On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1982-01-01
The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
International Nuclear Information System (INIS)
Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.
1977-01-01
The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...
DEFF Research Database (Denmark)
Grankowski, N; Gasior, E; Issinger, O G
1993-01-01
Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...
Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.
Directory of Open Access Journals (Sweden)
Elena eIlina
2013-07-01
Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.
Protein-protein interactions within late pre-40S ribosomes.
Directory of Open Access Journals (Sweden)
Melody G Campbell
2011-01-01
Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1993-01-01
RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....
Time of action of 4.5 S RNA in Escherichia coli translation
DEFF Research Database (Denmark)
Brown, S
1989-01-01
A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M
2014-08-01
5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
International Nuclear Information System (INIS)
Nowotny, V.; Nierhaus, K.H.
1988-01-01
A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains
Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S
2008-07-01
Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice
Czech Academy of Sciences Publication Activity Database
Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.
2016-01-01
Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016
Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation
International Nuclear Information System (INIS)
Terao, K.; Uchiumi, T.; Ogata, K.
1980-01-01
After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)
Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering
International Nuclear Information System (INIS)
Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.
1981-01-01
The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)
Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G
1979-01-01
The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.
Subcellular localization of Bombyx mori ribosomal protein S3a and ...
African Journals Online (AJOL)
USER
2010-04-05
Apr 5, 2010 ... In the present study, using a BV/PH-Bms3a-EGFP, we found that Bombyx mori ribosomal protein S3a. (BmS3a) with EGFP fused to its C-terminal, was predominantly localized in the cytoplasm of B. mori cells. Subsequently, to investigate the effect of BmS3a over-expression on BmNPV infection both at the.
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9
Directory of Open Access Journals (Sweden)
Arava Yoav
2007-08-01
Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
[Family of ribosomal proteins S1 contains unique conservative domain].
Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N
2010-01-01
Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.
Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel
2003-08-01
Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
Distribution of protein and RNA in the 30S ribosomal subunit
International Nuclear Information System (INIS)
Ramakrishnan, V.
1986-01-01
In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms
International Nuclear Information System (INIS)
Oesterberg, R.; Garrett, A.
1977-01-01
The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de
Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong
2016-03-01
Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1997-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1998-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip
2018-04-21
Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.
Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian
2016-01-01
Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.
Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering
International Nuclear Information System (INIS)
Burkhardt, N.
1997-01-01
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de
Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Garrett, R A
1981-01-01
The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
International Nuclear Information System (INIS)
Heidenreich, K.A.; Toledo, S.P.
1989-01-01
As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons
International Nuclear Information System (INIS)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi
2016-01-01
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Energy Technology Data Exchange (ETDEWEB)
Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)
2016-04-22
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
International Nuclear Information System (INIS)
Szyszka, Ryszard; Boguszewska, Aleksandra; Grankowski, Nikodem; Shugar, David
1996-01-01
Several halogeno benzimidazoles and 2-azabenzimidazoles, previously shown to be relatively selective inhibitors of protein kinases CK-I and/or CK-II from various sources, including CK-II from yeast [Szyszka et al. (1995) Biochem. Biophys. Res. Commun. 208, 418-424] inhibit also the yeast ribosomal protein kinase PK60S. The most effective inhibitor of CK-II and PK60S was tetrabromo-2-azabenzimidazole (TetraBr-2-azaBz), which was competitive with respect to ATP (and GTP in the case of CK-II) with K i values of 0.7 μM for CK-II, and 0.1 μM for PK60S. PK60S phosphorylates only three (YP1β, YB1β', YP2α) out of five polypeptides of pp13 kDa acidic proteins of 60S subunit phosphorylated by CK-II [Szyszka et al. (1995) Acta Biochim. Polon. 42, 357-362]. Accordingly, TetraBr-azaBz inhibits phosphorylation only of these polypeptides, catalysed by PK60S. Addition of TetraBr-2Bz to cultures of yeast cells, at concentrations which were without effect on cell growth, led to inhibition of intracellular phosphorylation of ribosomal acidic proteins, paralleling that observed ''in vitro''. TetraBr-2-azaBz is shown to be a useful tool for studies on the intracellular regulation of phosphorylation of the ribosomal 60S acidic proteins, which are involved in formation of active ribosomes. (author). 36 refs, 4 figs, 2 tabs
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Kamina, Anyango D; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
Sequence of a cloned cDNA encoding human ribosomal protein S11
Energy Technology Data Exchange (ETDEWEB)
Lott, J B; Mackie, G A
1988-02-11
The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Seema Dharni
2014-01-01
Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.
Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro
2014-11-01
Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.
Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle
Energy Technology Data Exchange (ETDEWEB)
Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)
1976-01-01
An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
International Nuclear Information System (INIS)
Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim
2005-01-01
Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs
Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.
Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel
2007-12-07
The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.
Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro
2016-08-26
Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Globular conformation of some ribosomal proteins in solution
International Nuclear Information System (INIS)
Serdyuk, I.N.; Spirin, A.S.
1978-01-01
The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)
The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.
MacConnell, W P; Kaplan, N O
1982-05-25
The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-01-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...
Directory of Open Access Journals (Sweden)
Andrea Ciammaruconi
2008-01-01
Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.
Architecture of the E.coli 70S ribosome
DEFF Research Database (Denmark)
Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.
1997-01-01
The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...
Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D
2017-01-01
Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.
Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad
2017-02-15
Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli
2017-05-27
Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.
Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad
2017-07-05
The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
International Nuclear Information System (INIS)
Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan
2013-01-01
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit
International Nuclear Information System (INIS)
Otaka, E.; Kobata, K.
1978-01-01
The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de
Maeda, Yasuo
2015-02-10
Apoptosis (programmed cell death) is regarded as ultimate differentiation of the cell. We have recently demonstrated that a targeted delivery of Dd-MRP4 (Dictyostelium mitochondrial ribosomal protein S4) suppresses specifically the proliferation of the human cancer cells, by inducing their apoptotic cell death (Chida et al., 2014, doi:10.1186/1475-2867-14-56). This amazing fact was discovered, simply based on the finding that Dd-MRP4 expression is absolutely required for transition of Dictyostelium cells from growth to differentiation (Chida et al., 2008, doi:10.1186/1471-2156-9-25; Maeda et al., 2013, doi:10.3390/biom3040943). Dd-MRP4 protein has quite unique structural characters, in that it is highly basic (pI: about 11.5) and interestingly has several nuclear-localization signals within the molecule. In this review, we introduce briefly the efficacy of several apoptosis-inducing substances reported thus far for cancer therapy, and speculate the possible mechanisms, by which apoptosis is specifically induced by Dd-MRP4, on the basis of its structural uniqueness. We also discuss several issues to be solved for the medical application of ectopically expressed Dd-MRP4 in human cancer cells.
Energy Technology Data Exchange (ETDEWEB)
Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)
2013-11-15
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.
International Nuclear Information System (INIS)
Ahn, Eun Hee; Kim, Dae Won; Kang, Hye Won; Shin, Min Jae; Won, Moo Ho; Kim, Joon; Kim, Dong Joon; Kwon, Oh-Shin; Kang, Tae-Cheon; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young
2010-01-01
This study investigated the preventive effect of ribosomal protein S3 (rpS3) on 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema in mice. A cell permeable expression vector PEP-1-rpS3 was constructed. Topical application of the vector markedly inhibited TPA-induced expression levels of cyclooxygenase-2 (COX-2) and pro-inflammatory cytokines. Application of PEP-1-rpS3 also resulted in a significant reduction in the activation of nuclear factor-kappa B (NF-kB) and mitogen-activated protein kinase (MAPK) in TPA-treated ears. These results indicate that PEP-1-rpS3 inhibits inflammatory response cytokines and enzymes by blocking NF-kB and MAPK, prompting the suggestion that PEP-1-rpS3 can be used as a therapeutic agent against skin inflammation.
Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio
2016-04-15
We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.
Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R
2014-10-14
Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.
Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R
2012-12-14
Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.
Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.
2015-01-01
We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways
Galián, J A; Rosato, M; Rosselló, J A
2012-06-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
International Nuclear Information System (INIS)
Timmins, P.A.; Langowski, J.; Brown, R.S.
1988-01-01
The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-05-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria
2017-12-01
In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.
Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad
2016-01-14
Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.
Directory of Open Access Journals (Sweden)
Gisela Pöll
Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.
Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard
2015-04-07
During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.
Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S
2004-12-01
The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome
Directory of Open Access Journals (Sweden)
Jendrik Hentschel
2017-07-01
Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Directory of Open Access Journals (Sweden)
Brittany Burton
Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.
Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.
Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad
2015-04-17
Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.
Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen
2017-01-01
Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of
Directory of Open Access Journals (Sweden)
Mikael S Lindström
Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.
Directory of Open Access Journals (Sweden)
Jun-ichi Kakehi
Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.
Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette
2012-07-01
Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
DEFF Research Database (Denmark)
Tchórzewski, M; Boldyreff, B; Issinger, O
2000-01-01
The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...
International Nuclear Information System (INIS)
Gorelic, L.; Parker, D.
1978-01-01
The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage
Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?
DEFF Research Database (Denmark)
Christiansen, J; Douthwaite, S R; Christensen, A
1985-01-01
Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...
Ribosomal history reveals origins of modern protein synthesis.
Directory of Open Access Journals (Sweden)
Ajith Harish
Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto
2011-01-01
Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Sequence analysis and over-expression of ribosomal protein S28 ...
African Journals Online (AJOL)
RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...
Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.
Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera
2017-01-23
Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental
Kashuba, Elena
2015-05-12
We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways that control cell proliferation, oxidative phosphorylation, cellular respiration, and other redox reactions were activated in the immortalized cells. Here we report that, upon overexpression of S18-2 protein, primary rat skin fibroblasts underwent cell transformation. Cells passed more than 300 population doublings, and two out of three tested clones gave rise to tumors in experimental animals. Transformed cells showed anchorage-independent growth and loss of contact inhibition; they expressed epithelial markers, such as E-cadherin and β-catenin. Transformed cells showed increased telomerase activity, disturbance of the cell cycle, and chromosomal instability. Taken together, our data suggest that S18-2 is a newly identified oncoprotein that may be involved in cancerogenesis.
Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad
2013-01-01
Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461
Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.
Directory of Open Access Journals (Sweden)
Harry F Heijnen
Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.
Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli
DEFF Research Database (Denmark)
Brown, S
1987-01-01
A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae
Directory of Open Access Journals (Sweden)
Victor Manuel Gomez-Rodriguez
2013-08-01
Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
International Nuclear Information System (INIS)
Buck, M.; Cooperman, B.S.
1990-01-01
In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7
Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki
2013-08-01
Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.
Neutron scattering and the 30 S ribosomal subunit of E. coli
International Nuclear Information System (INIS)
Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.
1982-01-01
This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures
Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O
1995-01-01
Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
DEFF Research Database (Denmark)
Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S
2009-01-01
Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....
Spirin, Alexander S
2009-11-17
A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Rebalance between 7S and 11S globulins in soybean seeds of differing protein content and 11SA4.
Yang, A; Yu, X; Zheng, A; James, A T
2016-11-01
Protein content and globulin subunit composition of soybean seeds affect the quality of soy foods. In this proteomic study, the protein profile of soybean seeds with high (∼45.5%) or low (∼38.6%) protein content and with or without the glycinin (11S) subunit 11SA4 was examined. 44 unique proteins and their homologues were identified and showed that both protein content and 11SA4 influenced the abundance of a number of proteins. The absence of 11SA4 exerted a greater impact than the protein content, and led to a decreased abundance of glycinin G2/A2B1 and G5/A5A4B3 subunits, which resulted in lower total 11S with a concomitant higher total β-conglycinin (7S). Low protein content was associated with higher glycinin G3/A1aB1b and lower glycinin G4/A5A4B3. Using the proteomic approach, it was demonstrated that 11SA4 deficiency induced compensatory accumulation of 7S globulins and led to a similar total abundance for 7S+11S irrespective of protein content or 11SA4. Copyright © 2016 Elsevier Ltd. All rights reserved.
The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.
Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim
2012-10-01
YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.
Recognition determinants for proteins and antibiotics within 23S rRNA
DEFF Research Database (Denmark)
Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup
1995-01-01
Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans.
Chowdhury, Tahmeena; Köhler, Julia R
2015-10-01
TOR and PKA signaling pathways control eukaryotic cell growth and proliferation. TOR activity in model fungi, such as Saccharomyces cerevisiae, responds principally to nutrients, e.g., nitrogen and phosphate sources, which are incorporated into the growing cell mass; PKA signaling responds to the availability of the cells' major energy source, glucose. In the fungal commensal and pathogen, Candida albicans, little is known of how these pathways interact. Here, the signal from phosphorylated ribosomal protein S6 (P-S6) was defined as a surrogate marker for TOR-dependent anabolic activity in C. albicans. Nutritional, pharmacologic and genetic modulation of TOR activity elicited corresponding changes in P-S6 levels. The P-S6 signal corresponded to translational activity of a GFP reporter protein. Contributions of four PKA pathway components to anabolic activation were then examined. In high glucose concentrations, only Tpk2 was required to upregulate P-S6 to physiologic levels, whereas all four tested components were required to downregulate P-S6 in low glucose. TOR was epistatic to PKA components with respect to P-S6. In many host niches inhabited by C. albicans, glucose is scarce, with protein being available as a nitrogen source. We speculate that PKA may modulate TOR-dependent cell growth to a rate sustainable by available energy sources, when monomers of anabolic processes, such as amino acids, are abundant. © 2015 John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Issinger, O G; Beier, H; Speichermann, N
1980-01-01
Phosphorylation of eukaryotic ribosomal proteins in vitro by essentially homogeneous preparations of cyclic AMP-dependent protein kinase catalytic subunit and cyclic GMP-dependent protein kinase was compared. Each protein kinase was added at a concentration of 30nM. Ribosomal proteins were...... by the cyclic AMP-dependent enzyme. Between 0.1 and 0.2 mol of phosphate was incorporated/mol of these phosphorylated proteins. With the exception of protein S7, the same proteins were also major substrates for the cyclic GMP-dependent protein kinase. Time courses of the phosphorylation of individual proteins...... from the small and large ribosomal subunits in the presence of either protein kinase suggested four types of phosphorylation reactions: (1) proteins S2, S10 and L5 were preferably phosphorylated by the cyclic GMP-dependent protein kinase; (2) proteins S3 and L6 were phosphorylated at very similar rates...
Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun
2016-07-01
Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.
Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA
International Nuclear Information System (INIS)
Hirose, Yutaka; Harada, Fumio
2008-01-01
4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus
International Nuclear Information System (INIS)
Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya
2013-01-01
Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of
Cukras, Anthony R; Green, Rachel
2005-05-27
The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.
Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...
Martínez, Fernando; Daròs, José-Antonio
2014-09-01
The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly
Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu
2016-10-01
Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K
2014-07-08
Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.
Directory of Open Access Journals (Sweden)
Savinska L. O.
2015-08-01
Full Text Available Aim. Generation of polyclonal antibodies specific to the ribosomal protein S6 kinase isoform – p85S6K1 and directed to the N-terminal (1–23 aa extension of p85S6K1. Methods. Animal immunization with synthetic (1–23 aa peptide, ELISA, Western blot, Immunoprecipitation, immunofluorescent analysis. Results. Polyclonal antibodies have been generated, which specifically recognize only p85 but not p70 isoform of S6K1 in western blot, immunoprecipitation and immunofluorescence analysis. Conclusions. The obtained antibodies can be recommended for studies on the p85S6K1 and other S6K1 isoforms possessing the N-terminal extension – the identification of binding protein partners, analysis of subcellular localization under different physiological conditions, elucidation of the signal transduction pathways involving different S6K1 isoforms.
Directory of Open Access Journals (Sweden)
Kazuho Nishimura
2015-03-01
Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)
2015-09-18
The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Epstein-Barr virus-encoded EBNA-5 binds to Epstein-Barr virus-induced Fte1/S3a protein
International Nuclear Information System (INIS)
Kashuba, Elena; Yurchenko, Mariya; Szirak, Krisztina; Stahl, Joachim; Klein, George; Szekely, Laszlo
2005-01-01
Epstein-Barr virus (EBV) transforms resting human B cells into immortalized immunoblasts. EBV-encoded nuclear antigens EBNA-5 (also called EBNA-LP) is one of the earliest viral proteins expressed in freshly infected B cells. We have recently shown that EBNA-5 binds p14ARF, a nucleolar protein that regulates the p53 pathway. Here, we report the identification of another protein with partially nucleolar localization, the v-fos transformation effector Fte-1 (Fte-1/S3a), as an EBNA-5 binding partner. In transfected cells, Fte-1/S3a and EBNA-5 proteins showed high levels of colocalization in extranucleolar inclusions. Fte-1/S3a has multiple biological functions. It enhances v-fos-mediated cellular transformation and is part of the small ribosomal subunit. It also interacts with the transcriptional factor CHOP and apoptosis regulator poly(ADP-ribose) polymerase (PARP). Fte-1/S3a is regularly expressed at high levels in both tumors and cancer cell lines. Its high expression favors the maintenance of malignant phenotype and undifferentiated state, whereas its down-regulation is associated with cellular differentiation and growth arrest. Here, we show that EBV-induced B cell transformation leads to the up-regulation of Fte-1/S3a. We suggest that EBNA-5 through binding may influence the growth promoting, differentiation inhibiting, or apoptosis regulating functions of Fte-1/S3a
Directory of Open Access Journals (Sweden)
Ruilin Wang
Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.
DEFF Research Database (Denmark)
Douthwaite, S; Powers, T; Lee, J Y
1989-01-01
The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J
1999-11-19
4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.
Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R
2008-02-22
The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.
Directory of Open Access Journals (Sweden)
Igor Ruvinsky
Full Text Available BACKGROUND: Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-, are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. METHODOLOGY/PRINCIPAL FINDINGS: A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/- muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG in the muscle. CONCLUSIONS/SIGNIFICANCE: This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar
Directory of Open Access Journals (Sweden)
Carlos Alexandre Fernandes
2006-01-01
Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.
Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia
2016-10-01
Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.
2011-07-01
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.
Energy Technology Data Exchange (ETDEWEB)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)
2011-07-15
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.
Directory of Open Access Journals (Sweden)
Bani Kumar Pathak
Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.
The Р60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alternative mRNA translation
Directory of Open Access Journals (Sweden)
I. V. Zaiets
2018-07-01
Full Text Available Ribosomal protein S6 kinase 1 (S6K1 is a well-known downstream effector of mTORC1 (mechanistic target of rapamycin complex 1 participating primarily in the regulation of cell growth and metabolism. Deregulation of mTOR/S6K1 signaling can promote numerous human pathologies, including cancer, neurodegeneration, cardiovascular disease, and metabolic disorders. As existing data suggest, the S6K1 gene encodes several protein isoforms, including p85-S6K1, p70-S6K1, and p60-S6K1. The two of these isoforms, p85-S6K1 and p70-S6K1, were extensively studied to date. The origin and functional significance of the p60-S6K1 isoform remains a mystery, however, it was suggested that the isoform could be a product of alternative S6K1 mRNA translation. Herein we report the generation of HEK-293 cells exclusively expressing p60-S6K1 as a result of CRISPR/Cas9-mediated inactivation of p85/p70-S6K1 translation. Moreover, the generated modified cells displayed the elevated level of p60-S6K1 expression compared to that in wild-type HEK-293 cells. Our data confirm an assumption that p60-S6K1 is alternatively translated, most probably, from the common for both p70- and p85-S6K1 mRNA transcript and reveal a link between p60-S6K1 expression and such cellular processes as cell proliferation and motility. In addition, our findings indicate that the p60-S6K1 isoform of S6K1 may undergo a mode of regulation distinct from p70- and p85-S6K1 due to the absence of mTOR-regulated p60-S6K1 phosphorylation at T389 that is important for S6K1 activation.
Tsurugi, K; Collatz, E; Wool, E G; Lin, A
1976-12-25
The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Seventeen proteins (L4, L5, L7, L9, L11, L12, L13, L21, L22, L23, L26, L27, L30, L33, L35', L37, and L39) were isolated from three of the groups (B60, D60, G60) by ion exchange chromatography on carboxymethylcellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.5 to 15 mg. Eight of the proteins (L9, L11, L13, L21, L22, L35', L37 and L39) had no detectable contamination; the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.
Increased 5S rRNA oxidation in Alzheimer's disease.
Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R
2012-01-01
It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli
Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.
1982-06-01
This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.
Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen
2016-07-01
Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi
2018-01-01
We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.
Lin, A; McNally, J; Wool, I G
1983-09-10
The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.
The complete structure of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad
2014-11-13
Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.
International Nuclear Information System (INIS)
Uchiumi, T.; Wahba, A.J.; Traut, R.R.
1987-01-01
The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO 4 /polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO 4 gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO 4 /polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1) 2 and (P2) 2 dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits
Energy Technology Data Exchange (ETDEWEB)
Huber, J G
1996-10-17
NMR started to be applied to Fe-S proteins in the seventies. Its use has recently been enlarged as the problems arising from the paramagnetic polymetallic clusters ware overcome. Applications to [4Fe-4S] are presented herein. The information derived thereof deepens the understanding of the redox properties of these proteins which play a central role in the metabolism of bacterial cells. The secondary structure elements and the overall folding of Chromatium vinosum ferredoxin (Cv Fd) in solution have been established by NMR. The unique features of this sequence have been shown to fold as an {alpha} helix at the C-terminus and as a loop between two cysteines ligand of one cluster: these two parts localize in close proximity from one another. The interaction between nuclear and electronic spins is a source of additional structural information for (4Fe-AS] proteins. The conformation of the cysteine-ligands, as revealed by the Fe-(S{sub {gamma}}-C{sub {beta}}-H{sub {beta}})Cys dihedral angles, is related to the chemical shifts of the signals associated with the protons of these residues. The longitudinal relaxation times of the protons depend on their distance to the cluster. A quantitative relationship has been established and used to show that the solution structure of the high-potential ferredoxin from Cv differs significantly from the crystal structure around Phe-48. Both parameters (chemical shifts and longitudinal relaxation times) give also insight into the electronic and magnetic properties of the [4Fe-4S] clusters. The rate of intramolecular electron transfer between the two [4FE-4S] clusters of ferredoxins has been measured by NMR. It is far slower in the case of Cv Fd than for shorter ferredoxins. The difference may be associated with changes in the magnetic and/or electronic properties of one cluster. The strong paramagnetism of the [4Fe-4S] clusters, which originally limited the applicability of NMR to proteins containing these cofactors, has been proven
In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes
International Nuclear Information System (INIS)
Schubert, I.; Baeumlein, H.; Wobus, U.
