WorldWideScience

Sample records for rhoa-specific nucleotide exchange

  1. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  2. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  3. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  4. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.

    Science.gov (United States)

    Côté, Jean-François; Vuori, Kristiina

    2006-01-01

    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  5. Function of the Nucleotide Exchange Activity of Vav1 in T cell Development and Activation*

    Science.gov (United States)

    Saveliev, Alexander; Vanes, Lesley; Ksionda, Olga; Rapley, Jonathan; Smerdon, Stephen J.; Rittinger, Katrin; Tybulewicz, Victor L. J.

    2012-01-01

    The guanine nucleotide exchange factor (GEF) Vav1 is essential for transducing T cell antigen receptor (TCR) signals and therefore plays a critical role in the development and activation of T cells. It has been presumed that the GEF activity of Vav1 is important for its function; however, there has been no direct demonstration of this. Here, we generated mice expressing enzymatically inactive, but normally folded, Vav1 protein. Analysis of these mice showed that the GEF activity of Vav1 was necessary for the selection of thymocytes and for the optimal activation of T cells, including signal transduction to Rac1, Akt, and integrins. In contrast, the GEF activity of Vav1 was not required for TCR-induced calcium flux, activation of extracellular signal–regulated kinase (ERK) and protein kinase D1 (PKD1), and cell polarization. Thus, in T cells, the GEF activity of Vav1 is essential for some, but not all, of its functions. PMID:20009105

  6. Function of the nucleotide exchange activity of vav1 in T cell development and activation.

    Science.gov (United States)

    Saveliev, Alexander; Vanes, Lesley; Ksionda, Olga; Rapley, Jonathan; Smerdon, Stephen J; Rittinger, Katrin; Tybulewicz, Victor L J

    2009-12-15

    The guanine nucleotide exchange factor (GEF) Vav1 is essential for transducing T cell antigen receptor (TCR) signals and therefore plays a critical role in the development and activation of T cells. It has been presumed that the GEF activity of Vav1 is important for its function; however, there has been no direct demonstration of this. Here, we generated mice expressing enzymatically inactive, but normally folded, Vav1 protein. Analysis of these mice showed that the GEF activity of Vav1 was necessary for the selection of thymocytes and for the optimal activation of T cells, including signal transduction to Rac1, Akt, and integrins. In contrast, the GEF activity of Vav1 was not required for TCR-induced calcium flux, activation of extracellular signal-regulated kinase and protein kinase D1, and cell polarization. Thus, in T cells, the GEF activity of Vav1 is essential for some, but not all, of its functions.

  7. Haploinsufficiency of the Sec7 guanine nucleotide exchange factor gea1 impairs septation in fission yeast.

    Directory of Open Access Journals (Sweden)

    Alan M Eckler

    Full Text Available Membrane trafficking is essential to eukaryotic life and is controlled by a complex network of proteins that regulate movement of proteins and lipids between organelles. The GBF1/GEA family of Guanine nucleotide Exchange Factors (GEFs regulates trafficking between the endoplasmic reticulum and Golgi by catalyzing the exchange of GDP for GTP on ADP Ribosylation Factors (Arfs. Activated Arfs recruit coat protein complex 1 (COP-I to form vesicles that ferry cargo between these organelles. To further explore the function of the GBF1/GEA family, we have characterized a fission yeast mutant lacking one copy of the essential gene gea1 (gea1+/-, the Schizosaccharomyces pombe ortholog of GBF1. The haploinsufficient gea1+/- strain was shown to be sensitive to the GBF1 inhibitor brefeldin A (BFA and was rescued from BFA sensitivity by gea1p overexpression. No overt defects in localization of arf1p or arf6p were observed in gea1+/- cells, but the fission yeast homolog of the COP-I cargo sac1 was mislocalized, consistent with impaired COP-I trafficking. Although Golgi morphology appeared normal, a slight increase in vacuolar size was observed in the gea1+/- mutant strain. Importantly, gea1+/- cells exhibited dramatic cytokinesis-related defects, including disorganized contractile rings, an increased septation index, and alterations in septum morphology. Septation defects appear to result from altered secretion of enzymes required for septum dynamics, as decreased secretion of eng1p, a β-glucanase required for septum breakdown, was observed in gea1+/- cells, and overexpression of eng1p suppressed the increased septation phenotype. These observations implicate gea1 in regulation of septum breakdown and establish S. pombe as a model system to explore GBF1/GEA function in cytokinesis.

  8. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  9. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.

    Science.gov (United States)

    Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

    2014-03-04

    Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.

  11. WBSCR16 Is a Guanine Nucleotide Exchange Factor Important for Mitochondrial Fusion

    Directory of Open Access Journals (Sweden)

    Guorui Huang

    2017-07-01

    Full Text Available Regulated inter-mitochondrial fusion/fission is essential for maintaining optimal mitochondrial respiration and control of apoptosis and autophagy. In mammals, mitochondrial fusion is controlled by outer membrane GTPases MFN1 and MFN2 and by inner membrane (IM GTPase OPA1. Disordered mitochondrial fusion/fission contributes to various pathologies, and MFN2 or OPA1 mutations underlie neurodegenerative diseases. Here, we show that the WBSCR16 protein is primarily associated with the outer face of the inner mitochondrial membrane and is important for mitochondrial fusion. We provide evidence of a WBSCR16/OPA1 physical interaction in the intact cell and of a WBSCR16 function as an OPA1-specific guanine nucleotide exchange factor (GEF. Homozygosity for a Wbscr16 mutation causes early embryonic lethality, whereas neurons of mice heterozygous for the mutation have mitochondria with reduced membrane potential and increased susceptibility to fragmentation upon exposure to stress, suggesting roles for WBSCR16 deficits in neuronal pathologies.

  12. Proteomic analysis of Rac1 signaling regulation by guanine nucleotide exchange factors.

    Science.gov (United States)

    Marei, Hadir; Carpy, Alejandro; Macek, Boris; Malliri, Angeliki

    2016-08-02

    The small GTPase Rac1 is implicated in various cellular processes that are essential for normal cell function. Deregulation of Rac1 signaling has also been linked to a number of diseases, including cancer. The diversity of Rac1 functioning in cells is mainly attributed to its ability to bind to a multitude of downstream effectors following activation by Guanine nucleotide Exchange Factors (GEFs). Despite the identification of a large number of Rac1 binding partners, factors influencing downstream specificity are poorly defined, thus hindering the detailed understanding of both Rac1's normal and pathological functions. In a recent study, we demonstrated a role for 2 Rac-specific GEFs, Tiam1 and P-Rex1, in mediating Rac1 anti- versus pro-migratory effects, respectively. Importantly, via conducting a quantitative proteomic screen, we identified distinct changes in the Rac1 interactome following activation by either GEF, indicating that these opposing effects are mediated through GEF modulation of the Rac1 interactome. Here, we present the full list of identified Rac1 interactors together with functional annotation of the differentially regulated Rac1 binding partners. In light of this data, we also provide additional insights into known and novel signaling cascades that might account for the GEF-mediated Rac1-driven cellular effects.

  13. Expression of a Rho guanine nucleotide exchange factor, Ect2, in the developing mouse pituitary.

    Science.gov (United States)

    Islam, M S; Tsuji, T; Higashida, C; Takahashi, M; Higashida, H; Koizumi, K

    2010-05-01

    The pituitary gland is a highly mitotically active tissue after birth. Various cell types are known to undergo proliferation in the anterior pituitary. However, little is known about the mechanisms regulating mitotic activity in this tissue. When searching for genes specifically expressed in the pituitary gland among those that we previously screened in Drosophila, we found epithelial cell-transforming gene 2 (Ect2). Ect2 is a guanine nucleotide exchange factor for Rho GTPases, which is known to play an essential role in cytokinesis. Although there have been many cellular studies regarding the function of Ect2, the temporal and spatial expression patterns of Ect2 in vivo have not been determined. In the present study, we examined the postnatal developmental expression of Ect2 in the mouse pituitary. Enhanced Ect2 expression was detected in the mouse pituitary gland during the first 3 weeks after birth, which coincided well with the period of rapid pituitary expansion associated with increased growth rate. Immunostaining analysis showed that Ect2-expressing cells were distributed in the anterior and intermediate lobes, but not the posterior lobe, of the pituitary. These Ect2-expressing cells frequently incorporated the thymidine analogue, EdU (5-ethynyl-2'-deoxyuridine), indicating that these cells were mitotically active. Taken together, the results demonstrate the functional role of Ect2 in postnatal proliferating cells in the two lobes of the pituitary, thereby suggesting roles in developmental growth of the mammalian pituitary.

  14. Ric-8A, a Gα protein guanine nucleotide exchange factor potentiates taste receptor signaling

    Directory of Open Access Journals (Sweden)

    Claire J Fenech

    2009-10-01

    Full Text Available Taste receptors for sweet, bitter and umami tastants are G-protein coupled receptors (GPCRs. While much effort has been devoted to understanding G-protein-receptor interactions and identifying the components of the signalling cascade downstream of these receptors, at the level of the G-protein the modulation of receptor signal transduction remains relatively unexplored. In this regard a taste-specific regulator of G-protein signaling (RGS, RGS21, has recently been identified. To study whether guanine nucleotide exchange factors (GEFs are involved in the transduction of the signal downstream of the taste GPCRs we investigated the expression of Ric-8A and Ric-8B in mouse taste cells and their interaction with G-protein subunits found in taste buds. Mammalian Ric-8 proteins were initially identified as potent GEFs for a range of Gα subunits and Ric-8B has recently been shown to amplify olfactory signal transduction. We find that both Ric-8A and Ric-8B are expressed in a large portion of taste bud cells and that most of these cells contain IP3R-3 a marker for sweet, umami and bitter taste receptor cells. Ric-8A interacts with Gα-gustducin and Gαi2 through which it amplifies the signal transduction of hTas2R16, a receptor for bitter compounds. Overall, these findings are consistent with a role for Ric-8 in mammalian taste signal transduction.

  15. Structural landscape of the proline-rich domain of Sos1 nucleotide exchange factor.

    Science.gov (United States)

    McDonald, Caleb B; Bhat, Vikas; Kurouski, Dmitry; Mikles, David C; Deegan, Brian J; Seldeen, Kenneth L; Lednev, Igor K; Farooq, Amjad

    2013-01-01

    Despite its key role in mediating a plethora of cellular signaling cascades pertinent to health and disease, little is known about the structural landscape of the proline-rich (PR) domain of Sos1 guanine nucleotide exchange factor. Herein, using a battery of biophysical tools, we provide evidence that the PR domain of Sos1 is structurally disordered and adopts an extended random coil-like conformation in solution. Of particular interest is the observation that while chemical denaturation of PR domain results in the formation of a significant amount of polyproline II (PPII) helices, it has little or negligible effect on its overall size as measured by its hydrodynamic radius. Our data also show that the PR domain displays a highly dynamic conformational basin in agreement with the knowledge that the intrinsically unstructured proteins rapidly interconvert between an ensemble of conformations. Collectively, our study provides new insights into the conformational equilibrium of a key signaling molecule with important consequences on its physiological function. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Expression Pattern and Localization Dynamics of Guanine Nucleotide Exchange Factor RIC8 during Mouse Oogenesis.

    Directory of Open Access Journals (Sweden)

    Merly Saare

    Full Text Available Targeting of G proteins to the cell cortex and their activation is one of the triggers of both asymmetric and symmetric cell division. Resistance to inhibitors of cholinesterase 8 (RIC8, a guanine nucleotide exchange factor, activates a certain subgroup of G protein α-subunits in a receptor independent manner. RIC8 controls the asymmetric cell division in Caenorhabditis elegans and Drosophila melanogaster, and symmetric cell division in cultured mammalian cells, where it regulates the mitotic spindle orientation. Although intensely studied in mitosis, the function of RIC8 in mammalian meiosis has remained unknown. Here we demonstrate that the expression and subcellular localization of RIC8 changes profoundly during mouse oogenesis. Immunofluorescence studies revealed that RIC8 expression is dependent on oocyte growth and cell cycle phase. During oocyte growth, RIC8 is abundantly present in cytoplasm of oocytes at primordial, primary and secondary preantral follicle stages. Later, upon oocyte maturation RIC8 also populates the germinal vesicle, its localization becomes cell cycle dependent, and it associates with chromatin and the meiotic spindle. After fertilization, RIC8 protein converges to the pronuclei and is also detectable at high levels in the nucleolus precursor bodies of both maternal and paternal pronucleus. During first cleavage of zygote RIC8 localizes in the mitotic spindle and cell cortex of forming blastomeres. In addition, we demonstrate that RIC8 co-localizes with its interaction partners Gαi1/2:GDP and LGN in meiotic/mitotic spindle, cell cortex and polar bodies of maturing oocytes and zygotes. Downregulation of Ric8 by siRNA leads to interferred translocation of Gαi1/2 to cortical region of maturing oocytes and reduction of its levels. RIC8 is also expressed at high level in female reproductive organs e.g. oviduct. Therefore we suggest a regulatory function for RIC8 in mammalian gametogenesis and fertility.

  17. The guanine nucleotide exchange factor RIC8 regulates conidial germination through Gα proteins in Neurospora crassa.

    Directory of Open Access Journals (Sweden)

    Carla J Eaton

    Full Text Available Heterotrimeric G protein signaling is essential for normal hyphal growth in the filamentous fungus Neurospora crassa. We have previously demonstrated that the non-receptor guanine nucleotide exchange factor RIC8 acts upstream of the Gα proteins GNA-1 and GNA-3 to regulate hyphal extension. Here we demonstrate that regulation of hyphal extension results at least in part, from an important role in control of asexual spore (conidia germination. Loss of GNA-3 leads to a drastic reduction in conidial germination, which is exacerbated in the absence of GNA-1. Mutation of RIC8 leads to a reduction in germination similar to that in the Δgna-1, Δgna-3 double mutant, suggesting that RIC8 regulates conidial germination through both GNA-1 and GNA-3. Support for a more significant role for GNA-3 is indicated by the observation that expression of a GTPase-deficient, constitutively active gna-3 allele in the Δric8 mutant leads to a significant increase in conidial germination. Localization of the three Gα proteins during conidial germination was probed through analysis of cells expressing fluorescently tagged proteins. Functional TagRFP fusions of each of the three Gα subunits were constructed through insertion of TagRFP in a conserved loop region of the Gα subunits. The results demonstrated that GNA-1 localizes to the plasma membrane and vacuoles, and also to septa throughout conidial germination. GNA-2 and GNA-3 localize to both the plasma membrane and vacuoles during early germination, but are then found in intracellular vacuoles later during hyphal outgrowth.

  18. A non-catalytic N-terminal domain negatively influences the nucleotide exchange activity of translation elongation factor 1Bα.

    Science.gov (United States)

    Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V

    2016-02-01

    Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect. © 2015 FEBS.

  19. Hydrogen--deuterium exchanges in nucleosides and nucleotides. A mechanism for exchange of the exocyclic amino hydrogens of adenosine

    International Nuclear Information System (INIS)

    Cross, D.G.; Brown, A.; Fisher, H.F.

    1975-01-01

    The pH dependence of the apparent first-order rate constant for the exchange of the exocyclic amino hydrogens of adenosine with deuterium from the solvent was measured by stopped-flow ultraviolet spectroscopy. This dependence shows acid catalysis, base catalysis, and spontaneous exchange at neutral pH values. A study of the effect of several buffers on the rates of exchange reveals both general acid and general base catalytic behavior for the exchange process. We propose a general mechanism for the exchange which requires N-1 protonated adenosine as an intermediate for the acid-catalyzed exchange and amidine anion for the base-catalyzed exchange. In both cases the rate-limiting step is the base-catalyzed abstraction of a proton from the exocyclic amino moiety. Evaluation of the rate constants predicts the equilibrium for the exocyclic amino/imino tautomers to be 6.3 x 10 3 :1. (U.S.)

  20. Regulation of mitotic spindle formation by the RhoA guanine nucleotide exchange factor ARHGEF10

    Directory of Open Access Journals (Sweden)

    Satoh Takaya

    2009-07-01

    Full Text Available Abstract Background The Dbl family guanine nucleotide exchange factor ARHGEF10 was originally identified as the product of the gene associated with slowed nerve-conduction velocities of peripheral nerves. However, the function of ARHGEF10 in mammalian cells is totally unknown at a molecular level. ARHGEF10 contains no distinctive functional domains except for tandem Dbl homology-pleckstrin homology and putative transmembrane domains. Results Here we show that RhoA is a substrate for ARHGEF10. In both G1/S and M phases, ARHGEF10 was localized in the centrosome in adenocarcinoma HeLa cells. Furthermore, RNA interference-based knockdown of ARHGEF10 resulted in multipolar spindle formation in M phase. Each spindle pole seems to contain a centrosome consisting of two centrioles and the pericentriolar material. Downregulation of RhoA elicited similar phenotypes, and aberrant mitotic spindle formation following ARHGEF10 knockdown was rescued by ectopic expression of constitutively activated RhoA. Multinucleated cells were not increased upon ARHGEF10 knockdown in contrast to treatment with Y-27632, a specific pharmacological inhibitor for the RhoA effector kinase ROCK, which induced not only multipolar spindle formation, but also multinucleation. Therefore, unregulated centrosome duplication rather than aberration in cytokinesis may be responsible for ARHGEF10 knockdown-dependent multipolar spindle formation. We further isolated the kinesin-like motor protein KIF3B as a binding partner of ARHGEF10. Knockdown of KIF3B again caused multipolar spindle phenotypes. The supernumerary centrosome phenotype was also observed in S phase-arrested osteosarcoma U2OS cells when the expression of ARHGEF10, RhoA or KIF3B was abrogated by RNA interference. Conclusion Collectively, our results suggest that a novel RhoA-dependent signaling pathway under the control of ARHGEF10 has a pivotal role in the regulation of the cell division cycle. This pathway is not involved in

  1. The domain architecture of large guanine nucleotide exchange factors for the small GTP-binding protein Arf

    Directory of Open Access Journals (Sweden)

    Geldner Niko

    2005-02-01

    Full Text Available Abstract Background Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Results Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7. Conclusion Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.

  2. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  3. ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.

    Directory of Open Access Journals (Sweden)

    Karina Haebig

    Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  4. Anion-exchange analysis of isotopically labelled nucleotides, nucleosides, and bases in metabolic disorders

    International Nuclear Information System (INIS)

    Nissinen, E.A.O.

    1987-01-01

    This paper on the importance of cellular purines and pyrimidines is evidenced by the multitude of diseases, such as hyperuricemia, orotic aciduria, gout, Lesch-Nyhan syndrome, immunodeficiencies with B- and T-cell dysfunctions, etc. which result from aberrant metabolism. In addition, the use of purine and pyrimidine analogs in chemotherapy is of growing interest. Purine metabolism consists of a complex network of biochemical pathway. These pathways are under complicated feedback regulation and there also exists a close relationship between purine and pyrimidine metabolism. In addition, these pathways interact with those of the carbohydrate, amino acid, and energy metabolism. Since metabolic pathways are closely interrelated, a change in the concentration of a particular metabolite may lead to many changes in the overall metabolic profiles. For instance, in the area of nucleotide metabolism, the inhibition of IMP dehydrogenase by mycophenolic acid leads to various changes in both purine and pyrimidine nucleotide pools. Inhibition of de nova purine biosynthesis by methotrexate leads to many changes in purine and pyrimidine ribonucleotides and deoxyribonucleotides. Thus, the simultaneous measurement of all cellular purine and pyrimidine metabolites from individuals whose metabolism is altered, either by a metabolic disease or by the action of drugs, may further our understanding of cellular metabolism

  5. Measurement of nucleotide exchange rate constants in single rabbit soleus myofibrils during shortening and lengthening using a fluorescent ATP analog.

    Science.gov (United States)

    Shirakawa, I; Chaen, S; Bagshaw, C R; Sugi, H

    2000-02-01

    The kinetics of displacement of a fluorescent nucleotide, 2'(3')-O-[N[2-[[Cy3]amido]ethyl]carbamoyl]-adenosine 5'-triphosphate (Cy3-EDA-ATP), bound to rabbit soleus muscle myofibrils were studied using flash photolysis of caged ATP. Use of myofibrils from this slow twitch muscle allowed better resolution of the kinetics of nucleotide exchange than previous studies with psoas muscle myofibrils (, Biophys. J. 73:2033-2042). Soleus myofibrils in the presence of Cy3-EDA-nucleotides (Cy3-EDA-ATP or Cy3-EDA-ADP) showed selective fluorescence staining of the A-band. The K(m) for Cy3-EDA-ATP and the K(d) for Cy3-EDA-ADP binding to the myofibril A-band were 1.9 microM and 3.8 microM, respectively, indicating stronger binding of nucleotide to soleus cross-bridges compared to psoas cross-bridges (2.6 microM and 50 microM, respectively). After flash photolysis of caged ATP, the A-band fluorescence of the myofibril in the Cy3-EDA-ATP solution under isometric conditions decayed exponentially with a rate constant of 0.045 +/- 0.007 s(-1) (n = 32) at 10 degrees C, which was about seven times slower than that for psoas myofibrils. When a myofibril was allowed to shorten with a constant velocity, the nucleotide displacement rate constant increased from 0.066 s(-1) (isometric) to 0.14 s(-1) at 20 degrees C with increasing shortening velocity up to 0.1 myofibril length/s (V(max), the shortening velocity under no load was approximately 0. 2 myofibril lengths/s). The rate constant was not significantly affected by an isovelocity stretch of up to 0.1 myofibril lengths/s. These results suggest that the cross-bridge kinetics are not significantly affected at higher strain during lengthening but depend on the lower strain during shortening. These data also indicate that the interaction distance between a cross-bridge and the actin filament is at least 16 nm for a single cycle of the ATPase.

  6. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    Science.gov (United States)

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki

    2016-01-01

    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  7. The PDZ domain of the guanine nucleotide exchange factor PDZGEF directs binding to phosphatidic acid during brush border formation.

    Directory of Open Access Journals (Sweden)

    Sarah V Consonni

    Full Text Available PDZGEF is a guanine nucleotide exchange factor for the small G protein Rap. It was recently found that PDZGEF contributes to establishment of intestinal epithelial polarity downstream of the kinase Lkb1. By binding to phosphatidic acid enriched at the apical membrane, PDZGEF locally activates Rap2a resulting in induction of brush border formation via a pathway that includes the polarity players TNIK, Mst4 and Ezrin. Here we show that the PDZ domain of PDZGEF is essential and sufficient for targeting PDZGEF to the apical membrane of polarized intestinal epithelial cells. Inhibition of PLD and consequently production of phosphatidic acid inhibitis targeting of PDZGEF to the plasma membrane. Furthermore, localization requires specific positively charged residues within the PDZ domain. We conclude that local accumulation of PDZGEF at the apical membrane during establishment of epithelial polarity is mediated by electrostatic interactions between positively charged side chains in the PDZ domain and negatively charged phosphatidic acid.

  8. Remarkable nanoconfinement effects on chemical equilibrium manifested in nucleotide dimerization and H-D exchange reactions.

    Science.gov (United States)

    Polak, Micha; Rubinovich, Leonid

    2011-10-06

    Nanoconfinement entropic effects on chemical equilibrium involving a small number of molecules, which we term NCECE, are revealed by two widely diverse types of reactions. Employing statistical-mechanical principles, we show how the NCECE effect stabilizes nucleotide dimerization observed within self-assembled molecular cages. Furthermore, the effect provides the basis for dimerization even under an aqueous environment inside the nanocage. Likewise, the NCECE effect is pertinent to a longstanding issue in astrochemistry, namely the extra deuteration commonly observed for molecules reacting on interstellar dust grain surfaces. The origin of the NCECE effect is elucidated by means of the probability distributions of the reaction extent and related variations in the reactant-product mixing entropy. Theoretical modelling beyond our previous preliminary work highlights the role of the nanospace size in addition to that of the nanosystem size, namely the limited amount of molecules in the reaction mixture. Furthermore, the NCECE effect can depend also on the reaction mechanism, and on deviations from stoichiometry. The NCECE effect, leading to enhanced, greatly variable equilibrium "constants", constitutes a unique physical-chemical phenomenon, distinguished from the usual thermodynamical properties of macroscopically large systems. Being significant particularly for weakly exothermic reactions, the effects should stabilize products in other closed nanoscale structures, and thus can have notable implications for the growing nanotechnological utilization of chemical syntheses conducted within confined nanoreactors.

  9. Tritium labelled nucleotides: Heterogeneous metal catalyzed exchange labelling of ATP with tritium gas

    International Nuclear Information System (INIS)

    Jaiswal, D.K.; Morimoto, H.; Williams, P.G.; Wemmer, D.E.

