals (Sweden)
Jun Yang
Full Text Available Ribosomes are large ribonucleoprotein complexes that are fundamental for protein synthesis. Ribosomes are ribozymes because their catalytic functions such as peptidyl transferase and peptidyl-tRNA hydrolysis depend on the rRNA. rRNA is a heterogeneous biopolymer comprising of at least 112 chemically modified residues that are believed to expand its topological potential. In the present study, we established a comprehensive modification profile of Saccharomyces cerevisiae's 18S and 25S rRNA using a high resolution Reversed-Phase High Performance Liquid Chromatography (RP-HPLC. A combination of mung bean nuclease assay, rDNA point mutants and snoRNA deletions allowed us to systematically map all ribose and base modifications on both rRNAs to a single nucleotide resolution. We also calculated approximate molar levels for each modification using their UV (254nm molar response factors, showing sub-stoichiometric amount of modifications at certain residues. The chemical nature, their precise location and identification of partial modification will facilitate understanding the precise role of these chemical modifications, and provide further evidence for ribosome heterogeneity in eukaryotes.
Exploiting Pre-rRNA Processing in Diamond Blackfan Anemia Gene Discovery and Diagnosis
Farrar, Jason E.; Quarello, Paola; Fisher, Ross; O’Brien, Kelly A.; Aspesi, Anna; Parrella, Sara; Henson, Adrianna L.; Seidel, Nancy E.; Atsidaftos, Eva; Prakash, Supraja; Bari, Shahla; Garelli, Emanuela; Arceci, Robert J.; Dianzani, Irma; Ramenghi, Ugo; Vlachos, Adrianna; Lipton, Jeffrey M.; Bodine, David M.; Ellis, Steven R.
2014-01-01
Diamond Blackfan anemia (DBA), a syndrome primarily characterized by anemia and physical abnormalities, is one among a group of related inherited bone marrow failure syndromes (IBMFS) which share overlapping clinical features. Heterozygous mutations or single-copy deletions have been identified in 12 ribosomal protein genes in approximately 60% of DBA cases, with the genetic etiology unexplained in most remaining patients. Unlike many IBMFS, for which functional screening assays complement clinical and genetic findings, suspected DBA in the absence of typical alterations of the known genes must frequently be diagnosed after exclusion of other IBMFS. We report here a novel deletion in a child that presented such a diagnostic challenge and prompted development of a novel functional assay that can assist in the diagnosis of a significant fraction of patients with DBA. The ribosomal proteins affected in DBA are required for pre-rRNA processing, a process which can be interrogated to monitor steps in the maturation of 40S and 60S ribosomal subunits. In contrast to prior methods used to assess pre-rRNA processing, the assay reported here, based on capillary electrophoresis measurement of the maturation of rRNA in pre-60S ribosomal subunits, would be readily amenable to use in diagnostic laboratories. In addition to utility as a diagnostic tool, we applied this technique to gene discovery in DBA, resulting in the identification of RPL31 as a novel DBA gene. PMID:25042156
Galbiati, Alice; Penzo, Marianna; Bacalini, Maria Giulia; Onofrillo, Carmine; Guerrieri, Ania Naila; Garagnani, Paolo; Franceschi, Claudio; Treré, Davide; Montanaro, Lorenzo
2017-06-06
The alterations of ribosome biogenesis and protein synthesis play a direct role in the development of tumors. The accessibility and transcription of ribosomal genes is controlled at several levels, with their epigenetic regulation being one of the most important. Here we explored the JmjC domain-containing histone demethylase 1B (JHDM1B) function in the epigenetic control of rDNA transcription. Since JHDM1B is a negative regulator of gene transcription, we focused on the effects induced by JHDM1B knock-down (KD). We studied the consequences of stable inducible JHDM1B silencing in cell lines derived from transformed and untransformed mammary epithelial cells. In these cellular models, prolonged JHDM1B downregulation triggered a surge of 45S pre-rRNA transcription and processing, associated with a re-modulation of the H3K36me2 levels at rDNA loci and with changes in DNA methylation of specific CpG sites in rDNA genes. We also found that after JHDM1B KD, cells showed a higher ribosome content: which were engaged in mRNA translation. JHDM1B KD and the consequent stimulation of ribosomes biogenesis conferred more aggressive features to the tested cellular models, which acquired a greater clonogenic, staminal and invasive potential. Taken together, these data indicate that the reduction of JHDM1B leads to a more aggressive cellular phenotype in mammary gland cells, by virtue of its negative regulatory activity on ribosome biogenesis.