1978-01-01
In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)
Hatakeyama, T; Hatakeyama, T
1990-07-06
The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.
Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.
Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad
2012-03-23
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.
Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*
Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad
2012-01-01
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031
Branciamore, Sergio; Di Giulio, Massimo
2012-04-01
The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.
The Phosphorylation of Ribosomal Protein in Lemna minor
Trewavas, A.
1973-01-01
Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405
Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA
Energy Technology Data Exchange (ETDEWEB)
Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.
2007-01-01
Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.
The ribosome structure controls and directs mRNA entry, translocation and exit dynamics
International Nuclear Information System (INIS)
Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej
2008-01-01
The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu
2016-10-01
Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect
Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M
2004-12-01
Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.
Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli
International Nuclear Information System (INIS)
Gravel, M.; Melancon, P.; Barkier-Gingras, L.
1987-01-01
[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance
Perche-Letuvée, Phanélie; Kathirvelu, Velavan; Berggren, Gustav; Clemancey, Martin; Latour, Jean-Marc; Maurel, Vincent; Douki, Thierry; Armengaud, Jean; Mulliez, Etienne; Fontecave, Marc; Garcia-Serres, Ricardo; Gambarelli, Serge; Atta, Mohamed
2012-01-01
Wybutosine and its derivatives are found in position 37 of tRNA encoding Phe in eukaryotes and archaea. They are believed to play a key role in the decoding function of the ribosome. The second step in the biosynthesis of wybutosine is catalyzed by TYW1 protein, which is a member of the well established class of metalloenzymes called “Radical-SAM.” These enzymes use a [4Fe-4S] cluster, chelated by three cysteines in a CX3CX2C motif, and S-adenosyl-l-methionine (SAM) to generate a 5′-deoxyadenosyl radical that initiates various chemically challenging reactions. Sequence analysis of TYW1 proteins revealed, in the N-terminal half of the enzyme beside the Radical-SAM cysteine triad, an additional highly conserved cysteine motif. In this study we show by combining analytical and spectroscopic methods including UV-visible absorption, Mössbauer, EPR, and HYSCORE spectroscopies that these additional cysteines are involved in the coordination of a second [4Fe-4S] cluster displaying a free coordination site that interacts with pyruvate, the second substrate of the reaction. The presence of two distinct iron-sulfur clusters on TYW1 is reminiscent of MiaB, another tRNA-modifying metalloenzyme whose active form was shown to bind two iron-sulfur clusters. A possible role for the second [4Fe-4S] cluster in the enzyme activity is discussed. PMID:23043105
Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T
1998-09-25
A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.
Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L
2017-11-01
Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In
Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes
Directory of Open Access Journals (Sweden)
Nicholas T. Ingolia
2014-09-01
Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.
1987-01-01
The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly
Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales
2010-08-16
In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy
Three-spin Strings on AdS_5 x S^5 from N=4 SYM
DEFF Research Database (Denmark)
Kristjansen, C.
2004-01-01
Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate the anal......Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate...... the analyticity structure encoded in the Bethe equations for various distributions of Bethe roots. In a certain region of the parameter space our operators reduce to the gauge theory duals of the folded string with two large angular momenta and in another region to the duals of the circular string with angular...... momentum assignment (J,J',J'), J>J'. In between we locate a critical line. We propose that the operators above the critical line are the gauge theory duals of the circular elliptic string with three different spins and support this by a perturbative calculation....
Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells
Directory of Open Access Journals (Sweden)
Cohen Sarit
2010-03-01
Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.
He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J
2012-07-01
The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.
DEFF Research Database (Denmark)
Richter, W W; Zang, K D; Issinger, O G
1983-01-01
Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...
The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron
Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.
1982-01-01
The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.
International Nuclear Information System (INIS)
Revenkova, E.; Masson, J.; Koncz, C.; Afsar, K.; Jakovleva, L.; Paszkowski, J.
1999-01-01
A recessive Arabidopsis mutant with elevated sensitivity to DNA damaging treatments was identified in one out of 800 families generated by T-DNA insertion mutagenesis. The T-DNA generated a chromosomal deletion of 1287 bp in the promoter of one of three S27 ribosomal protein genes (ARS27A) preventing its expression. Seedlings of ars27A developed normally under standard growth conditions, suggesting wildtype proficiency of translation. However, growth was strongly inhibited in media supplemented with methyl methane sulfate (MMS) at a concentration not affecting the wild type. This inhibition was accompanied by the formation of tumor–like structures instead of auxiliary roots. Wild-type seedlings treated with increasing concentrations of MMS up to a lethal dose never displayed such a trait, neither was this phenotype observed in ars27A plants in the absence of MMS or under other stress conditions. Thus, the hypersensitivity and tumorous growth are mutant-specific responses to the genotoxic MMS treatment. Another important feature of the mutant is its inability to perform rapid degradation of transcripts after UV treatment, as seen in wild-type plants. Therefore, we propose that the ARS27A protein is dispensable for protein synthesis under standard conditions but is required for the elimination of possibly damaged mRNA after UV irradiation. (author)
Fluorescent S-layer fusion proteins
International Nuclear Information System (INIS)
Kainz, B.
2010-01-01
This work describes the construction and characterisation of fluorescent S-layer fusion proteins used as building blocks for the fabrication of nanostructured monomolecular biocoatings on silica particles with defined fluorescence properties. The S-layer protein SgsE of Geobacillus stearothermophilus NRS 2004/3a was fused with the pH-dependant cyan, green and yellow variant of the green fluorescent protein (GFP) and the red fluorescent protein mRFP1. These fluorescent S-layer fusion proteins, acting as scaffold and optical sensing element simultaneously, were able to reassemble in solution and on silica particles forming 2D nanostructures with p2 lattice symmetry (a=11 ±0.5 nm, b=14 ±0.4 nm, g=80 ±1 o ). The pH-dependant fluorescence behaviour was studied with fluorimetry, confocal microscopy and flow cytometry. These fluorescent S-layer fusion proteins can be used as pH-sensor. 50% of the fluorescence intensity decreases at their calculated pKa values (pH6 - pH5). The fluorescence intensity of the GFP variants vanished completely between pH4 and pH3 whereas the chromophore of the red protein mRFP1 was only slightly affected in acidic conditions. At the isoelectric point of the S-layer coated silica particles (pH4.6 ±0.2) an increase in particle aggregation was detected by flow cytometry. The cyan and yellow fluorescent proteins were chosen to create a bi-fluorescent S-layer tandem fusion protein with the possibility for resonance energy transfer (FRET). A transfer efficiency of 20% and a molecular distance between the donor (ECFP) and acceptor (YFP) chromophores of around 6.2 nm could be shown. This bi-fluorescent ECFP-SgsE-YFP tandem fusion protein was able to reassemble on solid surfaces. The remarkable combination of fluorescence and self-assembly and the design of bi-functional S-layer tandem fusion protein matrices makes them to a promising tool in nanobiotechnology. (author) [de
International Nuclear Information System (INIS)
Pereira, Larissa Miranda
2009-01-01
The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
The 4p-5d, 6d and 4p-6s, 7s transitions of Mo IX
International Nuclear Information System (INIS)
Khatoon, S.; Chaghtai, M.S.Z.; Rahimullah, K.
1979-01-01
The transitions 4p-5d, 6d and 4p-6s, 7s have been studied for the first time in Mo IX. The authors have identified 42 4p-5d, 36 4p-6d, 22 4p-6s and 22 4p-7s transitions, establishing 16 4p 3 5d, 14 4p 3 6d and all the ten 4p 3 6s, 7s levels of the spectrum concerned. The ionization energy is estimated to be (1 323 700 +- 700)cm -1 or (164.11 +- 0.09)eV. The spectrum was recorded in sliding and open spark discharges with a 5 m grazing incidence spectrograph of Lund University (Sweden) from about 40 A to 440 A. (Auth.)
Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom
2016-07-07
A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.
Pidutti, P; Federici, F; Brandi, J; Manna, L; Rizzi, E; Marini, U; Cecconi, D
2018-02-01
The aim of this study was to investigate the antimicrobial potential of proteins secreted by a new strain of Lactobacillus salivarius. The secretome of L. salivarius SGL 03 strain was analysed by gel-assisted fractionation and MS/MS to identify low-molecular-mass proteins. This strategy allowed us to identify 10 secreted proteins. Then, a combination of heterologous expression and agar well diffusion was used to characterize them as to their antimicrobial activity, mechanisms of action and stability. Our findings indicate that L27 and L30 proteins of the 50S ribosomal subunit have antimicrobial activity against Streptococcus pyogenes, Streptococcus uberis and Enterococcus faecium. In addition, both proteins are bactericidal against S. pyogenes and maintain their antimicrobial activity after different protease treatments, at acidic pH, after heat treatment, and if stored in a refrigerated ambient at least at 4°C. The overall results demonstrated that the L27 and L30 ribosomal proteins are of interest as new antimicrobial molecules to prevent the growth of S. pyogenes, S. uberis and E. faecium. Our results provide the first insight into the extra-ribosomal activity of L27 and L30 secreted proteins of L. salivarius. This study demonstrated the capacity of L. salivarius SGL 03 to produce antimicrobial molecules and suggested this strain as a promising probiotic candidate. © 2017 The Society for Applied Microbiology.
4EBP-Dependent Signaling Supports West Nile Virus Growth and Protein Expression.
Shives, Katherine D; Massey, Aaron R; May, Nicholas A; Morrison, Thomas E; Beckham, J David
2016-10-18
West Nile virus (WNV) is a (+) sense, single-stranded RNA virus in the Flavivirus genus. WNV RNA possesses an m7 GpppN m 5' cap with 2'- O -methylation that mimics host mRNAs preventing innate immune detection and allowing the virus to translate its RNA genome through the utilization of cap-dependent translation initiation effectors in a wide variety of host species. Our prior work established the requirement of the host mammalian target of rapamycin complex 1 (mTORC1) for optimal WNV growth and protein expression; yet, the roles of the downstream effectors of mTORC1 in WNV translation are unknown. In this study, we utilize gene deletion mutants in the ribosomal protein kinase called S6 kinase (S6K) and eukaryotic translation initiation factor 4E-binding protein (4EBP) pathways downstream of mTORC1 to define the role of mTOR-dependent translation initiation signals in WNV gene expression and growth. We now show that WNV growth and protein expression are dependent on mTORC1 mediated-regulation of the eukaryotic translation initiation factor 4E-binding protein/eukaryotic translation initiation factor 4E-binding protein (4EBP/eIF4E) interaction and eukaryotic initiation factor 4F (eIF4F) complex formation to support viral growth and viral protein expression. We also show that the canonical signals of mTORC1 activation including ribosomal protein s6 (rpS6) and S6K phosphorylation are not required for WNV growth in these same conditions. Our data suggest that the mTORC1/4EBP/eIF4E signaling axis is activated to support the translation of the WNV genome.
4EBP-Dependent Signaling Supports West Nile Virus Growth and Protein Expression
Directory of Open Access Journals (Sweden)
Katherine D. Shives
2016-10-01
Full Text Available West Nile virus (WNV is a (+ sense, single-stranded RNA virus in the Flavivirus genus. WNV RNA possesses an m7GpppNm 5′ cap with 2′-O-methylation that mimics host mRNAs preventing innate immune detection and allowing the virus to translate its RNA genome through the utilization of cap-dependent translation initiation effectors in a wide variety of host species. Our prior work established the requirement of the host mammalian target of rapamycin complex 1 (mTORC1 for optimal WNV growth and protein expression; yet, the roles of the downstream effectors of mTORC1 in WNV translation are unknown. In this study, we utilize gene deletion mutants in the ribosomal protein kinase called S6 kinase (S6K and eukaryotic translation initiation factor 4E-binding protein (4EBP pathways downstream of mTORC1 to define the role of mTOR-dependent translation initiation signals in WNV gene expression and growth. We now show that WNV growth and protein expression are dependent on mTORC1 mediated-regulation of the eukaryotic translation initiation factor 4E-binding protein/eukaryotic translation initiation factor 4E-binding protein (4EBP/eIF4E interaction and eukaryotic initiation factor 4F (eIF4F complex formation to support viral growth and viral protein expression. We also show that the canonical signals of mTORC1 activation including ribosomal protein s6 (rpS6 and S6K phosphorylation are not required for WNV growth in these same conditions. Our data suggest that the mTORC1/4EBP/eIF4E signaling axis is activated to support the translation of the WNV genome.
NMR of proteins (4Fe-4S): structural properties and intramolecular electron transfer
International Nuclear Information System (INIS)
Huber, J.G.
1996-01-01
NMR started to be applied to Fe-S proteins in the seventies. Its use has recently been enlarged as the problems arising from the paramagnetic polymetallic clusters ware overcome. Applications to [4Fe-4S] are presented herein. The information derived thereof deepens the understanding of the redox properties of these proteins which play a central role in the metabolism of bacterial cells. The secondary structure elements and the overall folding of Chromatium vinosum ferredoxin (Cv Fd) in solution have been established by NMR. The unique features of this sequence have been shown to fold as an α helix at the C-terminus and as a loop between two cysteines ligand of one cluster: these two parts localize in close proximity from one another. The interaction between nuclear and electronic spins is a source of additional structural information for (4Fe-AS] proteins. The conformation of the cysteine-ligands, as revealed by the Fe-(S γ -C β -H β )Cys dihedral angles, is related to the chemical shifts of the signals associated with the protons of these residues. The longitudinal relaxation times of the protons depend on their distance to the cluster. A quantitative relationship has been established and used to show that the solution structure of the high-potential ferredoxin from Cv differs significantly from the crystal structure around Phe-48. Both parameters (chemical shifts and longitudinal relaxation times) give also insight into the electronic and magnetic properties of the [4Fe-4S] clusters. The rate of intramolecular electron transfer between the two [4FE-4S] clusters of ferredoxins has been measured by NMR. It is far slower in the case of Cv Fd than for shorter ferredoxins. The difference may be associated with changes in the magnetic and/or electronic properties of one cluster. The strong paramagnetism of the [4Fe-4S] clusters, which originally limited the applicability of NMR to proteins containing these cofactors, has been proven instrumental in affording new
Architecture of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad
2014-01-23
Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
Significance of the S100A4 protein in psoriasis
DEFF Research Database (Denmark)
Zibert, John R; Skov, Lone; Thyssen, Jacob P
2010-01-01
the expression and significance of S100A4 in psoriasis. We found significant upregulation of S100A4 in the dermis of psoriatic skin compared with normal skin. This pattern of S100A4 expression differs considerably from that of other S100 proteins, S100A7 and S100A8/9, with predominant expression in the epidermis...... of psoriasis. Furthermore, we revealed a massive release of the biologically active forms of S100A4 from psoriatic skin. Interestingly, we found stabilization (increase) of p53 in the basal layer of epidermis in close proximity to cells expressing S100A4. To examine the possible implication of S100A4...... in the pathogenesis of psoriasis, we analyzed the effect of S100A4 blocking antibodies in a human psoriasis xenograft SCID mouse model and observed a significant reduction of the epidermal thickness and impairment in cell proliferation and dermal vascularization. In conclusion, we showed strong upregulation...
Directory of Open Access Journals (Sweden)
Jennifer L Houmani
Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.
(1S,3S,4S-tert-Butyl N-[1-benzyl-3-hydroxy-5-phenyl-4-(picolinamidopentyl]carbamate
Directory of Open Access Journals (Sweden)
Jian-Feng Zheng
2008-07-01
Full Text Available The title compound, C29H35N3O4, was obtained by the reaction of (2S,4S,5S-tert-butyl N-(4-amino-1-benzyl-3-hydroxy-5-phenylpentylcarbamate and picolinic acid using oxalyl chloride as a chlorinating reagent to activate the carboxyl group. In the crystal structure there are two molecules in the asymmetric unit, which are aligned edge-to-face. In one molecule, the pyridyl ring forms a dihedral angle of 22.0 (1° with the phenyl ring of the terminal benzyl group and 14.3 (1° with the other phenyl ring; in the other molecule, the corresponding angles are 12.1 (1 and 10.6 (1°, respectively. The packing is stabilized by intermolecular hydrogen bonds and C—H...π interactions.
Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei
2013-10-22
The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.
Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin
International Nuclear Information System (INIS)
Boehm, H.; Stahl, J.; Bielka, H.
1979-01-01
N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)
Volovelsky, Oded; Cohen, Gili; Kenig, Ariel; Wasserman, Gilad; Dreazen, Avigail; Meyuhas, Oded; Silver, Justin; Naveh-Many, Tally
2016-04-01
Secondary hyperparathyroidism is characterized by increased serum parathyroid hormone (PTH) level and parathyroid cell proliferation. However, the molecular pathways mediating the increased parathyroid cell proliferation remain undefined. Here, we found that the mTOR pathway was activated in the parathyroid of rats with secondary hyperparathyroidism induced by either chronic hypocalcemia or uremia, which was measured by increased phosphorylation of ribosomal protein S6 (rpS6), a downstream target of the mTOR pathway. This activation correlated with increased parathyroid cell proliferation. Inhibition of mTOR complex 1 by rapamycin decreased or prevented parathyroid cell proliferation in secondary hyperparathyroidism rats and in vitro in uremic rat parathyroid glands in organ culture. Knockin rpS6(p-/-) mice, in which rpS6 cannot be phosphorylated because of substitution of all five phosphorylatable serines with alanines, had impaired PTH secretion after experimental uremia- or folic acid-induced AKI. Uremic rpS6(p-/-) mice had no increase in parathyroid cell proliferation compared with a marked increase in uremic wild-type mice. These results underscore the importance of mTOR activation and rpS6 phosphorylation for the pathogenesis of secondary hyperparathyroidism and indicate that mTORC1 is a significant regulator of parathyroid cell proliferation through rpS6. Copyright © 2016 by the American Society of Nephrology.
DEFF Research Database (Denmark)
Issinger, O G; Beier, H
1978-01-01
Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....
Directory of Open Access Journals (Sweden)
Stefanie Gerstberger
2017-10-01
Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.
Protein folding on the ribosome studied using NMR spectroscopy
Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John
2013-01-01
NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462
Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.
1985-01-01
Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis
The 4.5 S RNA gene of Escherichia coli is essential for cell growth
DEFF Research Database (Denmark)
Brown, S; Fournier, M J
1984-01-01
The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...
DEFF Research Database (Denmark)
Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka
2012-01-01
additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....
Institute of Scientific and Technical Information of China (English)
Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao
2017-01-01
As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song
2009-11-01
RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first
Synergistic inhibition of the intrinsic factor X activation by protein S and C4b-binding protein
Koppelman, S.J.
1995-01-01
The complement protein C4b-binding protein plays an important role in the regulation of the protein C anticoagulant pathway. C4b-binding protein can bind to protein S, thereby inhibiting the cofactor activity of protein S for activated protein C. In this report, we describe a new role for
D = 4 Yang-Mills correlators from NSR strings on AdS5 x S5
International Nuclear Information System (INIS)
Polyakov, D.
1999-07-01
In our previous work (hep-th/9812044) we have proposed the sigma-model action, conjectured to be the NSR analogue of superstring theory on AdS 5 x S 5 . This sigma-model is the NSR superstring action with potential term corresponding to the exotic 5-form vertex operator (branelike state). This 5-form potential plays the role of cosmological term, effectively curving the flat space-time geometry to that of AdS 5 x S 5 . In this paper we study this ansatz in more detail and provide the derivation of the correlators of the four-dimensional super Yang-Mills theory from the above mentioned sigma-model. In particular, we show that the correlation function of two dilaton vertex operators in such a model reproduces the well-known result for the two-point function in N = 4 four-dimensional super Yang-Mills theory. (author)
Singh, Itu; Yadav, Asha Ram; Mohanty, Keshar Kunja; Katoch, Kiran; Sharma, Prashant; Mishra, Bishal; Bisht, Deepa; Gupta, U D; Sengupta, Utpal
2015-04-01
Autoantibodies against various components of host are known to occur in leprosy. Nerve damage is the primary cause of disability associated with leprosy. The aim of this study was to detect the level of autoantibodies and lympho-proliferative response against myelin basic protein (MBP) in leprosy patients (LPs) and their correlation with clinical phenotypes of LPs. Further, probable role of molecular mimicry in nerve damage of LPs was investigated. We observed significantly high level of anti-MBP antibodies in LPs across the spectrum and a positive significant correlation between the level of anti-MBP antibodies and the number of nerves involved in LPs. We report here that 4 B cell epitopes of myelin A1 and Mycobacterium leprae proteins, 50S ribosomal L2 and lysyl tRNA synthetase are cross-reactive. Further, M. leprae sonicated antigen hyperimmunization was responsible for induction of autoantibody response in mice which could be adoptively transferred to naive mice. For the first time our findings suggest the role of molecular mimicry in nerve damage in leprosy. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Differential Stoichiometry among Core Ribosomal Proteins
Directory of Open Access Journals (Sweden)
Nikolai Slavov
2015-11-01
Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.
Sequence analysis and over-expression of ribosomal protein S28 ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-03
Jun 3, 2009 ... protein S28 gene (RPS28) from the Giant Panda. Wan-ru Hou1* .... Materials. Skeletal muscle was collected from a dead Giant Panda at the Wo- ... synthesis. ... 72°C for 3 min in the first cycle and the anneal temperature decea- ..... laboratory manual 2nd ed., Cold Spring Harbor Laboratory Press, Cold.
Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions
Zhang, Yawei; Li, Gang
2018-01-01
Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.