    1991-09-01

    Adenosine 5' triphosphate (ATP) in aqueous solution has been labeled by exchange with tritium gas in the presence of palladium oxide catalyst. Comparison with our experiments using Pd/BaSO 4 as the catalyst shows that we have obtained product with higher specific activity and improved chemical purity. 3 H NMR spectroscopy of the tritiated ATP shows labelling in both the C-8 and C-2 positions, and the integral ratio of these positions was found to vary from 3:1 to 1:1 under different reaction conditions. 5 refs., 1 fig., 2 tabs

  10. The Cdc42 guanine nucleotide exchange factor FGD6 coordinates cell polarity and endosomal membrane recycling in osteoclasts.

    Science.gov (United States)

    Steenblock, Charlotte; Heckel, Tobias; Czupalla, Cornelia; Espírito Santo, Ana Isabel; Niehage, Christian; Sztacho, Martin; Hoflack, Bernard

    2014-06-27

    The initial step of bone digestion is the adhesion of osteoclasts onto bone surfaces and the assembly of podosomal belts that segregate the bone-facing ruffled membrane from other membrane domains. During bone digestion, membrane components of the ruffled border also need to be recycled after macropinocytosis of digested bone materials. How osteoclast polarity and membrane recycling are coordinated remains unknown. Here, we show that the Cdc42-guanine nucleotide exchange factor FGD6 coordinates these events through its Src-dependent interaction with different actin-based protein networks. At the plasma membrane, FGD6 couples cell adhesion and actin dynamics by regulating podosome formation through the assembly of complexes comprising the Cdc42-interactor IQGAP1, the Rho GTPase-activating protein ARHGAP10, and the integrin interactors Talin-1/2 or Filamin A. On endosomes and transcytotic vesicles, FGD6 regulates retromer-dependent membrane recycling through its interaction with the actin nucleation-promoting factor WASH. These results provide a mechanism by which a single Cdc42-exchange factor controlling different actin-based processes coordinates cell adhesion, cell polarity, and membrane recycling during bone degradation. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Phosphorylation- and nucleotide-binding-induced changes to the stability and hydrogen exchange patterns of JNK1ß1 provide insight into its mechanisms of activation

    CSIR Research Space (South Africa)

    Owen, GR

    2014-10-01

    Full Text Available –deuterium exchange (HX) mass spectrometry were used to investigate the changes to the stability and conformation/conformational dynamics of JNK1ß1 induced by phosphorylative activation. Equivalent studies were also employed to determine the effects of nucleotide...

  12. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor

    Science.gov (United States)

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G. H.; Fukuhara, Shigetomo; Taylor, Susan S.; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José

    2016-01-01

    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. PMID:26797121

  13. A computational study of a recreated G protein-GEF reaction intermediate competent for nucleotide exchange: fate of the Mg ion.

    Directory of Open Access Journals (Sweden)

    Mériam Ben Hamida-Rebaï

    Full Text Available Small G-proteins of the superfamily Ras function as molecular switches, interacting with different cellular partners according to their activation state. G-protein activation involves the dissociation of bound GDP and its replacement by GTP, in an exchange reaction that is accelerated and regulated in the cell by guanine-nucleotide exchange factors (GEFs. Large conformational changes accompany the exchange reaction, and our understanding of the mechanism is correspondingly incomplete. However, much knowledge has been derived from structural studies of blocked or inactive mutant GEFs, which presumably closely represent intermediates in the exchange reaction and yet which are by design incompetent for carrying out the nucleotide exchange reaction. In this study we have used comparative modelling to recreate an exchange-competent form of a late, pre-GDP-ejection intermediate species in Arf1, a well-characterized small G-protein. We extensively characterized three distinct models of this intermediate using molecular dynamics simulations, allowing us to address ambiguities related to the mutant structural studies. We observed in particular the unfavorable nature of Mg2+ associated forms of the complex and the establishment of closer Arf1-GEF contacts in its absence. The results of this study shed light on GEF-mediated activation of this small G protein and on predicting the fate of the Mg ion at a critical point in the exchange reaction. The structural models themselves furnish additional targets for interfacial inhibitor design, a promising direction for exploring potentially druggable targets with high biological specificity.

  14. BLOC-3 mutated in Hermansky-Pudlak syndrome is a Rab32/38 guanine nucleotide exchange factor.

    Science.gov (United States)

    Gerondopoulos, Andreas; Langemeyer, Lars; Liang, Jin-Rui; Linford, Andrea; Barr, Francis A

    2012-11-20

    Hermansky-Pudlak syndrome (HPS) is a human disease characterized by partial loss of pigmentation and impaired blood clotting. These symptoms are caused by defects in the biogenesis of melanosomes and platelet dense granules, often referred to as lysosome-related organelles. Genes mutated in HPS encode subunits of the biogenesis of lysosome-related organelles complexes (BLOCs). BLOC-1 and BLOC-2, together with the AP-3 clathrin adaptor complex, act at early endosomes to sort components required for melanin formation and melanosome biogenesis away from the degradative lysosomal pathway toward early stage melanosomes. However the molecular functions of the Hps1-Hps4 complex BLOC-3 remain mysterious. Like other trafficking pathways, melanosome biogenesis and transport of enzymes involved in pigmentation involves specific Rab GTPases, in this instance Rab32 and Rab38. We now demonstrate that BLOC-3 is a Rab32 and Rab38 guanine nucleotide exchange factor (GEF). Silencing of the BLOC-3 subunits Hps1 and Hps4 results in the mislocalization of Rab32 and Rab38 and reduction in pigmentation. In addition, we show that BLOC-3 can promote specific membrane recruitment of Rab32/38. BLOC-3 therefore defines a novel Rab GEF family with a specific function in the biogenesis of lysosome-related organelles. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. A Steric-inhibition model for regulation of nucleotide exchange via the Dock180 family of GEFs.

    Science.gov (United States)

    Lu, Mingjian; Kinchen, Jason M; Rossman, Kent L; Grimsley, Cynthia; Hall, Matthew; Sondek, John; Hengartner, Michael O; Yajnik, Vijay; Ravichandran, Kodi S

    2005-02-22

    CDM (CED-5, Dock180, Myoblast city) family members have been recently identified as novel, evolutionarily conserved guanine nucleotide exchange factors (GEFs) for Rho-family GTPases . They regulate multiple processes, including embryonic development, cell migration, apoptotic-cell engulfment, tumor invasion, and HIV-1 infection, in diverse model systems . However, the mechanism(s) of regulation of CDM proteins has not been well understood. Here, our studies on the prototype member Dock180 reveal a steric-inhibition model for regulating the Dock180 family of GEFs. At basal state, the N-terminal SH3 domain of Dock180 binds to the distant catalytic Docker domain and negatively regulates the function of Dock180. Further studies revealed that the SH3:Docker interaction sterically blocks Rac access to the Docker domain. Interestingly, ELMO binding to the SH3 domain of Dock180 disrupted the SH3:Docker interaction, facilitated Rac access to the Docker domain, and contributed to the GEF activity of the Dock180/ELMO complex. Additional genetic rescue studies in C. elegans suggested that the regulation of the Docker-domain-mediated GEF activity by the SH3 domain and its adjoining region is evolutionarily conserved. This steric-inhibition model may be a general mechanism for regulating multiple SH3-domain-containing Dock180 family members and may have implications for a variety of biological processes.

  16. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.

    Science.gov (United States)

    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G

    2015-12-01

    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs. © 2015 Society for Laboratory Automation and Screening.

  17. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.

    Directory of Open Access Journals (Sweden)

    Hiroaki Kajiho

    Full Text Available The Rab family of small guanosine triphosphatases (GTPases plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs. Ras and Rab interactor (or Ras interaction/interference-like (RINL, which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM domain-containing (Anks protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  18. Structure of the nucleotide exchange factor eIF2B reveals mechanism of memory-enhancing molecule.

    Science.gov (United States)

    Tsai, Jordan C; Miller-Vedam, Lakshmi E; Anand, Aditya A; Jaishankar, Priyadarshini; Nguyen, Henry C; Renslo, Adam R; Frost, Adam; Walter, Peter

    2018-03-30

    Regulation by the integrated stress response (ISR) converges on the phosphorylation of translation initiation factor eIF2 in response to a variety of stresses. Phosphorylation converts eIF2 from a substrate to a competitive inhibitor of its dedicated guanine nucleotide exchange factor, eIF2B, thereby inhibiting translation. ISRIB, a drug-like eIF2B activator, reverses the effects of eIF2 phosphorylation, and in rodents it enhances cognition and corrects cognitive deficits after brain injury. To determine its mechanism of action, we solved an atomic-resolution structure of ISRIB bound in a deep cleft within decameric human eIF2B by cryo-electron microscopy. Formation of fully active, decameric eIF2B holoenzyme depended on the assembly of two identical tetrameric subcomplexes, and ISRIB promoted this step by cross-bridging a central symmetry interface. Thus, regulation of eIF2B assembly emerges as a rheostat for eIF2B activity that tunes translation during the ISR and that can be further modulated by ISRIB. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. Identification of a negative regulatory region for the exchange activity and characterization of T332I mutant of Rho guanine nucleotide exchange factor 10 (ARHGEF10).

    Science.gov (United States)

    Chaya, Taro; Shibata, Satoshi; Tokuhara, Yasunori; Yamaguchi, Wataru; Matsumoto, Hiroshi; Kawahara, Ichiro; Kogo, Mikihiko; Ohoka, Yoshiharu; Inagaki, Shinobu

    2011-08-26

    The T332I mutation in Rho guanine nucleotide exchange factor 10 (ARHGEF10) was previously found in persons with slowed nerve conduction velocities and thin myelination of peripheral nerves. However, the molecular and cellular basis of the T332I mutant is not understood. Here, we show that ARHGEF10 has a negative regulatory region in the N terminus, in which residue 332 is located, and the T332I mutant is constitutively active. An N-terminal truncated ARHGEF10 mutant, ARHGEF10 ΔN (lacking amino acids 1-332), induced cell contraction that was inhibited by a Rho kinase inhibitor Y27632 and had higher GEF activity for RhoA than the wild type. The T332I mutant also showed the phenotype similar to the N-terminal truncated mutant. These data suggest that the ARHGEF10 T332I mutation-associated phenotype observed in the peripheral nerves is due to activated GEF activity of the ARHGEF10 T332I mutant.

  20. Identification of a Negative Regulatory Region for the Exchange Activity and Characterization of T332I Mutant of Rho Guanine Nucleotide Exchange Factor 10 (ARHGEF10)*

    Science.gov (United States)

    Chaya, Taro; Shibata, Satoshi; Tokuhara, Yasunori; Yamaguchi, Wataru; Matsumoto, Hiroshi; Kawahara, Ichiro; Kogo, Mikihiko; Ohoka, Yoshiharu; Inagaki, Shinobu

    2011-01-01

    The T332I mutation in Rho guanine nucleotide exchange factor 10 (ARHGEF10) was previously found in persons with slowed nerve conduction velocities and thin myelination of peripheral nerves. However, the molecular and cellular basis of the T332I mutant is not understood. Here, we show that ARHGEF10 has a negative regulatory region in the N terminus, in which residue 332 is located, and the T332I mutant is constitutively active. An N-terminal truncated ARHGEF10 mutant, ARHGEF10 ΔN (lacking amino acids 1–332), induced cell contraction that was inhibited by a Rho kinase inhibitor Y27632 and had higher GEF activity for RhoA than the wild type. The T332I mutant also showed the phenotype similar to the N-terminal truncated mutant. These data suggest that the ARHGEF10 T332I mutation-associated phenotype observed in the peripheral nerves is due to activated GEF activity of the ARHGEF10 T332I mutant. PMID:21719701

  1. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence*

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L.; Embrey, Kevin J.; Golovanov, Alexander P.

    2016-01-01

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly 15N-labeled Ras as well as [13C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. PMID:26565026

  2. Overexpression of GEFT, a Rho family guanine nucleotide exchange factor, predicts poor prognosis in patients with rhabdomyosarcoma.

    Science.gov (United States)

    Sun, Chao; Liu, Chunxia; Li, Shugang; Li, Hongan; Wang, Yuanyuan; Xie, Yuwen; Li, Bingcheng; Cui, Xiaobin; Chen, Yunzhao; Zhang, Wenjie; Li, Feng

    2014-01-01

    Rhabdomyosarcoma (RMS) is one of the most common soft-tissue sarcomas in children and adolescents with poor prognosis. Yet, there is lack of effective prognostic biomarkers for RMS. The present study, therefore, aimed to explore potential biomarkers for RMS based on our previous findings using array comparative genomic hybridization. We investigated guanine nucleotide exchange factor, GEFT, at expression level in 45 RMS patients and 36 normal striated muscle controls using immunohistochemistry using tissue microarrays. The expression rate of GEFT in RMS samples (42/45, 93.33%) was significantly higher (Prate of GEFT in RMS (31/45, 68.89%) was also significantly higher (P<0.05) than that in normal controls (0/36, 0.00%). Increased expression of GEFT correlated significantly with advanced disease stages (stages III/IV) (P=0.001), lymph node metastasis (P=0.019), and distant metastasis (P=0.004), respectively, in RMS patients. In addition, RMS patients having overexpressed GEFT experienced worse overall survival (OS) than those having low levels of GEFT (P=0.001). GEFT overexpression was determined to be an independent prognostic factor for poor OS in RMS patients (hazard ratio: 3.491, 95% confidence interval: 1.121-10.871, P=0.004). In conclusion, these observations provide the first evidence of GEFT overexpression in RMS and its correlations with disease aggressiveness and metastasis. These findings suggest that GEFT may serve as a promising biomarker predicting poor prognosis in RMS patients, thus implying its potential as a therapeutic target.

  3. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence.

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L; Embrey, Kevin J; Golovanov, Alexander P

    2016-01-22

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly (15)N-labeled Ras as well as [(13)C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Dynamic studies of H-Ras•GTPγS interactions with nucleotide exchange factor Sos reveal a transient ternary complex formation in solution.

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Embrey, Kevin J; Golovanov, Alexander P

    2016-07-14

    The cycling between GDP- and GTP- bound forms of the Ras protein is partly regulated by the binding of Sos. The structural/dynamic behavior of the complex formed between activated Sos and Ras at the point of the functional cycle where the nucleotide exchange is completed has not been described to date. Here we show that solution NMR spectra of H-Ras∙GTPγS mixed with a functional fragment of Sos (Sos(Cat)) at a 2:1 ratio are consistent with the formation of a rather dynamic assembly. H-Ras∙GTPγS binding was in fast exchange on the NMR timescale and retained a significant degree of molecular tumbling independent of Sos(Cat), while Sos(Cat) also tumbled largely independently of H-Ras. Estimates of apparent molecular weight from both NMR data and SEC-MALS revealed that, at most, only one H-Ras∙GTPγS molecule appears stably bound to Sos. The weak transient interaction between Sos and the second H-Ras∙GTPγS may provide a necessary mechanism for complex dissociation upon the completion of the native GDP → GTP exchange reaction, but also explains measurable GTP → GTP exchange activity of Sos routinely observed in in vitro assays that use fluorescently-labelled analogs of GTP. Overall, the data presents the first dynamic snapshot of Ras functional cycle as controlled by Sos.

  5. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  6. Guanine nucleotide exchange factor αPIX leads to activation of the Rac 1 GTPase/glycogen phosphorylase pathway in interleukin (IL)-2-stimulated T cells

    DEFF Research Database (Denmark)

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea

    2015-01-01

    Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate...... in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described....... More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation...

  7. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein regulates neurite development via PI3K-AKT and ERK signaling pathways.

    Science.gov (United States)

    Zhou, C; Li, C; Li, D; Wang, Y; Shao, W; You, Y; Peng, J; Zhang, X; Lu, L; Shen, X

    2013-12-19

    The elongation of neuron is highly dependent on membrane trafficking. Brefeldin A (BFA)-inhibited guanine nucleotide-exchange protein 1 (BIG1) functions in the membrane trafficking between the Golgi apparatus and the plasma membrane. BFA, an uncompetitive inhibitor of BIG1 can inhibit neurite outgrowth and polarity development. In this study, we aimed to define the possible role of BIG1 in neurite development and to further investigate the potential mechanism. By immunostaining, we found that BIG1 was extensively colocalized with synaptophysin, a marker for synaptic vesicles in soma and partly in neurites. The amount of both protein and mRNA of BIG1 were up-regulated during rat brain development. BIG1 depletion significantly decreased the neurite length and inhibited the phosphorylation of phosphatidylinositide 3-kinase (PI3K) and protein kinase B (AKT). Inhibition of BIG1 guanine nucleotide-exchange factor (GEF) activity by BFA or overexpression of the dominant-negative BIG1 reduced PI3K and AKT phosphorylation, indicating regulatory effects of BIG1 on PI3K-AKT signaling pathway is dependent on its GEF activity. BIG1 siRNA or BFA treatment also significantly reduced extracellular signal-regulated kinase (ERK) phosphorylation. Overexpression of wild-type BIG1 significantly increased ERK phosphorylation, but the dominant-negative BIG1 had no effect on ERK phosphorylation, indicating the involvement of BIG1 in ERK signaling regulation may not be dependent on its GEF activity. Our result identified a novel function of BIG1 in neurite development. The newly recognized function integrates the function of BIG1 in membrane trafficking with the activation of PI3K-AKT and ERK signaling pathways which are critical in neurite development. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  8. Reversible thermal transition in GrpE, the nucleotide exchange factor of the DnaK heat-shock system.

    Science.gov (United States)

    Grimshaw, J P; Jelesarov, I; Schönfeld, H J; Christen, P

    2001-03-02

    DnaK, a Hsp70 acting in concert with its co-chaperones DnaJ and GrpE, is essential for Escherichia coli to survive environmental stress, including exposure to elevated temperatures. Here we explored the influence of temperature on the structure of the individual components and the functional properties of the chaperone system. GrpE undergoes extensive but fully reversible conformational changes in the physiologically relevant temperature range (transition midpoint at approximately 48 degrees C), as observed with both circular dichroism measurements and differential scanning calorimetry, whereas no thermal transitions occur in DnaK and DnaJ between 15 degrees C and 48 degrees C. The conformational changes in GrpE appear to be important in controlling the interconversion of T-state DnaK (ATP-liganded, low affinity for polypeptide substrates) and R-state DnaK (ADP-liganded, high affinity for polypeptide substrates). The rate of the T --> R conversion of DnaK due to DnaJ-triggered ATP hydrolysis follows an Arrhenius temperature dependence. In contrast, the rate of the R --> T conversion due to GrpE-catalyzed ADP/ATP exchange increases progressively less with increasing temperature and even decreases at temperatures above approximately 40 degrees C, indicating a temperature-dependent reversible inactivation of GrpE. At heat-shock temperatures, the reversible structural changes of GrpE thus shift DnaK toward its high-affinity R state.

  9. The N54-αs Mutant Has Decreased Affinity for βγ and Suggests a Mechanism for Coupling Heterotrimeric G Protein Nucleotide Exchange with Subunit Dissociation.

    Science.gov (United States)

    Cleator, John H; Wells, Christopher A; Dingus, Jane; Kurtz, David T; Hildebrandt, John D

    2018-05-01

    Ser54 of G s α binds guanine nucleotide and Mg 2+ as part of a conserved sequence motif in GTP binding proteins. Mutating the homologous residue in small and heterotrimeric G proteins generates dominant-negative proteins, but by protein-specific mechanisms. For α i/o , this results from persistent binding of α to βγ , whereas for small GTP binding proteins and α s this results from persistent binding to guanine nucleotide exchange factor or receptor. This work examined the role of βγ interactions in mediating the properties of the Ser54-like mutants of G α subunits. Unexpectedly, WT- α s or N54- α s coexpressed with α 1B -adrenergic receptor in human embryonic kidney 293 cells decreased receptor stimulation of IP3 production by a cAMP-independent mechanism, but WT- α s was more effective than the mutant. One explanation for this result would be that α s , like Ser47 α i/o , blocks receptor activation by sequestering βγ ; implying that N54- α S has reduced affinity for βγ since it was less effective at blocking IP3 production. This possibility was more directly supported by the observation that WT- α s was more effective than the mutant in inhibiting βγ activation of phospholipase C β 2. Further, in vitro synthesized N54- α s bound biotinylated- βγ with lower apparent affinity than did WT- α s The Cys54 mutation also decreased βγ binding but less effectively than N54- α s Substitution of the conserved Ser in α o with Cys or Asn increased βγ binding, with the Cys mutant being more effective. This suggests that Ser54 of α s is involved in coupling changes in nucleotide binding with altered subunit interactions, and has important implications for how receptors activate G proteins. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  10. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor: EFFECT ON PKA LOCALIZATION AND P-Rex1 SIGNALING.

    Science.gov (United States)

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G H; Fukuhara, Shigetomo; Taylor, Susan S; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José

    2016-03-18

    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  12. A Histidine pH sensor regulates activation of the Ras-specific guanine nucleotide exchange factor RasGRP1.

    Science.gov (United States)

    Vercoulen, Yvonne; Kondo, Yasushi; Iwig, Jeffrey S; Janssen, Axel B; White, Katharine A; Amini, Mojtaba; Barber, Diane L; Kuriyan, John; Roose, Jeroen P

    2017-09-27

    RasGRPs are guanine nucleotide exchange factors that are specific for Ras or Rap, and are important regulators of cellular signaling. Aberrant expression or mutation of RasGRPs results in disease. An analysis of RasGRP1 SNP variants led to the conclusion that the charge of His 212 in RasGRP1 alters signaling activity and plasma membrane recruitment, indicating that His 212 is a pH sensor that alters the balance between the inactive and active forms of RasGRP1. To understand the structural basis for this effect we compared the structure of autoinhibited RasGRP1, determined previously, to those of active RasGRP4:H-Ras and RasGRP2:Rap1b complexes. The transition from the autoinhibited to the active form of RasGRP1 involves the rearrangement of an inter-domain linker that displaces inhibitory inter-domain interactions. His 212 is located at the fulcrum of these conformational changes, and structural features in its vicinity are consistent with its function as a pH-dependent switch.

  13. An unexpected role for the yeast nucleotide exchange factor Sil1 as a reductant acting on the molecular chaperone BiP

    Science.gov (United States)

    Siegenthaler, Kevin D; Pareja, Kristeen A; Wang, Jie; Sevier, Carolyn S

    2017-01-01

    Unfavorable redox conditions in the endoplasmic reticulum (ER) can decrease the capacity for protein secretion, altering vital cell functions. While systems to manage reductive stress are well-established, how cells cope with an overly oxidizing ER remains largely undefined. In previous work (Wang et al., 2014), we demonstrated that the chaperone BiP is a sensor of overly oxidizing ER conditions. We showed that modification of a conserved BiP cysteine during stress beneficially alters BiP chaperone activity to cope with suboptimal folding conditions. How this cysteine is reduced to reestablish 'normal' BiP activity post-oxidative stress has remained unknown. Here we demonstrate that BiP's nucleotide exchange factor – Sil1 – can reverse BiP cysteine oxidation. This previously unexpected reductant capacity for yeast Sil1 has potential implications for the human ataxia Marinesco-Sjögren syndrome, where it is interesting to speculate that a disruption in ER redox-signaling (due to genetic defects in SIL1) may influence disease pathology. DOI: http://dx.doi.org/10.7554/eLife.24141.001 PMID:28257000

  14. Solo, a RhoA-targeting guanine nucleotide exchange factor, is critical for hemidesmosome formation and acinar development in epithelial cells.

    Science.gov (United States)

    Fujiwara, Sachiko; Matsui, Tsubasa S; Ohashi, Kazumasa; Deguchi, Shinji; Mizuno, Kensaku

    2018-01-01

    Cell-substrate adhesions are essential for various physiological processes, including embryonic development and maintenance of organ functions. Hemidesmosomes (HDs) are multiprotein complexes that attach epithelial cells to the basement membrane. Formation and remodeling of HDs are dependent on the surrounding mechanical environment; however, the upstream signaling mechanisms are not well understood. We recently reported that Solo (also known as ARHGEF40), a guanine nucleotide exchange factor targeting RhoA, binds to keratin8/18 (K8/K18) intermediate filaments, and that their interaction is important for force-induced actin and keratin cytoskeletal reorganization. In this study, we show that Solo co-precipitates with an HD protein, β4-integrin. Co-precipitation assays revealed that the central region (amino acids 330-1057) of Solo binds to the C-terminal region (1451-1752) of β4-integrin. Knockdown of Solo significantly suppressed HD formation in MCF10A mammary epithelial cells. Similarly, knockdown of K18 or treatment with Y-27632, a specific inhibitor of Rho-associated kinase (ROCK), suppressed HD formation. As Solo knockdown or Y-27632 treatment is known to disorganize K8/K18 filaments, these results suggest that Solo is involved in HD formation by regulating K8/K18 filament organization via the RhoA-ROCK signaling pathway. We also showed that knockdown of Solo impairs acinar formation in MCF10A cells cultured in 3D Matrigel. In addition, Solo accumulated at the site of traction force generation in 2D-cultured MCF10A cells. Taken together, these results suggest that Solo plays a crucial role in HD formation and acinar development in epithelial cells by regulating mechanical force-induced RhoA activation and keratin filament organization.