Directory of Open Access Journals (Sweden)
Maria Augusta Dario
2017-07-01
Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to
Directory of Open Access Journals (Sweden)
Kevin Weitemier
2015-01-01
Full Text Available Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual’s consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%. Most nrDNA positions (91% were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the “noncoding” ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1994-01-01
The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...
International Nuclear Information System (INIS)
Stenger, Drake C.; French, Roy
2004-01-01
Helper component-proteinase (HC-Pro) of Wheat streak mosaic virus strain Sidney 81 (WSMV-Sidney 81) was systematically replaced with the corresponding cistron derived from four strains of WSMV (Type, TK1, CZ, and El Batan 3), the tritimovirus Oat necrotic mottle virus (ONMV), the rymoviruses Agropyron mosaic virus (AgMV) and Hordeum mosaic virus (HoMV), or the potyviruses Tobacco etch virus (TEV) and Turnip mosaic virus (TuMV). These HC-Pro proteins varied in amino acid sequence identity shared with HC-Pro of WSMV-Sidney 81 from high (strains of WSMV at ∼86-99%) to moderate (ONMV at 70%) to low (rymoviruses and potyviruses at ∼15-17%). Surprisingly, all chimeric viral genomes examined were capable of systemic infection of wheat upon inoculation with RNA transcripts produced in vitro. HC-Pro replacements derived from tritimoviruses did not alter host range relative to WSMV-Sidney 81, as each of these chimeric viruses was able to systemically infect wheat, oat, and corn line SDp2. These results indicate that differences in host range among tritimoviruses, including the inability of ONMV to infect wheat or the inability of WSMV strains Type and El Batan 3 to infect SDp2 corn, are not determined by HC-Pro. In contrast, all chimeric viruses bearing HC-Pro replacements derived from rymoviruses or potyviruses were unable to infect SDp2 corn and oat. Collectively, these results indicate that HC-Pro from distantly related virus species of the family Potyviridae are competent to provide WSMV-Sidney 81 with all functions necessary for infection of a permissive host (wheat) and that virus-host interactions required for systemic infection of oat and SDp2 corn are more stringent. Changes in symptom severity or mechanical transmission efficiency observed for some chimeric viruses further suggest that HC-Pro affects virulence in WSMV
DEFF Research Database (Denmark)
Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka
2012-01-01
additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....
Hsu, Yi-Feng; Chen, Yun-Chu; Hsiao, Yu-Chun; Wang, Bing-Jyun; Lin, Shih-Yun; Cheng, Wan-Hsing; Jauh, Guang-Yuh; Harada, John J; Wang, Co-Shine
2014-01-01
The Arabidopsis thaliana T-DNA insertion mutant rh57-1 exhibited hypersensitivity to glucose (Glc) and abscisic acid (ABA). The other two rh57 mutants also showed Glc hypersensitivity similar to rh57-1, strongly suggesting that the Glc-hypersensitive feature of these mutants results from mutation of AtRH57. rh57-1 and rh57-3 displayed severely impaired seedling growth when grown in Glc concentrations higher than 3%. The gene, AtRH57 (At3g09720), was expressed in all Arabidopsis organs and its transcript was significantly induced by ABA, high Glc and salt. The new AtRH57 belongs to class II DEAD-box RNA helicase gene family. Transient expression of AtRH57-EGFP (enhanced green fluorescent protein) in onion cells indicated that AtRH57 was localized in the nucleus and nucleolus. Purified AtRH57-His protein was shown to unwind double-stranded RNA independent of ATP in vitro. The ABA biosynthesis inhibitor fluridone profoundly redeemed seedling growth arrest mediated by sugar. rh57-1 showed increased ABA levels when exposed to high Glc. Quantitative real time polymerase chain reaction analysis showed that AtRH57 acts in a signaling network downstream of HXK1. A feedback inhibition of ABA accumulation mediated by AtRH57 exists within the sugar-mediated ABA signaling. AtRH57 mutation and high Glc conditions additively caused a severe defect in small ribosomal subunit formation. The accumulation of abnormal pre-rRNA and resistance to protein synthesis-related antibiotics were observed in rh57 mutants and in the wild-type Col-0 under high Glc conditions. These results suggested that AtRH57 plays an important role in rRNA biogenesis in Arabidopsis and participates in response to sugar involving Glc- and ABA signaling during germination and seedling growth. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
Directory of Open Access Journals (Sweden)
Kazuho Nishimura
2015-03-01
Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
Directory of Open Access Journals (Sweden)
Bai-Wei Gu
Full Text Available Dyskeratosis congenita (DC is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells
Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J
2015-01-01
Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human
Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos
2010-10-01
Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
DEFF Research Database (Denmark)
Skov, Vibe; Glintborg, Dorte; Knudsen, Steen
2008-01-01
indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...
Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.
Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I
2013-05-01
All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
A FYVE zinc finger domain protein specifically links mRNA transport to endosome trafficking.
Pohlmann, Thomas; Baumann, Sebastian; Haag, Carl; Albrecht, Mario; Feldbrügge, Michael
2015-05-18
An emerging theme in cellular logistics is the close connection between mRNA and membrane trafficking. A prominent example is the microtubule-dependent transport of mRNAs and associated ribosomes on endosomes. This coordinated process is crucial for correct septin filamentation and efficient growth of polarised cells, such as fungal hyphae. Despite detailed knowledge on the key RNA-binding protein and the molecular motors involved, it is unclear how mRNAs are connected to membranes during transport. Here, we identify a novel factor containing a FYVE zinc finger domain for interaction with endosomal lipids and a new PAM2-like domain required for interaction with the MLLE domain of the key RNA-binding protein. Consistently, loss of this FYVE domain protein leads to specific defects in mRNA, ribosome, and septin transport without affecting general functions of endosomes or their movement. Hence, this is the first endosomal component specific for mRNP trafficking uncovering a new mechanism to couple mRNPs to endosomes.
RNA precursor pool metabolism and RNA synthesis in X-irradiated Tetrahymena
International Nuclear Information System (INIS)
Stephens, R.E.; Paul, I.J.; Zimmerman, A.M.
1976-01-01
The incorporation of a radioactive RNA precursor ( 3 H-uridine) has been used in many studies as an index for measuring the synthesis of RNA, yet there is a distinct possibility that the results so obtained were significantly influenced by radiation-induced effects on the metabolism of this precursor into UTP (the primary immediate precursor of RNA) before its incorporation into RNA. A direct examination was therefore undertaken of the effects of X-irradiation on the metabolism of 3 H-uridine and its relationship to RNA synthesis as determined by incorporation. X-irradiation of logarithmically growing Tetrahymena pyriformis caused a dose-dependent depression of total cellular RNA synthesis. Ribosomal RNA (which comprises about 80 per cent of total cellular RNA) synthesis was also depressed by X-irradiation in a dose-dependent manner. Measurements of the levels of radioactivity present in the UTP precursor pool of both irradiated and unirradiated cells were obtained by means of DEAE-cellulose column chromatography of the extracted free nucleotides. Metabolism of 3 H-uridine into UMP, UDP and UTP was depressed by 40%, 26% and 27% respectively, whereas incorporation of 3 H-uridine into RNA was depressed by 77%. The results show that about one-third of the observed (apparent) depression in RNA synthesis was due to radiation-induced effects on the precursor pool, and the remaining two-thirds due to some definite effect of radiation at the transcription level leading to depressed synthesis of RNA. (U.K.)
DEFF Research Database (Denmark)
Porse, B T; Leviev, I; Mankin, A S
1998-01-01
A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...
Ribosomal Antibiotics: Contemporary Challenges
Directory of Open Access Journals (Sweden)
Tamar Auerbach-Nevo
2016-06-01
Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.
[Correlation between five RNA markers of rat's skin and PMI at different temperatures].
Pan, Hui; Zhang, Heng; Lü, Ye-hui; Ma, Jian-long; Ma, Kai-jun; Chen, Long
2014-08-01
To explore the correlation between postmortem interval (PMI) and five RNA markers of rat's skin--β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA(18S rRNA), 5S ribosomal RNA (5S rRNA), and microRNA-203 (miR-203), at different temperatures. Eighteen SD rats were randomly divided into three environmental temperature groups: 4 °C, 15 °C and 35 °C, respectively. Skin samples were taken at 11 time points from 0 h to 120 h post-mortem. The total RNA was extracted from the skin samples and the five RNA levels were detected by real-time fluorescent quantitative PCR. Proper internal reference was selected by geNorm software. Regression analysis of the RNA markers was conducted by GraphPad software. 5S rRNA and miR-203 were most suitable internal references. A good linear relationship between PMI and RNA levels (β-actin and GAPDH) was observed in two groups (4 °C and 15 °C), whereas the S type curve relationship between the expression levels of the two markers (β-actin and GAPDH) and PMI was observed in the 35 °C group. The partial linear relationship between 18S rRNA and PMI was observed in the groups (15 °C and 35 °C). Skin could be a suitable material for extracting RNA. The RNA expression levels of β-actin and GAPDH correlate well with PMI, and these RNA markers of skin tissue could be additional indice for the estimation of PMI.