Bergmann, U; Wittmann-Liebold, B
1993-03-23
50S ribosomal subunits from the extreme halophilic archaebacterium Haloarcula marismortui were treated with the homobifunctional protein-protein cross-linking reagents diepoxybutane (4 A) and dithiobis(succinimidyl propionate) (12 A). The dominant product with both cross-linking reagents was identified on the protein level as HmaL23-HmaL29, which is homologous to the protein pair L23-L29 from Escherichia coli [Walleczek, J., Martin, T., Redl, B., Stöffler-Meilicke, M., & Stöffler, G. (1989) Biochemistry 28, 4099-4105] and from Bacillus stearothermophilus [Brockmöller, J., & Kamp, R. M. (1986) Biol. Chem. Hoppe-Seyler 367, 925-935]. To reveal the exact cross-linking site in HmaL23-HmaL29, the cross-linked complex was purified on a preparative scale by conventional and high-performance liquid chromatography. After endoproteolytic fragmentation of the protein pair, the amino acids engaged in cross-link formation were unambiguously identified by N-terminal sequence analysis and mass spectrometry of the cross-linked peptides. The cross-link is formed between lysine-57 in the C-terminal region of HmaL29 and the alpha-amino group of the N-terminal serine in protein HmaL23, irrespective of the cross-linking reagent. This result demonstrates that the N-terminal region of protein HmaL23 and the C-terminal domain of HmaL29 are highly flexible so that the distance between the two polypeptide chains can vary by at least 8 A. Comparison of our cross-linking results with those obtained with B. stearothermophilus revealed that the fine structure within this ribosomal domain is at least partially conserved.
Directory of Open Access Journals (Sweden)
Sanchita Das
Full Text Available Sodium antimony gluconate (SAG unresponsiveness of Leishmania donovani (Ld had effectively compromised the chemotherapeutic potential of SAG. 60s ribosomal L23a (60sRL23a, identified as one of the over-expressed protein in different resistant strains of L.donovani as observed with differential proteomics studies indicates towards its possible involvement in SAG resistance in L.donovani. In the present study 60sRL23a has been characterized for its probable association with SAG resistance mechanism.The expression profile of 60s ribosomal L23a (60sRL23a was checked in different SAG resistant as well as sensitive strains of L.donovani clinical isolates by real-time PCR and western blotting and was found to be up-regulated in resistant strains. Ld60sRL23a was cloned, expressed in E.coli system and purified for raising antibody in swiss mice and was observed to have cytosolic localization in L.donovani. 60sRL23a was further over-expressed in sensitive strain of L.donovani to check its sensitivity profile against SAG (Sb V and III and was found to be altered towards the resistant mode.This study reports for the first time that the over expression of 60sRL23a in SAG sensitive parasite decreases the sensitivity of the parasite towards SAG, miltefosine and paramomycin. Growth curve of the tranfectants further indicated the proliferative potential of 60sRL23a assisting the parasite survival and reaffirming the extra ribosomal role of 60sRL23a. The study thus indicates towards the role of the protein in lowering and redistributing the drug pressure by increased proliferation of parasites and warrants further longitudinal study to understand the underlying mechanism.
The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.
Chan, Y L; Paz, V; Olvera, J; Wool, I G
1993-04-30
The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.
Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki
2017-03-01
Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in
Structural model of the 50S subunit of E.Coli ribosomes from solution scattering
Energy Technology Data Exchange (ETDEWEB)
Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)
1994-12-31
The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.
Structural model of the 50S subunit of E.Coli ribosomes from solution scattering
International Nuclear Information System (INIS)
Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.
1994-01-01
The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
The metastasis-promoting S100A4 protein confers neuroprotection in brain injury
DEFF Research Database (Denmark)
Dmytriyeva, Oksana; Pankratova, Stanislava; Owczarek, Sylwia
2012-01-01
and downregulating the neuroprotective protein metallothionein I+II. We identify two neurotrophic motifs in S100A4 and show that these motifs are neuroprotective in animal models of brain trauma. Finally, we find that S100A4 rescues neurons via the Janus kinase/STAT pathway and, partially, the interleukin-10......Identification of novel pro-survival factors in the brain is paramount for developing neuroprotective therapies. The multifunctional S100 family proteins have important roles in many human diseases and are also upregulated by brain injury. However, S100 functions in the nervous system remain...... unclear. Here we show that the S100A4 protein, mostly studied in cancer, is overexpressed in the damaged human and rodent brain and released from stressed astrocytes. Genetic deletion of S100A4 exacerbates neuronal loss after brain trauma or excitotoxicity, increasing oxidative cell damage...
Directory of Open Access Journals (Sweden)
Azat Gabdulkhakov
2017-02-01
Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.
Energy Technology Data Exchange (ETDEWEB)
Sameshima, M; Ito, K; Iwabuchi, M
1972-01-01
In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R
2013-02-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.
AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74
Energy Technology Data Exchange (ETDEWEB)
Hiraishi, Nobuhiro; Ishida, Yo-ichi; Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp
2015-11-20
Nuclear VCP-like 2 (NVL2) is a chaperone-like nucleolar ATPase of the AAA (ATPase associated with diverse cellular activities) family, which exhibits a high level of amino acid sequence similarity with the cytosolic AAA-ATPase VCP/p97. These proteins generally act on macromolecular complexes to stimulate energy-dependent release of their constituents. We previously showed that NVL2 interacts with RNA processing/degradation machinery containing an RNA helicase MTR4/DOB1 and an exonuclease complex, nuclear exosome, and involved in the biogenesis of 60S ribosomal subunits. These observations implicate NVL2 as a remodeling factor for the MTR4-exosome complex during the maturation of pre-ribosomal particles. Here, we used a proteomic screen and identified a WD repeat-containing protein 74 (WDR74) as a factor that specifically dissociates from this complex depending on the ATPase activity of NVL2. WDR74 shows weak amino acid sequence similarity with the yeast ribosome biogenesis protein Nsa1 and is co-localized with NVL2 in the nucleolus. Knockdown of WDR74 decreases 60S ribosome levels. Taken together, our results suggest that WDR74 is a novel regulatory protein of the MTR4-exsosome complex whose interaction is regulated by NVL2 and is involved in ribosome biogenesis. - Highlights: • WDR74 accumulates in MTR4-exosome complex upon expression of dominant-negative NVL2. • WDR74 is co-localized with NVL2 in the nucleolus. • WDR74, along with NVL2, is involved in the synthesis of 60S ribosomal subunits.
AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74
International Nuclear Information System (INIS)
Hiraishi, Nobuhiro; Ishida, Yo-ichi; Nagahama, Masami
2015-01-01
Nuclear VCP-like 2 (NVL2) is a chaperone-like nucleolar ATPase of the AAA (ATPase associated with diverse cellular activities) family, which exhibits a high level of amino acid sequence similarity with the cytosolic AAA-ATPase VCP/p97. These proteins generally act on macromolecular complexes to stimulate energy-dependent release of their constituents. We previously showed that NVL2 interacts with RNA processing/degradation machinery containing an RNA helicase MTR4/DOB1 and an exonuclease complex, nuclear exosome, and involved in the biogenesis of 60S ribosomal subunits. These observations implicate NVL2 as a remodeling factor for the MTR4-exosome complex during the maturation of pre-ribosomal particles. Here, we used a proteomic screen and identified a WD repeat-containing protein 74 (WDR74) as a factor that specifically dissociates from this complex depending on the ATPase activity of NVL2. WDR74 shows weak amino acid sequence similarity with the yeast ribosome biogenesis protein Nsa1 and is co-localized with NVL2 in the nucleolus. Knockdown of WDR74 decreases 60S ribosome levels. Taken together, our results suggest that WDR74 is a novel regulatory protein of the MTR4-exsosome complex whose interaction is regulated by NVL2 and is involved in ribosome biogenesis. - Highlights: • WDR74 accumulates in MTR4-exosome complex upon expression of dominant-negative NVL2. • WDR74 is co-localized with NVL2 in the nucleolus. • WDR74, along with NVL2, is involved in the synthesis of 60S ribosomal subunits.
4s24p3--4s4p4 and 4s24p3--4s2fp25s transitions in Y VII, Zr VIII, Nb IX, and MoX
International Nuclear Information System (INIS)
Reader, J.; Acquista, N.
1981-01-01
Spectra of ionized Y, Zr, Nb, and Mo have been observed in sliding-spark and triggered-spark discharges on 10.7-m normal- and grazing-incidence spectrographs at the National Bureau of Standards in Washington, D. C. From these observations the 4s 2 4p 3 --4s4p 4 transitions in Y VII, Zr VIII, Nb IX, and Mo X have been identified. The 4s 2 4p 3 --4s 2 4p 2 5s transitions in Y VII-Mo X, previously identified by Rahimullah et al. [Phys. Scr. 14, 221--223 (1976); 18, 96--106 (1978)], have been confirmed. In Y VII the 4s 2 4p 3 --4s 2 4p 2 6s and 4s4p 4 --4p 5 transition also have been found. The parameters obtained from least-squares fits to the energy levels are compared with Hartree--Fock calculations. Preliminary values of the ionization energies have been determined as 110.02 +- 0.15 eV for Y VII, 133.7 +- 0.5 eV for Zr VIII, 159.2 +- 0.7 eV for Nb IX, and 186.4 +- 1.2 eV for Mo X
On the control of ribosomal protein biosynthesis in Escherichia coli
International Nuclear Information System (INIS)
Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.
1977-01-01
The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene
Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA
DEFF Research Database (Denmark)
Ostergaard, P; Phan, H; Johansen, L B
1998-01-01
The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J
2013-08-08
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.
Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.
Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P
2010-08-01
Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr
International Nuclear Information System (INIS)
Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.
1993-01-01
The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
Emerging functions of ribosomal proteins in gene-specific transcription and translation
International Nuclear Information System (INIS)
Lindstroem, Mikael S.
2009-01-01
Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.
International Nuclear Information System (INIS)
Bogdanovich, P; Karpuškienė, R; Kisielius, R
2015-01-01
The ab initio quasirelativistic Hartree–Fock method developed specifically for the calculation of spectral parameters of heavy atoms and highly charged ions is used to derive spectral data for the 4s 2 4p 5 , 4s 2 4p 4 4d and 4s4p 6 configurations of the multicharged tungsten ion W 39+ . The relativistic effects are taken into account in the Breit–Pauli approximation for the quasirelativistic Hartree–Fock radial orbitals. The configuration interaction method is applied to include the electron correlation effects. Produced data are compared with existing experimental measurements and theoretical calculations. (paper)
18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA
Directory of Open Access Journals (Sweden)
Cory Ann Leonard
2016-01-01
Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.
Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs
International Nuclear Information System (INIS)
Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.
1986-01-01
5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)
Directory of Open Access Journals (Sweden)
Scott P Kenney
Full Text Available Human ribosomal protein S17 (RPS17 is mutated in Diamond-Blackfan Anemia (DBA, a bone marrow disorder that fails to produce sufficient red blood cells leading to anemia. Recently, an RPS17 protein sequence was also found to be naturally inserted in the genome of hepatitis E virus (HEV from patients chronically-infected by HEV. The role of RPS17 in HEV replication and pathogenesis remains unknown due to the lack of knowledge about how RPS17 functions at a molecular level. Understanding the biological function of RPS17 is critical for elucidating its role in virus infection and DBA disease processes. In this study we probed the subcellular distribution of normal and mutant RPS17 proteins in a human liver cell line (Huh7. RPS17 was primarily detected within the nucleus, and more specifically within the nucleoli. Using a transient expression system in which RPS17 or truncations were expressed as fusions with enhanced yellow fluorescent protein (eYFP, we were able to identify and map, for the first time, two separate nuclear localization signals (NLSs, one to the first 13 amino acids of the amino-terminus of RPS17 and the other within amino acids 30-60. Additionally, we mapped amino acid sequences required for nucleolar accumulation of RPS17 to amino acids 60-70. Amino acids 60-70 possess a di-RG motif that may be necessary for nucleolar retention of RPS17. The results from this study enhance our knowledge of RSP17 and will facilitate future mechanistic studies about the roles of RSP17 in hepatitis E and DBA disease processes.
Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong
2014-01-01
Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.
Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping
2017-05-01
The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.
Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.
He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J
2009-12-31
We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.
Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul
2015-08-18
Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V
2018-04-06
Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.
Indian Academy of Sciences (India)
143, AT3G05200.1, 8262, I, 0.6, 259312_at, ATL6 (Arabidopsis T?xicos en Levadura 6); protein binding / zinc ion binding. 144, LOC_Os08g37760.1, 8262, D, -1.07, Os.17554.1.S1_at, zinc finger, C3HC4 type family protein, expressed. 145, AT5G27420.1, 8262, D, -0.95, 246777_at, zinc finger (C3HC4-type RING finger) ...
Bacterial effector binding to ribosomal protein s3 subverts NF-kappaB function.
Directory of Open Access Journals (Sweden)
Xiaofei Gao
2009-12-01
Full Text Available Enteric bacterial pathogens cause food borne disease, which constitutes an enormous economic and health burden. Enterohemorrhagic Escherichia coli (EHEC causes a severe bloody diarrhea following transmission to humans through various means, including contaminated beef and vegetable products, water, or through contact with animals. EHEC also causes a potentially fatal kidney disease (hemolytic uremic syndrome for which there is no effective treatment or prophylaxis. EHEC and other enteric pathogens (e.g., enteropathogenic E. coli (EPEC, Salmonella, Shigella, Yersinia utilize a type III secretion system (T3SS to inject virulence proteins (effectors into host cells. While it is known that T3SS effectors subvert host cell function to promote diarrheal disease and bacterial transmission, in many cases, the mechanisms by which these effectors bind to host proteins and disrupt the normal function of intestinal epithelial cells have not been completely characterized. In this study, we present evidence that the E. coli O157:H7 nleH1 and nleH2 genes encode T3SS effectors that bind to the human ribosomal protein S3 (RPS3, a subunit of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kappaB transcriptional complexes. NleH1 and NleH2 co-localized with RPS3 in the cytoplasm, but not in cell nuclei. The N-terminal region of both NleH1 and NleH2 was required for binding to the N-terminus of RPS3. NleH1 and NleH2 are autophosphorylated Ser/Thr protein kinases, but their binding to RPS3 is independent of kinase activity. NleH1, but not NleH2, reduced the nuclear abundance of RPS3 without altering the p50 or p65 NF-kappaB subunits or affecting the phosphorylation state or abundance of the inhibitory NF-kappaB chaperone IkappaBalpha NleH1 repressed the transcription of a RPS3/NF-kappaB-dependent reporter plasmid, but did not inhibit the transcription of RPS3-independent reporters. In contrast, NleH2 stimulated RPS3-dependent transcription, as well
Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli
DEFF Research Database (Denmark)
Brown, S
1991-01-01
4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....
IgD, cyclooxygenase-2 and ribosomal protein S6-PS240 immune response in a case of early psoriasis
Directory of Open Access Journals (Sweden)
Ana Maria Abreu Velez
2018-02-01
Full Text Available Psoriasis is an inflammatory skin disease. Five classic types of psoriasis have been defined: plaque, inverse, pustular, guttate, and erythrodermic. The early psoriasis immunologic skin immune response is not well understood. Here we aim to show an immune and cell signaling response in a case of early psoriasis. A 56 year old female presented with a desquamative lesion on her right leg. A skin biopsy for hematoxylin and eosin (H&E and immunohistochemistry (IHC staining was taken. The diagnosis indicated early psoriasis, and IHC showed positive IgD staining in the epidermal corneal layer, as well as positive staining with ribosomal protein S6-pS240 (RIBO in the hyperproliferative epidermis. Cyclooxygenase-2 (COX-2 was also very positive in the granular layer in spots, at the basement membrane zone of the skin and in the inflammatory infiltrate in the dermis subjacent to hyperproliferative psoriatic areas. In an early case of psoriasis, we confirmed the presence of IgD, RIBO and COX-2. Each molecule seems to be playing a role in inflammation and intracellular signaling pathways in early psoriasis. The role of IgD is unknown, and this case brings to light the complexity of the pathologic changes occurring in early psoriatic lesions.
Directory of Open Access Journals (Sweden)
Sarah Pinder
2012-09-01
Full Text Available Ochratoxin A (OTA is considered to be a possible human urinary tract carcinogen, based largely on a rat model, but no molecular genetic changes in the rat carcinomas have yet been defined. The phosphorylated-S6 ribosomal protein is a marker indicating activity of the mammalian target of rapamycin, which is a serine/threonine kinase with a key role in protein biosynthesis, cell proliferation, transcription, cellular metabolism and apoptosis, while being functionally deregulated in cancer. To assess p-S6 expression we performed immunohistochemistry on formalin-fixed and paraffin-embedded tumours and normal tissues. Marked intensity of p-S6 expression was observed in highly proliferative regions of rat renal carcinomas and a rare angiosarcoma, all of which were attributed to prolonged exposure to dietary OTA. Only very small OTA-generated renal adenomas were negative for p-S6. Examples of rat subcutaneous fibrosarcoma and testicular seminoma, as well as of normal renal tissue, showed no or very weak positive staining. In contrast to the animal model, human renal cell carcinoma, upper urinary tract transitional cell carcinoma from cases of Balkan endemic nephropathy, and a human angiosarcoma were negative for p-S6. The combined findings are reminiscent of constitutive changes in the rat tuberous sclerosis gene complex in the Eker strain correlated with renal neoplasms, Therefore rat renal carcinogenesis caused by OTA does not obviously mimic human urinary tract tumourigenesis.
Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.
Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter
2012-12-18
Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
DEFF Research Database (Denmark)
Long, Katherine S.; Vester, Birte
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...
Tosto, D S; Hopp, H E
1996-01-01
The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.
Molecular mechanisms of Ca(2+) signaling in neurons induced by the S100A4 protein
DEFF Research Database (Denmark)
Kiryushko, Darya; Novitskaya, Vera; Soroka, Vladislav
2006-01-01
The S100A4 protein belongs to the S100 family of vertebrate-specific proteins possessing both intra- and extracellular functions. In the nervous system, high levels of S100A4 expression are observed at sites of neurogenesis and lesions, suggesting a role of the protein in neuronal plasticity. Ext...... at the cell surface. Thus, glycosaminoglycans may act as coreceptors of S100 proteins in neurons. This may provide a mechanism by which S100 proteins could locally regulate neuronal plasticity in connection with brain lesions and neurological disorders....
High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.
Baskakov, O I; Civis, S; Kawaguchi, K
2005-03-15
In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.
International Nuclear Information System (INIS)
Olsson, T.; Fraenkel, L.; Lindgren, I.; Nyberg, A.; Robertsson, L.; Rosen, A.
1986-01-01
A series of experiments has been performed to determine the hyperfine structure in the metastable 4d 5 5s 5 Dsub(1,2,3,4) states of Mo I by means of the laser radiofrequency double-resonance technique. Furthermore, hyperfine structure splittings and isotope shifts in seven optical transitions connecting the 4d 5 5s 5 Dsub(0,1,2,3,4) and the 4d 4 5s5p 5 Psub(1,2,3) states were resolved with the high-resolution laser spectroscopy technique. Radial hyperfine structure parameters are deduced for the effective operator within the 5 D states using the configurations 4d 4 5s 2 , 4d 5 5s and 4d 6 as a model space. The isotope shifts are also discussed, utilizing an effective operator, with particular emphasis on the J dependence. (orig.)
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry
DEFF Research Database (Denmark)
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-01-01
RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....
Berg, van den W.A.M.; Hagen, W.R.; Dongen, van W.M.A.M.
2000-01-01
Hybrid-cluster proteins ('prismane proteins') have previously been isolated and characterized from strictly anaerobic sulfate-reducing bacteria. These proteins contain two types of Fe/S clusters unique in biological systems: a [4Fe-4S] cubane cluster with spin-admixed S = 3/2 ground-state
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
International Nuclear Information System (INIS)
Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.
1989-01-01
The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig
Hatakeyama, T; Kimura, M
1988-03-15
Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.
Localized AdS_{5}×S^{5} Black Holes.
Dias, Óscar J C; Santos, Jorge E; Way, Benson
2016-10-07
According to heuristic arguments, global AdS_{5}×S^{5} black holes are expected to undergo a phase transition in the microcanonical ensemble. At high energies, one expects black holes that respect the symmetries of the S^{5}; at low energies, one expects "localized" black holes that appear pointlike on the S^{5}. According to anti-de Sitter/conformal field theory correspondence, N=4 supersymmetric Yang-Mills (SYM) theory on a 3-sphere should therefore exhibit spontaneous R-symmetry breaking at strong coupling. In this Letter, we numerically construct these localized black holes. We extrapolate the location of this phase transition, and compute the expectation value of the broken scalar operator with lowest conformal dimension. Via the correspondence, these results offer quantitative predictions for N=4 SYM theory.
Attosecond relative delay among xenon 5p, 5s, and 4d photoionization
Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri
2017-04-01
Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.
Production of RNA-protein cross links in γ irradiated E. Coli ribosomes
International Nuclear Information System (INIS)
Ekert, Bernard; Giocanti, Nicole
1976-01-01
γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr
4p-5s transitions in In XIII, In XIV and In XV
International Nuclear Information System (INIS)
Carroll, P.K.; Costello, J.T.; O'Sullivan, G.
1986-01-01
The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)
Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.
Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E
2017-01-01
Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.
Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B
1987-08-01
The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
International Nuclear Information System (INIS)
Kim, Kyoung-Dong; Chung, Woo-Hyun; Kim, Hyo-Jin; Lee, Kyung-Chang; Roe, Jung-Hye
2010-01-01
Mitochondrial monothiol glutaredoxins that bind Fe-S cluster are known to participate in Fe-S cluster assembly. However, their precise role has not been well understood. Among three monothiol glutaredoxins (Grx3, 4, and 5) in Schizosaccharomyces pombe only Grx5 resides in mitochondria. The Δgrx5 mutant requires cysteine on minimal media, and does not grow on non-fermentable carbon source such as glycerol. We found that the mutant is low in the activity of Fe-S enzymes in mitochondria as well as in the cytoplasm. Screening of multi-copy suppressor of growth defects of the mutant identified isa1 + gene encoding a putative A-type Fe-S scaffold, in addition to mas5 + and hsc1 + genes encoding putative chaperones for Fe-S assembly process. Examination of other scaffold and chaperone genes revealed that isa2 + , but not isu1 + and ssc1 + , complemented the growth phenotype of Δgrx5 mutant as isa1 + did, partly through restoration of Fe-S enzyme activities. The mutant also showed a significant decrease in the amount of mitochondrial DNA. We demonstrated that Grx5 interacts in vivo with Isa1 and Isa2 proteins in mitochondria by observing bimolecular fluorescence complementation. These results indicate that Grx5 plays a central role in Fe-S assembly process through interaction with A-type Fe-S scaffold proteins Isa1 and Isa2, each of which is an essential protein in S. pombe, and supports mitochondrial genome integrity as well as Fe-S assembly.