  15. Rac1 Activation Caused by Membrane Translocation of a Guanine Nucleotide Exchange Factor in Akt2-Mediated Insulin Signaling in Mouse Skeletal Muscle.

    Directory of Open Access Journals (Sweden)

    Nobuyuki Takenaka

    Full Text Available Insulin-stimulated glucose uptake in skeletal muscle is mediated by the glucose transporter GLUT4, which is translocated to the plasma membrane following insulin stimulation. Several lines of evidence suggested that the protein kinase Akt2 plays a key role in this insulin action. The small GTPase Rac1 has also been implicated as a regulator of insulin-stimulated GLUT4 translocation, acting downstream of Akt2. However, the mechanisms whereby Akt2 regulates Rac1 activity remain obscure. The guanine nucleotide exchange factor FLJ00068 has been identified as a direct regulator of Rac1 in Akt2-mediated signaling, but its characterization was performed mostly in cultured myoblasts. Here, we provide in vivo evidence that FLJ00068 indeed acts downstream of Akt2 as a Rac1 regulator by using mouse skeletal muscle. Small interfering RNA knockdown of FLJ00068 markedly diminished GLUT4 translocation to the sarcolemma following insulin administration or ectopic expression of a constitutively activated mutant of either phosphoinositide 3-kinase or Akt2. Additionally, insulin and these constitutively activated mutants caused the activation of Rac1 as shown by immunofluorescent microscopy using a polypeptide probe specific to activated Rac1 in isolated gastrocnemius muscle fibers and frozen sections of gastrocnemius muscle. This Rac1 activation was also abrogated by FLJ00068 knockdown. Furthermore, we observed translocation of FLJ00068 to the cell periphery following insulin stimulation in cultured myoblasts. Localization of FLJ00068 in the plasma membrane in insulin-stimulated, but not unstimulated, myoblasts and mouse gastrocnemius muscle was further affirmed by subcellular fractionation and subsequent immunoblotting. Collectively, these results strongly support a critical role of FLJ00068 in Akt2-mediated Rac1 activation in mouse skeletal muscle insulin signaling.

  16. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Kagiwada, Satoshi; Shimazu, Sayuri; Takegawa, Kaoru; Noguchi, Tetsuko; Miyamoto, Masaaki

    2015-01-01

    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed

  17. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta [Department of Biology, Graduate School of Science, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Kagiwada, Satoshi [Department of Biological Sciences, Faculty of Science, Nara Women' s University, Kitauoyanishi-machi, Nara 630-8506 (Japan); Shimazu, Sayuri [Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Takegawa, Kaoru [Department of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Noguchi, Tetsuko [Department of Biological Sciences, Faculty of Science, Nara Women' s University, Kitauoyanishi-machi, Nara 630-8506 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Department of Biology, Graduate School of Science, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan)

    2015-03-20

    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed.

  18. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  19. ARF6 Activated by the LHCG Receptor through the Cytohesin Family of Guanine Nucleotide Exchange Factors Mediates the Receptor Internalization and Signaling*

    Science.gov (United States)

    Kanamarlapudi, Venkateswarlu; Thompson, Aiysha; Kelly, Eamonn; López Bernal, Andrés

    2012-01-01

    The luteinizing hormone chorionic gonadotropin receptor (LHCGR) is a Gs-coupled GPCR that is essential for the maturation and function of the ovary and testis. LHCGR is internalized following its activation, which regulates the biological responsiveness of the receptor. Previous studies indicated that ADP-ribosylation factor (ARF)6 and its GTP-exchange factor (GEF) cytohesin 2 regulate LHCGR internalization in follicular membranes. However, the mechanisms by which ARF6 and cytohesin 2 regulate LHCGR internalization remain incompletely understood. Here we investigated the role of the ARF6 signaling pathway in the internalization of heterologously expressed human LHCGR (HLHCGR) in intact cells using a combination of pharmacological inhibitors, siRNA and the expression of mutant proteins. We found that human CG (HCG)-induced HLHCGR internalization, cAMP accumulation and ARF6 activation were inhibited by Gallein (βγ inhibitor), Wortmannin (PI 3-kinase inhibitor), SecinH3 (cytohesin ARF GEF inhibitor), QS11 (an ARF GAP inhibitor), an ARF6 inhibitory peptide and ARF6 siRNA. However, Dynasore (dynamin inhibitor), the dominant negative mutants of NM23-H1 (dynamin activator) and clathrin, and PBP10 (PtdIns 4,5-P2-binding peptide) inhibited agonist-induced HLHCGR and cAMP accumulation but not ARF6 activation. These results indicate that heterotrimeric G-protein, phosphatidylinositol (PI) 3-kinase (PI3K), cytohesin ARF GEF and ARF GAP function upstream of ARF6 whereas dynamin and clathrin act downstream of ARF6 in the regulation of HCG-induced HLHCGR internalization and signaling. In conclusion, we have identified the components and molecular details of the ARF6 signaling pathway required for agonist-induced HLHCGR internalization. PMID:22523074

  20. Comprehensive behavioral analysis of mice deficient in Rapgef2 and Rapgef6, a subfamily of guanine nucleotide exchange factors for Rap small GTPases possessing the Ras/Rap-associating domain.

    Science.gov (United States)

    Maeta, Kazuhiro; Hattori, Satoko; Ikutomo, Junji; Edamatsu, Hironori; Bilasy, Shymaa E; Miyakawa, Tsuyoshi; Kataoka, Tohru

    2018-05-10

    Rapgef2 and Rapgef6 define a subfamily of guanine nucleotide exchange factors for Rap small GTPases, characterized by the possession of the Ras/Rap-associating domain. Previous genomic analyses suggested their possible involvement in the etiology of schizophrenia. We recently demonstrated the development of an ectopic cortical mass (ECM), which resembles the human subcortical band heterotopia, in the dorsal telencephalon-specific Rapgef2 conditional knockout (Rapgef2-cKO) brains. Additional knockout of Rapgef6 in Rapgef2-cKO mice resulted in gross enlargement of the ECM whereas knockout of Rapgef6 alone (Rapgef6-KO) had no discernible effect on the brain morphology. Here, we performed a battery of behavioral tests to examine the effects of Rapgef2 or Rapgef6 deficiency on higher brain functions. Rapgef2-cKO mice exhibited hyperlocomotion phenotypes. They showed decreased anxiety-like behavior in the elevated plus maze and the open-field tests as well as increased depression-like behavior in the Porsolt forced swim and tail suspension tests. They also exhibited increased sociability especially in novel environments. They showed defects in cognitive function as evidenced by reduced learning ability in the Barnes circular maze test and by impaired working memory in the T maze tests. In contrast, although Rapgef6 and Rapgef2 share similarities in biochemical roles, Rapgef6-KO mice exhibited mild behavioral abnormalities detected with a number of behavioral tests, such as hyperlocomotion phenotype in the open-field test and the social interaction test with a novel environment and working-memory defects in the T-maze test. In conclusion, although there were differences in their brain morphology and the magnitude of the behavioral abnormalities, Rapgef2-cKO mice and Rapgef6-KO mice exhibited hyperlocomotion phenotype and working-memory defect, both of which could be recognized as schizophrenia-like behavior.

  1. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  2. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  3. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  4. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  5. Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain.

    Science.gov (United States)

    Ahn, Jinhi; Beharry, Seelochan; Molday, Laurie L; Molday, Robert S

    2003-10-10

    ABCR, also known as ABCA4, is a member of the superfamily of ATP binding cassette transporters that is believed to transport retinal or retinylidene-phosphatidylethanolamine across photoreceptor disk membranes. Mutations in the ABCR gene are responsible for Stargardt macular dystrophy and related retinal dystrophies that cause severe loss in vision. ABCR consists of two tandemly arranged halves each containing a membrane spanning segment followed by a large extracellular/lumen domain, a multi-spanning membrane domain, and a nucleotide binding domain (NBD). To define the role of each NBD, we examined the nucleotide binding and ATPase activities of the N and C halves of ABCR individually and co-expressed in COS-1 cells and derived from trypsin-cleaved ABCR in disk membranes. When disk membranes or membranes from co-transfected cells were photoaffinity labeled with 8-azido-ATP and 8-azido-ADP, only the NBD2 in the C-half bound and trapped the nucleotide. Co-expressed half-molecules displayed basal and retinal-stimulated ATPase activity similar to full-length ABCR. The individually expressed N-half displayed weak 8-azido-ATP labeling and low basal ATPase activity that was not stimulated by retinal, whereas the C-half did not bind ATP and exhibited little if any ATPase activity. Purified ABCR contained one tightly bound ADP, presumably in NBD1. Our results indicate that only NBD2 of ABCR binds and hydrolyzes ATP in the presence or absence of retinal. NBD1, containing a bound ADP, associates with NBD2 to play a crucial, non-catalytic role in ABCR function.

  6. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  7. Triple resonance experiments for the simultaneous correlation of H6/H5 and exchangeable protons of pyrimidine nucleotides in 13C,15N-labeled RNA applicable to larger RNA molecules

    International Nuclear Information System (INIS)

    Woehnert, Jens; Goerlach, Matthias; Schwalbe, Harald

    2003-01-01

    Triple-resonance two-dimensional H6/H5(C4N)H and C6/C5(C4N)H experiments are described that provide through-bond H6/H5 or C6/C5 to imino/amino correlations in pyrimidine bases in 13 C, 15 N-labeled RNA. The experiments simultaneously transfer H6/H5 magnetization by an INEPT step to the C6/C5 nuclei and by homonuclear CC- and heteronuclear CN-TOCSY steps via the intervening C4 nucleus to the N3/N4 nuclei and then by a reverse INEPT step to the imino/amino hydrogens. The sensitivity of these experiments is high as demonstrated using a 30-nucleotide pyrimidine rich RNA at a concentration of 0.9 mM at temperatures of 10 deg. C and 25 deg. C. This indicates the general applicability of the experiments and the possibility to obtain correlations for imino resonances in non-canonical regions of the target RNA

  8. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  9. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  10. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  11. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  12. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  13. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  14. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  15. Chromatographic study of nucleosides and nucleotides of central nervous system. Identification and first results on changes after total gamma irradiation of brain

    International Nuclear Information System (INIS)

    Valle, C.; Marquer, C.; Pasquier, C.

    Changes of brain energetic state and of different levels after irradiation are studied. The results will be compared with the variations of brain electric activity due to irradiation. Using an ion exchange chromatographic method for separation and quantitative analysis of nucleotides, evaluation of adenylic nucleotides in brain rat have been chosen [fr

  16. Heat exchanger

    International Nuclear Information System (INIS)

    Dostatni, A.W.; Dostatni, Michel.

    1976-01-01

    In the main patent, a description was given of a heat exchanger with an exchange surface in preformed sheet metal designed for the high pressure and temperature service particularly encountered in nuclear pressurized water reactors and which is characterised by the fact that it is composed of at least one exchanger bundle sealed in a containment, the said bundle or bundles being composed of numerous juxtaposed individual compartments whose exchange faces are built of preformed sheet metal. The present addendun certificate concerns shapes of bundles and their positioning methods in the exchanger containment enabling its compactness to be increased [fr

  17. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  18. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  19. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  20. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  1. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  2. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  3. Heat exchanger

    International Nuclear Information System (INIS)

    Leigh, D.G.

    1976-01-01

    The arrangement described relates particularly to heat exchangers for use in fast reactor power plants, in which heat is extracted from the reactor core by primary liquid metal coolant and is then transferred to secondary liquid metal coolant by means of intermediate heat exchangers. One of the main requirements of such a system, if used in a pool type fast reactor, is that the pressure drop on the primary coolant side must be kept to a minimum consistent with the maintenance of a limited dynamic head in the pool vessel. The intermediate heat exchanger must also be compact enough to be accommodated in the reactor vessel, and the heat exchanger tubes must be available for inspection and the detection and plugging of leaks. If, however, the heat exchanger is located outside the reactor vessel, as in the case of a loop system reactor, a higher pressure drop on the primary coolant side is acceptable, and space restriction is less severe. An object of the arrangement described is to provide a method of heat exchange and a heat exchanger to meet these problems. A further object is to provide a method that ensures that excessive temperature variations are not imposed on welded tube joints by sudden changes in the primary coolant flow path. Full constructional details are given. (U.K.)

  4. Exchange Network

    Science.gov (United States)

    The Environmental Information Exchange Network (EN) is an Internet-based system used by state, tribal and territorial partners to securely share environmental and health information with one another and EPA.

  5. Hydrogen exchange

    DEFF Research Database (Denmark)

    Jensen, Pernille Foged; Rand, Kasper Dyrberg

    2016-01-01

    Hydrogen exchange (HX) monitored by mass spectrometry (MS) is a powerful analytical method for investigation of protein conformation and dynamics. HX-MS monitors isotopic exchange of hydrogen in protein backbone amides and thus serves as a sensitive method for probing protein conformation...... and dynamics along the entire protein backbone. This chapter describes the exchange of backbone amide hydrogen which is highly quenchable as it is strongly dependent on the pH and temperature. The HX rates of backbone amide hydrogen are sensitive and very useful probes of protein conformation......, as they are distributed along the polypeptide backbone and form the fundamental hydrogen-bonding networks of basic secondary structure. The effect of pressure on HX in unstructured polypeptides (poly-dl-lysine and oxidatively unfolded ribonuclease A) and native folded proteins (lysozyme and ribonuclease A) was evaluated...

  6. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  7. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  8. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  9. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  10. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  11. Heat exchanger

    International Nuclear Information System (INIS)

    Drury, C.R.

    1988-01-01

    A heat exchanger having primary and secondary conduits in heat-exchanging relationship is described comprising: at least one serpentine tube having parallel sections connected by reverse bends, the serpentine tube constituting one of the conduits; a group of open-ended tubes disposed adjacent to the parallel sections, the open-ended tubes constituting the other of the conduits, and forming a continuous mass of contacting tubes extending between and surrounding the serpentine tube sections; and means securing the mass of tubes together to form a predetermined cross-section of the entirety of the mass of open-ended tubes and tube sections

  12. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  13. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  14. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  15. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  16. Heat exchanger

    Science.gov (United States)

    Wolowodiuk, Walter

    1976-01-06

    A heat exchanger of the straight tube type in which different rates of thermal expansion between the straight tubes and the supply pipes furnishing fluid to those tubes do not result in tube failures. The supply pipes each contain a section which is of helical configuration.

  17. Heat exchangers

    International Nuclear Information System (INIS)

    1975-01-01

    The tubes of a heat exchanger tube bank have a portion thereof formed in the shape of a helix, of effective radius equal to the tube radius and the space between two adjacent tubes, to tangentially contact the straight sections of the tubes immediately adjacent thereto and thereby provide support, maintain the spacing and account for differential thermal expansion thereof

  18. Exchange Options

    NARCIS (Netherlands)

    Jamshidian, F.

    2007-01-01

    The contract is described and market examples given. Essential theoretical developments are introduced and cited chronologically. The principles and techniques of hedging and unique pricing are illustrated for the two simplest nontrivial examples: the classical Black-Scholes/Merton/Margrabe exchange

  19. Exchange rates.

    Science.gov (United States)

    Mills, Bev

    2003-09-01

    IN MAY this year, I was lucky enough to go to Larissa in northern Greece as part of Hope Exchange 2003, an annual study tour organised by the European Union's hospital committee and administered by the Institute of Healthcare Management (IHM).

  20. Heat exchanger

    Science.gov (United States)

    Daman, Ernest L.; McCallister, Robert A.

    1979-01-01

    A heat exchanger is provided having first and second fluid chambers for passing primary and secondary fluids. The chambers are spaced apart and have heat pipes extending from inside one chamber to inside the other chamber. A third chamber is provided for passing a purge fluid, and the heat pipe portion between the first and second chambers lies within the third chamber.

  1. Heat exchanger

    International Nuclear Information System (INIS)

    Wolowodiuk, W.

    1976-01-01

    A heat exchanger of the straight tube type is described in which different rates of thermal expansion between the straight tubes and the supply pipes furnishing fluid to those tubes do not result in tube failures. The supply pipes each contain a section which is of helical configuration

  2. Kinetics of the interactions between yeast elongation factors 1A and 1Balpha, guanine nucleotides, and aminoacyl-tRNA

    DEFF Research Database (Denmark)

    Gromadski, Kirill B; Schümmer, Tobias; Strømgaard, Anne

    2007-01-01

    of guanine nucleotides. At the concentrations of nucleotides and factors prevailing in the cell, the overall exchange rate is expected to be in the range of 6 s(-1), which is compatible with the rate of protein synthesis in the cell. eEF1A.GTP binds Phe-tRNA(Phe) with a K(d) of 3 nm, whereas eEF1A.GDP shows...... no significant binding, indicating that eEF1A has similar tRNA binding properties as its prokaryotic homolog, EF-Tu. Udgivelsesdato: 2007-Dec-7...

  3. Ion exchange equilibrium constants

    CERN Document Server

    Marcus, Y

    2013-01-01

    Ion Exchange Equilibrium Constants focuses on the test-compilation of equilibrium constants for ion exchange reactions. The book first underscores the scope of the compilation, equilibrium constants, symbols used, and arrangement of the table. The manuscript then presents the table of equilibrium constants, including polystyrene sulfonate cation exchanger, polyacrylate cation exchanger, polymethacrylate cation exchanger, polysterene phosphate cation exchanger, and zirconium phosphate cation exchanger. The text highlights zirconium oxide anion exchanger, zeolite type 13Y cation exchanger, and

  4. Heat exchanger

    International Nuclear Information System (INIS)

    Bennett, J.C.

    1975-01-01

    A heat exchanger such as forms, for example, part of a power steam boiler is made up of a number of tubes that may be arranged in many different ways, and it is necessary that the tubes be properly supported. The means by which the tubes are secured must be as simple as possible so as to facilitate construction and must be able to continue to function effectively under the varying operating conditions to which the heat exchanger is subject. The arrangement described is designed to meet these requirements, in an improved way. The tubes are secured to a member extending past several tubes and abutment means are provided. At least some of the abutment means comprise two abutment pieces and a wedge secured to the supporting member, that acts on these pieces to maintain the engagement. (U.K.)

  5. Heat exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, E L; Eisenmann, G; Hahne, E [Stuttgart Univ. (TH) (F.R. Germany). Inst. fuer Thermodynamik und Waermetechnik

    1976-04-01

    A survey is presented on publications on design, heat transfer, form factors, free convection, evaporation processes, cooling towers, condensation, annular gap, cross-flowed cylinders, axial flow through a bundle of tubes, roughnesses, convective heat transfer, loss of pressure, radiative heat transfer, finned surfaces, spiral heat exchangers, curved pipes, regeneraters, heat pipes, heat carriers, scaling, heat recovery systems, materials selection, strength calculation, control, instabilities, automation of circuits, operational problems and optimization.

  6. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  7. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  8. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  9. The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy); Bianchi, Vera, E-mail: vbianchi@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy)

    2012-10-15

    In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [{sup 3}H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1{sup -} cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1{sup +} cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: Black-Right-Pointing-Pointer Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. Black-Right-Pointing-Pointer siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1{sup -} cells. Black-Right-Pointing-Pointer PNC1 overexpression accumulates dTTP in mitochondria of TK1{sup +} cells. Black-Right-Pointing-Pointer PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. Black-Right-Pointing-Pointer PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.

  10. The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

    International Nuclear Information System (INIS)

    Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara; Bianchi, Vera

    2012-01-01

    In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [ 3 H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1 − cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1 + cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: ► Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. ► siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1 − cells. ► PNC1 overexpression accumulates dTTP in mitochondria of TK1 + cells. ► PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. ► PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.

  11. Exchanging information

    International Nuclear Information System (INIS)

    1971-01-01

    The Agency has a statutory mandate to foster 'the exchange of scientific and technical information on the peaceful uses of atomic energy'. The prime responsibility for this work within the Agency lies with the Division of Scientific and Technical Information, a part of the Department of Technical Operations. The Division accomplishes its task by holding conferences and symposia (Scientific Conferences Section), through the Agency Library, by publishing scientific journals, and through the International Nuclear Information System (INIS). The Computer Section of the Division, which offers services to the Agency as a whole, provides resources for the automation of data storage and retrieval. (author)

  12. Matchmaker Exchange.

    Science.gov (United States)

    Sobreira, Nara L M; Arachchi, Harindra; Buske, Orion J; Chong, Jessica X; Hutton, Ben; Foreman, Julia; Schiettecatte, François; Groza, Tudor; Jacobsen, Julius O B; Haendel, Melissa A; Boycott, Kym M; Hamosh, Ada; Rehm, Heidi L

    2017-10-18

    In well over half of the individuals with rare disease who undergo clinical or research next-generation sequencing, the responsible gene cannot be determined. Some reasons for this relatively low yield include unappreciated phenotypic heterogeneity; locus heterogeneity; somatic and germline mosaicism; variants of uncertain functional significance; technically inaccessible areas of the genome; incorrect mode of inheritance investigated; and inadequate communication between clinicians and basic scientists with knowledge of particular genes, proteins, or biological systems. To facilitate such communication and improve the search for patients or model organisms with similar phenotypes and variants in specific candidate genes, we have developed the Matchmaker Exchange (MME). MME was created to establish a federated network connecting databases of genomic and phenotypic data using a common application programming interface (API). To date, seven databases can exchange data using the API (GeneMatcher, PhenomeCentral, DECIPHER, MyGene2, matchbox, Australian Genomics Health Alliance Patient Archive, and Monarch Initiative; the latter included for model organism matching). This article guides usage of the MME for rare disease gene discovery. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.

  13. Heat exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Harada, F; Yanagida, T; Fujie, K; Futawatari, H

    1975-04-30

    The purpose of this construction is the improvement of heat transfer in finned tube heat exchangers, and therefore the improvement of its efficiency or its output per unit volume. This is achieved by preventing the formation of flow boundary layers in gaseous fluid. This effect always occurs on flow of smooth adjacent laminae, and especially if these have pipes carrying liquid passing through them; it worsens the heat transfer of such a boundary layer considerably compared to that in the turbulent range. The fins, which have several rows of heat exchange tubes passing through them, are fixed at a small spacing on theses tubes. The fins have slots cut in them by pressing or punching, where the pressed-out material remains as a web, which runs parallel to the level of the fin and at a small distance from it. These webs and slots are arranged radially around every tube hole, e.g. 6 in number. For a suitable small tube spacing, two adjacent tubes opposite each other have one common slot. Many variants of such slot arrangements are illustrated.

  14. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  15. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  16. Segmented heat exchanger

    Science.gov (United States)

    Baldwin, Darryl Dean; Willi, Martin Leo; Fiveland, Scott Byron; Timmons, Kristine Ann

    2010-12-14

    A segmented heat exchanger system for transferring heat energy from an exhaust fluid to a working fluid. The heat exchanger system may include a first heat exchanger for receiving incoming working fluid and the exhaust fluid. The working fluid and exhaust fluid may travel through at least a portion of the first heat exchanger in a parallel flow configuration. In addition, the heat exchanger system may include a second heat exchanger for receiving working fluid from the first heat exchanger and exhaust fluid from a third heat exchanger. The working fluid and exhaust fluid may travel through at least a portion of the second heat exchanger in a counter flow configuration. Furthermore, the heat exchanger system may include a third heat exchanger for receiving working fluid from the second heat exchanger and exhaust fluid from the first heat exchanger. The working fluid and exhaust fluid may travel through at least a portion of the third heat exchanger in a parallel flow configuration.

  17. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  18. An alternative membrane transport pathway for phosphate and adenine nucleotides in mitochondria and its possible function

    Science.gov (United States)

    Reynafarje, Baltazar; Lehninger, Albert L.

    1978-01-01

    This paper describes the properties and a possible biological role of a transport process across the inner membrane of rat liver mitochondria resulting in the exchange of ATP4- (out) for ADP3- (in) + 0.5 phosphate2- (in). This transmembrane exchange reaction, designated as the ATP-ADP-phosphate exchange, is specific for the ligands shown, electroneutral, insensitive to N-ethylmaleimide or mersalyl, inhibited by atractyloside, and appears to occur only in the direction as written. It is thus distinct from the well-known phosphate-hydroxide and phosphate-dicarboxylate exchange systems, which are inhibited by mersalyl, and from the ATP-ADP exchanger, which does not transport phosphate. During ATP hydrolysis by mitochondria, half of the phosphate formed from ATP passes from the matrix to the medium by the mersalyl-insensitive ATP-ADP-phosphate exchange and the other half by the well-known mersalyl-sensitive phosphate-hydroxide exchange. These and other considerations have led to a hypothesis for the pathway and stoichiometry of ATP-dependent reverse electron transport, characterized by a requirement of 1.33 molecules of ATP per pair of electrons reversed and by the utilization of a different membrane transport pathway for phosphate and adenine nucleotides than is taken in forward electron flow and oxidative phosphorylation. The possible occurrence of independent pathways for ATP-forming forward electron flow and ATP-consuming reverse electron flow is consonant with the fact that the opposing degradative and synthetic pathways in the central routes of cell metabolism generally have different pathways that are independently regulated. PMID:283393

  19. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  20. Interaction between nucleotide binding sites on chloroplast coupling factor 1 during ATP hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Leckband, D.; Hammes, G.G.