Directory of Open Access Journals (Sweden)
Haiwei Cheng
Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.
RNase MRP and the RNA processing cascade in the eukaryotic ancestor.
Woodhams, Michael D; Stadler, Peter F; Penny, David; Collins, Lesley J
2007-02-08
Within eukaryotes there is a complex cascade of RNA-based macromolecules that process other RNA molecules, especially mRNA, tRNA and rRNA. An example is RNase MRP processing ribosomal RNA (rRNA) in ribosome biogenesis. One hypothesis is that this complexity was present early in eukaryotic evolution; an alternative is that an initial simpler network later gained complexity by gene duplication in lineages that led to animals, fungi and plants. Recently there has been a rapid increase in support for the complexity-early theory because the vast majority of these RNA-processing reactions are found throughout eukaryotes, and thus were likely to be present in the last common ancestor of living eukaryotes, herein called the Eukaryotic Ancestor. We present an overview of the RNA processing cascade in the Eukaryotic Ancestor and investigate in particular, RNase MRP which was previously thought to have evolved later in eukaryotes due to its apparent limited distribution in fungi and animals and plants. Recent publications, as well as our own genomic searches, find previously unknown RNase MRP RNAs, indicating that RNase MRP has a wide distribution in eukaryotes. Combining secondary structure and promoter region analysis of RNAs for RNase MRP, along with analysis of the target substrate (rRNA), allows us to discuss this distribution in the light of eukaryotic evolution. We conclude that RNase MRP can now be placed in the RNA-processing cascade of the Eukaryotic Ancestor, highlighting the complexity of RNA-processing in early eukaryotes. Promoter analyses of MRP-RNA suggest that regulation of the critical processes of rRNA cleavage can vary, showing that even these key cellular processes (for which we expect high conservation) show some species-specific variability. We present our consensus MRP-RNA secondary structure as a useful model for further searches.
Directory of Open Access Journals (Sweden)
Eric W. Triplett
2010-07-01
Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.
International Nuclear Information System (INIS)
Brooks, Allen F.; Vélez-Martínez, Carol S.; Hollis Showalter, H.D.; Garcia, George A.
2012-01-01
Highlights: ► Escherichia coli cells deficient in preQ 1 biosynthesis can utilize exogenous preQ 1 from growth media. ► Exogenous radiolabeled preQ 1 is incorporated into cellular RNA in both wild-type and preQ 1 deficient cells. ► Radiolabeled preQ 1 is incorporated into RNAs of differing sizes larger than tRNA. ► Analysis of isolated ribosomes shows that radiolabeled preQ 1 is incorporated into ribosomal RNA. ► The conclusion of this study is that queuine is incorporated into many other RNAs in addition to the known tRNAs. -- Abstract: There are over 100 modified bases that occur in RNA with the majority found in transfer RNA. It has been widely believed that the queuine modification is limited to four transfer RNA species in vivo. However, given the vast amount of the human genome (60–70%) that is transcribed into non-coding RNA (Mattick ), probing the presence of modified bases in these RNAs is of fundamental importance. The mechanism of incorporation of queuine, via transglycosylation, makes this uniquely poised to probe base modification in RNA. Results of incubations of Escherichia coli cell cultures with [ 3 H] preQ 1 (a queuine precursor in eubacteria) clearly demonstrate preQ 1 incorporation into a number of RNA species of various sizes larger than transfer RNA. Specifically, significant levels of preQ 1 incorporation into ribosomal RNA are observed. The modification of other large RNAs was also observed. These results confirm that non-coding RNAs contain modified bases and lead to the supposition that these modifications are necessary to control non-coding RNA structure and function as has been shown for transfer RNA.
Determination of low-energy structures of a small RNA hairpin using ...