Wang, Yong; Qian, Pei-Yuan
2009-01-01
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions
Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid
International Nuclear Information System (INIS)
Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.
1978-01-01
The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%
Li, Qun; Ren, Jun
2007-01-01
Reduced insulin sensitivity following chronic alcohol consumption may contribute to alcohol-induced brain damage although the underlying mechanism(s) has not been elucidated. This study was designed to examine the effect of chronic alcohol intake on insulin signaling in mouse cerebral cortex. FVB mice were fed with a 4% alcohol diet for 16 weeks. Insulin receptor substrates (IRS-1, IRS-2) and post-receptor signaling molecules Akt, mammalian target of rapamycin (mTOR), ribosomal p70s6 kinase (...
Directory of Open Access Journals (Sweden)
Peng Liu
2016-08-01
Full Text Available Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB which acts as one of the key components in trans-translation, and alternative ribosome-rescue factor A (ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR when treating in 2.0% KCl. Thus,the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti
The S4-S5 linker acts as a signal integrator for HERG K+ channel activation and deactivation gating.
Directory of Open Access Journals (Sweden)
Chai Ann Ng
Full Text Available Human ether-à-go-go-related gene (hERG K(+ channels have unusual gating kinetics. Characterised by slow activation/deactivation but rapid inactivation/recovery from inactivation, the unique gating kinetics underlie the central role hERG channels play in cardiac repolarisation. The slow activation and deactivation kinetics are regulated in part by the S4-S5 linker, which couples movement of the voltage sensor domain to opening of the activation gate at the distal end of the inner helix of the pore domain. It has also been suggested that cytosolic domains may interact with the S4-S5 linker to regulate activation and deactivation kinetics. Here, we show that the solution structure of a peptide corresponding to the S4-S5 linker of hERG contains an amphipathic helix. The effects of mutations at the majority of residues in the S4-S5 linker of hERG were consistent with the previously identified role in coupling voltage sensor movement to the activation gate. However, mutations to Ser543, Tyr545, Gly546 and Ala548 had more complex phenotypes indicating that these residues are involved in additional interactions. We propose a model in which the S4-S5 linker, in addition to coupling VSD movement to the activation gate, also contributes to interactions that stabilise the closed state and a separate set of interactions that stabilise the open state. The S4-S5 linker therefore acts as a signal integrator and plays a crucial role in the slow deactivation kinetics of the channel.
Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?
Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo
2017-04-15
Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr
Energy Technology Data Exchange (ETDEWEB)
Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)
1993-12-01
The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)
Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes
2014-12-01
During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.
Metastasis-inducing S100A4 protein is associated with the disease activity of rheumatoid arthritis
DEFF Research Database (Denmark)
Oslejsková, Lucie; Grigorian, Mariam; Hulejová, Hana
2009-01-01
To evaluate the association between metastasis-inducing protein S100A4 and disease activity in patients with RA, and to demonstrate the effect of TNF-alpha blocking therapy on plasma levels of S100A4 in these patients.......To evaluate the association between metastasis-inducing protein S100A4 and disease activity in patients with RA, and to demonstrate the effect of TNF-alpha blocking therapy on plasma levels of S100A4 in these patients....
cDNA, genomic sequence cloning and analysis of the ribosomal ...
African Journals Online (AJOL)
Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...
Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.
Ahuja, Richa; Kumar, Vijay
2017-07-01
RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
Ana Laura Sanchez-Sandoval
Full Text Available Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA and low-voltage (LVA activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.
Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel
2018-01-01
Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447
Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos
2018-01-01
Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
International Nuclear Information System (INIS)
Hagedorn, Claudia; King, Stephen F.; Luhn, Christoph
2012-01-01
Following the recent results from Daya Bay and RENO, which measure the lepton mixing angle θ 13 l ≈0.15, we revisit a supersymmetric (SUSY) S 4 ×SU(5) model, which predicts tri-bimaximal (TB) mixing in the neutrino sector with θ 13 l being too small in its original version. We show that introducing one additional S 4 singlet flavon into the model gives rise to a sizable θ 13 l via an operator which leads to the breaking of one of the two Z 2 symmetries preserved in the neutrino sector at leading order (LO). The results of the original model for fermion masses, quark mixing and the solar mixing angle are maintained to good precision. The atmospheric and solar mixing angle deviations from TB mixing are subject to simple sum rule bounds.
Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues
International Nuclear Information System (INIS)
Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.
1990-01-01
The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins
Yin; Ye; Yu; Liu
2010-01-01
A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.
Yin, Bo; Ye, Dong-Nai; Yu, Kai-Hui; Liu, Liang-Xian
2010-04-16
A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 degrees C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.
Structural interactions between lipids, water and S1-S4 voltage-sensing domains.
Krepkiy, Dmitriy; Gawrisch, Klaus; Swartz, Kenton J
2012-11-02
Membrane proteins serve crucial signaling and transport functions, yet relatively little is known about their structures in membrane environments or how lipids interact with these proteins. For voltage-activated ion channels, X-ray structures suggest that the mobile voltage-sensing S4 helix would be exposed to the membrane, and functional studies reveal that lipid modification can profoundly alter channel activity. Here, we use solid-state NMR to investigate structural interactions of lipids and water with S1-S4 voltage-sensing domains and to explore whether lipids influence the structure of the protein. Our results demonstrate that S1-S4 domains exhibit extensive interactions with lipids and that these domains are heavily hydrated when embedded in a membrane. We also find evidence for preferential interactions of anionic lipids with S1-S4 domains and that these interactions have lifetimes on the timescale of ≤ 10(-3)s. Arg residues within S1-S4 domains are well hydrated and are positioned in close proximity to lipids, exhibiting local interactions with both lipid headgroups and acyl chains. Comparative studies with a positively charged lipid lacking a phosphodiester group reveal that this lipid modification has only modest effects on the structure and hydration of S1-S4 domains. Taken together, our results demonstrate that Arg residues in S1-S4 voltage-sensing domains reside in close proximity to the hydrophobic interior of the membrane yet are well hydrated, a requirement for carrying charge and driving protein motions in response to changes in membrane voltage. Published by Elsevier Ltd.
Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit
Energy Technology Data Exchange (ETDEWEB)
Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.
2008-01-01
The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.
Trapping the ribosome to control gene expression.
Boehringer, Daniel; Ban, Nenad
2007-09-21
Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.
Directory of Open Access Journals (Sweden)
Bo Yin
2010-04-01
Full Text Available A general approach to (4S,5S-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl amides 10 based on a diastereoselective reduction of (5S,6RS-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.
Akten, Bikem; Tangredi, Michelle M.; Jauch, Eike; Roberts, Mary A.; Ng, Fanny; Raabe, Thomas; Jackson, F. Rob
2009-01-01
There is a universal requirement for post-translational regulatory mechanisms in circadian clock systems. Previous work in Drosophila has identified several kinases, phosphatases and an E3 ligase that are critical for determining the nuclear translocation and/or stability of clock proteins. The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. In mammals, RSK1 is a light- and clock-regulated kinase known to be activated by the MAPK pathway, but there is no direct evidence that it functions as a component of the circadian system. Here, we show that Drosophila S6KII RNA displays rhythms in abundance, indicative of circadian control. Importantly, an S6KII null mutant exhibits a short-period circadian phenotype that can be rescued by expression of the wild-type gene in clock neurons, indicating a role for S6KII in the molecular oscillator. Peak PER clock protein expression is elevated in the mutant, indicative of enhanced stability, whereas per mRNA level is decreased, consistent with enhanced feedback repression. Gene reporter assays show that decreased S6KII is associated with increased PER repression. Surprisingly, we demonstrate a physical interaction between S6KII and the Casein Kinase 2 regulatory subunit (CK2β), suggesting a functional relationship between the two kinases. In support of such a relationship, there are genetic interactions between S6KII and CK2 mutations, in vivo, which indicate that CK2 activity is required for S6KII action. We propose that the two kinases cooperate within clock neurons to fine-tune circadian period, improving the precision of the clock mechanism. PMID:19144847
Energy Technology Data Exchange (ETDEWEB)
Serrano, Pauline N. [Department of Chemistry, University of California, Davis CA 95616 USA; Wang, Hongxin [Department of Chemistry, University of California, Davis CA 95616 USA; Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA 94720 USA; Crack, Jason C. [Centre for Molecular and Structural Biochemistry, School of Chemistry, University of East Anglia, Norwich Research Park Norwich NR4 7TJ UK; Prior, Christopher [Centre for Molecular and Structural Biochemistry, School of Chemistry, University of East Anglia, Norwich Research Park Norwich NR4 7TJ UK; Hutchings, Matthew I. [School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ UK; Thomson, Andrew J. [Centre for Molecular and Structural Biochemistry, School of Chemistry, University of East Anglia, Norwich Research Park Norwich NR4 7TJ UK; Kamali, Saeed [University of Tennessee Space Institute, Tullahome TN 37388-9700 USA; Yoda, Yoshitaka [Research and Utilization Division, SPring-8/JASRI, 1-1-1 Kouto, Sayo Hyogo 679-5198 Japan; Zhao, Jiyong [Advanced Photon Source, Argonne National Laboratory, Argonne IL 60439 USA; Hu, Michael Y. [Advanced Photon Source, Argonne National Laboratory, Argonne IL 60439 USA; Alp, Ercan E. [Advanced Photon Source, Argonne National Laboratory, Argonne IL 60439 USA; Oganesyan, Vasily S. [Centre for Molecular and Structural Biochemistry, School of Chemistry, University of East Anglia, Norwich Research Park Norwich NR4 7TJ UK; Le Brun, Nick E. [Centre for Molecular and Structural Biochemistry, School of Chemistry, University of East Anglia, Norwich Research Park Norwich NR4 7TJ UK; Cramer, Stephen P. [Department of Chemistry, University of California, Davis CA 95616 USA; Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA 94720 USA
2016-10-25
The reaction of protein-bound iron–sulfur (Fe-S) clusters with nitric oxide (NO) plays key roles in NO-mediated toxicity and signaling. Elucidation of the mechanism of the reaction of NO with DNA regulatory proteins that contain Fe-S clusters has been hampered by a lack of information about the nature of the iron-nitrosyl products formed. Herein, we report nuclear resonance vibrational spectroscopy (NRVS) and density functional theory (DFT) calculations that identify NO reaction products in WhiD and NsrR, regulatory proteins that use a [4Fe-4S] cluster to sense NO. This work reveals that nitrosylation yields multiple products structurally related to Roussin's Red Ester (RRE, [Fe2(NO)4(Cys)2]) and Roussin's Black Salt (RBS, [Fe4(NO)7S3]. In the latter case, the absence of 32S/34S shifts in the Fe-S region of the NRVS spectra suggest that a new species, Roussin's Black Ester (RBE), may be formed, in which one or more of the sulfide ligands is replaced by Cys thiolates.
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-02-01
We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.
Alekseeva, O. S.; Devdariani, A. Z.; Grigorian, G. M.; Lednev, M. G.; Zagrebin, A. L.
2017-02-01
This study is devoted to the theoretical investigation of the quasimolecular emission of Xe*-He and Kr*-He collision pairs near the Xe (5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance atomic lines. The potential curves of the quasimolecules Xe(5p 56s) + He and Kr(4p 55s) + He have been obtained with the use of the effective Hamiltonian and pseudopotential methods. Based on these potential curves the processes of quasimolecular emission of Xe*+He and Kr*+He mixtures have been considered and the spectral distributions I(ħΔω) of photons emitted have been obtained in the framework of quasistatic approximation.
Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W
2006-01-01
The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.
Genetic selection and DNA sequences of 4.5S RNA homologs
DEFF Research Database (Denmark)
Brown, S; Thon, G; Tolentino, E
1989-01-01
A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...
Total synthesis of (3S, 5R, 3'S, 5'R)-capsorubin
International Nuclear Information System (INIS)
Frederico, Daniel; Constantino, Mauricio G.; Donate, Paulo M.
2009-01-01
The total synthesis of enantiomerically enriched (3S, 5R, 3'S, 5'R)-capsorubin (1) by aldol condensation of (1R, 4S)-1-(4-hydroxy-1,2,2-trimethyl-cyclopentyl)ethanone (2a) and crocetindial (3) is described. An alternative, short eight-step synthesis of the optically active compound 2a (ee 89%) is also reported. (author)
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben
2018-01-04
sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Reassembly of S-layer proteins
International Nuclear Information System (INIS)
Pum, Dietmar; Sleytr, Uwe B
2014-01-01
Crystalline bacterial cell surface layers (S-layers) represent the outermost cell envelope component in a broad range of bacteria and archaea. They are monomolecular arrays composed of a single protein or glycoprotein species and represent the simplest biological membranes developed during evolution. They are highly porous protein mesh works with unit cell sizes in the range of 3 to 30 nm, and pore sizes of 2 to 8 nm. S-layers are usually 5 to 20 nm thick (in archaea, up to 70 nm). S-layer proteins are one of the most abundant biopolymers on earth. One of their key features, and the focus of this review, is the intrinsic capability of isolated native and recombinant S-layer proteins to form self-assembled mono- or double layers in suspension, at solid supports, the air-water interface, planar lipid films, liposomes, nanocapsules, and nanoparticles. The reassembly is entropy-driven and a fascinating example of matrix assembly following a multistage, non-classical pathway in which the process of S-layer protein folding is directly linked with assembly into extended clusters. Moreover, basic research on the structure, synthesis, genetics, assembly, and function of S-layer proteins laid the foundation for their application in novel approaches in biotechnology, biomimetics, synthetic biology, and nanotechnology. (topical review)
Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.
Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger
2005-11-01
Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.
Anti-thrombin III, Protein C, and Protein S deficiency in acute coronary syndrome
Directory of Open Access Journals (Sweden)
Dasnan Ismail
2002-06-01
Full Text Available The final most common pathway for the majority of coronary artery disease is occlusion of a coronary vessel. Under normal conditions, antithrombin III (AT III, protein C, and protein S as an active protein C cofactor, are natural anticoagulants (hemostatic control that balances procoagulant activity (thrombin antithrombin complex balance to prevent thrombosis. If the condition becomes unbalanced, natural anticoagulants and the procoagulants can lead to thrombosis. Thirty subjects with acute coronary syndrome (ACS were studied for the incidence of antithrombin III (AT III, protein C, and protein S deficiencies, and the result were compare to the control group. Among patients with ACS, the frequency of distribution of AT-III with activity < 75% were 23,3% (7 of 30, and only 6,7% ( 2 of 30 in control subject. No one of the 30 control subject have protein C activity deficient, in ACS with activity < 70% were 13,3% (4 of 30. Fifteen out of the 30 (50% control subjects had protein S activity deficiency, while protein S deficiency activity < 70% was found 73.3.% (22 out of 30. On linear regression, the deterministic coefficient of AT-III activity deficiency to the development ACS was 13,25 %, and the deterministic coefficient of protein C activity deficient to the development of ACS was 9,06 %. The cut-off point for AT-III without protein S deficiency expected to contribute to the development of vessel disease was 45%. On discriminant analysis, protein C activity deficiency posed a risk for ACS of 4,5 greater than non deficient subjects, and AT-III activity deficiency posed a risk for ACS of 3,5 times greater than non deficient subjects. On binary logistic regression, protein S activity acted only as a reinforcing factor of AT-III activity deficiency in the development of ACS. Protein C and AT III deficiency can trigger ACS, with determinant coefficients of 9,06% and 13,25% respectively. Low levels of protein C posed a greater risk of
Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan
2012-01-01
5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.
Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15
International Nuclear Information System (INIS)
Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.
1987-01-01
A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed
Thioredoxin 1 regulation of protein S-desulfhydration
Directory of Open Access Journals (Sweden)
Youngjun Ju
2016-03-01
Full Text Available The importance of H2S in biology and medicine has been widely recognized in recent years, and protein S-sulfhydration is proposed to mediate the direct actions of H2S bioactivity in the body. Thioredoxin 1 (Trx1 is an important reducing enzyme that cleaves disulfides in proteins and acts as an S-denitrosylase. The regulation of Trx1 on protein S-sulfhydration is unclear. Here we showed that Trx1 facilitates protein S-desulfhydration. Overexpression of Trx1 attenuated the basal level and H2S-induced protein S-sulfhydration by direct interaction with S-sulfhydrated proteins, i.e., glyceraldehyde 3-phosphate dehydrogenase and pyruvate carboxylase. In contrast, knockdown of Trx1 mRNA expression by short interfering RNA or blockage of Trx1 redox activity with PX12 or 2,4-dinitrochlorobenzene enhanced protein S-sulfhydration. Mutation of cysteine-32 but not cysteine-35 in the Trp–Cys32–Gly–Pro–Cys35 motif eliminated the binding of Trx1 with S-sulfhydrated proteins and abolished the S-desulfhydrating effect of Trx1. All these data suggest that Trx1 acts as an S-desulfhydrase.
International Nuclear Information System (INIS)
Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj
2008-01-01
The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1
Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria
2014-01-01
We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.
Brand, R C; Klootwijk, J; Planta, R J; Maden, B E
1978-01-01
The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.
Further biochemical characterization of Mycobacterium leprae laminin-binding proteins
Directory of Open Access Journals (Sweden)
M.A.M. Marques
2001-04-01
Full Text Available It has been demonstrated that the alpha2 chain of laminin-2 present on the surface of Schwann cells is involved in the process of attachment of Mycobacterium leprae to these cells. Searching for M. leprae laminin-binding molecules, in a previous study we isolated and characterized the cationic proteins histone-like protein (Hlp and ribosomal proteins S4 and S5 as potential adhesins involved in M. leprae-Schwann cell interaction. Hlp was shown to bind alpha2-laminins and to greatly enhance the attachment of mycobacteria to ST88-14 Schwann cells. In the present study, we investigated the laminin-binding capacity of the ribosomal proteins S4 and S5. The genes coding for these proteins were PCR amplified and their recombinant products were shown to bind alpha2-laminins in overlay assays. However, when tested in ELISA-based assays and in adhesion assays with ST88-14 cells, in contrast to Hlp, S4 and S5 failed to bind laminin and act as adhesins. The laminin-binding property and adhesin capacity of two basic host-derived proteins were also tested, and only histones, but not cytochrome c, were able to increase bacterial attachment to ST88-14 cells. Our data suggest that the alanine/lysine-rich sequences shared by Hlp and eukaryotic H1 histones might be involved in the binding of these cationic proteins to laminin.
Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C
2004-06-01
Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.
Crossland, Hannah; Timmons, James A; Atherton, Philip J
2017-12-01
Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).
Characterization of the Leptospira interrogans S10-spc-alpha operon
Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.
2000-01-01
A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an
Energy Technology Data Exchange (ETDEWEB)
Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)
2011-02-10
The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.
Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA
International Nuclear Information System (INIS)
Barciszewska, M.Z.
1994-01-01
In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab
The occurrence of gibberellin-binding protein(s) in pea
Energy Technology Data Exchange (ETDEWEB)
Liu, Z.H.
1988-01-01
In vitro gibberellin (GA) binding properties of a cytosol fraction from epicotyls of dwarf pea (Pisum sativum L. cv. Progress No. 9) and tall pea (Pisum sativum L. cv. Alaska) were investigated using ({sup 3}H)GA{sub 4} in a DEAE filter paper assay at 0-3 C. The binding obtained is saturable, reversible, and temperature labile in dwarf pea, and has a half-life of dissociation of 5-6 min. By varying the concentration of ({sup 3}H)GA{sub 4} in the incubation medium the Kd was estimated to be 120-140 nM in dwarf pea and 70 nM in tall pea. The number of binding sites (n) was estimated to be 0.66 and 0.43 pmole mg{sup {minus}1} soluble protein in dwarf pea and in tall pea, respectively. In competition binding assays, biologically active GAs, such as GA{sub 3} and GA{sub 4} could reduce the level of ({sup 3}H)GA{sub 4} binding much more than the biologically inactive GA{sub 4} methyl ester and epi-GA{sub 4}. Changes in gibberellin-binding protein(s) were studied during seed germination. While the Kd of the binding protein(s) for ({sup 3}H)GA{sub 4} remained the same, there was a marked increase in the number of binding sites from 24 h soaked seed to 8-day old seedlings. Also, the Kd and the number of binding sites in the GA-responsive apical part and in the nonresponsive basal part in the epicotyl were similar. The effect of light on gibberellin-binding protein in dwarf pea was also studied. The GA-binding protein in dwarf pea was partially purified by gel filtration and ion exchange chromatography.
Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G
2015-06-01
Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis
Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe
International Nuclear Information System (INIS)
Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.
2007-01-01
The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well
Murar, Claudia E; Harmand, Thibault J; Bode, Jeffrey W
2017-09-15
We describe a new route for the synthesis of (S)-N-Boc-5-oxaproline. This building block is a key element for the chemical synthesis of proteins with the α-ketoacid-hydroxylamine (KAHA) ligation. The new synthetic pathway to the enantiopure oxaproline is based on a chiral amine mediated enantioselective conjugate addition of a hydroxylamine to trans-4-oxo-2-butenoate. This route is practical, scalable and economical and provides decagram amounts of material for protein synthesis and conversion to other protected forms of (S)-oxaproline. Copyright © 2017 Elsevier Ltd. All rights reserved.
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
Long, Katherine S.
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525
Liu, Peng; Chen, Yong; Wang, Dan; Tang, Yanqiong; Tang, Hongqian; Song, Haichao; Sun, Qun; Zhang, Yueling; Liu, Zhu
2016-01-01
Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA) in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides) was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN) as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB) which acts as one of the key components in trans-translation, and ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H) employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl) and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR) when treating in 2.0% KCl. Thus, the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti-microbial drugs targeted to the ribosome rescued factors in A
Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.
Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz
2014-12-16
5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Denslow, N.D.; O'Brien, T.W.