    1987-04-21

    The initial hydrolysis of radioactively-labelled CaATP by chloroplast coupling factor 1 was studied with the quenched-flow method. The time course of hydrolysis can be described as a first-order conversion of the enzyme to an active form followed by steady-state formation of product. The rate constant for the first-order process is independent of substrate concentration but increased hyperbolically to a limiting value of 0.43 s/sup -1/ with increasing concentrations of free Ca/sup 2 +/. A mechanism involving a Ca/sup 2 +/-triggered conversion to an active form of the enzyme is consistent with the data. The steady-state rate varied sigmoidally with the CaATP concentration. Initial exchange of tightly bound ADP is complex: approx. 50% of the bound nucleotide is lost within 30 s, with complete exchange requiring several minutes. The first-order rate constant characterizing the rapid phase of the reaction increases hyperbolically to a limiting value of 0.26 s/sup -1/ as the concentration of CaATP is increased, indicating that the binding of CaATP to the enzyme promotes the exchange process. Modification of the quenched-flow apparatus permitted measurement of the rate of nucleotide exchange during steady-state catalysis. The value of the first-order rate constant characterizing this process is similar to the catalytic rate constant determined under identical conditions. When MgATP is tightly bound to the enzyme, none of the kinetic properties of the enzyme described above were significantly changes. The results obtained suggest a mechanism in which two sites on the enzyme participate in catalysis. Several possible mechanisms consistent with the data are discussed.

  1. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  2. Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life

    Science.gov (United States)

    Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle

    2016-03-01

    The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the

  3. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  4. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  5. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  6. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  7. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  8. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  9. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  10. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  11. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  12. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  13. Exchange market pressure

    NARCIS (Netherlands)

    Jager, H.; Klaassen, F.; Durlauf, S.N.; Blume, L.E.

    2010-01-01

    Currencies can be under severe pressure in the foreign exchange market, but in a fixed (or managed) exchange rate regime that is not fully visible via the change in the exchange rate. Exchange market pressure (EMP) is a concept developed to nevertheless measure the pressure in such cases. This

  14. The preparation of nucleotides uniformly labelled with carbon-14 by biosinthetic methods. Isolation of adenilic, uridilic, cytidilic and guanlic acids, from the alkaline hydrolisate of escherichia coli RNA

    International Nuclear Information System (INIS)

    Garcia Pineda, D.; Pacheco Lopez, J.

    1978-01-01

    A method is described for the preparation and analysis of adenilic, uridilic, cytidylic and guanilic acids, labelled with carbon 14. Escherichia coli cells have been labelled by growing them in media containing glucose-carbon 14 as their only source of carbon. RNA is isolated from the cells, and after hydrolisis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the isolated nucleotides is determined and also its specific radioactivity. The distribution of radioactivity incorporated in the cell among different groups of molecular species is analyse. (author)

  15. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  16. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  17. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  18. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  19. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  1. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  2. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  4. Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

    Science.gov (United States)

    Flechsig, Holger

    2016-02-01

    ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter

  5. Effects of fenspiride on human bronchial cyclic nucleotide phosphodiesterase isoenzymes: functional and biochemical study.

    Science.gov (United States)

    Cortijo, J; Naline, E; Ortiz, J L; Berto, L; Girard, V; Malbezin, M; Advenier, C; Morcillo, E J

    1998-01-02

    We have investigated the role of human bronchial cyclic nucleotide phosphodiesterases in the effects of fenspiride, a drug endowed with bronchodilator and anti-inflammatory properties. Functional studies on human isolated bronchi showed that fenspiride (10(-6)-3 x 10(-3) M, 30 min) induced a shift to the left of the concentration-response curves for isoprenaline and sodium nitroprusside with -logEC50 values of 4.1+/-0.1 (n = 7) and 3.5+/-0.2 (n = 8), respectively. Biochemical studies were carried out on three human bronchi in which separation of cyclic nucleotide phosphodiesterase isoenzymes was performed by ion exchange chromatography followed by determination of phosphodiesterase activity with a radioisotopic method. Phosphodiesterase 4 (cyclic AMP-specific) and phosphodiesterase 5 (cyclic GMP-specific) were the major phosphodiesterase isoforms present in the human bronchial tissue. The presence of phosphodiesterase 1 (Ca2+/calmodulin-stimulated), phosphodiesterase 2 (cyclic GMP-stimulated) and, in two cases, phosphodiesterase 3 (cyclic GMP-inhibited) was also identified. Fenspiride inhibited phosphodiesterase 4 and phosphodiesterase 3 activities with -logIC50 values of 4.16+/-0.09 and 3.44+/-0.12, respectively. Phosphodiesterase 5 activity was also inhibited with a -logIC50 value of approximately 3.8. Fenspiride (fenspiride is an effective inhibitor of both cyclic AMP and cyclic GMP hydrolytic activity in human bronchial tissues and this action may contribute to its airway effects.

  6. Yersinia Virulence Depends on Mimicry of Host Rho-Family Nucleotide Dissociation Inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Prehna,G.; Ivanov, M.; Blisha, J.; Stebbins, C.

    2006-01-01

    Yersinia spp. cause gastroenteritis and the plague, representing historically devastating pathogens that are currently an important biodefense and antibiotic resistance concern. A critical virulence determinant is the Yersinia protein kinase A, or YpkA, a multidomain protein that disrupts the eukaryotic actin cytoskeleton. Here we solve the crystal structure of a YpkA-Rac1 complex and find that YpkA possesses a Rac1 binding domain that mimics host guanidine nucleotide dissociation inhibitors (GDIs) of the Rho GTPases. YpkA inhibits nucleotide exchange in Rac1 and RhoA, and mutations that disrupt the YpkA-GTPase interface abolish this activity in vitro and impair in vivo YpkA-induced cytoskeletal disruption. In cell culture experiments, the kinase and the GDI domains of YpkA act synergistically to promote cytoskeletal disruption, and a Y. pseudotuberculosis mutant lacking YpkA GDI activity shows attenuated virulence in a mouse infection assay. We conclude that virulence in Yersinia depends strongly upon mimicry of host GDI proteins by YpkA.

  7. Isotopically exchangeable phosphorus

    International Nuclear Information System (INIS)

    Barbaro, N.O.

    1984-01-01

    A critique revision of isotope dilution is presented. The concepts and use of exchangeable phosphorus, the phosphate adsorption, the kinetics of isotopic exchange and the equilibrium time in soils are discussed. (M.A.C.) [pt

  8. NCHRP peer exchange 2008.

    Science.gov (United States)

    2008-09-01

    Peer exchanges for state department of transportation (DOT) research programs originated with : the Intermodal Surface Transportation Efficiency Act of 1991 (ISTEA). That federal legislation : required the states to conduct periodic peer exchanges to...

  9. Indiana Health Information Exchange

    Science.gov (United States)

    The Indiana Health Information Exchange is comprised of various Indiana health care institutions, established to help improve patient safety and is recognized as a best practice for health information exchange.

  10. Fundamentals of ion exchange

    International Nuclear Information System (INIS)

    Townsend, R.P.

    1993-01-01

    In this paper the fundamentals of ion exchange mechanisms and their thermodynamics are described. A range of ion exchange materials is considered and problems of communication and technology transfer between scientists working in the field are discussed. (UK)

  11. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  12. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  13. Kinetics of hydrogen-deuterium exchange in guanosine 5'-monophosphate and guanosine 3':5'-monophosphate determined by laser-Raman spectroscopy.

    Science.gov (United States)

    Lane, M J; Thomas, G J

    1979-09-04

    Pseudo-first-order rate constants governing the deuterium exchange of 8-CH groups in guanosine 5'-monophosphate (5'-rGMP) and guanosine 3':5'-monophosphate (cGMP) were determined as a function of temperature in the range 30-80 degrees C by means of laser-Raman spectroscopy. For each guanine nucleotide the logarithm of the rate constant exhibits a strictly linear dependence on reciprocal temperature: i.e., k psi = Ae-Ea/RT with A = 8.84 X 10(14) h-1 and Ea = 24.6 kcal/mol for 5'-rGMP and A = 3.33 X 10(13) h-1 and Ea = 22.2 kcal/mol for cGMP. Exchange of the 8-CH groups in guanine nucleotides is generally 2-3 times more rapid than in adenine nucleotides [cf. g. j. thomas, Jr., & J. Livramento (1975) Biochemistry 14, 5210-5218]. As in the case of adenine nucleotides, cyclic and 5' nucleotides of guanine exchange at markedly different rates at lower temperatures, with exchange in the cyclic nucleotide being the more facile. Each of the guanine nucleotides was prepared in four different isotopic modifications for Raman spectral analysis. The Raman frequency shifts resulting from the various isotopic substitutions have been tabulated, and assignments have been given for most of the observed vibrational frequencies.

  14. Exchange rate policy

    Directory of Open Access Journals (Sweden)

    Plačkov Slađana

    2013-01-01

    Full Text Available Small oscillations of exchange rate certainly affect the loss of confidence in the currency (Serbian dinar, CSD and because of the shallow market even the smallest change in the supply and demand leads to a shift in exchange rate and brings uncertainty. Some economists suggest that the course should be linked to inflation and thus ensure predictable and stable exchange rates. Real exchange rate or slightly depressed exchange rate will encourage the competitiveness of exporters and perhaps ensure the development of new production lines which, in terms of overvalued exchange rate, had no economic justification. Fixed exchange rate will bring lower interest rates, lower risk and lower business uncertainty (uncertainty avoidance, but Serbia will also reduce foreign exchange reserves by following this trend. On the other hand, a completely free exchange rate, would lead to a (real fall of Serbian currency, which in a certain period would lead to a significant increase in exports, but the consequences for businessmen and citizens with loans pegged to the euro exchange rate, would be disastrous. We will pay special attention to the depreciation of the exchange rate, as it is generally favorable to the export competitiveness of Serbia and, on the other hand, it leads to an increase in debt servicing costs of the government as well as of the private sector. Oscillations of the dinar exchange rate, appreciation and depreciation, sometimes have disastrous consequences on the economy, investors, imports and exports. In subsequent work, we will observe the movement of the dinar exchange rate in Serbia, in the time interval 2009-2012, in order to strike a balance and maintain economic equilibrium. A movement of foreign currencies against the local currency is controlled in the foreign exchange market, so in case economic interests require, The National Bank of Serbia (NBS, on the basis of arbitrary criteria, can intervene in the market.

  15. Functional expression of human adenine nucleotide translocase 4 in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Takashi Hamazaki

    2011-04-01

    Full Text Available The adenine nucleotide translocase (ANT mediates the exchange of ADP and ATP across the inner mitochondrial membrane. The human genome encodes multiple ANT isoforms that are expressed in a tissue-specific manner. Recently a novel germ cell-specific member of the ANT family, ANT4 (SLC25A31 was identified. Although it is known that targeted depletion of ANT4 in mice resulted in male infertility, the functional biochemical differences between ANT4 and other somatic ANT isoforms remain undetermined. To gain insight into ANT4, we expressed human ANT4 (hANT4 in yeast mitochondria. Unlike the somatic ANT proteins, expression of hANT4 failed to complement an AAC-deficient yeast strain for growth on media requiring mitochondrial respiration. Moreover, overexpression of hANT4 from a multi-copy plasmid interfered with optimal yeast growth. However, mutation of specific amino acids of hANT4 improved yeast mitochondrial expression and supported growth of the AAC-deficient yeast on non-fermentable carbon sources. The mutations affected amino acids predicted to interact with phospholipids, suggesting the importance of lipid interactions for function of this protein. Each mutant hANT4 and the somatic hANTs exhibited similar ADP/ATP exchange kinetics. These data define common and distinct biochemical characteristics of ANT4 in comparison to ANT1, 2 and 3 providing a basis for study of its unique adaptation to germ cells.

  16. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  17. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  18. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  19. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  20. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  1. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  2. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  3. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  4. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  5. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  6. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  7. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  8. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  9. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  10. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  11. Automated exchange transfusion and exchange rate.

    Science.gov (United States)

    Funato, M; Shimada, S; Tamai, H; Taki, H; Yoshioka, Y

    1989-10-01

    An automated blood exchange transfusion (BET) with a two-site technique has been devised by Goldmann et al and by us, using an infusion pump. With this method, we successfully performed exchange transfusions 189 times in the past four years on 110 infants with birth weights ranging from 530 g to 4,000 g. The exchange rate by the automated method was compared with the rate by Diamond's method. Serum bilirubin (SB) levels before and after BET and the maximal SB rebound within 24 hours after BET were: 21.6 +/- 2.4, 11.5 +/- 2.2, and 15.0 +/- 1.5 mg/dl in the automated method, and 22.0 +/- 2.9, 11.2 +/- 2.5, and 17.7 +/- 3.2 mg/dl in Diamond's method, respectively. The result showed that the maximal rebound of the SB level within 24 hours after BET was significantly lower in the automated method than in Diamond's method (p less than 0.01), though SB levels before and after BET were not significantly different between the two methods. The exchange rate was also measured by means of staining the fetal red cells (F cells) both in the automated method and in Diamond's method, and comparing them. The exchange rate of F cells in Diamond's method went down along the theoretical exchange curve proposed by Diamond, while the rate in the automated method was significantly better than in Diamond's, especially in the early stage of BET (p less than 0.01). We believe that the use of this automated method may give better results than Diamond's method in the rate of exchange, because this method is performed with a two-site technique using a peripheral artery and vein.

  12. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  13. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  14. Outlook for ion exchange

    International Nuclear Information System (INIS)

    Kunin, R.

    1977-01-01

    This paper presents the history and theory of ion exchange technology and discusses the usefulness of ion exchange resins which found broad applications in chemical operations. It is demonstrated that the theory of ion exchange technology seems to be moving away from the physical chemist back to the polymer chemist where it started originally. This but confronted the polymer chemists with some knotty problems. It is pointed out that one has still to learn how to use ion exchange materials as efficiently as possible in terms of the waste load that is being pumped into the environment. It is interesting to note that, whereas ion exchange is used for abating pollution, it is also a polluter. One must learn how to use ion exchange as an antipollution device, and at the same time minimize its polluting properties

  15. Microsoft Exchange 2013 cookbook

    CERN Document Server

    Van Horenbeeck, Michael

    2013-01-01

    This book is a practical, hands-on guide that provides the reader with a number of clear, step-by-step exercises.""Microsoft Exchange 2013 Cookbook"" is targeted at network administrators who deal with the Exchange server in their day-to-day jobs. It assumes you have some practical experience with previous versions of Exchange (although this is not a requirement), without being a subject matter expert.

  16. Reactor fuel exchanging facility

    International Nuclear Information System (INIS)

    Kubota, Shin-ichi.

    1981-01-01

    Purpose: To enable operation of an emergency manual operating mechanism for a fuel exchanger with all operatorless trucks and remote operation of a manipulator even if the exchanger fails during the fuel exchanging operation. Constitution: When a fuel exchanging system fails while connected to a pressure tube of a nuclear reactor during a fuel exchanging operation, a stand-by self-travelling truck automatically runs along a guide line to the position corresponding to the stopping position at that time of the fuel exchanger based on a command from a central control chamber. At this time the truck is switched to manual operation, and approaches the exchanger while being monitored through a television camera and then stops. Then, a manipurator is connected to the emergency manual operating mechanism of the exchanger, and is operated through necessary emergency steps by driving the snout, the magazine, the grab or the like in the exchanger in response to the problem, and necessary operations for the emergency treatment are thus performed. (Sekiya, K.)

  17. GRUNDTVIG in transnational exchange

    DEFF Research Database (Denmark)

    Grundtvig in transnational exchange is the report from the seminar in december 2015 in cooperation with University of Cape Town and University of Hamburg.......Grundtvig in transnational exchange is the report from the seminar in december 2015 in cooperation with University of Cape Town and University of Hamburg....

  18. Building Relationships through Exchange

    Science.gov (United States)

    Primavera, Angi; Hall, Ellen

    2011-01-01

    From the moment of birth, children form and develop relationships with others in their world based on exchange. Children recognize that engaging in such encounters offers them the opportunity to enter into a relationship with another individual and to nurture that relationship through the exchange of messages and gifts, items and ideas. At Boulder…

  19. Exotic baryonium exchanges

    International Nuclear Information System (INIS)

    Nicolescu, B.

    1978-05-01

    The prominent effects supposed to be associated with the exchange of exotic baryonium Regge trajectories are reviewed. The experimental presence of all expected effects leads to suggest that the baryonium exchange mechanism is a correct phenomenological picture and that mesons with isospin 2 or 3/2 or with strangeness 2, strongly coupled to the baryon-antibaryon channels, must be observed

  20. Optimization of Heat Exchangers

    International Nuclear Information System (INIS)

    Catton, Ivan

    2010-01-01

    The objective of this research is to develop tools to design and optimize heat exchangers (HE) and compact heat exchangers (CHE) for intermediate loop heat transport systems found in the very high temperature reator (VHTR) and other Generation IV designs by addressing heat transfer surface augmentation and conjugate modeling. To optimize heat exchanger, a fast running model must be created that will allow for multiple designs to be compared quickly. To model a heat exchanger, volume averaging theory, VAT, is used. VAT allows for the conservation of mass, momentum and energy to be solved for point by point in a 3 dimensional computer model of a heat exchanger. The end product of this project is a computer code that can predict an optimal configuration for a heat exchanger given only a few constraints (input fluids, size, cost, etc.). As VAT computer code can be used to model characteristics (pumping power, temperatures, and cost) of heat exchangers more quickly than traditional CFD or experiment, optimization of every geometric parameter simultaneously can be made. Using design of experiment, DOE and genetric algorithms, GE, to optimize the results of the computer code will improve heat exchanger design.

  1. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  2. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  3. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  4. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  5. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  6. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  7. Standardizing exchange formats

    International Nuclear Information System (INIS)

    Lemmel, H.D.; Schmidt, J.J.

    1992-01-01

    An international network of co-operating data centres is described who maintain identical data bases which are simultaneously updated by an agreed data exchange procedure. The agreement covers ''data exchange formats'' which are compatible to the centres' internal data storage and retrieval systems which remain different, optimized at each centre to the available computer facilities and to the needs of the data users. Essential condition for the data exchange is an agreement on common procedures for the data exchange is an agreement on common procedures for the data compilation, including critical data analysis and validation. The systems described (''EXFOR'', ''ENDF'', ''CINDA'') are used for ''nuclear reaction data'', but the principles used for data compilation and exchange should be valid also for other data types. (author). 24 refs, 4 figs

  8. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  10. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  11. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  12. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  13. Anion exchange membrane

    Science.gov (United States)

    Verkade, John G; Wadhwa, Kuldeep; Kong, Xueqian; Schmidt-Rohr, Klaus

    2013-05-07

    An anion exchange membrane and fuel cell incorporating the anion exchange membrane are detailed in which proazaphosphatrane and azaphosphatrane cations are covalently bonded to a sulfonated fluoropolymer support along with anionic counterions. A positive charge is dispersed in the aforementioned cations which are buried in the support to reduce the cation-anion interactions and increase the mobility of hydroxide ions, for example, across the membrane. The anion exchange membrane has the ability to operate at high temperatures and in highly alkaline environments with high conductivity and low resistance.

  14. The preparation of nucleotides uniformly labelled with carbon-14 by biosynthetic methods. Isolation of adenylic, uridylic, cytidylic,and guanylic acids, from the alkaline hydrolysate of escherichia coli RNA

    International Nuclear Information System (INIS)

    Garcia Pineda, M. D.; Pacheco Lopez, J.

    1978-01-01

    A method is described for the preparation and analysis of adenylic, uri dilic, cytidi- 11c and guanylic acids, labelled with 14 C . Escherichia coli cells have been labelled by growing them in a medi dia containing glucose-14 C as their only source of carbon. RNA is isolated from the cells, and after hydrolysis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the Isolated nucleotides is determined, and also its specific radioactivity. (Author) 30 refs

  15. Data Exchange Inventory System (DEXI)

    Data.gov (United States)

    Social Security Administration — Enterprise tool used to identify data exchanges occurring between SSA and our trading partners. DEXI contains information on both incoming and outgoing exchanges and...

  16. Pion double charge exchange

    International Nuclear Information System (INIS)

    Cooper, M.D.

    1978-01-01

    The pion double charge exchange data on the oxygen isotopes is reviewed and new data on 9 Be, 12 C, 24 Mg, and 28 Si are presented. Where theoretical calculations exist, they are compared to the data. 9 references

  17. Research peer exchange, 2014.

    Science.gov (United States)

    2017-08-01

    The WSDOT Research Peer Exchange was held in Olympia, Washington on May 13 and 14, 2014 and addressed Research Program and Project Management as described in the following paragraphs: Program Management There are numerous funding programs, standing c...

  18. Cation Exchange Water Softeners

    Science.gov (United States)

    WaterSense released a notice of intent to develop a specification for cation exchange water softeners. The program has made the decision not to move forward with a spec at this time, but is making this information available.

  19. Exchange Risk Management Policy

    CERN Document Server

    2005-01-01

    At the Finance Committee of March 2005, following a comment by the CERN Audit Committee, the Chairman invited the Management to prepare a document on exchange risk management policy. The Finance Committee is invited to take note of this document.

  20. HUD Exchange Grantee Database

    Data.gov (United States)

    Department of Housing and Urban Development — The About Grantees section of the HUD Exchange brings up contact information, reports, award, jurisdiction, and location data for organizations that receive HUD...

  1. NASA Earth Exchange (NEX)

    Data.gov (United States)

    National Aeronautics and Space Administration — The NASA Earth Exchange (NEX) represents a new platform for the Earth science community that provides a mechanism for scientific collaboration and knowledge sharing....

  2. Floating Exchange Rate Regime

    OpenAIRE

    Quader, Syed Manzur

    2004-01-01

    In recent years, many developing countries having a history of high inflation, unfavorable balance of payment situation and a high level of foreign currencies denominated debt, have switched or are in the process of switching to a more flexible exchange rate regime. Therefore, the stability of the exchange rate and the dynamics of its volatility are more crucial than before to prevent financial crises and macroeconomic disturbances. This paper is designed to find out the reasons behind Bangla...

  3. Heat exchange apparatus

    International Nuclear Information System (INIS)

    Thurston, G.C.; McDaniels, J.D.; Gertsch, P.R.

    1979-01-01

    The present invention relates to heat exchangers used for transferring heat from the gas cooled core of a nuclear reactor to a secondary medium during standby and emergency conditions. The construction of the heat exchanger described is such that there is a minimum of welds exposed to the reactor coolant, the parasitic heat loss during normal operation of the reactor is minimized and the welds and heat transfer tubes are easily inspectable. (UK)

  4. Hibernation and gas exchange.

    Science.gov (United States)

    Milsom, William K; Jackson, Donald C

    2011-01-01

    Hibernation in endotherms and ectotherms is characterized by an energy-conserving metabolic depression due to low body temperatures and poorly understood temperature-independent mechanisms. Rates of gas exchange are correspondly reduced. In hibernating mammals, ventilation falls even more than metabolic rate leading to a relative respiratory acidosis that may contribute to metabolic depression. Breathing in some mammals becomes episodic and in some small mammals significant apneic gas exchange may occur by passive diffusion via airways or skin. In ectothermic vertebrates, extrapulmonary gas exchange predominates and in reptiles and amphibians hibernating underwater accounts for all gas exchange. In aerated water diffusive exchange permits amphibians and many species of turtles to remain fully aerobic, but hypoxic conditions can challenge many of these animals. Oxygen uptake into blood in both endotherms and ectotherms is enhanced by increased affinity of hemoglobin for O₂ at low temperature. Regulation of gas exchange in hibernating mammals is predominately linked to CO₂/pH, and in episodic breathers, control is principally directed at the duration of the apneic period. Control in submerged hibernating ectotherms is poorly understood, although skin-diffusing capacity may increase under hypoxic conditions. In aerated water blood pH of frogs and turtles either adheres to alphastat regulation (pH ∼8.0) or may even exhibit respiratory alkalosis. Arousal in hibernating mammals leads to restoration of euthermic temperature, metabolic rate, and gas exchange and occurs periodically even as ambient temperatures remain low, whereas body temperature, metabolic rate, and gas exchange of hibernating ectotherms are tightly linked to ambient temperature. © 2011 American Physiological Society.