Indian Academy of Sciences (India)
2012-06-25
Jun 25, 2012 ... such as water clusters, Argon clusters and different biomo- lecules. ... Keywords. Energy landscape; Monte Carlo; optimization; RNA; tertiary structure .... tui large ribosomal subunit (Residues 310–321, PDB ID: 1JJ2).
Profiling of Ribose Methylations in RNA by High-Throughput Sequencing
DEFF Research Database (Denmark)
Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Krogh, Nicolai
2015-01-01
(RiboMeth-seq) and its application to yeast ribosomes, presently the best-studied eukaryotic model system. We demonstrate detection of the known as well as new modifications, reveal partial modifications and unexpected communication between modification events, and determine the order of modification...... at several sites during ribosome biogenesis. Surprisingly, the method also provides information on a subset of other modifications. Hence, RiboMeth-seq enables a detailed evaluation of the importance of RNA modifications in the cells most sophisticated molecular machine. RiboMeth-seq can be adapted to other...
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.
Goldfarb, Katherine C; Cech, Thomas R
2017-01-01
MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.
Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert
2012-05-01
The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.
RNA Structural Dynamics As Captured by Molecular Simulations: A Comprehensive Overview
2018-01-01
With both catalytic and genetic functions, ribonucleic acid (RNA) is perhaps the most pluripotent chemical species in molecular biology, and its functions are intimately linked to its structure and dynamics. Computer simulations, and in particular atomistic molecular dynamics (MD), allow structural dynamics of biomolecular systems to be investigated with unprecedented temporal and spatial resolution. We here provide a comprehensive overview of the fast-developing field of MD simulations of RNA molecules. We begin with an in-depth, evaluatory coverage of the most fundamental methodological challenges that set the basis for the future development of the field, in particular, the current developments and inherent physical limitations of the atomistic force fields and the recent advances in a broad spectrum of enhanced sampling methods. We also survey the closely related field of coarse-grained modeling of RNA systems. After dealing with the methodological aspects, we provide an exhaustive overview of the available RNA simulation literature, ranging from studies of the smallest RNA oligonucleotides to investigations of the entire ribosome. Our review encompasses tetranucleotides, tetraloops, a number of small RNA motifs, A-helix RNA, kissing-loop complexes, the TAR RNA element, the decoding center and other important regions of the ribosome, as well as assorted others systems. Extended sections are devoted to RNA–ion interactions, ribozymes, riboswitches, and protein/RNA complexes. Our overview is written for as broad of an audience as possible, aiming to provide a much-needed interdisciplinary bridge between computation and experiment, together with a perspective on the future of the field. PMID:29297679
Directory of Open Access Journals (Sweden)
Teofânia HDA Vidigal
2001-07-01
Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.
Phan, Andy; Mailey, Katherine; Saeki, Jessica; Gu, Xiaobo; Schroeder, Susan J
2017-05-01
Accurate thermodynamic parameters improve RNA structure predictions and thus accelerate understanding of RNA function and the identification of RNA drug binding sites. Many viral RNA structures, such as internal ribosome entry sites, have internal loops and bulges that are potential drug target sites. Current models used to predict internal loops are biased toward small, symmetric purine loops, and thus poorly predict asymmetric, pyrimidine-rich loops with >6 nucleotides (nt) that occur frequently in viral RNA. This article presents new thermodynamic data for 40 pyrimidine loops, many of which can form UU or protonated CC base pairs. Uracil and protonated cytosine base pairs stabilize asymmetric internal loops. Accurate prediction rules are presented that account for all thermodynamic measurements of RNA asymmetric internal loops. New loop initiation terms for loops with >6 nt are presented that do not follow previous assumptions that increasing asymmetry destabilizes loops. Since the last 2004 update, 126 new loops with asymmetry or sizes greater than 2 × 2 have been measured. These new measurements significantly deepen and diversify the thermodynamic database for RNA. These results will help better predict internal loops that are larger, pyrimidine-rich, and occur within viral structures such as internal ribosome entry sites. © 2017 Phan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
High-throughput determination of RNA structure by proximity ligation.
Ramani, Vijay; Qiu, Ruolan; Shendure, Jay
2015-09-01
We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.
Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.
Directory of Open Access Journals (Sweden)
Tetsuro Kawano
Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.
Diversity of 23S rRNA genes within individual prokaryotic genomes.
Directory of Open Access Journals (Sweden)
Anna Pei
Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.
HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.
Filbin, Megan E; Kieft, Jeffrey S
2011-07-01
Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.