1984-01-01
To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles
Lumpy AdS5× S5 black holes and black belts
International Nuclear Information System (INIS)
Dias, Óscar J.C.; Santos, Jorge E.; Way, Benson
2015-01-01
Sufficiently small Schwarzschild black holes in global AdS 5 ×S 5 are Gregory-Laflamme unstable. We construct new families of black hole solutions that bifurcate from the onset of this instability and break the full SO(6) symmetry group of the S 5 down to SO(5). These new “lumpy" solutions are labelled by the harmonics ℓ. We find evidence that the ℓ=1 branch never dominates the microcanonical/canonical ensembles and connects through a topology-changing merger to a localised black hole solution with S 8 topology. We argue that these S 8 black holes should become the dominant phase in the microcanonical ensemble for small enough energies, and that the transition to Schwarzschild black holes is first order. Furthermore, we find two branches of solutions with ℓ=2. We expect one of these branches to connect to a solution containing two localised black holes, while the other branch connects to a black hole solution with horizon topology S 4 ×S 4 which we call a “black belt”.
DEFF Research Database (Denmark)
Bräuner-Osborne, Hans; Krogsgaard-Larsen, P
1998-01-01
1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...
DEFF Research Database (Denmark)
Belsham, Graham; Nielsen, Inge; Normann, Preben
2008-01-01
The initiation of protein synthesis on mRNAs within eukaryotic cells is achieved either by a 5' cap-dependent mechanism or through internal initiation directed by an internal ribosome entry site (IRES). Picornavirus IRES elements, located in the 59 untranslated region (5'UTR), contain extensive s...
Energy Technology Data Exchange (ETDEWEB)
Brown, James Mike [Department of Pharmacology, Physiology and Toxicology, Joan C. Edwards School of Medicine, Huntington, WV (United States); Kuhlman, Christopher [Southwest Environmental Health Sciences Center, Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona Health Sciences Center, Tucson, AZ (United States); Terneus, Marcus V. [Department of Pharmacology, Physiology and Toxicology, Joan C. Edwards School of Medicine, Huntington, WV (United States); Labenski, Matthew T. [Southwest Environmental Health Sciences Center, Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona Health Sciences Center, Tucson, AZ (United States); Lamyaithong, Andre Benja; Ball, John G. [Department of Pharmacology, Physiology and Toxicology, Joan C. Edwards School of Medicine, Huntington, WV (United States); Lau, Serrine S. [Southwest Environmental Health Sciences Center, Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona Health Sciences Center, Tucson, AZ (United States); Valentovic, Monica A., E-mail: Valentov@marshall.edu [Department of Pharmacology, Physiology and Toxicology, Joan C. Edwards School of Medicine, Huntington, WV (United States)
2014-12-01
Acetaminophen (APAP) hepatotoxicity is protected by S-adenosyl-L-methionine (SAMe) treatment 1 hour (h) after APAP in C57/Bl6 mice. This study examined protein carbonylation as well as mitochondrial and cytosolic protein adduction by 4-hydroxynonenal (4-HNE) using mass spectrometry (MS) analysis. Additional studies investigated the leakage of mitochondrial proteins and 4-HNE adduction of these proteins. Male C57/Bl6 mice (n = 5/group) were divided into the following groups and treated as indicated: Veh (15 ml/kg water, ip), SAMe (1.25 mmol/kg, ip), APAP (250 mg/kg), and SAMe given 1 h after APAP (S + A). APAP toxicity was confirmed by an increase (p < 0.05) in plasma ALT (U/l) and liver weight/10 g body weight relative to the Veh, SAMe and S + A groups 4 h following APAP treatment. SAMe administered 1 h post-APAP partially corrected APAP hepatotoxicity as ALT and liver weight/10 g body weights were lower in the S + A group compared the APAP group. APAP induced leakage of the mitochondrial protein, carbamoyl phosphate synthase-1 (CPS-1) into the cytosol and which was reduced in the S + A group. SAMe further reduced the extent of APAP mediated 4-HNE adduction of CPS-1. MS analysis of hepatic and mitochondrial subcellular fractions identified proteins from APAP treated mice. Site specific 4-HNE adducts were identified on mitochondrial proteins sarcosine dehydrogenase and carbamoyl phosphate synthase-1 (CPS-1). In summary, APAP is associated with 4-HNE adduction of proteins as identified by MS analysis and that CPS-1 leakage was greater in APAP treated mice. SAMe reduced the extent of 4-HNE adduction of proteins as well as leakage of CPS-1. - Highlights: • Acetaminophen (APAP) toxicity protected by S-adenosylmethionine (SAMe) • 4-Hydroxynonenal adducted to sarcosine dehydrogenase • 4-Hydroxynonenal adducted to carbamoyl phosphate synthetase-1 • SAMe reduced APAP mediated CPS-1 mitochondrial leakage.
International Nuclear Information System (INIS)
Brown, James Mike; Kuhlman, Christopher; Terneus, Marcus V.; Labenski, Matthew T.; Lamyaithong, Andre Benja; Ball, John G.; Lau, Serrine S.; Valentovic, Monica A.
2014-01-01
Acetaminophen (APAP) hepatotoxicity is protected by S-adenosyl-L-methionine (SAMe) treatment 1 hour (h) after APAP in C57/Bl6 mice. This study examined protein carbonylation as well as mitochondrial and cytosolic protein adduction by 4-hydroxynonenal (4-HNE) using mass spectrometry (MS) analysis. Additional studies investigated the leakage of mitochondrial proteins and 4-HNE adduction of these proteins. Male C57/Bl6 mice (n = 5/group) were divided into the following groups and treated as indicated: Veh (15 ml/kg water, ip), SAMe (1.25 mmol/kg, ip), APAP (250 mg/kg), and SAMe given 1 h after APAP (S + A). APAP toxicity was confirmed by an increase (p < 0.05) in plasma ALT (U/l) and liver weight/10 g body weight relative to the Veh, SAMe and S + A groups 4 h following APAP treatment. SAMe administered 1 h post-APAP partially corrected APAP hepatotoxicity as ALT and liver weight/10 g body weights were lower in the S + A group compared the APAP group. APAP induced leakage of the mitochondrial protein, carbamoyl phosphate synthase-1 (CPS-1) into the cytosol and which was reduced in the S + A group. SAMe further reduced the extent of APAP mediated 4-HNE adduction of CPS-1. MS analysis of hepatic and mitochondrial subcellular fractions identified proteins from APAP treated mice. Site specific 4-HNE adducts were identified on mitochondrial proteins sarcosine dehydrogenase and carbamoyl phosphate synthase-1 (CPS-1). In summary, APAP is associated with 4-HNE adduction of proteins as identified by MS analysis and that CPS-1 leakage was greater in APAP treated mice. SAMe reduced the extent of 4-HNE adduction of proteins as well as leakage of CPS-1. - Highlights: • Acetaminophen (APAP) toxicity protected by S-adenosylmethionine (SAMe) • 4-Hydroxynonenal adducted to sarcosine dehydrogenase • 4-Hydroxynonenal adducted to carbamoyl phosphate synthetase-1 • SAMe reduced APAP mediated CPS-1 mitochondrial leakage
Mitonuclear protein imbalance as a conserved longevity mechanism
Houtkooper, Riekelt H.; Mouchiroud, Laurent; Ryu, Dongryeol; Moullan, Norman; Katsyuba, Elena; Knott, Graham; Williams, Robert W.; Auwerx, Johan
2013-01-01
Longevity is regulated by a network of closely linked metabolic systems. We used a combination of mouse population genetics and RNA interference in Caenorhabditis elegans to identify mitochondrial ribosomal protein S5 (Mrps5) and other mitochondrial ribosomal proteins as metabolic and longevity
Directory of Open Access Journals (Sweden)
Yun-Chieh Tasi
2015-04-01
Full Text Available Overexpression of the amyloid precursor protein (APP and the hyperphosphorylation of the tau protein are vital in the understanding of the cause of Alzheimer’s disease (AD. As a consequence, regulation of the expression of both APP and tau proteins is one important approach in combating AD. The APP and tau proteins can be targeted at the levels of transcription, translation and protein structural integrity. This paper reports the utilization of a bi-cistronic vector containing either APP or tau internal ribosome entry site (IRES elements flanked by β-galactosidase gene (cap-dependent and secreted alkaline phosphatase (SEAP (cap-independent to discern the mechanism of action of memantine, an N-methyl-d-aspartate (NMDA receptor antagonist. Results indicate that memantine could reduce the activity of both the APP and tau IRES at a concentration of ~10 μM (monitored by SEAP activity without interfering with the cap-dependent translation as monitored by the β-galactosidase assay. Western blot analysis of the tau protein in neuroblastoma (N2A and rat hippocampal cells confirmed the halting of the expression of the tau proteins. We also employed this approach to identify a preparation named NB34, extracts of Boussingaultia baselloides (madeira-vine fermented with Lactobacillus spp., which can function similarly to memantine in both IRES of APP and Tau. The water maze test demonstrated that NB34 could improve the spatial memory of a high fat diet induced neurodegeneration in apolipoprotein E-knockout (ApoE−/− mice. These results revealed that the bi-cistronic vector provided a simple, and effective platform in screening and establishing the mechanistic action of potential compounds for the treatment and management of AD.
Energy Technology Data Exchange (ETDEWEB)
Pereira, Larissa Miranda
2009-07-01
The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813{sub Q}M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by {beta}- sheet feature. (author)
Bruining, J.; Fijnaut, H.M.
We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due
Directory of Open Access Journals (Sweden)
Mark A. Smith
2015-04-01
Full Text Available Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC and agouti-related protein (AgRP neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons.
Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons
Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,
The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.
Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P
2007-01-01
The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.
Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G
2011-05-01
The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.
The metastasis-associated Mts1(S100A4) protein could act as an angiogenic factor
DEFF Research Database (Denmark)
Ambartsumian, N; Klingelhöfer, Jörg; Grigorian, M
2001-01-01
The involvement of Mts1(S100A4), a small Ca(2+)-binding protein in tumor progression and metastasis had been demonstrated. However, the mechanism by which mts1(S100A4) promoted metastasis had not been identified. Here we demonstrated that Mts1(S100A4) had significant stimulatory effect on the ang...
Precision calculation of 1/4-BPS Wilson loops in AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany); Puletti, V. Giangreco M. [Science Institute, University of Iceland,Dunhaga 3, 107 Reykjavik (Iceland); Griguolo, L. [Dipartimento di Fisica e Scienze della Terra, Università di Parma andINFN Gruppo Collegato di Parma,Viale G.P. Usberti 7/A, 43100 Parma (Italy); Seminara, D. [Dipartimento di Fisica, Università di Firenze and INFN Sezione di Firenze,Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany)
2016-02-16
We study the strong coupling behaviour of 1/4-BPS circular Wilson loops (a family of “latitudes') in N=4 Super Yang-Mills theory, computing the one-loop corrections to the relevant classical string solutions in AdS{sub 5}×S{sup 5}. Supersymmetric localization provides an exact result that, in the large ’t Hooft coupling limit, should be reproduced by the sigma-model approach. To avoid ambiguities due to the absolute normalization of the string partition function, we compare the ratio between the generic latitude and the maximal 1/2-BPS circle: any measure-related ambiguity should simply cancel in this way. We use the Gel’fand-Yaglom method with Dirichlet boundary conditions to calculate the relevant functional determinants, that present some complications with respect to the standard circular case. After a careful numerical evaluation of our final expression we still find disagreement with the localization answer: the difference is encoded into a precise “remainder function'. We comment on the possible origin and resolution of this discordance.
ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.
Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J
2016-03-22
Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.
The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX
International Nuclear Information System (INIS)
Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.
1976-01-01
With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)
Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.
Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad
2015-07-08
Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.
Directory of Open Access Journals (Sweden)
Silar Philippe
2000-11-01
Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.
Lalucque, Hervé; Silar, Philippe
2000-01-01
Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985
The hyperfine structure constants for the 4s24p and 4s25s states of Ga
International Nuclear Information System (INIS)
Wang Qingmin; Dong Chenzhong
2012-01-01
The hyperfine structure (hfs) constants for the states 4s 2 4p 2 P 1/2,3/2 and 4s 2 5s 2 S 1/2 of 71 Ga were calculated using the GRASP2K package based on the multiconfiguration Dirac-Fock (MCDF) method. The results indicated that the core polarization effect was important for the hyperfine structure constants. (authors)
Andreeva, Irena
2018-01-01
During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209
International Nuclear Information System (INIS)
Horvatic, V.; Vadla, C.; Movre, M.
1993-01-01
The collisional excitation transfer for the processes Rb * (5P 3/2 ) + K(4S 1/2 ) → Rb(5S 1/2 ) + K * (4P J ), J = 1/2, 3/2, was investigated using two-photon laser excitation techniques with a thermionic heat-pipe diode as a detector. The population densities of the K 4P J levels induced by collisions with excited Rb atoms as well as those produced by direct laser excitation of the potassium atoms were probed through the measurement of the thermionic signals generated due to the ionization of the potassium atoms emerging from the K(4P J ) → K(7S 1/2 ) excitation channel. (orig./WL)
In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis
Essers, P.B.M.
2013-01-01
Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome
Grove, Tyler L; Radle, Matthew I; Krebs, Carsten; Booker, Squire J
2011-12-14
The radical SAM (RS) proteins RlmN and Cfr catalyze methylation of carbons 2 and 8, respectively, of adenosine 2503 in 23S rRNA. Both reactions are similar in scope, entailing the synthesis of a methyl group partially derived from S-adenosylmethionine (SAM) onto electrophilic sp(2)-hybridized carbon atoms via the intermediacy of a protein S-methylcysteinyl (mCys) residue. Both proteins contain five conserved Cys residues, each required for turnover. Three cysteines lie in a canonical RS CxxxCxxC motif and coordinate a [4Fe-4S]-cluster cofactor; the remaining two are at opposite ends of the polypeptide. Here we show that each protein contains only the one "radical SAM" [4Fe-4S] cluster and the two remaining conserved cysteines do not coordinate additional iron-containing species. In addition, we show that, while wild-type RlmN bears the C355 mCys residue in its as-isolated state, RlmN that is either engineered to lack the [4Fe-4S] cluster by substitution of the coordinating cysteines or isolated from Escherichia coli cultured under iron-limiting conditions does not bear a C355 mCys residue. Reconstitution of the [4Fe-4S] cluster on wild-type apo RlmN followed by addition of SAM results in rapid production of S-adenosylhomocysteine (SAH) and the mCys residue, while treatment of apo RlmN with SAM affords no observable reaction. These results indicate that in Cfr and RlmN, SAM bound to the unique iron of the [4Fe-4S] cluster displays two reactivities. It serves to methylate C355 of RlmN (C338 of Cfr), or to generate the 5'-deoxyadenosyl 5'-radical, required for substrate-dependent methyl synthase activity. © 2011 American Chemical Society
Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng
2016-07-01
Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.
Barriuso, Begoña; Antolín, Pilar; Arias, F Javier; Girotti, Alessandra; Jiménez, Pilar; Cordoba-Diaz, Manuel; Cordoba-Diaz, Damián; Girbés, Tomás
2016-06-10
Endoglin (CD105) is an accessory component of the TGF-β receptor complex, which is expressed in a number of tissues and over-expressed in the endothelial cells of tumor neovasculature. Targeting endoglin with immunotoxins containing type 2 ribosome-inactivating proteins has proved an effective tool to reduce blood supply to B16 mice tumor xenografts. We prepared anti-endoglin immunotoxin (IT)-containing recombinant musarmin 1 (single chain ribosome-inactivating proteins) linked to the mouse anti-human CD105 44G4 mouse monoclonal antibody via N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP). The immunotoxin specifically killed L929 fibroblast mouse cells transfected with the short form of human endoglin with IC50 values in the range of 5 × 10(-10) to 10(-9) M.
International Nuclear Information System (INIS)
Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji
2007-01-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21
YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis
Czech Academy of Sciences Publication Activity Database
Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří
2007-01-01
Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007
New holographic limit of AdS5(multiply-in-circle sign)S5
International Nuclear Information System (INIS)
Hatsuda, Machiko; Siegel, Warren
2003-01-01
We reexamine the projective light cone limit of the gauge-invariant Green-Schwarz action on five-dimensional anti-de Sitter (multiply-in-circle sign) the five-sphere. It implies the usual holography for AdS 5 , but also (a complex) one for S 5 . The result is N=4 projective superspace, which unlike N=4 harmonic superspace can describe N=4 super Yang-Mills theory off shell
Zhao, Huayan
2015-08-13
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming
2015-01-01
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Boehm, Jeffrey D; Nguyen, Vi; Tashiro, Rebecca M; Anderson, Dale; Shi, Chun; Wu, Xiaoguang; Woodrow, Lorna; Yu, Kangfu; Cui, Yuhai; Li, Zenglu
2018-03-01
Four soybean storage protein subunit QTLs were mapped using bulked segregant analysis and an F 2 population, which were validated with an F 5 RIL population. The storage protein globulins β-conglycinin (7S subunit) and glycinin (11S subunits) can affect the quantity and quality of proteins found in soybean seeds and account for more than 70% of the total soybean protein. Manipulating the storage protein subunits to enhance soymeal nutrition and for desirable tofu manufacturing characteristics are two end-use quality goals in soybean breeding programs. To aid in developing soybean cultivars with desired seed composition, an F 2 mapping population (n = 448) and an F 5 RIL population (n = 180) were developed by crossing high protein cultivar 'Harovinton' with the breeding line SQ97-0263_3-1a, which lacks the 7S α', 11S A 1 , 11S A 2 , 11S A 3 and 11S A 4 subunits. The storage protein composition of each individual in the F 2 and F 5 populations were profiled using SDS-PAGE. Based on the presence/absence of the subunits, genomic DNA bulks were formed among the F 2 plants to identify genomic regions controlling the 7S α' and 11S protein subunits. By utilizing polymorphic SNPs between the bulks characterized with Illumina SoySNP50K iSelect BeadChips at targeted genomic regions, KASP assays were designed and used to map QTLs causing the loss of the subunits. Soybean storage protein QTLs were identified on Chromosome 3 (11S A 1 ), Chromosome 10 (7S α' and 11S A 4 ), and Chromosome 13 (11S A 3 ), which were also validated in the F 5 RIL population. The results of this research could allow for the deployment of marker-assisted selection for desired storage protein subunits by screening breeding populations using the SNPs linked with the subunits of interest.
Directory of Open Access Journals (Sweden)
Frank S Choveau
2012-07-01
Full Text Available Voltage-gated potassium (Kv channels are tetramers, each subunit presenting six transmembrane segments (S1-S6, with each S1-S4 segments forming a voltage-sensing domain (VSD and the four S5-S6 forming both the conduction pathway and its gate. S4 segments control the opening of the intracellular activation gate in response to changes in membrane potential. Crystal structures of several voltage-gated ion channels in combination with biophysical and mutagenesis studies highlighted the critical role of the S4-S5 linker (S4S5L and of the S6 C-terminal part (S6T in the coupling between the VSD and the activation gate. Several mechanisms have been proposed to describe the coupling at a molecular scale. This review summarizes the mechanisms suggested for various voltage-gated ion channels, including a mechanism that we described for KCNQ1, in which S4S5L is acting like a ligand binding to S6T to stabilize the channel in a closed state. As discussed in this review, this mechanism may explain the reverse response to depolarization in HCN-like channels. As opposed to S4S5L, the phosphoinositide, phosphatidylinositol 4,5-bisphosphate (PIP2, stabilizes KCNQ1 channel in an open state. Many other ion channels (not only voltage-gated require PIP2 to function properly, confirming its crucial importance as an ion channel co-factor. This is highlighted in cases in which an altered regulation of ion channels by PIP2 leads to channelopathies, as observed for KCNQ1. This review summarizes the state of the art on the two regulatory mechanisms that are critical for KCNQ1 and other voltage-gated channels function (PIP2 and S4-S5L, and assesses their potential physiological and pathophysiological roles.
Pakula, Kevin K; Hansen, Lykke H; Vester, Birte
2017-09-01
Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.
Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.
Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U
2018-01-01
The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.
Smith, Mark A; Katsouri, Loukia; Irvine, Elaine E; Hankir, Mohammed K; Pedroni, Silvia M A; Voshol, Peter J; Gordon, Matthew W; Choudhury, Agharul I; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J
2015-04-21
Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Tian, Zhancheng; Liu, Guangyuan; Yin, Hong; Luo, Jianxun; Guan, Guiquan; Luo, Jin; Xie, Junren; Zheng, Jinfeng; Yuan, Xiaosong; Wang, Fangfang; Shen, Hui; Tian, Meiyuan
2013-10-18
Ovine babesiosis and theileriosis are important hemoprotozoal diseases of sheep and goats in tropical and subtropical regions that lead to economic losses in these animals. PCR-restriction fragment length polymorphism (PCR-RFLP) is a reliable molecular diagnostic tool for discriminating Theileria or Babesia species in the same host. In this study, the DNA sequences of a ribosomal protein S8 (RPS8) gene from four species of piroplasms in China were used to develop a species-specific PCR-RFLP diagnostic tool. The sensitivity of the PCR assays was 0.1 pg DNA for B. motasi and 1 pg DNA for T. uilenbergi and 10 pg DNA for Babesia sp. Xinjiang-2005 and T. luwenshuni. The clear size difference of the PCR products allowed for a direct discrimination for B. motasi, Babesia sp. Xinjiang-2005 and ovine Theileria species (T. uilenbergi and T. luwenshuni), except that the mixed infection between T. uilenbergi and T. luwenshuni may be difficult to distinguish, simply after the electrophoretic separation of the amplification products. Further T. uilenbergi and T. luwenshuni diagnoses were made by digesting the PCR product with SacI. The established method could be applicable for the survey of parasite dynamics, and epidemiological studies as well as prevention and control of the disease. Copyright © 2013 Elsevier B.V. All rights reserved.
Studies on the catalytic rate constant of ribosomal peptidyltransferase.
Synetos, D; Coutsogeorgopoulos, C
1987-02-20
A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.
The nuclear import of ribosomal proteins is regulated by mTOR
Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.