  5. Real exchange rate misalignments

    OpenAIRE

    Terra, Maria Cristina T.; Valladares, Frederico Estrella Carneiro

    2003-01-01

    This paper characterizes episodes of real appreciations and depreciations for a sample of 85 countries, approximately from 1960 to 1998. First, the equilibrium real exchange rate series are constructed for each country using Goldfajn and Valdes (1999) methodology (cointegration with fundamentals). Then, departures from equilibrium real exchange rate (misalignments) are obtained, and a Markov Switching Model is used to characterize the misalignments series as stochastic autor...

  6. Heat exchanger cleaning

    International Nuclear Information System (INIS)

    Gatewood, J.R.

    1980-01-01

    A survey covers the various types of heat-exchange equipment that is cleaned routinely in fossil-fired generating plants, the hydrocarbon-processing industry, pulp and paper mills, and other industries; the various types, sources, and adverse effects of deposits in heat-exchange equipment; some details of the actual procedures for high-pressure water jetting and chemical cleaning of some specific pieces of equipment, including nuclear steam generators. (DN)

  7. Single-molecule diffusometry reveals the nucleotide-dependent oligomerization pathways of Nicotiana tabacum Rubisco activase

    Science.gov (United States)

    Wang, Quan; Serban, Andrew J.; Wachter, Rebekka M.; Moerner, W. E.

    2018-03-01

    Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ˜0.1 s-1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.

  8. Cryptographic Combinatorial Securities Exchanges

    Science.gov (United States)

    Thorpe, Christopher; Parkes, David C.

    We present a useful new mechanism that facilitates the atomic exchange of many large baskets of securities in a combinatorial exchange. Cryptography prevents information about the securities in the baskets from being exploited, enhancing trust. Our exchange offers institutions who wish to trade large positions a new alternative to existing methods of block trading: they can reduce transaction costs by taking advantage of other institutions’ available liquidity, while third party liquidity providers guarantee execution—preserving their desired portfolio composition at all times. In our exchange, institutions submit encrypted orders which are crossed, leaving a “remainder”. The exchange proves facts about the portfolio risk of this remainder to third party liquidity providers without revealing the securities in the remainder, the knowledge of which could also be exploited. The third parties learn either (depending on the setting) the portfolio risk parameters of the remainder itself, or how their own portfolio risk would change if they were to incorporate the remainder into a portfolio they submit. In one setting, these third parties submit bids on the commission, and the winner supplies necessary liquidity for the entire exchange to clear. This guaranteed clearing, coupled with external price discovery from the primary markets for the securities, sidesteps difficult combinatorial optimization problems. This latter method of proving how taking on the remainder would change risk parameters of one’s own portfolio, without revealing the remainder’s contents or its own risk parameters, is a useful protocol of independent interest.

  9. Radial flow heat exchanger

    Science.gov (United States)

    Valenzuela, Javier

    2001-01-01

    A radial flow heat exchanger (20) having a plurality of first passages (24) for transporting a first fluid (25) and a plurality of second passages (26) for transporting a second fluid (27). The first and second passages are arranged in stacked, alternating relationship, are separated from one another by relatively thin plates (30) and (32), and surround a central axis (22). The thickness of the first and second passages are selected so that the first and second fluids, respectively, are transported with laminar flow through the passages. To enhance thermal energy transfer between first and second passages, the latter are arranged so each first passage is in thermal communication with an associated second passage along substantially its entire length, and vice versa with respect to the second passages. The heat exchangers may be stacked to achieve a modular heat exchange assembly (300). Certain heat exchangers in the assembly may be designed slightly differently than other heat exchangers to address changes in fluid properties during transport through the heat exchanger, so as to enhance overall thermal effectiveness of the assembly.

  10. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  11. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  12. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  13. Simultaneous quantification of porcine myocardial adenine nucleotides and creatine phosphate by ion-pair reverse-phase high-performance liquid chromatography

    International Nuclear Information System (INIS)

    Cordis, G.A.; Das, D.K.

    1987-01-01

    In order to follow the energy metabolism and the levels of high-energy phosphate compounds in porcine myocardium subjected to ischemic insult, it was necessary to develop a high-performance liquid chromatography (HPLC) method where creatine phosphate (CP) and the adenine nucleotides could be measured simultaneously in a single run. Currently available ion-pair reverse-phase HPLC methods require a separate injection with a change in wavelength and mobile phase in order to measure the creatine phosphate, while baseline separation of AMP is lacking. The ion-exchange HPLC method includes a simultaneous determination, but the baseline drifts due to the gradient and baseline separation of AMP is not achieved. In the following ion-pair reverse-phase HPLC method, simultaneous measurements of porcine myocardial adenine nucleotides and creatine phosphate were achieved along with a stable baseline and homogeneous baseline separation of each measured compound, allowing accurate quantification

  14. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  15. 2-Oxoglutarate levels control adenosine nucleotide binding by Herbaspirillum seropedicae PII proteins.

    Science.gov (United States)

    Oliveira, Marco A S; Gerhardt, Edileusa C M; Huergo, Luciano F; Souza, Emanuel M; Pedrosa, Fábio O; Chubatsu, Leda S

    2015-12-01

    Nitrogen metabolism in Proteobacteria is controlled by the Ntr system, in which PII proteins play a pivotal role, controlling the activity of target proteins in response to the metabolic state of the cell. Characterization of the binding of molecular effectors to these proteins can provide information about their regulation. Here, the binding of ATP, ADP and 2-oxoglutarate (2-OG) to the Herbaspirillum seropedicae PII proteins, GlnB and GlnK, was characterized using isothermal titration calorimetry. Results show that these proteins can bind three molecules of ATP, ADP and 2-OG with homotropic negative cooperativity, and 2-OG binding stabilizes the binding of ATP. Results also show that the affinity of uridylylated forms of GlnB and GlnK for nucleotides is significantly lower than that of the nonuridylylated proteins. Furthermore, fluctuations in the intracellular concentration of 2-OG in response to nitrogen availability are shown. Results suggest that under nitrogen-limiting conditions, PII proteins tend to bind ATP and 2-OG. By contrast, after an ammonium shock, a decrease in the 2-OG concentration is observed causing a decrease in the affinity of PII proteins for ATP. This phenomenon may facilitate the exchange of ATP for ADP on the ligand-binding pocket of PII proteins, thus it is likely that under low ammonium, low 2-OG levels would favor the ADP-bound state. © 2015 FEBS.

  16. Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion.

    Science.gov (United States)

    Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore

    2016-05-01

    The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

  17. Tensor exchange amplitudes in K +- N charge exchange reactions

    International Nuclear Information System (INIS)

    Svec, M.

    1979-01-01

    Tensor (A 2 ) exchange amplitudes in K +- N charge exchange (CEX) are constructed from the K +- N CEX data supplemented by information on the vector (rho) exchange amplitudes from πN sca tering. We observed new features in the t-structure of A 2 exchange amplitudes which contradict the t-de pendence anticipated by most of the Regge models. The results also provide evidence for violation of weak exchange degeneracy

  18. Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange

    DEFF Research Database (Denmark)

    Hmelo, Laura R; Borlee, Bradley R; Almblad, Henrik

    2015-01-01

    Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knock-ins, as well as single-nucleotide insertions, deletions and substitutions, in Pseudomonas aeruginosa. Unlike other approaches to allelic exch...

  19. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  20. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  1. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  2. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  3. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  4. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  5. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  6. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  7. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  8. Exchanging Description Logic Knowledge Bases

    NARCIS (Netherlands)

    Arenas, M.; Botoeva, E.; Calvanese, D.; Ryzhikov, V.; Sherkhonov, E.

    2012-01-01

    In this paper, we study the problem of exchanging knowledge between a source and a target knowledge base (KB), connected through mappings. Differently from the traditional database exchange setting, which considers only the exchange of data, we are interested in exchanging implicit knowledge. As

  9. Social dilemmas as exchange dilemmas

    NARCIS (Netherlands)

    Dijkstra, Jacob; van Assen, Marcel A.L.M.

    2016-01-01

    We develop a new paradigm to study social dilemmas, called exchange dilemmas. Exchange dilemmas arise from externalities of exchanges with third parties, and many real-life social dilemmas are more accurately modeled as exchange dilemmas rather than prisoner's dilemmas. Building on focusing and

  10. Social dilemmas as exchange dilemmas

    NARCIS (Netherlands)

    Dijkstra, J.; van Assen, M.A.L.M.

    2016-01-01

    We develop a new paradigm to study social dilemmas, called exchange dilemmas. Exchange dilemmas arise from externalities of exchanges with third parties, and many real-life social dilemmas are more accurately modeled as exchange dilemmas rather than prisoner's dilemmas. Bulding on focusing and

  11. Heat exchanger restart evaluation

    International Nuclear Information System (INIS)

    Morrison, J.M.; Hirst, C.W.; Lentz, T.F.

    1992-01-01

    On December 24, 1991, the K-Reactor was in the shutdown mode with full AC process water flow and full cooling water flow. Safety rod testing was being performed as part of the power ascension testing program. The results of cooling water samples indicated tritium concentrations higher than allowable. Further sampling and testing confirmed a Process Water System to Cooling Water System leak in heat exchanger 4A (HX 4A). The heat exchanger was isolated and the plant shutdown. Heat exchanger 4A was removed from the plant and moved to C-Area prior to performing examinations and diagnostic testing. This included locating and identifying the leaking tube or tubes, eddy current examination of the leaking tube and a number of adjacent tubes, visually inspecting the leaking tube from both the inside as well as the area surrounding the identified tube. The leaking tube was removed and examined metallurgically to determine the failure mechanism. In addition ten other tubes that either exhibited eddy current indications or would represent a baseline condition were removed from heat exchanger 4A for metallurgical examination. Additional analysis and review of heat exchanger leakage history was performed to determine if there are any patterns which can be used for predictive purposes. Compensatory actions have been taken to improve the sensitivity and response time to any future events of this type. The results of these actions are summary herein

  12. Heat exchanger restart evaluation

    International Nuclear Information System (INIS)

    Morrison, J.M.; Hirst, C.W.; Lentz, T.F.

    1992-01-01

    On December 24, 1991, the K-Reactor was in the shutdown mode with full AC process water flow and full cooling water flow. Safety rod testing was being performed as part of the power ascension testing program. The results of cooling water samples indicated tritium concentrations higher than allowable. Further sampling and testing confirmed a Process Water System to Cooling Water System leak in heat exchanger 4A (HX 4A). The heat exchanger was isolated and the plant shutdown. Heat exchanger 4kA was removed from the plant and moved to C-Area prior to performing examinations and diagnostic testing. This included locating and identifying the leaking tube or tubes, eddy current examination of the leaking tube and a number of adjacent tubes, visually inspecting the leaking tube from both the inside as well as the area surrounding the failure mechanism. In addition ten other tubes that either exhibited eddy current indications or would represent a baseline condition were removed from heat exchanger 4A for metallurgical examination. Additional analysis and review of heat exchanger leakage history was performed to determine if there are any patterns which can be used for predictive purposes. Compensatory actions have been taken to improve the sensitivity and response time to any future events of this type. The results of these actions are summarized herein

  13. Heat exchanger restart evaluation

    International Nuclear Information System (INIS)

    Morrison, J.M.; Hirst, C.W.; Lentz, T.F.

    1992-01-01

    On December 24, 1991, the K-Reactor was in the shutdown mode with full AC process water flow and full cooling water flow. Safety rod testing was being performed as part of the power ascension testing program. The results of cooling water samples indicated tritium concentrations higher than allowable. Further sampling and testing confirmed a Process Water System to Cooling Water System leak in heat exchanger 4A (HX 4A). The heat exchanger was isolated and the plant shutdown. Heat exchanger 4A was removed from the plant and moved to C-Area prior to performing examinations and diagnostic testing. This included locating and identifying the leaking tube or tubes, eddy current examination of the leaking tube and a number of adjacent tubes, visually inspecting the leaking tube from both the inside as well as the area surrounding the identified tube. The leaking tube was removed and examined metallurgically to determine the failure mechanism. In addition ten other tubes that either exhibited eddy current indications or would represent a baseline condition were removed from heat exchanger 4A for metallurgical examination. Additional analysis and review of heat exchanger leakage history was performed to determine if there are any patterns which can be used for predictive purposes. Compensatory actions have been taken to improve the sensitivity and response time to any future events of this type. The results of these actions are summarized

  14. Update heat exchanger designing principles

    International Nuclear Information System (INIS)

    Lipets, A.U.; Yampol'skij, A.E.

    1985-01-01

    Update heat exchanger design principles are analysed. Different coolant pattern in a heat exchanger are considered. It is suggested to rationally organize flow rates irregularity in it. Applying on heat exchanger designing measures on using really existing temperature and flow rate irregularities will permit to improve heat exchanger efficiency. It is expedient in some cases to artificially produce irregularities. In this connection some heat exchanger design principles must be reviewed now

  15. Social dilemmas as exchange dilemmas

    OpenAIRE

    Dijkstra, J.; van Assen, M.A.L.M.

    2016-01-01

    We develop a new paradigm to study social dilemmas, called exchange dilemmas. Exchange dilemmas arise from externalities of exchanges with third parties, and many real-life social dilemmas are more accurately modeled as exchange dilemmas rather than prisoner's dilemmas. Bulding on focusing and framing research we predict that defection is omnipresent in exchange dilemmas, which is corroborated in to very different experiments. Our results suggest that the fundamental problem of cooperation in...

  16. Ion exchange phenomena

    Energy Technology Data Exchange (ETDEWEB)

    Bourg, I.C.; Sposito, G.

    2011-05-01

    Ion exchange phenomena involve the population of readily exchangeable ions, the subset of adsorbed solutes that balance the intrinsic surface charge and can be readily replaced by major background electrolyte ions (Sposito, 2008). These phenomena have occupied a central place in soil chemistry research since Way (1850) first showed that potassium uptake by soils resulted in the release of an equal quantity of moles of charge of calcium and magnesium. Ion exchange phenomena are now routinely modeled in studies of soil formation (White et al., 2005), soil reclamation (Kopittke et al., 2006), soil fertilitization (Agbenin and Yakubu, 2006), colloidal dispersion/flocculation (Charlet and Tournassat, 2005), the mechanics of argillaceous media (Gajo and Loret, 2007), aquitard pore water chemistry (Tournassat et al., 2008), and groundwater (Timms and Hendry, 2007; McNab et al., 2009) and contaminant hydrology (Chatterjee et al., 2008; van Oploo et al., 2008; Serrano et al., 2009).

  17. Sorption by cation exchange

    International Nuclear Information System (INIS)

    Bradbury, M.H.; Baeyens, B.

    1994-04-01

    A procedure for introducing exchange into geochemical/surface complexation codes is described. Beginning with selectivity coefficients, K c , defined in terms of equivalent fractional ion occupancies, a general expression for the molar based exchange code input parameters, K ex , is derived. In natural systems the uptake of nuclides onto complex sorbents often occurs by more than one mechanism. The incorporation of cation exchange and surface complexation into a geochemical code therefore enables sorption by both mechanisms to be calculated simultaneously. The code and model concepts are tested against sets of experimental data from widely different sorption studies. A proposal is made to set up a data base of selectivity coefficients. Such a data base would form part of a more general one consisting of sorption mechanism specific parameters to be used in conjunction with geochemical/sorption codes to model and predict sorption. (author) 6 figs., 6 tabs., 26 refs

  18. Tubular heat exchanger

    International Nuclear Information System (INIS)

    Hayden, Owen; Willby, C.R.

    1976-01-01

    The invention concerns a heat exchanger of which the tubes, placed in a long casing, cross the casing cover in a sealed manner. These tubes are fixed to the tube plate forming this cover or to the branch tubes it comprises by means of compression joints. These joints make it possible to do away with welds that are sources of defects and to improve the operational safety of the apparatus. An advantageous form of the heat exchanger under the invention includes a manifold for each thermal exchange fluid, and one end of each tube is connected to this manifold by a pipe that is itself connected to the tube by a threaded connection. The latter provides for easy disconnection of the pipe in order to introduce a probe for inspecting the state of the tubes [fr

  19. Classification of exchange currents

    International Nuclear Information System (INIS)

    Friar, J.L.

    1983-01-01

    After expansion of the vector and axial vector currents in powers of (v/c), a heretofore unremarked regularity results. Meson exchange currents can be classified into types I and II, according to the way they satisfy the constraints of special relativity. The archetypes of these two categories are the impulse approximation to the vector and axial vector currents. After a brief discussion of these constraints, the (rhoπγ) and (ωsigmaγ) exchange currents are constructed and classified, and used to illustrate a number of important points which are often overlooked

  20. Alert Exchange Process Protocol

    Science.gov (United States)

    Groen, Frank

    2015-01-01

    The National Aeronautics and Space Administration of the United States of America (NASA), and the European Space Agency (ESA), and the Japanese Aerospace Exploration Agency (JAXA), acknowledging that NASA, ESA and JAXA have a mutual interest in exchanging Alerts and Alert Status Lists to enhance the information base for each system participant while fortifying the general level of cooperation between the policy agreement subscribers, and each Party will exchange Alert listings on regular basis and detailed Alert information on a need to know basis to the extent permitted by law.

  1. Lipid exchange by ultracentrifugation

    DEFF Research Database (Denmark)

    Drachmann, Nikolaj Düring; Olesen, Claus

    2014-01-01

    , and the complex interplay between the lipids and the P-type ATPases are still not well understood. We here describe a robust method to exchange the majority of the lipids surrounding the ATPase after solubilisation and/or purification with a target lipid of interest. The method is based on an ultracentrifugation...... step, where the protein sample is spun through a dense buffer containing large excess of the target lipid, which results in an approximately 80-85 % lipid exchange. The method is a very gently technique that maintains protein folding during the process, hence allowing further characterization...

  2. Microscale Regenerative Heat Exchanger

    Science.gov (United States)

    Moran, Matthew E.; Stelter, Stephan; Stelter, Manfred

    2006-01-01

    The device described herein is designed primarily for use as a regenerative heat exchanger in a miniature Stirling engine or Stirling-cycle heat pump. A regenerative heat exchanger (sometimes called, simply, a "regenerator" in the Stirling-engine art) is basically a thermal capacitor: Its role in the Stirling cycle is to alternately accept heat from, then deliver heat to, an oscillating flow of a working fluid between compression and expansion volumes, without introducing an excessive pressure drop. These volumes are at different temperatures, and conduction of heat between these volumes is undesirable because it reduces the energy-conversion efficiency of the Stirling cycle.

  3. Small Column Ion Exchange

    International Nuclear Information System (INIS)

    Huff, Thomas

    2010-01-01

    Small Column Ion Exchange (SCIX) leverages a suite of technologies developed by DOE across the complex to achieve lifecycle savings. Technologies are applicable to multiple sites. Early testing supported multiple sites. Balance of SRS SCIX testing supports SRS deployment. A forma Systems Engineering Evaluation (SEE) was performed and selected Small Column Ion Exchange columns containing Crystalline Silicotitanate (CST) in a 2-column lead/lag configuration. SEE considered use of Spherical Resorcinol-Formaldehyde (sRF). Advantages of approach at SRS include: (1) no new buildings, (2) low volume of Cs waste in solid form compared to aqueous strip effluent; and availability of downstream processing facilities for immediate processing of spent resin.

  4. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  5. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  6. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  7. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  8. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  9. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  10. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  11. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  12. Innovative heat exchangers

    CERN Document Server

    Scholl, Stephan

    2018-01-01

    This accessible book presents unconventional technologies in heat exchanger design that have the capacity to provide solutions to major concerns within the process and power-generating industries. Demonstrating the advantages and limits of these innovative heat exchangers, it also discusses micro- and nanostructure surfaces and micro-scale equipment, and introduces pillow-plate, helical and expanded metal baffle concepts. It offers step-by-step worked examples, which provide instructions for developing an initial configuration and are supported by clear, detailed drawings and pictures. Various types of heat exchangers are available, and they are widely used in all fields of industry for cooling or heating purposes, including in combustion engines. The market in 2012 was estimated to be U$ 42.7 billion and the global demand for heat exchangers is experiencing an annual growth of about 7.8 %. The market value is expected to reach U$ 57.9 billion in 2016, and approach U$ 78.16 billion in 2020. Providing a valua...

  13. Organizing Equity Exchanges

    Science.gov (United States)

    Schaper, Torsten

    In the last years equity exchanges have diversified their operations into business areas such as derivatives trading, post-trading services, and software sales. Securities trading and post-trading are subject to economies of scale and scope. The integration of these functions into one institution ensures efficiency by economizing on transactions costs.

  14. Resonance charge exchange processes

    International Nuclear Information System (INIS)

    Duman, E.L.; Evseev, A.V.; Eletskij, A.V.; Radtsig, A.A.; Smirnov, B.M.

    1979-01-01

    The calculation results for the resonance charge exchange cross sections for positive and negative atomic and molecular ions are given. The calculations are performed on the basis of the asymptotic theory. The factors affecting the calculation accuracy are analysed. The calculation data for 28 systems are compared with the experiment

  15. Chapter 11. Heat Exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Rafferty, Kevin D.; Culver, Gene

    1998-01-01

    Most geothermal fluids, because of their elevated temperature, contain a variety of dissolved chemicals. These chemicals are frequently corrosive toward standard materials of construction. As a result, it is advisable in most cases to isolate the geothermal fluid from the process to which heat is being transferred. The task of heat transfer from the geothermal fluid to a closed process loop is most often handled by a plate heat exchanger. The two most common types used in geothermal applications are: bolted and brazed. For smaller systems, in geothermal resource areas of a specific character, downhole heat exchangers (DHEs) provide a unique means of heat extraction. These devices eliminate the requirement for physical removal of fluid from the well. For this reason, DHE-based systems avoid entirely the environmental and practical problems associated with fluid disposal. Shell and tube heat exchangers play only a minor role in low-temperature, direct-use systems. These units have been in common use in industrial applications for many years and, as a result, are well understood. For these reasons, shell and tube heat exchangers will not be covered in this chapter.

  16. Basic Exchange Rate Theories

    NARCIS (Netherlands)

    J.G.M. van Marrewijk (Charles)

    2005-01-01

    textabstractThis four-chapter overview of basic exchange rate theories discusses (i) the elasticity and absorption approach, (ii) the (long-run) implications of the monetary approach, (iii) the short-run effects of monetary and fiscal policy under various economic conditions, and (iv) the transition

  17. Method for exchanging data

    NARCIS (Netherlands)

    2014-01-01

    The present invention relates to a method for exchanging data between at least two servers with use of a gateway. Preferably the method is applied to healthcare systems. Each server holds a unique federated identifier, which identifier identifies a single patient (P). Thus, it is possible for the

  18. Baltic Exchange toodi Tallinna

    Index Scriptorium Estoniae

    2007-01-01

    Viimane osa merekonteineritesse kokkupakitud Londoni laevandus- ja merebörsi Baltic Exchange'i endise peakorteri detailidest jõudis 2007. a. juunis Tallinna. Hoone detailid ostnud ärimehed Heiti Hääl ja Eerik-Niiles Kross plaanivad leida hoonele koha Tallinna kesklinnas. E.-N. Krossi kommentaar

  19. Exchangers man the pumps

    Science.gov (United States)

    Barkla, Bronwyn J; Hirschi, Kendal D

    2008-01-01

    Tonoplast-localised proton-coupled Ca2+ transporters encoded by cation/H+ exchanger (CAX) genes play a critical role in sequestering Ca2+ into the vacuole. These transporters may function in coordination with Ca2+ release channels, to shape stimulus-induced cytosolic Ca2+ elevations. Recent analysis of Arabidopsis CAX knockout mutants, particularly cax1 and cax3, identified a variety of phenotypes including sensitivity to abiotic stresses, which indicated that these transporters might play a role in mediating the plant's stress response. A common feature of these mutants was the perturbation of H+-ATPase activity at both the tonoplast and the plasma membrane, suggesting a tight interplay between the Ca2+/H+ exchangers and H+ pumps. We speculate that indirect regulation of proton flux by the exchangers may be as important as the direct regulation of Ca2+ flux. These results suggest cautious interpretation of mutant Ca2+/H+ exchanger phenotypes that may be due to either perturbed Ca2+ or H+ transport. PMID:19841670

  20. Telephone Exchange Maintenance

    CERN Multimedia

    2005-01-01

    Urgent maintenance work on CERN telephone exchanges will be performed on 24 March from 6 a.m. to 8 a.m. Telephone services may be disrupted or even interrupted during this time. For more details, please contact us by email at Standard.Telephone@cern.ch.

  1. Heat exchanger vibration

    International Nuclear Information System (INIS)

    Richards, D.J.W.