Directory of Open Access Journals (Sweden)
Noriko Umegaki-Arao
Full Text Available Karyopherin proteins mediate nucleocytoplasmic trafficking and are critical for protein and RNA subcellular localization. Recent studies suggest KPNA2 expression is induced in tumor cells and is strongly associated with prognosis, although the precise roles and mechanisms of KPNA2 overexpression in proliferative disorders have not been defined. We found that KPNA2 expression is induced in various proliferative disorders of the skin such as psoriasis, Bowen's disease, actinic keratosis, squamous cell carcinoma, Paget's disease, Merkel cell carcinoma, and mycosis fungoides. siRNA-mediated KPNA suppression revealed that KPNA2 is essential for significant suppression of HaCaT proliferation under starvation conditions. Ribosomal RNA transcription and protein synthesis were suppressed by starvation combined with knockdown of KPNA (including KPNA2 expression. KPNA2 localized to the nucleolus and interacted with proteins associated with mRNA processing, ribonucleoprotein complex biogenesis, chromatin modification, and transcription, as demonstrated by tandem affinity purification and mass spectrometry. KPNA2 may be an important promoter of ribosomal RNA and protein synthesis in tumor cells.
Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.
Liang, Xue-Hai; Crooke, Stanley T
2011-06-01
Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.
Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).
Douzery, E; Catzeflis, F M
1995-11-01
The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced
Porokhovnik, Lev N; Passekov, Vladimir P; Gorbachevskaya, Nataliya L; Sorokin, Alexander B; Veiko, Nataliya N; Lyapunova, Nataliya A
2015-04-01
Infantile autism and schizophrenia are severe multifactorial disorders with a pronounced genetic predisposition. Their pathogeneses are often associated with oxidative stress in the brain. Previously, we established that a cell's resistance to oxidative stress depended on the copy number of transcriptionally active genes for rRNA (ribosomal genes) in the cell's genome. The feature is measured cytogenetically in cultured lymphocytes derived from patients. It varies from 120 up to 190 copies per diploid genome, with an arithmetic mean of 150±4 (SE) copies in a healthy population (n=239), being considerably lower, according to our previous results, in a sample of patients with rheumatoid arthritis (n=49), another multifactorial disease with a proven significant role of oxidative stress in its pathogenesis: from 115 to 165 copies, with a mean of 140±4 (SE). Conversely, a sample of schizophrenic patients (n=42) previously showed a higher value of copy number of active rRNA genes compared with a healthy population: from 145 to 190 copies, with a mean of 170±4. This fact is of special interest in the context of the well-known, but still unexplained phenomenon of the reduced comorbidity rate of schizophrenia and rheumatoid arthritis. The copy number of active ribosomal genes was estimated in a sample of autistic children (n=51). In contrast with the schizophrenic patients studied previously, we found that the values were significantly lower than those in the healthy population: from 125 to 160 copies, with a mean of 142±5. In this work, we suggest a mathematical model of the oxidative stress dynamics on the basis of Lotka-Volterra's approach to predator-prey interactions. In our model, the 'prey' represents reactive oxygen species, whereas the 'predator' simulates molecules of the antioxidant enzymes. The rate of biosynthesis of the latter is limited by the number of ribosomes available, which, in turn, is determined by the copy number of active rRNA genes. Analysis of
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Raimondeau, Etienne; Bufton, Joshua C; Schaffitzel, Christiane
2018-06-19
Faulty mRNAs with a premature stop codon (PTC) are recognized and degraded by nonsense-mediated mRNA decay (NMD). Recognition of a nonsense mRNA depends on translation and on the presence of NMD-enhancing or the absence of NMD-inhibiting factors in the 3'-untranslated region. Our review summarizes our current understanding of the molecular function of the conserved NMD factors UPF3B and UPF1, and of the anti-NMD factor Poly(A)-binding protein, and their interactions with ribosomes translating PTC-containing mRNAs. Our recent discovery that UPF3B interferes with human translation termination and enhances ribosome dissociation in vitro , whereas UPF1 is inactive in these assays, suggests a re-interpretation of previous experiments and modification of prevalent NMD models. Moreover, we discuss recent work suggesting new functions of the key NMD factor UPF1 in ribosome recycling, inhibition of translation re-initiation and nascent chain ubiquitylation. These new findings suggest that the interplay of UPF proteins with the translation machinery is more intricate than previously appreciated, and that this interplay quality-controls the efficiency of termination, ribosome recycling and translation re-initiation. © 2018 The Author(s).