2014-01-01
Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810
Directory of Open Access Journals (Sweden)
Sun Yu
2011-11-01
Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.
Ribosomal elongation factor 4 promotes cell death associated with lethal stress.
Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin
2014-12-09
Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has
Salaba, O; Rylková, K; Vadlejch, J; Petrtýl, M; Scháňková, S; Brožová, A; Jankovská, I; Jebavý, L; Langrová, I
2013-03-01
Trichuris nematodes were isolated from roe deer (Capreolus capreolus). At first, nematodes were determined using morphological and biometrical methods. Subsequently genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from ribosomal DNA (RNA) was amplified and sequenced using PCR techniques. With u sing morphological and biometrical methods, female nematodes were identified as Trichuris globulosa, and the only male was identified as Trichuris ovis. The females were classified into four morphotypes. However, analysis of the internal transcribed spacers (ITS1-5.8S-ITS2) of specimens did not confirm this classification. Moreover, the female individuals morphologically determined as T. globulosa were molecularly identified as Trichuris discolor. In the case of the only male molecular analysis match the result of the molecular identification. Furthermore, a comparative phylogenetic study was carried out with the ITS1 and ITS2 sequences of the Trichuris species from various hosts. A comparison of biometric information from T. discolor individuals from this study was also conducted.
Energy Technology Data Exchange (ETDEWEB)
Kowalski, K., E-mail: kamil.kowalski@put.poznan.pl [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland); Jurczyk, M.U. [Division of Mother’s and Child’s Health, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Wirstlein, P.K. [Department of Gynecology and Obstetrics, Division of Reproduction, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Jakubowicz, J.; Jurczyk, M. [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland)
2017-05-15
Highlights: • Ultrafine grained composites were formed by consolidating mechanically alloyed powders. • Mechanical properties were sensitive to the content of 45S5 Bioglass in Mg-4Y-5.5Dy-0.5Zr alloy. • Fluoride treated composites displayed superior corrosion resistance in Ringer solution. • Composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material. - Abstract: Bulk samples of an ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-x wt% 45S5 Bioglass (x = 0, 5) and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites have been synthesized by consolidating mechanically alloyed powders. The influence of the chemical composition on the microstructure, mechanical properties and corrosion behavior of bulk composites were studied. The sintering of (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass powders led to the formation of a bulk composite with grain size of approx. 95 nm. The corrosion behavior of Mg-based composites before and after hydrofluoric acid treatment was also investigated. The ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass composite was more corrosion resistant than the bulk Mg-4Y-5.5Dy-0.5Zr alloy after HF treatment. The in vitro biocompatibility of synthesized composites was evaluated and compared with microcrystalline magnesium. Magnesium, (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
New antiferromagnetic semiconductor CuCr1.5Sb0.5S4
International Nuclear Information System (INIS)
Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.
1993-01-01
New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.
Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong
2013-03-01
Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.
Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence
Directory of Open Access Journals (Sweden)
Ysabel Montoya
2000-08-01
Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
16S/18S ribosomal DNA clone library analysis of rumen microbial diversity
International Nuclear Information System (INIS)
Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.
2005-01-01
The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 10 6 protozoa/ml, 10 3 -10 7 fungi/ml, 10 10 bacteria/ml, and 10 9 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial
Pre-potential in the AdS{sub 5}×S{sup 5} type IIB superspace
Energy Technology Data Exchange (ETDEWEB)
Poláček, Martin; Siegel, Warren [C.N. Yang Institute for Theoretical Physics, State University of New York,100 Nicolls Rd., Stony Brook, NY 11794-3840 (United States)
2017-01-16
We found the pre-potential in the superspace with AdS{sub 5} × S{sup 5} background. The pre-potential appears as part of the vielbeins, without derivatives. In both subspaces (AdS{sub 5} and S{sup 5}) we used Poincaré coordinates. We picked one bulk coordinate in AdS{sub 5} and one bulk coordinate in S{sup 5} to define the space-cone gauge. Such space-cone gauge destroys the bulk Lorentz covariance. However, it still preserves boundary Lorentz covariance (and gives projective superspace) SO(3,1)⊗SO(4) and so symmetries of boundary CFT are manifest.
Directory of Open Access Journals (Sweden)
Begoña Barriuso
2016-06-01
Full Text Available Endoglin (CD105 is an accessory component of the TGF-β receptor complex, which is expressed in a number of tissues and over-expressed in the endothelial cells of tumor neovasculature. Targeting endoglin with immunotoxins containing type 2 ribosome-inactivating proteins has proved an effective tool to reduce blood supply to B16 mice tumor xenografts. We prepared anti-endoglin immunotoxin (IT—containing recombinant musarmin 1 (single chain ribosome-inactivating proteins linked to the mouse anti-human CD105 44G4 mouse monoclonal antibody via N-succinimidyl 3-(2-pyridyldithio propionate (SPDP. The immunotoxin specifically killed L929 fibroblast mouse cells transfected with the short form of human endoglin with IC50 values in the range of 5 × 10−10 to 10−9 M.
International Nuclear Information System (INIS)
Clemons, William M. Jr.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki
2001-01-01
We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 (angstrom) resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 (angstrom) resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.
DNA-repair protein hHR23a alters its protein structure upon binding proteasomal subunit S5a
Walters, Kylie J.; Lech, Patrycja J.; Goh, Amanda M.; Wang, Qinghua; Howley, Peter M.
2003-01-01
The Rad23 family of proteins, including the human homologs hHR23a and hHR23b, stimulates nucleotide excision repair and has been shown to provide a novel link between proteasome-mediated protein degradation and DNA repair. In this work, we illustrate how the proteasomal subunit S5a regulates hHR23a protein structure. By using NMR spectroscopy, we have elucidated the structure and dynamic properties of the 40-kDa hHR23a protein and show it to contain four structured domains connected by flexible linker regions. In addition, we reveal that these domains interact in an intramolecular fashion, and by using residual dipolar coupling data in combination with chemical shift perturbation analysis, we present the hHR23a structure. By itself, hHR23a adopts a closed conformation defined by the interaction of an N-terminal ubiquitin-like domain with two ubiquitin-associated domains. Interestingly, binding of the proteasomal subunit S5a disrupts the hHR23a interdomain interactions and thereby causes it to adopt an opened conformation. PMID:14557549
Wang, Hansen; Kim, Susan S; Zhuo, Min
2010-07-09
Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome.
Directory of Open Access Journals (Sweden)
Si-Nan Zhang
2012-02-01
Full Text Available RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A gene of the Giant Panda (Ailuropoda melanoleuca. The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids
On N=8 supergravity in AdS5 and N=4 superconformal Yang-Mills theory
International Nuclear Information System (INIS)
Ferrara, S.; Zaffaroni, A.; Froensdal, C.
1998-01-01
We discuss the spectrum of states of IIB supergravity on AdS 5 x S 5 in a manifest SU(2,2/4) invariant setting. The boundary fields are described in terms of N=4 superconformal Yang-Mills theory and the proposed correspondence between supergravity in AdS 5 and superconformal invariant singleton theory at the boundary is formulated in a N=4 superfield covariant language. (orig.)
DEFF Research Database (Denmark)
He, Yangzi
and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...
Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S
2003-09-01
The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.
Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.
Directory of Open Access Journals (Sweden)
Pierre Bonnin
2017-05-01
Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling
Hypoxic stress-induced changes in ribosomes of maize seedling roots
International Nuclear Information System (INIS)
Bailey-Serres, J.; Freeling, M.
1990-01-01
The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress
Magnetic and electrical properties of (FeIn2S4)1−x(CuIn5S8)x solid solutions
International Nuclear Information System (INIS)
Trukhanov, S.V.; Bodnar, I.V.; Zhafar, M.A.
2015-01-01
In this study, single crystals of FeIn 2 S 4 and CuIn 5 S 8 compounds, and (FeIn 2 S 4 ) 1−x (CuIn 5 S 8 ) x solid solutions were grown using the Bridgman method. The magnetic and electrical properties of the samples obtained were investigated at temperatures of 5–300 K and in a magnetic field range of 0–14 T. It was established that all of the solid solutions were paramagnets down to low temperatures of ~10 K. It was shown that the ground state of the magnetic phase of the samples was a spin glass state, where the freezing temperature increased monotonically with the increase in the concentration of Fe 2+ cations. All of the samples exhibited semiconductor characteristics in terms of electrical resistivity. The concentration-dependent critical magnetic temperatures, magnetic moment, and activation energy were plotted, which are probably explained by the magnetic state formation of the (FeIn 2 S 4 ) 1−x (CuIn 5 S 8 ) x solid solution single crystals based on the empirical Goodenough–Kanamori rules
Lifescience Database Archive (English)
Full Text Available somal protein S5 OS=Thermotoga sp. (s... 33 10.0 tr|B7RFH6|B7RFH6_9THEM Ribosomal protein S5 OS=Marinitoga piezo...6_9THEM Ribosomal protein S5 OS=Marinitoga piezophila KA3 GN=rpsE PE=4 SV=1 Length = 178 Score = 33.5 bits (
DEFF Research Database (Denmark)
Deshmukh, Atul S.; Treebak, Jonas Thue; Long, Yun Chau
2008-01-01
AMP-activated protein kinase (AMPK) is an important energy-sensing protein in skeletal muscle. Mammalian target of rapamycin (mTOR) mediates translation initiation and protein synthesis through ribosomal S6 kinase 1 (S6K1) and eukaryotic initiation factor 4E-binding protein 1 (4E-BP1). AMPK...... activation reduces muscle protein synthesis by down-regulating mTOR signaling, whereas insulin mediates mTOR signaling via Akt activation. We hypothesized that AMPK-mediated inhibitory effects on mTOR signaling depend on catalytic alpha2 and regulatory gamma3 subunits. Extensor digitorum longus muscle from...... (Thr37/46) (P mTOR targets, suggesting mTOR signaling is blocked by prior AMPK activation. The AICAR-induced inhibition was partly rescued...
Günther, Tobias J.; Raff, Johannes; Pollmann, Katrin
2016-01-01
Genomic analyses of Viridibacillus arvi JG-B58 that was previously isolated from heavy metal contaminated environment identified three different putative surface layer (S-layer) protein genes namely slp1, slp2, and slp3. All three genes are expressed during cultivation. At least two of the V. arvi JG-B58 S-layer proteins were visualized on the surface of living cells via atomic force microscopy (AFM). These S-layer proteins form a double layer with p4 symmetry. The S-layer proteins were isolated from the cells using two different methods. Purified S-layer proteins were recrystallized on SiO2 substrates in order to study the structure of the arrays and self-assembling properties. The primary structure of all examined S-layer proteins lack some features that are typical for Bacillus or Lysinibacillus S-layers. For example, they possess no SLH domains that are usually responsible for the anchoring of the proteins to the cell wall. Further, the pI values are relatively high ranging from 7.84 to 9.25 for the matured proteins. Such features are typical for S-layer proteins of Lactobacillus species although sequence comparisons indicate a close relationship to S-layer proteins of Lysinibacillus and Bacillus strains. In comparison to the numerous descriptions of S-layers, there are only a few studies reporting the concomitant existence of two different S-layer proteins on cell surfaces. Together with the genomic data, this is the first description of a novel type of S-layer proteins showing features of Lactobacillus as well as of Bacillus-type S-layer proteins and the first study of the cell envelope of Viridibacillus arvi. PMID:27285458
The Escherichia coli BolA Protein IbaG Forms a Histidine-Ligated [2Fe-2S]-Bridged Complex with Grx4.
Dlouhy, Adrienne C; Li, Haoran; Albetel, Angela-Nadia; Zhang, Bo; Mapolelo, Daphne T; Randeniya, Sajini; Holland, Ashley A; Johnson, Michael K; Outten, Caryn E
2016-12-13
Two ubiquitous protein families have emerged as key players in iron metabolism, the CGFS-type monothiol glutaredoxins (Grxs) and the BolA proteins. Monothiol Grxs and BolA proteins form heterocomplexes that have been implicated in Fe-S cluster assembly and trafficking. The Escherichia coli genome encodes members of both of these proteins families, namely, the monothiol glutaredoxin Grx4 and two BolA family proteins, BolA and IbaG. Previous work has demonstrated that E. coli Grx4 and BolA interact as both apo and [2Fe-2S]-bridged heterodimers that are spectroscopically distinct from [2Fe-2S]-bridged Grx4 homodimers. However, the physical and functional interactions between Grx4 and IbaG are uncharacterized. Here we show that co-expression of Grx4 with IbaG yields a [2Fe-2S]-bridged Grx4-IbaG heterodimer. In vitro interaction studies indicate that IbaG binds the [2Fe-2S] Grx4 homodimer to form apo Grx4-IbaG heterodimer as well as the [2Fe-2S] Grx4-IbaG heterodimer, altering the cluster stability and coordination environment. Additionally, spectroscopic and mutagenesis studies provide evidence that IbaG ligates the Fe-S cluster via the conserved histidine that is present in all BolA proteins and by a second conserved histidine that is present in the H/C loop of two of the four classes of BolA proteins. These results suggest that IbaG may function in Fe-S cluster assembly and trafficking in E. coli as demonstrated for other BolA homologues that interact with monothiol Grxs.
International Nuclear Information System (INIS)
Kobayashi, Hiroshi; Swapna, G. V. T.; Wu, Kuen-Phon; Afinogenova, Yuliya; Conover, Kenith; Mao, Binchen; Montelione, Gaetano T.; Inouye, Masayori
2012-01-01
A common obstacle to NMR studies of proteins is sample preparation. In many cases, proteins targeted for NMR studies are poorly expressed and/or expressed in insoluble forms. Here, we describe a novel approach to overcome these problems. In the protein S tag-intein (PSTI) technology, two tandem 92-residue N-terminal domains of protein S (PrS 2 ) from Myxococcus xanthus is fused at the N-terminal end of a protein to enhance its expression and solubility. Using intein technology, the isotope-labeled PrS 2 -tag is replaced with non-isotope labeled PrS 2 -tag, silencing the NMR signals from PrS 2 -tag in isotope-filtered 1 H-detected NMR experiments. This method was applied to the E. coli ribosome binding factor A (RbfA), which aggregates and precipitates in the absence of a solubilization tag unless the C-terminal 25-residue segment is deleted (RbfAΔ25). Using the PrS 2 -tag, full-length well-behaved RbfA samples could be successfully prepared for NMR studies. PrS 2 (non-labeled)-tagged RbfA (isotope-labeled) was produced with the use of the intein approach. The well-resolved TROSY-HSQC spectrum of full-length PrS 2 -tagged RbfA superimposes with the TROSY-HSQC spectrum of RbfAΔ25, indicating that PrS 2 -tag does not affect the structure of the protein to which it is fused. Using a smaller PrS-tag, consisting of a single N-terminal domain of protein S, triple resonance experiments were performed, and most of the backbone 1 H, 15 N and 13 C resonance assignments for full-length E. coli RbfA were determined. Analysis of these chemical shift data with the Chemical Shift Index and heteronuclear 1 H– 15 N NOE measurements reveal the dynamic nature of the C-terminal segment of the full-length RbfA protein, which could not be inferred using the truncated RbfAΔ25 construct. CS-Rosetta calculations also demonstrate that the core structure of full-length RbfA is similar to that of the RbfAΔ25 construct.
Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh
2013-08-01
The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.
Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T
2015-02-01
Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.
Directory of Open Access Journals (Sweden)
Ziliang Wang
Full Text Available Small ribosomal protein subunit S7 (RPS7 has been reported to be associated with various malignancies, but the role of RPS7 in ovarian cancer remains unclear. In this study, we found that silencing of RPS7 by a specific shRNA promoted ovarian cancer cell proliferation, accelerated cell cycle progression, and slightly reduced cell apoptosis and response to cisplatin treatment. Knockdown of RPS7 resulted in increased expression of P85α, P110α, and AKT2. Although the basal levels of ERK1/2, MEK1/2, and P38 were inconsistently altered in ovarian cancer cells, the phosphorylated forms of MEK1/2 (Ser217/221, ERK1/2 (Thr202/Tyr204, JNK1/2 (Thr183/Tyr185, and P38 (Thr180/Tyr182 were consistently reduced after RPS7 was silenced. Both the in vitro anchorage-independent colony formation and in vivo animal tumor formation capability of cells were enhanced after RPS7 was depleted. We also showed that silencing of RPS7 enhanced ovarian cancer cell migration and invasion. In sum, our results suggest that RPS7 suppresses ovarian tumorigenesis and metastasis through PI3K/AKT and MAPK signal pathways. Thus, RPS7 may be used as a potential marker for diagnosis and treatment of ovarian cancer.
Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.
2016-01-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417
Structural basis for precursor protein-directed ribosomal peptide macrocyclization.
Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D
2016-11-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.
Directory of Open Access Journals (Sweden)
Chao-Ping Wang
2011-06-01
Full Text Available Glossogyne tenuifolia (GT is a traditional Chinese herb that possesses strong antioxidant activity and protects against endothelial cell (EC injury by inhibition of free reactive oxygen species (ROS. The aim of this study was to elucidate the mechanisms by which GT prevents endothelial injury using a proteomics approach. We used a sensitive method to analyze the S- nitrosoproteins utilizing a modified biotin-switch method in order to detect the possible effects of GT on protein posttranslational modification. After treatment of vascular ECs with GT, two proteins HspA9 (IS1, beta-actin (IS2 were observed to have increased posttranslational S-nitrosylation, whereas seven proteins, vimentin (DS2, DS3 and DS5, tropomyosin 3, 4 (DS6 and DS7 and oxidative phosphorylation protein such as ATP synthase, F1 complex (DS1 and 80K-H protein (DS4, were found to have decreased posttranslational S-nitrosylation. Due to S-nitrosylation of HspA9 causing the reduction of intracellular ROS and S-nitrosylation of ATP synthase interfering with ATP production and ROS formation, our study may indicate a novel mechanism in which GT protects EC injury by the inhibition of oxidative reaction.
Spectrum and quantum symmetries of the AdS{sub 5} x S{sup 5} superstring
Energy Technology Data Exchange (ETDEWEB)
Heinze, Martin
2014-12-18
The initial AdS/CFT duality pair, the duality between N=4 SYM and the AdS{sub 5} x S{sup 5} superstring, appears to enjoy quantum integrability in the planar limit, which allowed to devise powerful methods ostensibly solving the spectral problem. However, quantization of the AdS{sub 5} x S{sup 5} superstring from first principles is still an open question and especially the spectrum of short string states has previously been derived only at leading order in large 't Hooft coupling. In this thesis we investigate possible routes to quantize short string states perturbatively beyond the leading order, where equally our aim is to gain better appreciation of the quantum symmetries at play. A prominent role is played by the lowest excited string states, dual to the Konishi supermultiplet, and we start by reviewing critically an asserted derivation of the Konishi anomalous dimension in the setup of pure spinor string theory. Next, we constrain ourselves to bosonic AdS{sub 5} x S{sup 5} String in static gauge, where we construct a so-called single-mode string solution, a generalization of the pulsating string allowing for unconstrained zero-modes. This solution shows classical integrability and invariance under the isometries SO(2,4) x SO(6) at the quantum level. Arguing heuristically about the effects of supersymmetry, we indeed recover the first non-trivial quantum correction to the Konishi anomalous dimension. We continue by implementing static gauge for the full AdS{sub 5} x S{sup 5} superstring and find elegant expressions for the Lagrangian density and the supercharges. We then constrain our interest to the superparticle and, using two different methods, find canonical coordinates at quadratic order in fermions. We conclude by exploring another quantization scheme: As the single-mode string is nothing but the SO(2,4) x SO(6) orbit of the pulsating string, we apply orbit method quantization to the particle and spinning string solutions in bosonic AdS{sub 3} x S
International Nuclear Information System (INIS)
Gross, M.; Redman, R.; Kaplansky, D.A.
1985-01-01
The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining
q-Poincaré supersymmetry in AdS5/CFT4
Borsato, Riccardo; Torrielli, Alessandro
2018-03-01
We consider the exact S-matrix governing the planar spectral problem for strings on AdS5 ×S5 and N = 4 super Yang-Mills, and we show that it is invariant under a novel "boost" symmetry, which acts as a differentiation with respect to the particle momentum. This generator leads us also to reinterpret the usual centrally extended psu (2 | 2) symmetry, and to conclude that the S-matrix is invariant under a q-Poincaré supersymmetry algebra, where the deformation parameter is related to the 't Hooft coupling. We determine the two-particle action (coproduct) that turns out to be non-local, and study the property of the new symmetry under crossing transformations. We look at both the strong-coupling (large tension in the string theory) and weak-coupling (spin-chain description of the gauge theory) limits; in the former regime we calculate the cobracket utilising the universal classical r-matrix of Beisert and Spill. In the eventuality that the boost has higher partners, we also construct a quantum affine version of 2D Poincaré symmetry, by contraction of the quantum affine algebra Uq (sl2 ˆ) in Drinfeld's second realisation.
q-Poincaré supersymmetry in AdS5/CFT4
Directory of Open Access Journals (Sweden)
Riccardo Borsato
2018-03-01
Full Text Available We consider the exact S-matrix governing the planar spectral problem for strings on AdS5×S5 and N=4 super Yang–Mills, and we show that it is invariant under a novel “boost” symmetry, which acts as a differentiation with respect to the particle momentum. This generator leads us also to reinterpret the usual centrally extended psu(2|2 symmetry, and to conclude that the S-matrix is invariant under a q-Poincaré supersymmetry algebra, where the deformation parameter is related to the 't Hooft coupling. We determine the two-particle action (coproduct that turns out to be non-local, and study the property of the new symmetry under crossing transformations. We look at both the strong-coupling (large tension in the string theory and weak-coupling (spin-chain description of the gauge theory limits; in the former regime we calculate the cobracket utilising the universal classical r-matrix of Beisert and Spill. In the eventuality that the boost has higher partners, we also construct a quantum affine version of 2D Poincaré symmetry, by contraction of the quantum affine algebra Uq(sl2ˆ in Drinfeld's second realisation.
An Archaea 5S rRNA analog is stably expressed in Escherichia coli
Yang, Y.; Fox, G. E.
1996-01-01
Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.
Directory of Open Access Journals (Sweden)
Inda, Luis A.