    1977-01-01

    The heat exchangers of various types are common items of plant in the generation and transmission of electricity. The amount of attention given to the flow-induced vibrations of heat exchangers by designers is usually related to the operational history of similar items of plant. Consequently, if a particular design procedure yields items of plant which behave in a satisfactory manner during their operational life, there is little incentive to improve or refine the design procedure. On the other hand, failures of heat exchangers clearly indicate deficiencies in the design procedures or in the data available to the designer. When such failures are attributable to flow-induced vibrations, the identification of the mechanisms involved is a prime importance. Ideally, basic research work provides the background understanding and the techniques necessary to be able to identify the important mechanisms. In practice, the investigation of a flow-induced vibration problem may identify the presence of mechanisms but may not be able to quantify their effects adequately. In these circumstances the need for additional work is established and the objectives of the research programme emerge. The purpose of this paper is to outline the background to the current research programme at C.E.R.L. on heat exchanger vibration

  2. Application of ion exchangers

    International Nuclear Information System (INIS)

    Markhol, M.

    1985-01-01

    Existing methods of multi-element separation for radiochemical analysis are considered. The majority of existing methods is noted to be based on application of organic and inorganic ion exchangers. Distillation, coprecipitation, extraction as well as combination of the above methods are also used. Concrete flowsheets of multi-element separation are presented

  3. Fuel exchanger control device

    International Nuclear Information System (INIS)

    Kurabayashi, Masaharu.

    1985-01-01

    Purpose: To improve the stability and the operationability of the fuel exchanging work by checking the validity of the data before the initiation of the work. Constitution: A floppy disc stores the initial charging state data showing the arrangement of fuel assemblies in the reactor core pool, data showing the working procedures for the fuel exchange and a final charged state data upon completion of the work. The initial data and the procedure data are read from the disk and stored once into a memory. Then, the initial data are sequentially performed on the memory in accordance with the procedure data and, thereafter, they were compared with the final data read from the disk. After confirming that there are no errors in the working data, the procedure data are orderly instructed to the fuel exchanger for performing fuel replacement. Accordingly, since the data are checked before the initiation of the work, the fuel exchange can be performed automatically thereby improving the operationability thereof. (Yoshino, Y.)

  4. Upright heat exchanger

    International Nuclear Information System (INIS)

    Martoch, J.; Kugler, V.; Krizek, V.; Strmiska, F.

    1988-01-01

    The claimed heat exchanger is characteristic by the condensate level being maintained directly in the exchanger while preserving the so-called ''dry'' tube plate. This makes it unnecessary to build another pressure vessel into the circuit. The design of the heat exchanger allows access to both tube plates, which facilitates any repair. Another advantage is the possibility of accelerating the indication of leakage from the space of the second operating medium which is given by opening the drainage pipes of the lower bundle into the collar space and from there through to the indication pipe. The exchanger is especially suitable for deployment in the circuits of nuclear power plants where the second operating medium will be hot water of considerably lower purity than is that of the condensate. A rapid display of leakage can prevent any long-term penetration of this water into the condensate, which would result in worsening water quality in the entire secondary circuit of the nuclear power plant. (J.B.). 1 fig

  5. Heat exchanger vibration

    Energy Technology Data Exchange (ETDEWEB)

    Richards, D J.W. [CERL, CEGB, Leatherhead, Surrey (United Kingdom)

    1977-12-01

    The heat exchangers of various types are common items of plant in the generation and transmission of electricity. The amount of attention given to the flow-induced vibrations of heat exchangers by designers is usually related to the operational history of similar items of plant. Consequently, if a particular design procedure yields items of plant which behave in a satisfactory manner during their operational life, there is little incentive to improve or refine the design procedure. On the other hand, failures of heat exchangers clearly indicate deficiencies in the design procedures or in the data available to the designer. When such failures are attributable to flow-induced vibrations, the identification of the mechanisms involved is a prime importance. Ideally, basic research work provides the background understanding and the techniques necessary to be able to identify the important mechanisms. In practice, the investigation of a flow-induced vibration problem may identify the presence of mechanisms but may not be able to quantify their effects adequately. In these circumstances the need for additional work is established and the objectives of the research programme emerge. The purpose of this paper is to outline the background to the current research programme at C.E.R.L. on heat exchanger vibration.

  6. VEGF-induced Rac1 activation in endothelial cells is regulated by the guanine nucleotide exchange factor Vav2

    NARCIS (Netherlands)

    Garrett, Tiana A.; van Buul, Jaap D.; Burridge, Keith

    2007-01-01

    Vascular endothelial growth factor (VEGF) signaling is critical for both normal and disease-associated vascular development. Dysregulated VEGF signaling has been implicated in ischemic stroke, tumor angiogenesis, and many other vascular diseases. VEGF signals through several effectors, including the

  7. Tyrosine Phosphorylation of the Guanine Nucleotide Exchange Factor GIV Promotes Activation of PI3K During Cell Migration

    Science.gov (United States)

    Lin, Changsheng; Ear, Jason; Pavlova, Yelena; Mittal, Yash; Kufareva, Irina; Ghassemian, Majid; Abagyan, Ruben; Garcia-Marcos, Mikel; Ghosh, Pradipta

    2014-01-01

    GIV (Gα-interacting vesicle-associated protein; also known as Girdin), enhances Akt activation downstream of multiple growth factor– and G-protein–coupled receptors to trigger cell migration and cancer invasion. Here we demonstrate that GIV is a tyrosine phosphoprotein that directly binds to and activates phosphoinositide 3-kinase (PI3K). Upon ligand stimulation of various receptors, GIV was phosphorylated at Tyr1764 and Tyr1798 by both receptor and non-receptor tyrosine kinases. These phosphorylation events enabled direct binding of GIV to the N- and C-terminal SH2 domains of p85α, a regulatory subunit of PI3K, stabilized receptor association with PI3K, and enhanced PI3K activity at the plasma membrane to trigger cell migration. Tyrosine phosphorylation of GIV and its association with p85α increased during metastatic progression of a breast carcinoma. These results suggest a mechanism by which multiple receptors activate PI3K through tyrosine phosphorylation of GIV, thereby making the GIVPI3K interaction a potential therapeutic target within the PI3K-Akt pathway. PMID:21954290

  8. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  9. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  10. Analytical applications of ion exchangers

    CERN Document Server

    Inczédy, J

    1966-01-01

    Analytical Applications of Ion Exchangers presents the laboratory use of ion-exchange resins. This book discusses the development in the analytical application of ion exchangers. Organized into 10 chapters, this book begins with an overview of the history and significance of ion exchangers for technical purposes. This text then describes the properties of ion exchangers, which are large molecular water-insoluble polyelectrolytes having a cross-linked structure that contains ionic groups. Other chapters consider the theories concerning the operation of ion-exchange resins and investigate th

  11. Horizontal Curve Virtual Peer Exchange : an RSPCB Peer Exchange

    Science.gov (United States)

    2014-06-01

    This report summarizes the Horizontal Curve Virtual Peer Exchange sponsored by the Federal Highway Administration (FHWA) Office of Safetys Roadway Safety Professional Capacity Building Program on June 17, 2014. This virtual peer exchange was the f...

  12. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  13. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  14. The Metaphysics of Economic Exchanges

    Directory of Open Access Journals (Sweden)

    Massin Olivier

    2017-05-01

    Full Text Available What are economic exchanges? The received view has it that exchanges are mutual transfers of goods motivated by inverse valuations thereof. As a corollary, the standard approach treats exchanges of services as a subspecies of exchanges of goods. We raise two objections against this standard approach. First, it is incomplete, as it fails to take into account, among other things, the offers and acceptances that lie at the core of even the simplest cases of exchanges. Second, it ultimately fails to generalize to exchanges of services, in which neither inverse preferences nor mutual transfers hold true. We propose an alternative definition of exchanges, which treats exchanges of goods as a special case of exchanges of services and which builds in offers and acceptances. According to this theory: (i The valuations motivating exchanges are propositional and convergent rather than objectual and inverse; (ii All exchanges of goods involve exchanges of services/actions, but not the reverse; (iii Offers and acceptances, together with the contractual obligations and claims they bring about, lie at the heart of all cases of exchange.

  15. The Emerging Role of Guanine Exchange Factors in ALS and other neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Cristian eDroppelmann

    2014-09-01

    Full Text Available Small GTPases participate in a broad range of cellular processes such as proliferation, differentiation and migration. The exchange of GDP for GTP resulting in the activation of these GTPases is catalyzed by a group of enzymes called guanine nucleotide exchange factors (GEFs, of which two classes: Dbl-related exchange factors and the more recently described Dock family exchange factors. Increasingly, deregulation of normal GEF activity or function has been associated with a broad range of disease states, including neurodegeneration and neurodevelopmental disorders. In this review, we examine this evidence with special emphasis on the novel role of Rho guanine nucleotide exchange factor (RGNEF/p190RhoGEF in the pathogenesis of amyotrophic lateral sclerosis (ALS. RGNEF is the first neurodegeneration-linked GEF that regulates not only RhoA GTPase activation but also functions as an RNA binding protein that directly acts with low molecular weight neurofilament (NEFL mRNA 3’UTR to regulate its stability. This dual role for RGNEF, coupled with the increasing understanding of the key role for GEFs in modulating the GTPase function in cell survival suggests a prominent role for GEFs in mediating a critical balance between cytotoxicity and neuroprotection which, when disturbed, contributes to neuronal loss.

  16. Data Exchange Inventory (DEXI) System

    Data.gov (United States)

    Social Security Administration — DEXI is an intranet application used by SSA users to track all incoming and outgoing data exchanges between SSA and our data exchange partners. Information such as...

  17. Automatic fuel exchanging device

    International Nuclear Information System (INIS)

    Takahashi, Fuminobu.

    1984-01-01

    Purpose: To enable to designate the identification number of a fuel assembly in a nuclear reactor pressure vessel thereby surely exchanging the designated assembly within a short time. Constitution: Identification number (or letter) pressed on a grip of a fuel assembly is to be detected by a two-dimensional ultrasonic probe of a pull-up mechanism. When the detected number corresponds with the designated number, a control signal is outputted, whereby the pull-up drive control mechanism or pull-up mechanism responds to pull-up and exchange the fuel assembly of the identified number. With such a constitution, the fuel assembly can rapidly and surely be recognized even if pressed letters deviate to the left or right of the probe, and further, the hinge portion and the signal processing portion can be simplified. (Horiuchi, T.)

  18. Manufacture of heat exchangers

    International Nuclear Information System (INIS)

    Burton, J.E.; Tombs, R.W.T.

    1980-01-01

    A tube bundle for use in a heat exchanger has a series of spaced parallel tubes supported by tube plates and is manufactured by depositing welding material around the end of each tube, machining the deposited material to form an annular flange around the end of the tube and welding the flange into apertures in the tube plate. Preferably the tubes have a length which is slightly less than the distance between the outer surfaces of the tube plates and the deposited material is deposited so that it overlaps and protects the end surfaces of the tubes. A plug may be inserted in the bore of the tubes during the welding material deposition which, as described, is effected by manual metal arc welding. One use of heat exchangers incorporating a tube bundle manufactured as above is in apparatus for reducing the volume of, and recovering nitric acid from, radioactive effluents from a nuclear reprocessing plant. (author)

  19. Compact cryocooler heat exchangers

    International Nuclear Information System (INIS)

    Luna, J.; Frederking, T.H.K.

    1991-01-01

    Compact heat exchangers are subject to different constraints as a room temperature gas is cooled down by a cold stream returning from a JT valve (or a similar cryoprocess component). In particular, the optimization of exchangers for liquid helium systems has to cover a wide range in temperature and density of the fluid. In the present work we address the following thermodynamic questions: 1. The optimization of intermediate temperatures which optimize stage operation (a stage is assumed to have a constant cross section); 2. The optimum temperature difference available for best overall economic performance values. The results are viewed in the context of porous media concepts applied to rather low speeds of fluid flow in narrow passages. In this paper examples of fluid/solid constraints imposed in this non-classical low temperature area are presented

  20. Exchange currents in nuclear physics

    International Nuclear Information System (INIS)

    Truglik, Eh.

    1980-01-01

    Starting from Adler's low-energy theorem for the soft pion production amplitudes the predictions of the meson exchange currents theory for the nuclear physics are discussed. The results are reformulated in terms of phenomenological lagrangians. This method allows one to pass naturally to the more realistic case of hard mesons. The predictions are critically compared with the existing experimental data. The main processes in which vector isovector exchange currents, vector isoscalar exchange currents and axial exchange currents take place are pointed out

  1. Hydrogen Exchange Mass Spectrometry

    Science.gov (United States)

    Mayne, Leland

    2018-01-01

    Hydrogen exchange (HX) methods can reveal much about the structure, energetics, and dynamics of proteins. The addition of mass spectrometry (MS) to an earlier fragmentation-separation HX analysis now extends HX studies to larger proteins at high structural resolution and can provide information not available before. This chapter discusses experimental aspects of HX labeling, especially with respect to the use of MS and the analysis of MS data. PMID:26791986

  2. Characterizing Slow Chemical Exchange in Nucleic Acids by Carbon CEST and Low Spin-Lock Field R1ρ NMR Spectroscopy

    Science.gov (United States)

    Zhao, Bo; Hansen, Alexandar L.; Zhang, Qi

    2016-01-01

    Quantitative characterization of dynamic exchange between various conformational states provides essential insights into the molecular basis of many regulatory RNA functions. Here, we present an application of nucleic-acid-optimized carbon chemical exchange saturation transfer (CEST) and low spin-lock field R1ρ relaxation dispersion (RD) NMR experiments in characterizing slow chemical exchange in nucleic acids that is otherwise difficult if not impossible to be quantified by the ZZ-exchange NMR experiment. We demonstrated the application on a 47-nucleotide fluoride riboswitch in the ligand-free state, for which CEST and R1ρ RD profiles of base and sugar carbons revealed slow exchange dynamics involving a sparsely populated (p ~ 10%) and shortly lived (τ ~ 10 ms) NMR “invisible” state. The utility of CEST and low spin-lock field R1ρ RD experiments in studying slow exchange was further validated in characterizing an exchange as slow as ~60 s−1. PMID:24299272

  3. Characterizing slow chemical exchange in nucleic acids by carbon CEST and low spin-lock field R(1ρ) NMR spectroscopy.

    Science.gov (United States)

    Zhao, Bo; Hansen, Alexandar L; Zhang, Qi

    2014-01-08

    Quantitative characterization of dynamic exchange between various conformational states provides essential insights into the molecular basis of many regulatory RNA functions. Here, we present an application of nucleic-acid-optimized carbon chemical exchange saturation transfer (CEST) and low spin-lock field R(1ρ) relaxation dispersion (RD) NMR experiments in characterizing slow chemical exchange in nucleic acids that is otherwise difficult if not impossible to be quantified by the ZZ-exchange NMR experiment. We demonstrated the application on a 47-nucleotide fluoride riboswitch in the ligand-free state, for which CEST and R(1ρ) RD profiles of base and sugar carbons revealed slow exchange dynamics involving a sparsely populated (p ~ 10%) and shortly lived (τ ~ 10 ms) NMR "invisible" state. The utility of CEST and low spin-lock field R(1ρ) RD experiments in studying slow exchange was further validated in characterizing an exchange as slow as ~60 s(-1).

  4. Identification of novel single nucleotide polymorphisms associated with acute respiratory distress syndrome by exome-seq.

    Directory of Open Access Journals (Sweden)

    Katherine Shortt

    Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.

  5. Two adenine nucleotide translocase paralogues involved in cell proliferation and spermatogenesis in the silkworm Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Ryohei Sugahara

    Full Text Available Mitochondrial adenine nucleotide translocase (ANT specifically acts in ADP/ATP exchange through the mitochondrial inner membrane. This transporter protein thereby plays a significant role in energy metabolism in eukaryotic cells. Most mammals have four paralogous ANT genes (ANT1-4 and utilize these paralogues in different types of cells. The fourth paralogue of ANT (ANT4 is present only in mammals and reptiles and is exclusively expressed in testicular germ cells where it is required for meiotic progression in the spermatocytes. Here, we report that silkworms harbor two ANT paralogues, the homeostatic paralogue (BmANTI1 and the testis-specific paralogue (BmANTI2. The BmANTI2 protein has an N-terminal extension in which the positions of lysine residues in the amino acid sequence are distributed as in human ANT4. An expression analysis showed that BmANTI2 transcripts were restricted to the testis, suggesting the protein has a role in the progression of spermatogenesis. By contrast, BmANTI1 was expressed in all tissues tested, suggesting it has an important role in homeostasis. We also observed that cultured silkworm cells required BmANTI1 for proliferation. The ANTI1 protein of the lepidopteran Plutella xylostella (PxANTI1, but not those of other insect species (or PxANTI2, restored cell proliferation in BmANTI1-knockdown cells suggesting that ANTI1 has similar energy metabolism functions across the Lepidoptera. Our results suggest that BmANTI2 is evolutionarily divergent from BmANTI1 and has developed a specific role in spermatogenesis similar to that of mammalian ANT4.

  6. Exchange rate rebounds after foreign exchange market interventions

    Science.gov (United States)

    Hoshikawa, Takeshi

    2017-03-01

    This study examined the rebounds in the exchange rate after foreign exchange intervention. When intervention is strongly effective, the exchange rate rebounds at next day. The effect of intervention is reduced slightly by the rebound after the intervention. The exchange rate might have been 67.12-77.47 yen to a US dollar without yen-selling/dollar-purchasing intervention of 74,691,100 million yen implemented by the Japanese government since 1991, in comparison to the actual exchange rate was 103.19 yen to the US dollar at the end of March 2014.

  7. Heat exchanger tube tool

    International Nuclear Information System (INIS)

    Gugel, G.

    1976-01-01

    Certain types of heat-exchangers have tubes opening through a tube sheet to a manifold having an access opening offset from alignment with the tube ends. A tool for inserting a device, such as for inspection or repair, is provided for use in such instances. The tool is formed by a flexible guide tube insertable through the access opening and having an inner end provided with a connector for connection with the opening of the tube in which the device is to be inserted, and an outer end which remains outside of the chamber, the guide tube having adequate length for this arrangement. A flexible transport hose for internally transporting the device slides inside of the guide tube. This hose is long enough to slide through the guide tube, into the heat-exchanger tube, and through the latter to the extent required for the use of the device. The guide tube must be bent to reach the end of the heat-exchanger tube and the latter may be constructed with a bend, the hose carrying anit-friction elements at interspaced locations along its length to make it possible for the hose to negotiate such bends while sliding to the location where the use of the device is required

  8. Timing Foreign Exchange Markets

    Directory of Open Access Journals (Sweden)

    Samuel W. Malone

    2016-03-01

    Full Text Available To improve short-horizon exchange rate forecasts, we employ foreign exchange market risk factors as fundamentals, and Bayesian treed Gaussian process (BTGP models to handle non-linear, time-varying relationships between these fundamentals and exchange rates. Forecasts from the BTGP model conditional on the carry and dollar factors dominate random walk forecasts on accuracy and economic criteria in the Meese-Rogoff setting. Superior market timing ability for large moves, more than directional accuracy, drives the BTGP’s success. We explain how, through a model averaging Monte Carlo scheme, the BTGP is able to simultaneously exploit smoothness and rough breaks in between-variable dynamics. Either feature in isolation is unable to consistently outperform benchmarks throughout the full span of time in our forecasting exercises. Trading strategies based on ex ante BTGP forecasts deliver the highest out-of-sample risk-adjusted returns for the median currency, as well as for both predictable, traded risk factors.

  9. The exchangeability of shape

    Directory of Open Access Journals (Sweden)

    Kaba Dramane

    2010-10-01

    Full Text Available Abstract Background Landmark based geometric morphometrics (GM allows the quantitative comparison of organismal shapes. When applied to systematics, it is able to score shape changes which often are undetectable by traditional morphological studies and even by classical morphometric approaches. It has thus become a fast and low cost candidate to identify cryptic species. Due to inherent mathematical properties, shape variables derived from one set of coordinates cannot be compared with shape variables derived from another set. Raw coordinates which produce these shape variables could be used for data exchange, however they contain measurement error. The latter may represent a significant obstacle when the objective is to distinguish very similar species. Results We show here that a single user derived dataset produces much less classification error than a multiple one. The question then becomes how to circumvent the lack of exchangeability of shape variables while preserving a single user dataset. A solution to this question could lead to the creation of a relatively fast and inexpensive systematic tool adapted for the recognition of cryptic species. Conclusions To preserve both exchangeability of shape and a single user derived dataset, our suggestion is to create a free access bank of reference images from which one can produce raw coordinates and use them for comparison with external specimens. Thus, we propose an alternative geometric descriptive system that separates 2-D data gathering and analyzes.

  10. Social exchange: Relations and networks

    OpenAIRE

    Dijkstra, Jacob

    2015-01-01

    In this short paper, I review the literature on social exchange networks, with specific attention to theoretical and experimental research. I indicate how social exchange theory is rooted in general social theory and mention a few of its main links to social network analysis and empirical network research. The paper provides an accessible entry into the literature on social exchange.

  11. O3 and NOx Exchange

    NARCIS (Netherlands)

    Loubet, B.; Castell, J.F.; Laville, P.; Personne, E.; Tuzet, A.; Ammann, C.; Emberson, L.; Ganzeveld, L.; Kowalski, A.S.; Merbold, L.; Stella, P.; Tuovinen, J.P.

    2015-01-01

    This discussion was based on the background document “Review on modelling atmosphere-biosphere exchange of Ozone and Nitrogen oxides”, which reviews the processes contributing to biosphere-atmosphere exchange of O3 and NOx, including stomatal and non-stomatal exchange of O3 and NO, NO2.

  12. Integrated Foreign Exchange Risk Management

    DEFF Research Database (Denmark)

    Aabo, Tom; Høg, Esben; Kuhn, Jochen

    Empirical research has focused on export as a proxy for the exchange rate exposure and the use of foreign exchange derivatives as the instrument to deal with this exposure. This empirical study applies an integrated foreign exchange risk management approach with a particular focus on the role...

  13. Effects of catecholamines on rat myocardial metabolism. II. Influence of catecholamines on 32p-incorporation into rat myocardial adenylic nucleotides and their turn-over.

    Science.gov (United States)

    Merouze, P; Gaudemer, Y; Gautheron, D

    1975-01-01

    1. The influence of catecholamines (adrenaline and noradrenaline) on 32Pi incorporation into intracellular phosphate and adenylic nucleotides has been studied on rat myocardium slices; consequently, the turn-over of nucleotides could be determined and compared under the influence of these two hormones. 2. In order to specify the site of action of these catecholamines, several inhibitors and activators of energetic metabolism were included in the incubation medium: 3'5'-AMP, caffein, ouabain, oligomycin, rotenone + antimycin. 3. Both catecholamines favour Pi exchanges between intra and extracellular spaces; ATP turn-over is greatly increased, while ADP turn-over is slightly decreased, and 32P-incorporation into ADP is increased. 4. 3'5'-AMP and caffein are without effect on Pi penetration; however, caffein increases catecholamine effects on this penetration. ATP turn-over is slightly increased by 3'5'-AMP or caffein. 5. Ouabain decreases ATP turn-over but does not prevent the adrenaline induced acceleration. Inhibitors of oxidative phosphorylation and electron transport decrease ATP-turn-over severely; this inhibition is not released by catecholamines. 6. It is concluded that the catecholamine effects observed are dependent on the oxidative phosphorylations process. The increase of Pi exchange by catecholamines may be related to the increase of extracellular space and cation translocations we observed with the hormones.

  14. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  15. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  16. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  17. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  18. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  19. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  20. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  1. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  2. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  3. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  4. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  5. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  6. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  7. Mastering Microsoft Exchange Server 2010

    CERN Document Server

    McBee, Jim

    2010-01-01

    A top-selling guide to Exchange Server-now fully updated for Exchange Server 2010. Keep your Microsoft messaging system up to date and protected with the very newest version, Exchange Server 2010, and this comprehensive guide. Whether you're upgrading from Exchange Server 2007 SP1 or earlier, installing for the first time, or migrating from another system, this step-by-step guide provides the hands-on instruction, practical application, and real-world advice you need.: Explains Microsoft Exchange Server 2010, the latest release of Microsoft's messaging system that protects against spam and vir

  8. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  9. Progress in liquid ion exchangers

    International Nuclear Information System (INIS)

    Nakagawa, Genkichi

    1974-01-01

    Review is made on the extraction with anion exchangers and the extraction with liquid cation exchangers. On the former, explanation is made on the extraction of acids, the relation between anion exchange and the extraction of metals, the composition of the metallic complexes that are extracted, and the application of the extraction with anion exchangers to analytical chemistry. On the latter, explanation is made on the extraction of metals and its application to analytical chemistry. The extraction with liquid ion exchangers is suitable for the operation in chromatography, because the distribution of extracting agents into aqueous phase is small, and extraction equilibrium is quickly reached, usually within 1 to several minutes. The separation by means of anion exchangers is usually made from hydrochloric acid solution. For example, Brinkman et al. determined Rf values for more than 50 elements by thin layer chromatography. Tables are given for showing the structure of the liquid ion exchangers and the polymerized state of various amines. (Mori, K.)