Czech Academy of Sciences Publication Activity Database
Mikulík, Karel; Bobek, Jan; Ziková, Alice; Smětáková, Magdalena; Bezoušková, Silvia
2011-01-01
Roč. 7, č. 3 (2011), s. 817-823 ISSN 1742-206X R&D Projects: GA ČR GAP302/10/0468; GA ČR GA303/09/0475; GA ČR GA310/07/1009; GA AV ČR(CZ) IAA500110805 Institutional research plan: CEZ:AV0Z50200510 Keywords : ESCHERICHIA-COLI RIBOSOME * ELONGATION-FACTOR-G * MESSENGER-RNA Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2011
Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting
2017-03-17
The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Quantitative analysis of ribosome–mRNA complexes at different translation stages
Shirokikh, Nikolay E.; Alkalaeva, Elena Z.; Vassilenko, Konstantin S.; Afonina, Zhanna A.; Alekhina, Olga M.; Kisselev, Lev L.; Spirin, Alexander S.
2010-01-01
Inhibition of primer extension by ribosome–mRNA complexes (toeprinting) is a proven and powerful technique for studying mechanisms of mRNA translation. Here we have assayed an advanced toeprinting approach that employs fluorescently labeled DNA primers, followed by capillary electrophoresis utilizing standard instruments for sequencing and fragment analysis. We demonstrate that this improved technique is not merely fast and cost-effective, but also brings the primer extension inhibition method up to the next level. The electrophoretic pattern of the primer extension reaction can be characterized with a precision unattainable by the common toeprint analysis utilizing radioactive isotopes. This method allows us to detect and quantify stable ribosomal complexes at all stages of translation, including initiation, elongation and termination, generated during the complete translation process in both the in vitro reconstituted translation system and the cell lysate. We also point out the unique advantages of this new methodology, including the ability to assay sites of the ribosomal complex assembly on several mRNA species in the same reaction mixture. PMID:19910372
Soysa, Radika; Tran, Khoa D; Ullman, Buddy; Yates, Phillip A
2015-12-01
We have designed a novel series of integrating ribosomal RNA promoter vectors with five incrementally different constitutive expression profiles, covering a 250-fold range. Differential expression was achieved by placing different combinations of synthetic or leishmanial DNA sequences upstream and downstream of the transgene coding sequence in order to modulate pre-mRNA processing efficiency and mRNA stability, respectively. All of the vectors have extensive multiple cloning sites, and versions are available for producing N- or C- terminal GFP fusions at each of the possible relative expression levels. In addition, the modular configuration of the vectors allows drug resistance cassettes and other components to be readily exchanged. In toto, these vectors should be useful additions to the toolkit available for molecular and genetic studies of Leishmania donovani. Copyright © 2016 Elsevier B.V. All rights reserved.
Onouchi, Hitoshi; Nagami, Yoko; Haraguchi, Yuhi; Nakamoto, Mari; Nishimura, Yoshiko; Sakurai, Ryoko; Nagao, Nobuhiro; Kawasaki, Daisuke; Kadokura, Yoshitomo; Naito, Satoshi
2005-01-01
Expression of the Arabidopsis CGS1 gene that codes for cystathionine γ-synthase is feedback regulated at the step of mRNA stability in response to S-adenosyl-L-methionine (AdoMet). A short stretch of amino acid sequence, called the MTO1 region, encoded by the first exon of CGS1 itself is involved in this regulation. Here, we demonstrate, using a cell-free system, that AdoMet induces temporal translation elongation arrest at the Ser-94 codon located immediately downstream of the MTO1 region, by analyzing a translation intermediate and performing primer extension inhibition (toeprint) analysis. This translation arrest precedes the formation of a degradation intermediate of CGS1 mRNA, which has its 5′ end points near the 5′ edge of the stalled ribosome. The position of ribosome stalling also suggests that the MTO1 region in nascent peptide resides in the ribosomal exit tunnel when translation elongation is temporarily arrested. In addition to the MTO1 region amino acid sequence, downstream Trp-93 is also important for the AdoMet-induced translation arrest. This is the first example of nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in eukaryotes. Furthermore, our data suggest that the ribosome stalls at the step of translocation rather than at the step of peptidyl transfer. PMID:16027170
Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming
2017-01-01
Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae . In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7 , several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741( yrr1 Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1 , and SNQ2 , as well as the RNA helicase gene DBP2 , increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1 Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing.