2013-06-01
Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en
Directory of Open Access Journals (Sweden)
Chenjing Shang
Full Text Available Although the protein translation inhibition activity of ribosome inactivating proteins (RIPs is well documented, little is known about the contribution of the lectin chain to the biological activity of these proteins. In this study, we compared the in vitro and intracellular activity of several S. nigra (elderberry RIPs and non-RIP lectins. Our data demonstrate that RIPs from elderberry are much more toxic to HeLa cells than to primary fibroblasts. Differences in the cytotoxicity between the elderberry proteins correlated with differences in glycan specificity of their lectin domain, cellular uptake efficiency and intracellular destination. Despite the fact that the bulk of the RIPs accumulated in the lysosomes and partly in the Golgi apparatus, we could demonstrate effective inhibition of protein synthesis in cellula. As we also observed cytotoxicity for non-RIP lectins, it is clear that the lectin chain triggers additional pathways heralding cell death. Our data suggest that one of these pathways involves the induction of autophagy.
Li, Chang-Ling; Yang, Jin-Gang; Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu
2014-01-01
Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125
Directory of Open Access Journals (Sweden)
Chang-Ling Li
Full Text Available Megakaryocytes (MKs are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1 at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
International Nuclear Information System (INIS)
Stahl, J.; Boehm, H.; Voderberg, M.
1981-01-01
Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)
Three spin string configuration in γ-Deformed AdS5xS5 background
International Nuclear Information System (INIS)
Bobev, N.; Rashkov, R.; Dimov, H.
2006-01-01
The aim of this paper is to investigate semiclassical rotating string configurations in the recently found Lunin-Maldacena background. This background is conjectured to be dual to the Leigh-Strassler β-deformation of N = 4 SYM and therefore a good laboratory for tests of the AdS/CFT correspondence beyond the well explored AdS 5 xS 5 case. We consider different multispin configurations of rotating strings by allowing the strings to move in both the AdS 5 and the deformed S 5 part of the Lunin-Maldacena background. For all of these configurations we compute the string energy in terms of the angular momenta and the string winding numbers and thus provide the possibility of reproducing our results from a computation of the anomalous dimension of the corresponding dilatation operator. This can be achieved by means of the Bethe ansatz techniques for the relevant sectors of the corresponding Yang-Mills theory. We also compare our results to those for multispin rotating strings on AdS 5 xS 5 . (authors)
Abat, Jasmeet K; Mattoo, Autar K; Deswal, Renu
2008-06-01
Nitric oxide (NO) is a signaling molecule that affects a myriad of processes in plants. However, the mechanistic details are limited. NO post-translationally modifies proteins by S-nitrosylation of cysteines. The soluble S-nitrosoproteome of a medicinal, crassulacean acid metabolism (CAM) plant, Kalanchoe pinnata, was purified using the biotin switch technique. Nineteen targets were identified by MALDI-TOF mass spectrometry, including proteins associated with carbon, nitrogen and sulfur metabolism, the cytoskeleton, stress and photosynthesis. Some were similar to those previously identified in Arabidopsis thaliana, but kinesin-like protein, glycolate oxidase, putative UDP glucose 4-epimerase and putative DNA topoisomerase II had not been identified as targets previously for any organism. In vitro and in vivo nitrosylation of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), one of the targets, was confirmed by immunoblotting. Rubisco plays a central role in photosynthesis, and the effect of S-nitrosylation on its enzymatic activity was determined using NaH14CO3. The NO-releasing compound S-nitrosoglutathione inhibited its activity in a dose-dependent manner suggesting Rubisco inactivation by nitrosylation for the first time.
Beiersdorfer, P.; Bitter, M.; Hey, D.; Reed, K. J.
2002-09-01
We have identified the dipole-forbidden 1s2s2p 4P5/2-->1s22s 2S1/2 transition in lithiumlike Ar15+ in high-resolution K-shell x-ray emission spectra recorded at the Livermore EBIT-II electron-beam ion trap and the Princeton National Spherical Tokamak Experiment. Unlike other Ar15+ satellite lines, which can be excited by dielectronic recombination, the line is exclusively excited by electron-impact excitation. Its predicted radiative rate is comparable to that of the well-known 1s2p 3P1-->1s2 1S0 magnetic quadrupole transition in heliumlike Ar16+. As a result, it can also only be observed in low-density plasma. We present calculations of the electron-impact excitation cross sections of the innershell excited Ar15+ satellite lines, including the magnetic sublevels needed for calculating the linear line polarization. We compare these calculations to the relative magnitudes of the observed 1s2s2p-->1s22s transitions and find good agreement, confirming the identification of the lithiumlike 1s2s2p 4P5/2-->1s22s 2S1/2 magnetic quadrupole line.
International Nuclear Information System (INIS)
Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M.
2008-01-01
A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH 2 -terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH 2 -terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Å resolution and were indexed in space group P4 1 (or P4 3 ), with unit-cell parameters a = b = 78.6, c = 135.2 Å
Directory of Open Access Journals (Sweden)
Sayaka Tsuji
2017-07-01
Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.
Wang, Hansen; Kim, Susan S.; Zhuo, Min
2010-01-01
Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of α-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome. PMID:20457613
DEFF Research Database (Denmark)
Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk
2005-01-01
We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....
The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan.
Mittal, Nitish; Guimaraes, Joao C; Gross, Thomas; Schmidt, Alexander; Vina-Vilaseca, Arnau; Nedialkova, Danny D; Aeschimann, Florian; Leidel, Sebastian A; Spang, Anne; Zavolan, Mihaela
2017-09-06
In Saccharomyces cerevisiae, deletion of large ribosomal subunit protein-encoding genes increases the replicative lifespan in a Gcn4-dependent manner. However, how Gcn4, a key transcriptional activator of amino acid biosynthesis genes, increases lifespan, is unknown. Here we show that Gcn4 acts as a repressor of protein synthesis. By analyzing the messenger RNA and protein abundance, ribosome occupancy and protein synthesis rate in various yeast strains, we demonstrate that Gcn4 is sufficient to reduce protein synthesis and increase yeast lifespan. Chromatin immunoprecipitation reveals Gcn4 binding not only at genes that are activated, but also at genes, some encoding ribosomal proteins, that are repressed upon Gcn4 overexpression. The promoters of repressed genes contain Rap1 binding motifs. Our data suggest that Gcn4 is a central regulator of protein synthesis under multiple perturbations, including ribosomal protein gene deletions, calorie restriction, and rapamycin treatment, and provide an explanation for its role in longevity and stress response.The transcription factor Gcn4 is known to regulate yeast amino acid synthesis. Here, the authors show that Gcn4 also acts as a repressor of protein biosynthesis in a range of conditions that enhance yeast lifespan, such as ribosomal protein knockout, calorie restriction or mTOR inhibition.
[Comparison of two types of cell cultures for preparation of sTNFRII-gAD fusion protein].
Huang, Shigao; Yin, Yuting; Xiong, Chunhui; Wang, Caihong; Lü, Jianxin; Gao, Jimin
2013-01-01
In this study we used two types of cell cultures, i.e., anchorage-dependent basket and full suspension batch cultures of sTNFRII-gAD-expressing CHO cells in the CelliGen 310 bioreactor (7.5 L) to compare their yields in order to optimize the culturing conditions for efficient expression of sTNFRII-gAD fusion protein consisting of soluble tumor necrosis factor receptor II and globular domain of adiponectin. The anchorage-dependent basket culture was performed in 4L 10% serum-containing medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 3 days, and then switched to 4 L serum-free LK021 medium to continue the culture for 4 days. The full suspension batch culture was carried out in the 4 L serum-free LK021 medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 7 days. The culturing conditions were monitored in real-time to maintain pH and dissolved oxygen stability through the whole process. The supernatants were collected by centrifuge, and the protein was concentrated through Pellicon flow ultrafiltration system and then purified by DEAE anion exchange. The results showed that the yields of sTNFRII-gAD fusion protein were 8.0 mg/L with 95% purity and 7.5 mg/L with 98% purity in the anchorage-dependent basket and the full suspension batch cultures, respectively. The study provided the framework for the pilot production of sTNFRII-gAD fusion protein.
International Nuclear Information System (INIS)
Lipson, Rebecca S.; Webb, Kristofor J.; Clarke, Steven G.
2010-01-01
Rps2/rpS2 is a well conserved protein of the eukaryotic ribosomal small subunit. Rps2 has previously been shown to contain asymmetric dimethylarginine residues, the addition of which is catalyzed by zinc-finger-containing arginine methyltransferase 3 (Rmt3) in the fission yeast Schizosaccharomyces pombe and protein arginine methyltransferase 3 (PRMT3) in mammalian cells. Here, we demonstrate that despite the lack of a zinc-finger-containing homolog of Rmt3/PRMT3 in the budding yeast Saccharomyces cerevisiae, Rps2 is partially modified to generate asymmetric dimethylarginine and monomethylarginine residues. We find that this modification of Rps2 is dependent upon the major arginine methyltransferase 1 (Rmt1) in S. cerevisiae. These results are suggestive of a role for Rmt1 in modifying the function of Rps2 in a manner distinct from that occurring in S. pombe and mammalian cells.
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false S-Abscisic Acid, (S)-5-(1-hydroxy-2,6... Exemptions From Tolerances § 180.1281 S-Abscisic Acid, (S)-5-(1-hydroxy-2,6,6-trimethyl-4-oxo-1-cyclohex-2... from the requirement of a tolerance is established for residues of S-Abscisic Acid in or on all food...
Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism
Directory of Open Access Journals (Sweden)
Deborah Chiabrando
2010-01-01
Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.
A closer look at two AdS4 branes in an AdS5 bulk
International Nuclear Information System (INIS)
Thambyahpillai, Shiyamala
2005-01-01
We investigate a scenario with two AdS 4 branes in an AdS 5 bulk. In this scenario there are two gravitons and we investigate the role played by each of them for different positions of the second brane. We show that both gravitons play a significant role only when the turn-around point in the warp factor is approximately equidistant from both branes. We find that the ultralight mode becomes heavy as the second brane approaches the turn-around point, and the physics begins to resemble that of the RS model. Thus we demonstrate the crucial role played by the turn-around in the warp factor in enabling the presence of both gravitons. (author)
Directory of Open Access Journals (Sweden)
Maria Serena Fabbrini
2017-10-01
Full Text Available Plant ribosome-inactivating protein (RIP toxins are EC3.2.2.22 N-glycosidases, found among most plant species encoded as small gene families, distributed in several tissues being endowed with defensive functions against fungal or viral infections. The two main plant RIP classes include type I (monomeric and type II (dimeric as the prototype ricin holotoxin from Ricinus communis that is composed of a catalytic active A chain linked via a disulphide bridge to a B-lectin domain that mediates efficient endocytosis in eukaryotic cells. Plant RIPs can recognize a universally conserved stem-loop, known as the α-sarcin/ ricin loop or SRL structure in 23S/25S/28S rRNA. By depurinating a single adenine (A4324 in 28S rat rRNA, they can irreversibly arrest protein translation and trigger cell death in the intoxicated mammalian cell. Besides their useful application as potential weapons against infected/tumor cells, ricin was also used in bio-terroristic attacks and, as such, constitutes a major concern. In this review, we aim to summarize past studies and more recent progresses made studying plant RIPs and discuss successful approaches that might help overcoming some of the bottlenecks encountered during the development of their biomedical applications.
On stringy AdS5 x S5 and higher spin holography
International Nuclear Information System (INIS)
Bianchi, Massimo; Morales, Jose F.; Samtleben, Henning
2003-01-01
We derive the spectrum of Kaluza-Klein descendants of string excitations on AdS 5 x S 5 . String states are organized in long multiplets of the AdS supergroup SU(2,2|4,R) with a rich pattern of shortenings at the higher spin enhancement point λ=0. The string states holographically dual to the higher spin currents of SYM theory in the strict zero coupling limit are identified together with the corresponding Goldstone particles responsible for the Higgsing of the higher spin symmetry at λ≠ 0. Exploiting higher spin symmetry we propose a very simple yet effective mass formula and establish a one-to-one correspondence between the complete spectrum of Δ 0 ≤ 4 string states and relevant/marginal single-trace deformations in N = 4 SYM theory at large N. To this end, we describe how to efficiently enumerate scaling operators in 'free' YM theory, with the inclusion of fermionic 'letters', by resorting to Polya theory. Comparison between the spectra of 1/4-BPS states is also presented. Finally, we discuss how to organize the spectrum of N = 4 SYM theory in SU(2,2|4,R) supermultiplets by means of some kind of 'Eratostenes's sieve'. (author)
Collision broadening and shift of the potassium 4P-7S and 4P-5D lines by argon
International Nuclear Information System (INIS)
Hohimer, J.P.
1981-01-01
A two-step laser excitation technique has been used to investigate the collisional broadening and shift of excited-state potassium transitions. Values for the argon collisional broadening and shift constants for the potassium 4p-7s and 4p-5d transitions were determined from line shapes for argon pressures up to 100 Torr. The values of these constants (in units of 10 -9 rad s -1 atom -1 cm 3 ) are (4P/sub 1/2/-7S/sub 1/2/): γ=11.60 +- 0.07, β=-6.68 +- 0.11; (4P/sub 3/2/-7S/sub 1/2/): γ=11.49 +- 0.15, β=-6.82 +- 0.14; (4P/sub 1/2/-5D/sub 3/2/): γ=8.64 +- 0.07, β=-4.62 +- 0.04; (4P/sub 3/2/-5D/sub 3/2/): γ=8.58 +- 0.10, β=-3.49 +- 0.32; (4P/sub 3/2/-5D/sub 5/2/): γ=9.13 +- 0.10, β=-4.73 +- 0.09. These broadening and shift constants are interpreted in terms of a Lennard-Jones interaction potential
Problem-Based Test: Functional Analysis of Mutant 16S rRNAs
Szeberenyi, Jozsef
2010-01-01
Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…
4p-5s transitions in YVII, VIII, ZrVIII, IX, NbIX, X and MoX, XI
International Nuclear Information System (INIS)
Rahimullah, K.; Chaghtai, M.S.Z.; Khatoon, S.
1976-01-01
The spectra of Y VII, VIII, Zr VIII, IX, Nb X and Mo X, XI are studied for the first time and the 1971 analysis of Nb IX is improved. By analyses of the transitions 4s 2 4psup(k)-4s 2 4psup(k-1)5s all the levels of the configurations 4p 3 , 4p 2 5s, 4p 2 and 4p5s are established in the spectra concerned. (Auth.)
International Nuclear Information System (INIS)
Vaqueiro, Paz
2006-01-01
Two new main group metal sulphides, [C 1 N 4 H 26 ] 0.5 [InS 2 ] (1) and [C 1 N 4 H 26 ] 0.5 [GaS 2 ] (2) have been prepared solvothermally in the presence of 1,4-bis(3-aminopropyl)piperazine and their crystal structures determined by single-crystal X-ray diffraction. Both compounds are isostructural and crystallise in the monoclinic space group P2 1 /n (Z=4), with a=6.5628(5), b=11.2008(9), c=12.6611(9) A and β=94.410(4) o (wR=0.035) for compound (1) and a=6.1094(5), b=11.2469(9), c=12.7064(10) A and β=94.313(4) o (wR=0.021) for compound (2). The structure of [C 1 N 4 H 26 ] 0.5 [MS 2 ] (M=In,Ga) consists of one-dimensional [MS 2 ] - chains which run parallel to the crystallographic a axis and are separated by diprotonated amine molecules. These materials represent the first example of solvothermally prepared one-dimensional gallium and indium sulphides. -- Graphical abstract: [C 1 N 4 H 26 ] 0.5 [InS 2 ] and [C 1 N 4 H 26 ] 0.5 [GaS 2 ], prepared under solvothermal conditions, consist of one-dimensional [MS 2 ] - chains separated by diprotonated 1,4-bis(3-aminopropyl)piperazine molecules
Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean
2013-09-01
Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.
Site-specific fluorescent labeling of nascent proteins on the translating ribosome.
Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou
2011-09-28
As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.
Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi
2013-11-01
Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.
International Nuclear Information System (INIS)
Martin, A.E.; Burgess, B.K.; Stout, C.D.; Cash, V.L.; Dean, D.R.; Jensen, G.M.; Stephens, P.J.
1990-01-01
Azotobacter vinelandii ferredoxin I is a small protein that contains one [4Fe-4S] cluster and one [3Fe-4S] cluster. Recently the x-ray crystal structure has been redetermined and the fdxA gene, which encodes the protein, has been cloned and sequenced. Here the authors report the site-directed mutation of Cys-20, which is a ligand of the [4Fe-4S] cluster in the native protein, to alanine and the characterization of the protein product by x-ray crystallographic and spectroscopic methods. The data show that the mutant protein again contains one [4Fe-4S] cluster and one [3Fe-4S] cluster. The new [4Fe-4S] cluster obtains its fourth ligand from Cys-24, a free cysteine in the native structure. The formation of this [4Fe-4S] cluster drives rearrangement of the protein structure
The AdS5xS5 superstring worldsheet S matrix and crossing symmetry
International Nuclear Information System (INIS)
Janik, Romuald A.
2006-01-01
An S matrix satisfying the Yang-Baxter equation with symmetries relevant to the AdS 5 xS 5 superstring recently has been determined up to an unknown scalar factor. Such scalar factors are typically fixed using crossing relations; however, due to the lack of conventional relativistic invariance, in this case its determination remained an open problem. In this paper we propose an algebraic way to implement crossing relations for the AdS 5 xS 5 superstring worldsheet S matrix. We base our construction on a Hopf-algebraic formulation of crossing in terms of the antipode and introduce generalized rapidities living on the universal cover of the parameter space which is constructed through an auxillary, coupling-constant dependent, elliptic curve. We determine the crossing transformation and write functional equations for the scalar factor of the S matrix in the generalized rapidity plane
Energy Technology Data Exchange (ETDEWEB)
Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)
2015-05-15
PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.
Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.
Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M
2018-06-08
Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.
S-Layer Protein-Based Biosensors
Directory of Open Access Journals (Sweden)
Bernhard Schuster
2018-04-01
Full Text Available The present paper highlights the application of bacterial surface (S- layer proteins as versatile components for the fabrication of biosensors. One technologically relevant feature of S-layer proteins is their ability to self-assemble on many surfaces and interfaces to form a crystalline two-dimensional (2D protein lattice. The S-layer lattice on the surface of a biosensor becomes part of the interface architecture linking the bioreceptor to the transducer interface, which may cause signal amplification. The S-layer lattice as ultrathin, highly porous structure with functional groups in a well-defined special distribution and orientation and an overall anti-fouling characteristics can significantly raise the limit in terms of variety and the ease of bioreceptor immobilization, compactness of bioreceptor molecule arrangement, sensitivity, specificity, and detection limit for many types of biosensors. The present paper discusses and summarizes examples for the successful implementation of S-layer lattices on biosensor surfaces in order to give a comprehensive overview on the application potential of these bioinspired S-layer protein-based biosensors.
S-Layer Protein-Based Biosensors.
Schuster, Bernhard
2018-04-11
The present paper highlights the application of bacterial surface (S-) layer proteins as versatile components for the fabrication of biosensors. One technologically relevant feature of S-layer proteins is their ability to self-assemble on many surfaces and interfaces to form a crystalline two-dimensional (2D) protein lattice. The S-layer lattice on the surface of a biosensor becomes part of the interface architecture linking the bioreceptor to the transducer interface, which may cause signal amplification. The S-layer lattice as ultrathin, highly porous structure with functional groups in a well-defined special distribution and orientation and an overall anti-fouling characteristics can significantly raise the limit in terms of variety and the ease of bioreceptor immobilization, compactness of bioreceptor molecule arrangement, sensitivity, specificity, and detection limit for many types of biosensors. The present paper discusses and summarizes examples for the successful implementation of S-layer lattices on biosensor surfaces in order to give a comprehensive overview on the application potential of these bioinspired S-layer protein-based biosensors.
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2015-10-23
p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.
Bhopale, Kamlesh K; Amer, Samir M; Kaphalia, Lata; Soman, Kizhake V; Wiktorowicz, John E; Shakeel Ansari, Ghulam A; Kaphalia, Bhupendra S
2017-07-01
The aim of this study was to identify differentially expressed proteins in the pancreatic tissue of hepatic alcohol dehydrogenase-deficient deer mice fed ethanol to understand metabolic basis and mechanism of alcoholic chronic pancreatitis. Mice were fed liquid diet containing 3.5 g% ethanol daily for 3 months, and differentially expressed pancreatic proteins were identified by protein separation using 2-dimensional gel electrophoresis and identification by mass spectrometry. Nineteen differentially expressed proteins were identified by applying criteria established for protein identification in proteomics. An increased abundance was found for ribosome-binding protein 1, 60S ribosomal protein L31-like isoform 1, histone 4, calcium, and adenosine triphosphate (ATP) binding proteins and the proteins involved in antiapoptotic processes and endoplasmic reticulum function, stress, and/or homeostasis. Low abundance was found for endoA cytokeratin, 40S ribosomal protein SA, amylase 2b isoform precursor, serum albumin, and ATP synthase subunit β and the proteins involved in cell motility, structure, and conformation. Chronic ethanol feeding in alcohol dehydrogenase-deficient deer mice differentially expresses pancreatic functional and structural proteins, which can be used to develop biomarker(s) of alcoholic chronic pancreatitis, particularly amylase 2b precursor, and 60 kDa heat shock protein and those involved in ATP synthesis and blood osmotic pressure.
Protein S is protective in pulmonary fibrosis.