  10. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  11. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  12. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  13. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  14. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  15. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  16. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  17. Exchange functional by a range-separated exchange hole

    International Nuclear Information System (INIS)

    Toyoda, Masayuki; Ozaki, Taisuke

    2011-01-01

    An approximation to the exchange-hole density is proposed for the evaluation of the exact exchange energy in electronic structure calculations within the density-functional theory and the Kohn-Sham scheme. Based on the localized nature of density matrix, the exchange hole is divided into the short-range (SR) and long-range (LR) parts by using an adequate filter function, where the LR part is deduced by matching of moments with the exactly calculated SR counterpart, ensuring the correct asymptotic -1/r behavior of the exchange potential. With this division, the time-consuming integration is truncated at a certain interaction range, largely reducing the computation cost. The total energies, exchange energies, exchange potentials, and eigenvalues of the highest-occupied orbitals are calculated for the noble-gas atoms. The close agreement of the results with the exact values suggests the validity of the approximation.

  18. Influence of the MDM2 single nucleotide polymorphism SNP309 on tumour development in BRCA1 mutation carriers

    Directory of Open Access Journals (Sweden)

    Johnson Peter W

    2006-03-01

    Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.

  19. Direct Determination of Six Cytokinin Nucleotide Monophosphates in Coconut Flesh by Reversed-Phase Liquid Chromatography-Tandem Mass Spectrometry.

    Science.gov (United States)

    Cao, Zhao-Yun; Ma, You-Ning; Sun, Li-Hua; Mou, Ren-Xiang; Zhu, Zhi-Wei; Chen, Ming-Xue

    2017-11-15

    Coconut contains many uncharacterized cytokinins that have important physiological effects in plants and humans. In this work, a method based on liquid chromatography-tandem mass spectrometry was developed for identification and quantification of six cytokinin nucleotide monophosphates in coconut flesh. Excellent separation was achieved using a low-coverage C18 bonded-phase column with an acidic mobile phase, which greatly improved the retention of target compounds. To enable high-throughput analysis, a single-step solid-phase extraction using mixed-mode anion-exchange cartridges was employed for sample preparation. This proved to be an effective method to minimize matrix effects and ensure high selectivity. The limits of detection varied from 0.06 to 0.3 ng/mL, and the limits of quantification ranged from 0.2 to 1.0 ng/mL. The linearity was statistically verified over 2 orders of magnitude, giving a coefficient of determination (R 2 ) greater than 0.9981. The mean recoveries were from 81 to 108%; the intraday precision (n = 6) was less than 11%; and the interday precision (n = 11) was within 14%. The developed method was applied to the determination of cytokinin nucleotide monophosphates in coconut flesh samples, and four of them were successfully identified and quantified. The results showed that trans-zeatin riboside-5'-monophosphate was the dominant cytokinin, with a concentration of 2.7-34.2 ng/g, followed by N 6 -isopentenyladenosine-5'-monophosphate (≤12.9 ng/g), while the concentrations of cis-zeatin riboside-5'-monophosphate and dihydrozeatin riboside-5'-monophosphate were less than 2.2 and 4.9 ng/g, respectively.

  20. Exchange and fellowship programme

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1959-04-15

    By February 1959, the IAEA had received and considered nearly 300 nominations from 31 countries for nuclear science fellowships. More than 200 of the candidates - from 29 countries - had been selected for placement in centres of training in 21 countries. The programme covers three types of training: 1. General techniques training: to develop skills in the use of some fundamental techniques in the field of nuclear energy; 2. Specialist training: to prepare specialists in the theoretical and experimental aspects of the science and technology of nuclear energy; 3. Research training: to provide advanced training, including active participation in research work; this is for persons potentially qualified to develop and carry out research programmes in the basic sciences and engineering. The duration of training varies from some weeks to five or six years. The long-duration training is given at universities or educational establishments of university level, and is of special interest to Member States lacking personnel with the requisite university education. Under its 1959 exchange and fellowship programme, the Agency will be in a position to award over 400 fellowships. Some of these will be paid out of the Agency's operating fund, while 130 fellowships have been offered directly to IAEA by Member States for training at their universities or institutes. There are two new features in the Agency's 1959 programme. One provides for fellowships for scientific research work, the other is the exchange of specialists

  1. Fuel exchanging apparatus

    International Nuclear Information System (INIS)

    Imada, Takahiko; Sato, Hideo.

    1975-01-01

    Object: To provide a centripetal device, which has an initial spring force greater than a frictional force in an oscillating direction of a telescope mast, on a mast fixing device mounted on a body of fuel exchanging apparatus so that the telescope mast may be secured quickly returning to a predetermined initial position. Structure: When the body of fuel exchanging apparatus is stopped at a predetermined position, a tension spring, which has an initial spring force greater than a frictional force in an oscillating direction of the telescope mast, causes a lug to be forced by means of a push rod to position a sliding base plate to its original position. At the same time, a device of similar structure causes an operating arm to be positioned to the original position, and a lock pin urged by a cylinder is inserted into a through hole in the sliding base plate and operating arm so that the telescope mast may be fixed and retained. (Hanada, M.)

  2. Supramolecular Properties of Triazole-containing Two Armed Peptidomimetics: From Organogelators to Nucleotide-binding Tweezers

    Science.gov (United States)

    Chui, Tin Ki

    obtain a clearer picture on the mode of association of these two series of branched peptidomimetics, the length of the tripeptidomimetic arms was truncated to a dipeptide, and the amino acid, valine, was used for further studies. Both the two new candidates, 88-K-V2 and 89-B-V2, were shown to dimerize in chloroform as shown from vapor pressure osmometry (VPO) studies. 1H NMR titration experiments indicated a better dimerization strength for the latter candidate due to the intermolecular pi-pi interactions offered by its benzene ring in addition to the intermolecular hydrogen bonding by the amides and triazole units. H/D exchange and 2D NMR experiments, and molecular modeling revealed that 88-K-V2 dimerized through the formation of antiparallel beta-strands whereas formation of parallel beta-strands took place in 89-B-V2. Compound 88-K-V2 was found to form 1:1 complexes with chloride (Ka 640 M-1) and monobasic diethyl phosphate (DEP) ion (Ka 810 M-1) in chloroform. Interestingly, 89-B-V 2 was shown to form the usual 1:1 complex with the former ion (Ka 970 M-1) while forming an unexpected 2:1 complex with the latter with positive cooperativity. It was observed that both the amides and triazole protons were involved in anion-binding. In the 88-K-V2-DEP complex, the host formed a helix-like structure that wrapped around the anion located at the center of the complex as determined by 2D NMR and molecular modeling studies. Finally, further structural modification of 88-K-V2 gave a water-soluble nucleotide-binding tweezer 93-K-R2·4TFA . This tweezer consisted of four arginines (R), two triazole units, two pyrene probes and a small hydrophilic ethanolamine tail. Fluorescence study showed that this tweezer was able to form 1:1 complexes with different nucleotides in water with similar binding strength regardless of the number of phosphate groups present in the nucleotides. Moleular modeling suggested that such a charge-independent binding behavior was due to the similar number

  3. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  4. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  5. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  6. Ion exchange technology assessment report

    International Nuclear Information System (INIS)

    Duhn, E.F.

    1992-01-01

    In the execution of its charter, the SRS Ion Exchange Technology Assessment Team has determined that ion exchange (IX) technology has evolved to the point where it should now be considered as a viable alternative to the SRS reference ITP/LW/PH process. The ion exchange media available today offer the ability to design ion exchange processing systems tailored to the unique physical and chemical properties of SRS soluble HLW's. The technical assessment of IX technology and its applicability to the processing of SRS soluble HLW has demonstrated that IX is unquestionably a viable technology. A task team was chartered to evaluate the technology of ion exchange and its potential for replacing the present In-Tank Precipitation and proposed Late Wash processes to remove Cs, Sr, and Pu from soluble salt solutions at the Savannah River Site. This report documents the ion exchange technology assessment and conclusions of the task team

  7. Data Exchange Protocol in Repsail

    Directory of Open Access Journals (Sweden)

    Gucma Maciej

    2017-12-01

    Full Text Available Article presents implantation and theoretical considerations of data exchange protocol developed for the RepSail project, where main objective was design and building innovative hybrid yacht. One of problems during the design process was improper functioning of data exchange protocols that were available in the commercially available devices to mention navigation purpose NMEA183 or 2000 as well as automation dedicated ones (CAN and similar. Author shows the basis of the dedicated format of exchange for in board devices.

  8. Developing bulk exchange spring magnets

    Science.gov (United States)

    Mccall, Scott K.; Kuntz, Joshua D.

    2017-06-27

    A method of making a bulk exchange spring magnet by providing a magnetically soft material, providing a hard magnetic material, and producing a composite of said magnetically soft material and said hard magnetic material to make the bulk exchange spring magnet. The step of producing a composite of magnetically soft material and hard magnetic material is accomplished by electrophoretic deposition of the magnetically soft material and the hard magnetic material to make the bulk exchange spring magnet.

  9. Can Exchange Rates Be Predicted?

    OpenAIRE

    Siriwutiset, Trin

    2007-01-01

    Foreign exchange rates produce significant impacts on both the macroeconomic and microeconomic scale. Countries� government and multinational companies have been seeking ways to stabilize the exchange rates for a few decades. However, there is no perfect consensus on methods to control and stabilize the exchange rates. In fact, there are several occasions in history where turbulence movements caused crisis in the economies. There are several factors that are identified by economis...

  10. Towards automatic exchange of information

    OpenAIRE

    Oberson, Xavier

    2015-01-01

    This article describes the various steps that led towards automatic exchange of information as the global standard and the issues that remain to be solved. First, the various competing models of exchange information, such as Double Tax Treaty (DTT), TIEA's, FATCA or UE Directives are described with a view to show how they interact between themselves. Second, the so-called Rubik Strategy is summarized and compared with an automatic exchange of information (AEOI). The third part then describes ...

  11. Exchange rate smoothing in Hungary

    OpenAIRE

    Karádi, Péter

    2005-01-01

    The paper proposes a structural empirical model capable of examining exchange rate smoothing in the small, open economy of Hungary. The framework assumes the existence of an unobserved and changing implicit exchange rate target. The central bank is assumed to use interest rate policy to obtain this preferred rate in the medium term, while market participants are assumed to form rational expectations about this target and influence exchange rates accordingly. The paper applies unobserved varia...

  12. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  13. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  14. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  15. Mastering Microsoft Exchange Server 2013

    CERN Document Server

    Elfassy, David

    2013-01-01

    The bestselling guide to Exchange Server, fully updated for the newest version Microsoft Exchange Server 2013 is touted as a solution for lowering the total cost of ownership, whether deployed on-premises or in the cloud. Like the earlier editions, this comprehensive guide covers every aspect of installing, configuring, and managing this multifaceted collaboration system. It offers Windows systems administrators and consultants a complete tutorial and reference, ideal for anyone installing Exchange Server for the first time or those migrating from an earlier Exchange Server version.Microsoft

  16. Exchange bias theory

    International Nuclear Information System (INIS)

    Kiwi, Miguel

    2001-01-01

    Research on the exchange bias (EB) phenomenon has witnessed a flurry of activity during recent years, which stems from its use in magnetic sensors and as stabilizers in magnetic reading heads. EB was discovered in 1956 but it attracted only limited attention until these applications, closely related to giant magnetoresistance, were developed during the last decade. In this review, I initially give a short introduction, listing the most salient experimental results and what is required from an EB theory. Next, I indicate some of the obstacles in the road towards a satisfactory understanding of the phenomenon. The main body of the text reviews and critically discusses the activity that has flourished, mainly during the last 5 years, in the theoretical front. Finally, an evaluation of the progress made, and a critical assessment as to where we stand nowadays along the road to a satisfactory theory, is presented

  17. The Radioecology Exchange

    Energy Technology Data Exchange (ETDEWEB)

    Barnett, Catherine L.; Beresford, Nicholas A.; Patel, Sabera; Wells, Claire; Howard, Brenda J. [NERC Centre for Ecology and Hydrology, CEH Lancaster, Lancaster Environment Centre, Library Av., Bailrigg, Lancaster, LA1 4AP (United Kingdom); Mora, Juan Carlos; Real, Almudena [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas (CIEMAT), Avenida complutense 22, Madrid, 28040 (Spain); Beaugelin-Seiller, Karine; Gilbin, Rodolphe; Hinton, Thomas [IRSN-Institut de Radioprotection et de Surete Nucleaire, 31, Avenue de la Division Leclerc, 92260 Fontenay-Aux-Roses (France); Vesterbacka, Pia; Muikku, Maarit; Outola, Iisa [Radiation and Nuclear Safety Authority, P.O. Box 14, FI-00881 Helsinki (Finland); Skuterud, Lavrans; AlbumYtre-Eide, Martin [Norwegian Radiation Protection Authority, Grini Naeringspark 13, Oesteraas, 1332 (Norway); Bradshaw, Clare; Stark, Karolina; Jaeschke, Ben [Stockholms Universitet, Universitetsvaegen 10, Stockholm, 10691 (Sweden); Oughton, Deborah; Skipperud, Lindis [NMBU Norwegian University of Life Science P.O. Box 5003N-1432 Aas, Oslo (Norway); Vandenhove, Hildegarde; Vanhoudt, Nathalie [SCK.CEN, Studiecentrum voor Kernenergie/Centre d' Etude de l' Energie Nucleaire, Avenue Herrmann-Debroux 40, BE-1160 Brussels (Belgium); Willrodt, Christine; Steiner, Martin [Bundesamt fuer Strahlenschutz, Willy-Brandt-Strasse 5, 38226 Salzgitter (Germany)

    2014-07-01

    The Radioecology Exchange (www.radioecology-exchange.org) was created in 2011 under the EU FP7 STAR (Strategy for Allied Radioecology) network of excellence. The project aims to integrate the research efforts on radioecology of nine European organisations into a sustainable network. The web site (together with associated Twitter feeds and Facebook page) currently provides the gateway to project outputs and other on-line radiation protection and radioecological resources. In 2013, the EU FP7 COMET (Coordination and implementation of a pan-European instrument for radioecology) project commenced; it aims to strengthen research on the impact of radiation on man and the environment. COMET includes the STAR partners with the addition of one Japanese and two Ukrainian research institutes. As STAR and COMET interact closely together and with the European Radioecology Alliance (www.er-alliance.org/), the Radioecology Exchange will be modified to become an international 'hub' for information related to radioecology. Project specific information will be hosted on separate web sites www.star-radioecology.org and www.comet-radioecology.org. This paper will present an overview of the resources hosted on the Radioecology Exchange inviting other scientists to contribute. Highlighted aspects of the site include: Social media (News blog, Twitter, Facebook) - Items announcing project outputs, training courses, jobs, studentships etc. Virtual laboratory - Information which encourages integration through joint research and integrated use of data and sample materials. These pages will focus on three categories: (1) Methodological: descriptions and video clips of commonly used analytical methods and protocols and the procedures used in STAR and COMET; (2) Informative: databases made available by STAR/COMET partners together with details of sample archives held. Fact-sheets on radio-ecologically important radionuclides and 'topical descriptions' which show absorbed

  18. The Radioecology Exchange

    Energy Technology Data Exchange (ETDEWEB)

    Barnett, Catherine L.; Beresford, Nicholas A.; Patel, Sabera; Wells, Claire; Howard, Brenda J. [NERC Centre for Ecology and Hydrology, CEH Lancaster, Lancaster Environment Centre, Library Av., Bailrigg, Lancaster, LA1 4AP (United Kingdom); Mora, Juan Carlos; Real, Almudena [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas (CIEMAT), Avenida complutense 22, Madrid, 28040 (Spain); Beaugelin-Seiller, Karine; Gilbin, Rodolphe; Hinton, Thomas [IRSN-Institut de Radioprotection et de Surete Nucleaire, 31, Avenue de la Division Leclerc, 92260 Fontenay-Aux-Roses (France); Vesterbacka, Pia; Muikku, Maarit; Outola, Iisa [Radiation and Nuclear Safety Authority, P.O. Box 14, FI-00881 Helsinki (Finland); Skuterud, Lavrans; AlbumYtre-Eide, Martin [Norwegian Radiation Protection Authority, Grini Naeringspark 13, Oesteraas, 1332 (Norway); Bradshaw, Clare; Stark, Karolina; Jaeschke, Ben [Stockholms Universitet, Universitetsvaegen 10, Stockholm, 10691 (Sweden); Oughton, Deborah; Skipperud, Lindis [NMBU Norwegian University of Life Science P.O. Box 5003N-1432 Aas, Oslo (Norway); Vandenhove, Hildegarde; Vanhoudt, Nathalie [SCK.CEN, Studiecentrum voor Kernenergie/Centre d' Etude de l' Energie Nucleaire, Avenue Herrmann-Debroux 40, BE-1160 Brussels (Belgium); Willrodt, Christine; Steiner, Martin [Bundesamt fuer Strahlenschutz, Willy-Brandt-Strasse 5, 38226 Salzgitter (Germany)

    2014-07-01

    The Radioecology Exchange (www.radioecology-exchange.org) was created in 2011 under the EU FP7 STAR (Strategy for Allied Radioecology) network of excellence. The project aims to integrate the research efforts on radioecology of nine European organisations into a sustainable network. The web site (together with associated Twitter feeds and Facebook page) currently provides the gateway to project outputs and other on-line radiation protection and radioecological resources. In 2013, the EU FP7 COMET (Coordination and implementation of a pan-European instrument for radioecology) project commenced; it aims to strengthen research on the impact of radiation on man and the environment. COMET includes the STAR partners with the addition of one Japanese and two Ukrainian research institutes. As STAR and COMET interact closely together and with the European Radioecology Alliance (www.er-alliance.org/), the Radioecology Exchange will be modified to become an international 'hub' for information related to radioecology. Project specific information will be hosted on separate web sites www.star-radioecology.org and www.comet-radioecology.org. This paper will present an overview of the resources hosted on the Radioecology Exchange inviting other scientists to contribute. Highlighted aspects of the site include: Social media (News blog, Twitter, Facebook) - Items announcing project outputs, training courses, jobs, studentships etc. Virtual laboratory - Information which encourages integration through joint research and integrated use of data and sample materials. These pages will focus on three categories: (1) Methodological: descriptions and video clips of commonly used analytical methods and protocols and the procedures used in STAR and COMET; (2) Informative: databases made available by STAR/COMET partners together with details of sample archives held. Fact-sheets on radio-ecologically important radionuclides and 'topical descriptions' which show absorbed dose estimations for

  19. Catalysed hydrogen isotope exchange

    International Nuclear Information System (INIS)

    1973-01-01

    A method is described for enhancing the rate of exchange of hydrogen atoms in organic compounds or moieties with deuterium or tritium atoms. It comprises reacting the organic compound or moiety and a compound which is the source of deuterium or tritium in the presence of a catalyst consisting of a non-metallic, metallic or organometallic halide of Lewis acid character and which is reactive towards water, hydrogen halides or similar protonic acids. The catalyst is a halide or organometallic halide of: (i) zinc or another element of Group IIb; (ii) boron, aluminium or another element of Group III; (iii) tin, lead, antimony or another element of Groups IV to VI; or (iv) a transition metal, lanthanide or stable actinide; or a halohalide. (author)

  20. The preparation of nucleotides uniformly labelled with carbon-14 by biosynthetic methods. Isolation of adenylic, uridylic, cytidylic,and guanylic acids, from the alkaline hydrolysate of escherichia coli RNA; Preparacion de nucleiotidos uniformemente marcados con 14{sup C}, por via biosintetica. Aislamiento de los acidos adenilico, uridilico, citidilico y guanilico, procedentes de la hidrolisis alcalina de RNA de escherichia Coli.

    Energy Technology Data Exchange (ETDEWEB)

    Garcia Pineda, M D; Pacheco Lopez, J

    1978-07-01

    A method is described for the preparation and analysis of adenylic, uri dilic, cytidi- 11c and guanylic acids, labelled with 14{sup C}. Escherichia coli cells have been labelled by growing them in a medi dia containing glucose-14{sup C} as their only source of carbon. RNA is isolated from the cells, and after hydrolysis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the Isolated nucleotides is determined, and also its specific radioactivity. (Author) 30 refs.

  1. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  2. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  3. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  4. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  5. cAMP signalling in the vasculature: the role of Epac (exchange protein directly activated by cAMP).

    Science.gov (United States)

    Roberts, Owain Llŷr; Dart, Caroline

    2014-02-01

    The second messenger cAMP plays a central role in mediating vascular smooth muscle relaxation in response to vasoactive transmitters and in strengthening endothelial cell-cell junctions that regulate the movement of solutes, cells and macromolecules between the blood and the surrounding tissue. The vasculature expresses three cAMP effector proteins: PKA (protein kinase A), CNG (cyclic-nucleotide-gated) ion channels, and the most recently discovered Epacs (exchange proteins directly activated by cAMP). Epacs are a family of GEFs (guanine-nucleotide-exchange factors) for the small Ras-related GTPases Rap1 and Rap2, and are being increasingly implicated as important mediators of cAMP signalling, both in their own right and in parallel with the prototypical cAMP target PKA. In the present paper, we review what is currently known about the role of Epac within blood vessels, particularly with regard to the regulation of vascular tone, endothelial barrier function and inflammation.

  6. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  7. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  8. New type fuel exchange system

    International Nuclear Information System (INIS)

    Meshii, Toshio; Maita, Yasushi; Hirota, Koichi; Kamishima, Yoshio.

    1988-01-01

    When the reduction of the construction cost of FBRs is considered from the standpoint of the machinery and equipment, to make the size small and to heighten the efficiency are the assigned mission. In order to make a reactor vessel small, it is indispensable to decrease the size of the equipment for fuel exchange installed on the upper part of a core. Mitsubishi Heavy Industries Ltd. carried out the research on the development of a new type fuel exchange system. As for the fuel exchange system for FBRs, it is necessary to change the mode of fuel exchange from that of LWRs, such as handling in the presence of chemically active sodium and inert argon atmosphere covering it and handling under heavy shielding against high radiation. The fuel exchange system for FBRs is composed of a fuel exchanger which inserts, pulls out and transfers fuel and rotary plugs. The mechanism adopted for the new type fuel exchange system that Mitsubishi is developing is explained. The feasibility of the mechanism on the upper part of a core was investigated by water flow test, vibration test and buckling test. The design of the mechanism on the upper part of the core of a demonstration FBR was examined, and the new type fuel exchange system was sufficiently applicable. (Kako, I.)

  9. Tube in shell heat exchangers

    International Nuclear Information System (INIS)

    Hayden, O.; Willby, C.R.; Sheward, G.E.; Ormrod, D.T.; Firth, G.F.

    1980-01-01

    An improved tube-in-shell heat exchanger to be used between liquid metal and water is described for use in the liquid metal coolant system of fast breeder reactors. It is stated that this design is less prone to failures which could result in sodium water reactions than previous exchangers. (UK)

  10. Social exchange : Relations and networks

    NARCIS (Netherlands)

    Dijkstra, Jacob

    2015-01-01

    In this short paper, I review the literature on social exchange networks, with specific attention to theoretical and experimental research. I indicate how social exchange theory is rooted in general social theory and mention a few of its main links to social network analysis and empirical network

  11. Ion exchange : principles and applications

    International Nuclear Information System (INIS)

    Bank, Nader; Majumdar, A.S.

    1975-01-01

    An attempt is made to provide a brief state-of-the-art review of the basic principles underlying the unit operation of ion exchange and its numerous and diverse commercial applications. A selective bibliography is provided for the benefit of the reader interested in pursuing any specific aspect of ion exchange. (author)

  12. Educators Exchange: A Program Evaluation.

    Science.gov (United States)

    Armstrong, William B.

    The Educators Exchange Program (EEP) was established under a training and educational exchange agreement reached by California's San Diego Community College District (SDCCD) and the republic of Mexico. In the program, the District provided a 4-week technological training program to faculty at Centros de Capacitacion Tecnologica Industrial…

  13. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  14. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  15. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  16. Transendothelial lipoprotein exchange and microalbuminuria

    DEFF Research Database (Denmark)

    Jensen, Jan Skov; Feldt-Rasmussen, Bo; Jensen, Kurt Svarre

    2004-01-01

    OBJECTIVE: Microalbuminuria associates with increased risk of atherosclerosis in individuals without diabetes. We hypothesized that transendothelial lipoprotein exchange is elevated among such individuals, possibly explaining increased intimal lipoprotein accumulation and thus atherosclerosis....... METHODS: Using an in vivo isotope technique, transendothelial exchange of low density lipoprotein (LDL) was measured in 77 non-diabetic individuals. Autologous 131-iodinated LDL was reinjected intravenously, and the 1-h fractional escape rate was calculated as index of transendothelial exchange. RESULTS......: There was no difference in transendothelial LDL exchange between subjects with microalbuminuria versus normoalbuminuria (mean (95% confidence interval) 3.8%/h (3.3-4.3%/h) versus 4.2%/h (3.7-4.7%/h); P=0.33). In contrast, there was a positive correlation between transendothelial LDL exchange and (logarithmically...