Directory of Open Access Journals (Sweden)
Luis G Morello
Full Text Available NIP7 is one of the many trans-acting factors required for eukaryotic ribosome biogenesis, which interacts with nascent pre-ribosomal particles and dissociates as they complete maturation and are exported to the cytoplasm. By using conditional knockdown, we have shown previously that yeast Nip7p is required primarily for 60S subunit synthesis while human NIP7 is involved in the biogenesis of 40S subunit. This raised the possibility that human NIP7 interacts with a different set of proteins as compared to the yeast protein. By using the yeast two-hybrid system we identified FTSJ3, a putative ortholog of yeast Spb1p, as a human NIP7-interacting protein. A functional association between NIP7 and FTSJ3 is further supported by colocalization and coimmunoprecipitation analyses. Conditional knockdown revealed that depletion of FTSJ3 affects cell proliferation and causes pre-rRNA processing defects. The major pre-rRNA processing defect involves accumulation of the 34S pre-rRNA encompassing from site A' to site 2b. Accumulation of this pre-rRNA indicates that processing of sites A0, 1 and 2 are slower in cells depleted of FTSJ3 and implicates FTSJ3 in the pathway leading to 18S rRNA maturation as observed previously for NIP7. The results presented in this work indicate a close functional interaction between NIP7 and FTSJ3 during pre-rRNA processing and show that FTSJ3 participates in ribosome synthesis in human cells.
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh
2013-08-01
The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.
Directory of Open Access Journals (Sweden)
Chenyu Zhang
2009-05-01
Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial
RNA secondary structure diagrams for very large molecules: RNAfdl
DEFF Research Database (Denmark)
Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E.
2013-01-01
There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10 3 bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments...
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
A FYVE zinc finger domain protein specifically links mRNA transport to endosome trafficking
Pohlmann, Thomas; Baumann, Sebastian; Haag, Carl; Albrecht, Mario; Feldbrügge, Michael
2015-01-01
An emerging theme in cellular logistics is the close connection between mRNA and membrane trafficking. A prominent example is the microtubule-dependent transport of mRNAs and associated ribosomes on endosomes. This coordinated process is crucial for correct septin filamentation and efficient growth of polarised cells, such as fungal hyphae. Despite detailed knowledge on the key RNA-binding protein and the molecular motors involved, it is unclear how mRNAs are connected to membranes during transport. Here, we identify a novel factor containing a FYVE zinc finger domain for interaction with endosomal lipids and a new PAM2-like domain required for interaction with the MLLE domain of the key RNA-binding protein. Consistently, loss of this FYVE domain protein leads to specific defects in mRNA, ribosome, and septin transport without affecting general functions of endosomes or their movement. Hence, this is the first endosomal component specific for mRNP trafficking uncovering a new mechanism to couple mRNPs to endosomes. DOI: http://dx.doi.org/10.7554/eLife.06041.001 PMID:25985087
MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.
Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier
2016-10-25
MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.
Chromosomal stasis in distinct families of marine Percomorpharia from South Atlantic.
Paim, Fabilene Gomes; Almeida, Leandro Aragão da Hora; Affonso, Paulo Roberto Antunes de Mello; Sobrinho-Scudeler, Patrícia Elda; Oliveira, Claudio; Diniz, Débora
2017-01-01
The weakness of physical barriers in the marine environment and the dispersal potential of fish populations have been invoked as explanations of the apparent karyotype stasis of marine Percomorpha, but several taxa remain poorly studied cytogenetically. To increase the chromosomal data in this fish group, we analyzed cytogenetically three widespread Atlantic species from distinct families: Chaetodipterus faber Broussonet, 1782 (Ephippidae), Lutjanus synagris Linnaeus, 1758 (Lutjanidae) and Rypticus randalli Courtenay, 1967 (Serranidae). The three species shared a karyotype composed of 2n=48 acrocentric chromosomes, single nucleolus organizer regions (NORs) and reduced amounts of centromeric heterochromatin. A single NOR-bearing pair was identified in all species by physical mapping of 18S rDNA while non-syntenic 5S rRNA genes were located at centromeric region of a single pair. The similar karyotypic macrostructure observed in unrelated groups of Percomorpharia reinforces the conservative karyoevolution of marine teleosteans. Nonetheless, the species could be differentiated based on the pair bearing ribosomal cistrons, revealing the importance of microstructural analyses in species with symmetric and stable karyotypes.