Urawa, M; Kobayashi, T; D'Alessandro-Gabazza, C N; Fujimoto, H; Toda, M; Roeen, Z; Hinneh, J A; Yasuma, T; Takei, Y; Taguchi, O; Gabazza, E C
2016-08-01
Essentials Epithelial cell apoptosis is critical in the pathogenesis of idiopathic pulmonary fibrosis. Protein S, a circulating anticoagulant, inhibited apoptosis of lung epithelial cells. Overexpression of protein S in lung cells reduced bleomycin-induced pulmonary fibrosis. Intranasal therapy with exogenous protein S ameliorated bleomycin-induced pulmonary fibrosis. Background Pulmonary fibrosis is the terminal stage of interstitial lung diseases, some of them being incurable and of unknown etiology. Apoptosis plays a critical role in lung fibrogenesis. Protein S is a plasma anticoagulant with potent antiapoptotic activity. The role of protein S in pulmonary fibrosis is unknown. Objectives To evaluate the clinical relevance of protein S and its protective role in pulmonary fibrosis. Methods and Results The circulating level of protein S was measured in patients with pulmonary fibrosis and controls by the use of enzyme immunoassays. Pulmonary fibrosis was induced with bleomycin in transgenic mice overexpressing human protein S and wild-type mice, and exogenous protein S or vehicle was administered to wild-type mice; fibrosis was then compared in both models. Patients with pulmonary fibrosis had reduced circulating levels of protein S as compared with controls. Inflammatory changes, the levels of profibrotic cytokines, fibrosis score, hydroxyproline content in the lungs and oxygen desaturation were significantly reduced in protein S-transgenic mice as compared with wild-type mice. Wild-type mice treated with exogenous protein S showed significant decreases in the levels of inflammatory and profibrotic markers and fibrosis in the lungs as compared with untreated control mice. After bleomycin infusion, mice overexpressing human protein S showed significantly low caspase-3 activity, enhanced expression of antiapoptotic molecules and enhanced Akt and Axl kinase phosphorylation as compared with wild-type counterparts. Protein S also inhibited apoptosis of alveolar
Fine structure of the 1s5f and 1s5g levels of He I
International Nuclear Information System (INIS)
Kriescher, Y.; Hilt, O.; Oppen, G. v.
1994-01-01
The fine structure of the 1s 5f and 1s 5g levels of He I was measured using microwave spectroscopy. The helium atoms were excited by ion impact, and the eleven allowed 1s 5f 2S+1 F J -1s 5g 2S'+1 G J , transitions near ν∼15 GHz were induced and detected by measuring the 1s 4d-1s 2p or 1s 3d-1s 2p spectral-line intensities of the impact radiation as a function of the microwave frequency. The measured transition frequencies are in accord with theoretical values and, except for one transition frequency, with earlier experimental data. The existing discrepancy between these earlier data and theory could be solved. (orig.)
Thermophysical properties of Na2Th (MoO4)3 (s) and Na4Th (MoO4)4 (s)
International Nuclear Information System (INIS)
Dash, Smruti; Rakshit, S.K.; Singh, Ziley; Keskar, Meera; Dahale, N.D.
2009-01-01
The heat capacity of Na 2 Th (MoO 4 ) 3 (s) and Na 4 Th (MoO 4 ) 4 (s) have been measured by differential scanning calorimeter in the temperature range 318 to 845 K. The corresponding values are: C p,m (Na 2 Th (MoO 4 ) 3 ,s,T) (JK-1 mol-1) 368.710+ 1.0 10-1 (T/K) - 4950267 (K/T)2 (318 ≤ T (K) ≤ 845). C p,m (Na 4 Th (MoO 4 ) 4 ,s,T) (JK-1 mol-1) = 638.761+ 5.12 10-3 (T/K) - 12691691 (K/T)-2 (318 ≤ T (K) ≤ 845). Experimental heat capacity values for Na 2 Th (MoO 4 ) 3 (s) match reasonably well with that of additive oxide values. But C p,m (T) values of Na 4 Th (MoO 4 ) 4 (s) deviates substantially from the additive oxide values above 700 K. The uncertainty of the measurements reported in this study is calculated to be within 1 to 3 % . (author)
Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa
2017-01-01
Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
Directory of Open Access Journals (Sweden)
Afrooz DANESHPARVAR
2017-06-01
Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
1986-01-01
We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...
DEFF Research Database (Denmark)
Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert
2015-01-01
The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...
Directory of Open Access Journals (Sweden)
Mohan Babu
Full Text Available Elongation factor RbbA is required for ATP-dependent deacyl-tRNA release presumably after each peptide bond formation; however, there is no information about the cellular role. Proteomic analysis in Escherichia coli revealed that RbbA reciprocally co-purified with a conserved inner membrane protein of unknown function, YhjD. Both proteins are also physically associated with the 30S ribosome and with members of the lipopolysaccharide transport machinery. Genome-wide genetic screens of rbbA and yhjD deletion mutants revealed aggravating genetic interactions with mutants deficient in the electron transport chain. Cells lacking both rbbA and yhjD exhibited reduced cell division, respiration and global protein synthesis as well as increased sensitivity to antibiotics targeting the ETC and the accuracy of protein synthesis. Our results suggest that RbbA appears to function together with YhjD as part of a regulatory network that impacts bacterial oxidative phosphorylation and translation efficiency.
Lacher, M D; Siegenthaler, A; Jäger, R; Yan, Xi; Hett, S; Xuan, L; Saurer, S; Lareu, R R; Dharmarajan, A M; Friis, R
2003-05-01
Using differential display, we isolated DDC-4, a secreted frizzled-related protein (sFRP), which is induced in the physiological apoptosis of hormonally regulated, reproductive tissues such as mammary gland, prostate, corpus luteum and uterus. The role of this gene in apoptosis was studied in animals overexpressing ectopic DDC-4/sFRP-4. Transgenic mice bearing the DDC-4/sFRP-4 cDNA under the control of the MMTV-LTR promoter showed lactational insufficiency and many apoptotic cells in the alveoli between day 19 of pregnancy and day 4 of lactation as demonstrated by TUNEL reaction and the presence of activated caspase-3. We performed a PKB/Akt kinase assay and studied several of its substrates using phosphorylation-specific antibodies to show reduced phosphorylation in PKB/Akt itself, as well as in glycogen synthetase kinase-3beta (GSK-3beta), BAD, and Forkhead. Taken together, our results show a role for DDC-4/sFRP-4 in abrogating an epithelial cell survival pathway at the onset of mammary gland involution.
Energy Technology Data Exchange (ETDEWEB)
Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine
1930-06-16
The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.
Folded three-spin string solutions in AdS5 x S5
International Nuclear Information System (INIS)
Ryang Shijong
2004-01-01
We construct a spinning closed string solution in AdS 5 x S 5 which is folded in the radial direction and has two equal spins in AdS 5 and a spin in S 5 . The energy expression of the three-spin solution specified by the folding and winding numbers for the small S 5 spin shows a logarithmic behavior and a one-third power behavior of the large total AdS 5 spin, in the long string and in the short string located near the boundary of AdS 5 respectively. It exhibits the non-regular expansion in the 't Hooft coupling constant, while it takes the regular one when the S 5 spin becomes large. (author)
Directory of Open Access Journals (Sweden)
Saurav Mallik
Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Mercury Exposure: Protein Biomarkers of Mercury Exposure in Jaraqui Fish from the Amazon Region.
Vieira, José Cavalcante Souza; Braga, Camila Pereira; de Oliveira, Grasieli; Padilha, Cilene do Carmo Federici; de Moraes, Paula Martin; Zara, Luiz Fabricio; Leite, Aline de Lima; Buzalaf, Marília Afonso Rabelo; Padilha, Pedro de Magalhães
2018-05-01
This study presents data on the extraction and characterization of proteins associated with mercury in the muscle and liver tissues of jaraqui (Semaprochilodus spp.) from the Madeira River in the Brazilian Amazon. Protein fractionation was carried out by two-dimensional electrophoresis (2D-PAGE). Mercury determination in tissues, pellets, and protein spots was performed by graphite furnace atomic absorption spectrometry (GFAAS). Proteins in the spots that showed mercury were characterized by electrospray ionization tandem mass spectrometry (ESI-MS/MS). The highest mercury concentrations were found in liver tissues and pellets (426 ± 6 and 277 ± 4 μg kg -1 ), followed by muscle tissues and pellets (132 ± 4 and 86 ± 1 μg kg -1 , respectively). Mercury quantification in the protein spots allowed us to propose stoichiometric ratios in the range of 1-4 mercury atoms per molecule of protein in the protein spots. The proteins characterized in the analysis by ESI-MS/MS were keratin, type II cytoskeletal 8, parvalbumin beta, parvalbumin-2, ubiquitin-40S ribosomal S27a, 39S ribosomal protein L36 mitochondrial, hemoglobin subunit beta, and hemoglobin subunit beta-A/B. The results suggest that proteins such as ubiquitin-40S ribosomal protein S27a, which have specific domains, possibly zinc finger, can be used as biomarkers of mercury, whereas mercury and zinc present characteristics of soft acids.
The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel
DEFF Research Database (Denmark)
Wekselman, I.; Zimmerman, E.; Davidovich, C.
2017-01-01
in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1994-01-01
The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...
Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon
2012-07-17
In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.
DEFF Research Database (Denmark)
Tamaki, Yodo; Iwanaga, Yoshitaka; Niizuma, Shinichiro
2013-01-01
Metastasis-associated protein, S100A4 is suggested as a marker for fibrosis in several organs. It also modulates DNA binding of p53 and affects its function. However, the functional role of S100A4 in the myocardium has remained unclear. Therefore, we investigated the role of S100A4 and its relati...
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton
International Nuclear Information System (INIS)
Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing
2003-01-01
The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)
Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions
International Nuclear Information System (INIS)
Churilov, S.S.; Joshi, Y.N.
2001-01-01
The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)
ELOVL4 protein preferentially elongates 20:5n3 to very long chain PUFAs over 20:4n6 and 22:6n3[S
Yu, Man; Benham, Aaron; Logan, Sreemathi; Brush, R. Steven; Mandal, Md Nawajes A.; Anderson, Robert E.; Agbaga, Martin-Paul
2012-01-01
We hypothesized that reduction/loss of very long chain PUFAs (VLC-PUFAs) due to mutations in the ELOngase of very long chain fatty acid-4 (ELOVL4) protein contributes to retinal degeneration in autosomal dominant Stargardt-like macular dystrophy (STGD3) and age-related macular degeneration; hence, increasing VLC-PUFA in the retina of these patients could provide some therapeutic benefits. Thus, we tested the efficiency of elongation of C20-C22 PUFA by the ELOVL4 protein to determine which substrates are the best precursors for biosynthesis of VLC-PUFA. The ELOVL4 protein was expressed in pheochromocytoma cells, while green fluorescent protein-expressing and nontransduced cells served as controls. The cells were treated with 20:5n3, 22:6n3, and 20:4n6, either individually or in equal combinations. Both transduced and control cells internalized and elongated the supplemented FAs to C22-C26 precursors. Only ELOVL4-expressing cells synthesized C28-C38 VLC-PUFA from these precursors. In general, 20:5n3 was more efficiently elongated to VLC-PUFA in the ELOVL4-expressing cells, regardless of whether it was in combination with 22:6n3 or with 20:4n6. In each FA treatment group, C34 and C36 VLC-PUFAs were the predominant VLC-PUFAs in the ELOVL4-expressing cells. In summary, 20:5n3, followed by 20:4n6, seems to be the best precursor for boosting the synthesis of VLC-PUFA by ELOVL4 protein. PMID:22158834
International Nuclear Information System (INIS)
Bordenave-Montesquieu, A.; Benoit-Cattin, P.; Gleizes, A.
1985-01-01
One-electron capture into N 4+ (1s2ln'l') configurations, with n'=2 to 4, has been observed by electron spectrometry when a N 5+ (1s2s 3 S) multicharged ion beam encounters an He or H 2 target, at low collision velocity (upsilon=0.37 au) within single-collision conditions. Contributions of other 1s2l metastable states and of the 1s 2 ground state may be disregarded. A small indication of two-electron capture by 1s2s 3 S ions into (1s2s 3 S)3l3l' configurations is also seen. (author)
Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk
2003-01-01
Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413
Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami
2017-01-01
Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...
Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra
DEFF Research Database (Denmark)
Thomsen, S.; Hansen, Harald S.; Nyman, U.
1991-01-01
Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...
Wang, Shuzhen; Zhang, Yubo; Liu, Honggao; He, Ying; Yan, Junjie; Wu, Zhihua; Ding, Yi
2012-11-01
Alpha-momorcharin (α-MC), a member of the ribosome-inactivating protein (RIP) family, has been used not only as antiviral, antimicrobial, and antitumor agents, but also as toxicant to protozoa, insects, and fungi. In this study, we expressed the protein in Escherichia coli Rosetta (DE3) pLysS strain and purified it by nickel-nitrilotriacetic acid affinity chromatography. A total of 85 mg of homogeneous protein was obtained from 1 l culture supernatant of Rosetta (DE3) pLysS, showing a high recovery rate of 73.9%. Protein activity assay indicated that α-MC had both N-glycosidase activity and DNA-nuclease activity, the former releasing RIP diagnostic RNA fragment (Endo's fragment) from rice rRNAs and the latter converting supercoiled circular DNA of plasmid pET-32a(+) into linear conformations in a concentration-dependent manner. Specially, we found that α-MC could inhibit the mycelial growth of Fusarium solani and Fusarium oxysporum with IC(50) values of 6.23 and 4.15 μM, respectively. Results of optical microscopy and transmission electron microscopy demonstrated that α-MC caused extensive septum formation, loss of integrity of the cell wall, separation of the cytoplasm from the cell wall, deformation of cells with irregular budding sites, and apoptosis in F. solani. Moreover, α-MC was active against Pseudomonas aeruginosa with an IC(50) value of 0.59 μM. The α-MC protein carries a high potential for the design of new antifungal drugs or the development of transgenic crops resistant to pathogens.
Li, Junhua; Zhang, Yang; Yang, Yanjun
2013-03-01
The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.
Directory of Open Access Journals (Sweden)
M. Halloran
2013-01-01
Full Text Available Neurodegenerative diseases involve the progressive loss of neurons, and a pathological hallmark is the presence of abnormal inclusions containing misfolded proteins. Although the precise molecular mechanisms triggering neurodegeneration remain unclear, endoplasmic reticulum (ER stress, elevated oxidative and nitrosative stress, and protein misfolding are important features in pathogenesis. Protein disulphide isomerase (PDI is the prototype of a family of molecular chaperones and foldases upregulated during ER stress that are increasingly implicated in neurodegenerative diseases. PDI catalyzes the rearrangement and formation of disulphide bonds, thus facilitating protein folding, and in neurodegeneration may act to ameliorate the burden of protein misfolding. However, an aberrant posttranslational modification of PDI, S-nitrosylation, inhibits its protective function in these conditions. S-nitrosylation is a redox-mediated modification that regulates protein function by covalent addition of nitric oxide- (NO- containing groups to cysteine residues. Here, we discuss the evidence for abnormal S-nitrosylation of PDI (SNO-PDI in neurodegeneration and how this may be linked to another aberrant modification of PDI, S-glutathionylation. Understanding the role of aberrant S-nitrosylation/S-glutathionylation of PDI in the pathogenesis of neurodegenerative diseases may provide insights into novel therapeutic interventions in the future.
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
International Nuclear Information System (INIS)
Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry
2008-01-01
The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library
Pactamycin binding site on archaebacterial and eukaryotic ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.G.
1987-01-01
The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics
Foundations of the AdS5 x S5 superstring: I
International Nuclear Information System (INIS)
Arutyunov, Gleb; Frolov, Sergey
2009-01-01
We review the recent advances towards finding the spectrum of the AdS 5 x S 5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing literature. The present part I deals with foundations of classical string theory in AdS 5 x S 5 , light-cone perturbative quantization and the derivation of the exact light-cone world-sheet scattering matrix
Directory of Open Access Journals (Sweden)
Xiulan Zhang
2013-07-01
Full Text Available In the asymmetric unit of the title compound, (C16H38N2O6[Zn(C3S52], two independent cations lie across inversion centers. In one of the cations, the three symmetry-unique O—H groups are disordered over two sets of sites with refined occupancy ratios of 0.701 (9:0.299 (9, 0.671 (8:0.329 (8 and 0.566 (7:0.434 (7. In the anion, the ZnII ion is coordinated in a distorted tetrahedral environment by four S atoms of two chelating 1,3-dithiole-2-thione-4,5-dithiolato ligands. The dihedral angle between the mean planes [maximun deviations = 0.022 (3 and 0.0656 (6 Å] of the two ligands is 87.76 (3°. An intamolecular O—H...O hydrogen bond occurs in the disordered cation. In the crystal, O—H...O and O—H...S hydrogen bonds link the components into a two-dimensional network parallel to (0-11.
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Bolognesi, A; Polito, L; Olivieri, F; Valbonesi, P; Barbieri, L; Battelli, M G; Carusi, M V; Benvenuto, E; Del Vecchio Blanco, F; Di Maro, A; Parente, A; Di Loreto, M; Stirpe, F
1997-12-01
New single-chain (type 1) ribosome-inactivating proteins (RIPs) were isolated from the seeds of Basella rubra L. (two proteins) and from the leaves of Bougainvillea spectabilis Willd. (one protein). These RIPs inhibit protein synthesis both in a cell-free system, with an IC50 (concentration causing 50% inhibition) in the 10(-10) M range, and by various cell lines, with IC50S in the 10(-8)-10(-6) M range. All three RIPs released adenine not only from rat liver ribosomes but also from Escherichia coli rRNA, polyadenylic acid, herring sperm DNA, and artichoke mottled crinkle virus (AMCV) genomic RNA, thus being polynucleotide:adenosine glycosidases. The proteins from Basella rubra had toxicity to mice similar to that of most type 1 RIPs (Barbieri et al., 1993, Biochim Biophys Acta 1154: 237-282) with an LD50 (concentration that is 50% lethal) Bougainvillea spectabilis had an LD50 > 32 mg.kg-1. The N-terminal sequence of the two RIPs from Basella rubra had 80-93% identity, whereas it differed from the sequence of the RIP from Bougainvillea spectabilis. When tested with antibodies against various RIPs, the RIPs from Basella gave some cross-reactivity with sera against dianthin 32, and weak cross-reactivity with momordin I and momorcochin-S, whilst the RIP from Bougainvillea did not cross-react with any antiserum tested. An RIP from Basella rubra and one from Bougainvillea spectabilis were tested for antiviral activity, and both inhibited infection of Nicotiana benthamiana by AMCV.
Growth Inhibition by Bupivacaine Is Associated with Inactivation of Ribosomal Protein S6 Kinase 1
Beigh, Mushtaq Ahmad; Showkat, Mehvish; Bashir, Basharat; Bashir, Asma; Hussain, Mahboob ul; Andrabi, Khurshid Iqbal
2014-01-01
Bupivacaine is an amide type long acting local anesthetic used for epidural anesthesia and nerve blockade in patients. Use of bupivacaine is associated with severe cytotoxicity and apoptosis along with inhibition of cell growth and proliferation. Although inhibition of Erk, Akt, and AMPK seemingly appears to mediate some of the bupivacaine effects, potential downstream targets that mediate its effect remain unknown. S6 kinase 1 is a common downstream effector of several growth regulatory pathways involved in cell growth and proliferation known to be affected by bupivacaine. We have accordingly attempted to relate the growth inhibitory effects of bupivacaine with the status of S6K1 activity and we present evidence that decrease in cell growth and proliferation by bupivacaine is mediated through inactivation of S6 kinase 1 in a concentration and time dependent manner. We also show that ectopic expression of constitutively active S6 kinase 1 imparts substantial protection from bupivacaine induced cytotoxicity. Inactivation of S6K1 though associated with loss of putative mTOR mediated phosphorylation did not correspond with loss of similar phosphorylations in 4EBP1 indicating that S6K1 inhibition was not mediated through inactivation of mTORC1 signaling pathway or its down regulation. PMID:24605337
Directory of Open Access Journals (Sweden)
Mateus Mondin
2007-01-01
Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.
Jordanian deformations of the AdS5×S5 superstring
Kawaguchi, I.; Matsumoto, T.; Yoshida, K
2014-01-01
We consider Jordanian deformations of the AdS_5xS^5 superstring action. The deformations correspond to non-standard q-deformation. In particular, it is possible to perform partial deformations, for example, only for the S^5 part. Then the classical action and the Lax pair are constructed with a
Proteins interacting with the 26S proteasome
DEFF Research Database (Denmark)
Hartmann-Petersen, R; Gordon, C
2004-01-01
The 26S proteasome is the multi-protein protease that recognizes and degrades ubiquitinylated substrates targeted for destruction by the ubiquitin pathway. In addition to the well-documented subunit organization of the 26S holoenzyme, it is clear that a number of other proteins transiently...... associate with the 26S complex. These transiently associated proteins confer a number of different roles such as substrate presentation, cleavage of the multi-ubiquitin chain from the protein substrate and turnover of misfolded proteins. Such activities are essential for the 26S proteasome to efficiently...... fulfill its intracellular function in protein degradation....
The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).
Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M
2011-08-01
The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.
International Nuclear Information System (INIS)
Zerne, R.
1992-01-01
This diploma project consists of spectroscopic examinations of atomic selenium. Natural selenium was thermally dissociated in a quarts resonance cell keeping the background pressure of selenium molecules low by differential heating. The 4p 3 5S 5 S 2 level was excited by frequency-tripled pulsed dye-laser radiation at 207 nm. From time-resolved recording of the fluorescence decay at 216 nm the natural radiative lifetime of the 5 S 2 level was determined to be 493(15) ns. Quantum-beat and optical double resonance measurements in an external magnetic field yielded g j = 2.0004(10) for the Lande factor
Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites
DEFF Research Database (Denmark)
Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie
2017-01-01
Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...
Manchado, Manuel; Infante, Carlos; Asensio, Esther; Cañavate, Jose Pedro; Douglas, Susan E
2007-07-03
Ribosomal proteins (RPs) are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. The development of large-scale genomics of Senegalese sole (Solea senegalensis) and Atlantic halibut (Hippoglossus hippoglossus), two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S) ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29) in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.
Directory of Open Access Journals (Sweden)
Cañavate Jose
2007-07-01
Full Text Available Abstract Background Ribosomal proteins (RPs are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. Results The development of large-scale genomics of Senegalese sole (Solea senegalensis and Atlantic halibut (Hippoglossus hippoglossus, two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29 in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. Conclusion The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.
Ribosome-Inactivating Proteins from Plants: A Historical Overview
Directory of Open Access Journals (Sweden)
Andrea Bolognesi
2016-11-01
Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.