  17. Heat exchanger leakage problem location

    Directory of Open Access Journals (Sweden)

    Jícha Miroslav

    2012-04-01

    Full Text Available Recent compact heat exchangers are very often assembled from numerous parts joined together to separate heat transfer fluids and to form the required heat exchanger arrangement. Therefore, the leak tightness is very important property of the compact heat exchangers. Although, the compact heat exchangers have been produced for many years, there are still technological problems associated with manufacturing of the ideal connection between the individual parts, mainly encountered with special purpose heat exchangers, e.g. gas turbine recuperators. This paper describes a procedure used to identify the leakage location inside the prime surface gas turbine recuperator. For this purpose, an analytical model of the leaky gas turbine recuperator was created to assess its performance. The results obtained are compared with the experimental data which were acquired during the recuperator thermal performance analysis. The differences between these two data sets are used to indicate possible leakage areas.

  18. Next Generation Microchannel Heat Exchangers

    CERN Document Server

    Ohadi, Michael; Dessiatoun, Serguei; Cetegen, Edvin

    2013-01-01

    In Next Generation Microchannel Heat Exchangers, the authors’ focus on the new generation highly efficient heat exchangers and presentation of novel data and technical expertise not available in the open literature.  Next generation micro channels offer record high heat transfer coefficients with pressure drops much less than conventional micro channel heat exchangers. These inherent features promise fast penetration into many mew markets, including high heat flux cooling of electronics, waste heat recovery and energy efficiency enhancement applications, alternative energy systems, as well as applications in mass exchangers and chemical reactor systems. The combination of up to the minute research findings and technical know-how make this book very timely as the search for high performance heat and mass exchangers that can cut costs in materials consumption intensifies.

  19. Heat exchanger performance monitoring guidelines

    International Nuclear Information System (INIS)

    Stambaugh, N.; Closser, W. Jr.; Mollerus, F.J.

    1991-12-01

    Fouling can occur in many heat exchanger applications in a way that impedes heat transfer and fluid flow and reduces the heat transfer or performance capability of the heat exchanger. Fouling may be significant for heat exchanger surfaces and flow paths in contact with plant service water. This report presents guidelines for performance monitoring of heat exchangers subject to fouling. Guidelines include selection of heat exchangers to monitor based on system function, safety function and system configuration. Five monitoring methods are discussed: the heat transfer, temperature monitoring, temperature effectiveness, delta P and periodic maintenance methods. Guidelines are included for selecting the appropriate monitoring methods and for implementing the selected methods. The report also includes a bibliography, example calculations, and technical notes applicable to the heat transfer method

  20. A spin exchange model for singlet fission

    Science.gov (United States)

    Yago, Tomoaki; Wakasa, Masanobu

    2018-03-01

    Singlet fission has been analyzed with the Dexter model in which electron exchange occurs between chromophores, conserving the spin for each electron. In the present study, we propose a spin exchange model for singlet fission. In the spin exchange model, spins are exchanged by the exchange interaction between two electrons. Our analysis with simple spin functions demonstrates that singlet fission is possible by spin exchange. A necessary condition for spin exchange is a variation in exchange interactions. We also adapt the spin exchange model to triplet fusion and triplet energy transfer, which often occur after singlet fission in organic solids.

  1. Electrically switched ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Lilga, M.A. [Pacific Northwest National Lab., Richland, WA (United States); Schwartz, D.T.; Genders, D.

    1997-10-01

    A variety of waste types containing radioactive {sup 137}Cs are found throughout the DOE complex. These waste types include water in reactor cooling basins, radioactive high-level waste (HLW) in underground storage tanks, and groundwater. Safety and regulatory requirements and economics require the removal of radiocesium before these wastes can be permanently disposed of. Electrically Switched Ion Exchange (ESIX) is an approach for radioactive cesium separation that combines IX and electrochemistry to provide a selective, reversible, and economic separation method that also produces little or no secondary waste. In the ESIX process, an electroactive IX film is deposited electrochemically onto a high-surface area electrode, and ion uptake and elution are controlled directly by modulating the potential of the film. For cesium, the electroactive films under investigation are ferrocyanides, which are well known to have high selectivities for cesium in concentrated sodium solutions. When a cathode potential is applied to the film, Fe{sup +3} is reduced to the Fe{sup +2} state, and a cation must be intercalated into the film to maintain charge neutrality (i.e., Cs{sup +} is loaded). Conversely, if an anodic potential is applied, a cation must be released from the film (i.e., Cs{sup +} is unloaded). Therefore, to load the film with cesium, the film is simply reduced; to unload cesium, the film is oxidized.

  2. Humanitarianism and Unequal Exchange

    Directory of Open Access Journals (Sweden)

    Raja Swamy

    2017-08-01

    Full Text Available This article examines the relationship between humanitarian aid and ecologically unequal exchange in the context of post-disaster reconstruction. I assess the manner in which humanitarian aid became a central part of the reconstruction process in India's Tamil Nadu state following the devastating 2004 Indian Ocean tsunami. This article focuses on how the humanitarian “gift” of housing became a central plank of the state's efforts to push fishers inland while opening up coastal lands for various economic development projects such as ports, infrastructure, industries, and tourism. As part of the state and multilateral agency financed reconstruction process, the humanitarian aid regime provided “free” houses as gifts to recipients while expecting in return the formal abandonment of all claims to the coast. The humanitarian “gift” therefore helped depoliticize critical issues of land and resources, location and livelihood, which prior to the tsunami were subjects of long-standing political conflicts between local fisher populations and the state. The gift economy in effect played into an ongoing conflict over land and resources and effectively sought to ease the alienation of fishers from their coastal commons and near shore marine resource base. I argue that humanitarian aid, despite its associations with benevolence and generosity, presents a troubling and disempowering set of options for political struggles over land, resources, and social entitlements such as housing, thereby intensifying existing ecological and economic inequalities.

  3. Heat exchanger design

    OpenAIRE

    Vítek, Tomáš

    2017-01-01

    Tato bakalářská práce řeší návrh výměníku tepla pro teplovodní kotel se zplyňovací komorou pro předehřev spalovacího vzduchu odpadním teplem spalin. Hodnoty pro výpočet byly experimentálně naměřeny. Práce obsahuje stručný popis trubkového výměníku tepla, stechiometrický vypočet spalování, návrh geometrických rozměrů výměníku, výpočet tlakových ztrát a výpočet výkonu. Její součástí je také výkresová dokumentace navrženého výměníku. This bachelor thesis solves design of a heat exchanger for ...

  4. Effects of Externalities on Patterns of Exchange

    NARCIS (Netherlands)

    Dijkstra, J.; van Assen, M.A.L.M.

    Many real−life examples of exchanges with externalities exist. Externalities of exchange are defined as direct consequences of exchanges for the payoff of actors who are not involved in the exchange. This paper focuses on how externalities influence the partner choice in exchange networks. In an

  5. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  6. Studies on the production of endogenous pyrogen by rabbit monocytes: the role of calcium and cyclic nucleotides.

    Science.gov (United States)

    Sigal, S L; Duff, G W; Atkins, E

    1985-01-01

    Rabbit monocytes stimulated with endotoxin produced endogenous pyrogen, even under conditions of high or low extracellular calcium concentrations. Maximal production occurred when the concentration was in the near-physiological range. Prolonged incubation of cells with a calcium chelator prevented subsequent activation with endotoxin, an effect which was rapidly reversible by re-addition of calcium but not other cations. Addition of small amounts of lanthanum, which acts as a calcium channel blocker, prevented the restoration of pyrogen production, indicating that entry of the added calcium into the monocyte was required. Incorporation of a calcium ionophore into the cell membrane did not stimulate pyrogen production, and no measurable influx or efflux of calcium occurred during stimulation with endotoxin. These observations suggest that a slowly exchangeable calcium pool is necessary for the production of endogenous pyrogen, but that a rise in intracellular calcium is not by itself a necessary or sufficient stimulus. This stands in contrast to other biological systems in which Ca2+ directly couples stimulus and hormone secretion. Incubation of cells with agents shown to increase cyclic 3',5' AMP or cyclic 3',5' GMP levels in monocytes similarly did not stimulate pyrogen production or modulate its production by endotoxin stimulation. Thus, cyclic nucleotides also did not play a detectable role as intracellular messengers in this system. Future work is required to define more clearly the mechanism for the production of endogenous pyrogen, given its marked effects on the immune system through lymphocyte activation and temperature regulation.

  7. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  8. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  9. Heteronuclear multidimensional NMR and homology modelling studies of the C-terminal nucleotide-binding domain of the human mitochondrial ABC transporter ABCB6

    Energy Technology Data Exchange (ETDEWEB)

    Kurashima-Ito, Kaori [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Ikeya, Teppei [National Institute of Advanced Industrial Science and Technology (AIST), (Japan); Senbongi, Hiroshi [Mitochondrial Diseases Group, MRC Dunn Human NutritionUnit (United Kingdom); Tochio, Hidehito [International Graduate School of Arts and Sciences, Supramolecular Biology, Yokohama City University, Molecular Biophysics Laboratory (Japan); Mikawa, Tsutomu [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Shibata, Takehiko [RIKEN, Shibata Distinguished Senior Scientist Laboratory (Japan); Ito, Yutaka [RIKEN, Cellular and Molecular Biology Laboratory (Japan)], E-mail: ito-yutaka@center.tmu.ac.jp

    2006-05-15

    Human ATP-binding cassette, sub-family B, member 6 (ABCB6) is a mitochondrial ABC transporter, and presumably contributes to iron homeostasis. Aimed at understanding the structural basis for the conformational changes accompanying the substrate-transportation cycle, we have studied the C-terminal nucleotide-binding domain of ABCB6 (ABCB6-C) in both the nucleotide-free and ADP-bound states by heteronuclear multidimensional NMR and homology modelling. A non-linear sampling scheme was utilised for indirectly acquired {sup 13}C and {sup 15}N dimensions of all 3D triple-resonance NMR experiments, in order to overcome the instability and the low solubility of ABCB6-C. The backbone resonances for approximately 25% of non-proline residues, which are mostly distributed around the functionally important loops and in the Helical domain, were not observed for nucleotide-free form of ABCB6-C. From the pH, temperature and magnetic field strength dependencies of the resonance intensities, we concluded that this incompleteness in the assignments is mainly due to the exchange between multiple conformations at an intermediate rate on the NMR timescale. These localised conformational dynamics remained in ADP-bound ABCB6-C except for the loops responsible for adenine base and {alpha}/{beta}-phosphate binding. These results revealed that the localised dynamic cooperativity, which was recently proposed for a prokaryotic ABC MJ1267, also exists in a higher eukaryotic ABC, and is presumably shared by all members of the ABC family. Since the Helical domain is the putative interface to the transmembrane domain, this cooperativity may explain the coupled functions between domains in the substrate-transportation cycle.

  10. Custom, contract, and kidney exchange.

    Science.gov (United States)

    Healy, Kieran; Krawiec, Kimberly D

    2012-01-01

    In this Essay, we examine a case in which the organizational and logistical demands of a novel form of organ exchange (the nonsimultaneous, extended, altruistic donor (NEAD) chain) do not map cleanly onto standard cultural schemas for either market or gift exchange, resulting in sociological ambiguity and legal uncertainty. In some ways, a NEAD chain resembles a form of generalized exchange, an ancient and widespread instance of the norm of reciprocity that can be thought of simply as the obligation to “pay it forward” rather than the obligation to reciprocate directly with the original giver. At the same time, a NEAD chain resembles a string of promises and commitments to deliver something in exchange for some valuable consideration--that is, a series of contracts. Neither of these salient "social imaginaries" of exchange--gift giving or formal contract--perfectly meets the practical demands of the NEAD system. As a result, neither contract nor generalized exchange drives the practice of NEAD chains. Rather, the majority of actual exchanges still resemble a simpler form of exchange: direct, simultaneous exchange between parties with no time delay or opportunity to back out. If NEAD chains are to reach their full promise for large-scale, nonsimultaneous organ transfer, legal uncertainties and sociological ambiguities must be finessed, both in the practices of the coordinating agencies and in the minds of NEAD-chain participants. This might happen either through the further elaboration of gift-like language and practices, or through a creative use of the cultural form and motivational vocabulary, but not necessarily the legal and institutional machinery, of contract.

  11. Relational and XML Data Exchange

    CERN Document Server

    Arenas, Marcelo

    2010-01-01

    Data exchange is the problem of finding an instance of a target schema, given an instance of a source schema and a specification of the relationship between the source and the target. Such a target instance should correctly represent information from the source instance under the constraints imposed by the target schema, and it should allow one to evaluate queries on the target instance in a way that is semantically consistent with the source data. Data exchange is an old problem that re-emerged as an active research topic recently, due to the increased need for exchange of data in various for

  12. Corrosion protected reversing heat exchanger

    International Nuclear Information System (INIS)

    Zawierucha, R.

    1984-01-01

    A reversing heat exchanger of the plate and fin type having multiple aluminum parting sheets in a stacked arrangement with corrugated fins separating the sheets to form multiple flow paths, means for closing the ends of the sheets, an input manifold arrangement of headers for the warm end of of the exchanger and an output manifold arrangement for the cold end of the exchanger with the input air feed stream header and the waste gas exhaust header having an alloy of zinc and aluminum coated on the inside surface for providing corrosion protection to the stack

  13. Heat exchanger using graphite foam

    Science.gov (United States)

    Campagna, Michael Joseph; Callas, James John

    2012-09-25

    A heat exchanger is disclosed. The heat exchanger may have an inlet configured to receive a first fluid and an outlet configured to discharge the first fluid. The heat exchanger may further have at least one passageway configured to conduct the first fluid from the inlet to the outlet. The at least one passageway may be composed of a graphite foam and a layer of graphite material on the exterior of the graphite foam. The layer of graphite material may form at least a partial barrier between the first fluid and a second fluid external to the at least one passageway.

  14. Organic decontamination by ion exchange

    International Nuclear Information System (INIS)

    Wilson, T.R.

    1994-01-01

    This study has successfully identified ion exchanger media suitable for decontaminating the 5500-gallon organic layer in Tank 241-C-103. Decontamination of radionuclides is necessary to meet shipping, incinerator site storage, and incineration feed requirements. The exchanger media were identified through a literature search and experiments at the Russian Institute for Physical Chemistry. The principal radionuclides addressed are Cs-137 and Sr-90. Recommendations for an experimental program plan conclude the discussion. The experimental program would provide the data necessary for plant design specifications for a column and for ion exchange media to be used in decontaminating the organic layer

  15. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  16. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  17. Marriage exchanges, seed exchanges, and the dynamics of manioc diversity.

    Science.gov (United States)

    Delêtre, Marc; McKey, Doyle B; Hodkinson, Trevor R

    2011-11-08

    The conservation of crop genetic resources requires understanding the different variables-cultural, social, and economic-that impinge on crop diversity. In small-scale farming systems, seed exchanges represent a key mechanism in the dynamics of crop genetic diversity, and analyzing the rules that structure social networks of seed exchange between farmer communities can help decipher patterns of crop genetic diversity. Using a combination of ethnobotanical and molecular genetic approaches, we investigated the relationships between regional patterns of manioc genetic diversity in Gabon and local networks of seed exchange. Spatially explicit Bayesian clustering methods showed that geographical discontinuities of manioc genetic diversity mirror major ethnolinguistic boundaries, with a southern matrilineal domain characterized by high levels of varietal diversity and a northern patrilineal domain characterized by low varietal diversity. Borrowing concepts from anthropology--kinship, bridewealth, and filiation--we analyzed the relationships between marriage exchanges and seed exchange networks in patrilineal and matrilineal societies. We demonstrate that, by defining marriage prohibitions, kinship systems structure social networks of exchange between farmer communities and influence the movement of seeds in metapopulations, shaping crop diversity at local and regional levels.

  18. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  19. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  20. Properties of the mitochondrial carrier of adenine-nucleotide after purification. Study of the transport protein under isolated form and reincorporated form in phospho-lipidic vesicles

    International Nuclear Information System (INIS)

    Brandolin, Gerard

    1983-01-01

    The first part of this research thesis addresses the reconstitution of the ADP/ATP transport by incorporation of the specific carrier, isolated in presence of detergent, in phospholipids vesicles. Fundamental properties of the reconstituted transport are identical to that of transport in mitochondria, notably as far as the exchange stoichiometry, the turn over and the transport Km are concerned, as well as the asymmetric orientation of the carrier in the membrane. The second part of this research addresses the study of interactions of specific ligands with the ADP/ATP transport protein in presence of detergent. The study of the variations of the intrinsic fluorescence of the isolated ADP/ATP carrier highlights conformational changes exclusively induced by the presence of transportable nucleotides which are modulated in a different manner by carboxy-atractyloside or bongkrekic acid. Moreover, by using the isolated protein, a detailed analysis of binding parameters of fluorescent analogues of ATP is reported [fr

  1. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  2. Theory and design of heat exchanger : Double pipe and heat exchanger in abnormal condition

    International Nuclear Information System (INIS)

    Min, Ui Dong

    1996-02-01

    This book introduces theory and design of heat exchanger, which includes HTRI program, multiple tube heat exchanger external heating, theory of heat transfer, basis of design of heat exchanger, two-phase flow, condensation, boiling, material of heat exchanger, double pipe heat exchanger like hand calculation, heat exchanger in abnormal condition such as Jackets Vessel, and Coiled Vessel, design and summary of steam tracing.

  3. Exchange of Information in Tax Matters

    OpenAIRE

    Paweł Szwajdler

    2017-01-01

    The main aim of this paper is to present issues related to exchange of tax information. The author focuses on models of exchange of information and boundaries of obligations in reference to above-mentioned problems. Automatic exchange of information, spontaneous exchange of information and exchange of information on request are analysed in this work on the base of OECD Convention on Mutual Administrative Assistance in Tax Matters, Council Directive 2011/16 and OECD Model Agreement on Exchange...

  4. Apparatus and process for deuterium exchange

    International Nuclear Information System (INIS)

    Ergenc, M.S.

    1976-01-01

    The deuterium exchange plant is combined with an absorption refrigeration plant in order to improve the exchange process and to produce refrigeration. The refrigeration plant has a throttling means for expanding and cooling a portion of the liquid exchange medium separated in the exchange plant as well as an evaporator, in which the said liquid exchange medium is brought into heat exchange with a cold consumer device, absorption means for forming a solution of the used exchange medium and fresh water and a pump for pumping the solution into the exchange plant

  5. VLER Health Exchange by Area

    Data.gov (United States)

    Department of Veterans Affairs — “Connect Your Docs” through the Virtual Lifetime Electronic Record (VLER) Health Exchange program. This program gives VA and community health care providers secure...

  6. Estimating Foreign Exchange Reserve Adequacy

    Directory of Open Access Journals (Sweden)

    Abdul Hakim

    2013-04-01

    Full Text Available Accumulating foreign exchange reserves, despite their cost and their impacts on other macroeconomics variables, provides some benefits. This paper models such foreign exchange reserves. To measure the adequacy of foreign exchange reserves for import, it uses total reserves-to-import ratio (TRM. The chosen independent variables are gross domestic product growth, exchange rates, opportunity cost, and a dummy variable separating the pre and post 1997 Asian financial crisis. To estimate the risky TRM value, this paper uses conditional Value-at-Risk (VaR, with the help of Glosten-Jagannathan-Runkle (GJR model to estimate the conditional volatility. The results suggest that all independent variables significantly influence TRM. They also suggest that the short and long run volatilities are evident, with the additional evidence of asymmetric effects of negative and positive past shocks. The VaR, which are calculated assuming both normal and t distributions, provide similar results, namely violations in 2005 and 2008.

  7. Mechanical calculation of heat exchangers

    International Nuclear Information System (INIS)

    Osweiller, Francis.

    1977-01-01

    Many heat exchangers are still being dimensioned at the present time by means of the American TEMA code (Tubular Exchanger Manufacturers Association). The basic formula of this code often gives rise to significant tubular plate thicknesses which, apart from the cost of materials, involve significant machining. Some constructors have brought into use calculation methods that are more analytic so as to take into better consideration the mechanical phenomena which come into play in a heat exchanger. After a brief analysis of these methods it is shown, how the original TEMA formulations have changed to reach the present version and how this code has incorporated Gardner's results for treating exchangers with two fixed heads. A formal and numerical comparison is then made of the analytical and TEMA methods by attempting to highlight a code based on these methods or a computer calculation programme in relation to the TEMA code [fr

  8. Microplate Heat Exchanger, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose a microplate heat exchanger for cryogenic cooling systems used for continuous flow distributed cooling systems, large focal plane arrays, multiple cooling...

  9. Shared Year Exchange in Nursing

    DEFF Research Database (Denmark)

    Vedsegaard, Helle Wendner; Wederkinck, Elisabeth

    2010-01-01

    Beskrivelse af Shared Year Exchange in Nursing, et udviklingsporjekt omhandlende udvikling, beskrivelse og implementering af et fælles studieår for sygeplejerskestuderende ved Metropol og La Trobe University Australien.......Beskrivelse af Shared Year Exchange in Nursing, et udviklingsporjekt omhandlende udvikling, beskrivelse og implementering af et fælles studieår for sygeplejerskestuderende ved Metropol og La Trobe University Australien....

  10. Exchange Rate and Inflation Dynamics

    OpenAIRE

    Eatzaz Ahmad; Saima Ahmed Ali

    1999-01-01

    This paper studies simultaneous determination of nominal exchange rate and domestic price level in Pakistan. The estimated model contains sufficient built-in dynamics to trace the pattern and speed of adjustment in the two variables in response to temporary or permanent shocks. The two domestic shocks considered in the paper are monetary and real shocks, while the three external shocks considered are import price, export price and foreign exchange reserves shocks. The study finds that the imp...

  11. Sodium vapor charge exchange cell

    International Nuclear Information System (INIS)

    Hiddleston, H.R.; Fasolo, J.A.; Minette, D.C.; Chrien, R.E.; Frederick, J.A.

    1976-01-01

    An operational sequential charge-exchange ion source yielding a 50 MeV H - current of approximately 8 mA is planned for use with the Argonne 500 MeV booster synchrotron. We report on the progress for development of a sodium vapor charge-exchange cell as part of that planned effort. Design, fabrication, and operating results to date are presented and discussed. (author)

  12. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  13. Electrically switched cesium ion exchange

    International Nuclear Information System (INIS)

    Lilga, M.A.; Orth, R.J.; Sukamto, J.P.H.; Schwartz, D.T.; Haight, S.M.; Genders, J.D.

    1997-04-01

    Electrically Switched Ion Exchange (ESIX) is a separation technology being developed as an alternative to conventional ion exchange for removing radionuclides from high-level waste. The ESIX technology, which combines ion exchange and electrochemistry, is geared toward producing electroactive films that are highly selective, regenerable, and long lasting. During the process, ion uptake and elution are controlled directly by modulating the potential of an ion exchange film that has been electrochemically deposited onto a high surface area electrode. This method adds little sodium to the waste stream and minimizes the secondary wastes associated with traditional ion exchange techniques. Development of the ESIX process is well underway for cesium removal using ferrocyanides as the electroactive films. Films having selectivity for perrhenate (a pertechnetate surrogate) over nitrate also have been deposited and tested. A case study for the KE Basin on the Hanford Site was conducted based on the results of the development testing. Engineering design baseline parameters for film deposition, film regeneration, cesium loading, and cesium elution were used for developing a conceptual system. Order of magnitude cost estimates were developed to compare with conventional ion exchange. This case study demonstrated that KE Basin wastewater could be processed continuously with minimal secondary waste and reduced associated disposal costs, as well as lower capital and labor expenditures

  14. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  15. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  16. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  17. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  18. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  19. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  20. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  1. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  2. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  3. Differential regulation of inositol 1,4,5-trisphosphate by co-existing P2Y-purinoceptors and nucleotide receptors on bovine aortic endothelial cells.

    Science.gov (United States)

    Purkiss, J R; Wilkinson, G F; Boarder, M R

    1994-03-01

    1. We have examined the inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) responses in bovine aortic endothelial (BAE) cells to purines (ATP, ADP and analogues) and the pyrimidine, uridine triphosphate (UTP). 2. Exchange of medium on BAE cells in the absence of agonist was found to be a stimulus for Ins(1,4,5)P3 generation. BAE cells stimulated with 100 microM ATP, 30 microM 2MeSATP (an agonist at P2Y-purinoceptors but not nucleotide receptors) or 100 microM UTP (an agonist at nucleotide receptors but not P2Y-purinoceptors) gave Ins(1,4,5)P3 responses above that caused by exchange of medium. The time course was rapid, with peak response within the first 5 s and levels returning close to basal after 30 s of stimulation. 3. Significant differences in Ins(1,4,5)P3 responses to 100 microM UTP and 30 microM 2MeSATP stimulation were observed. The response to UTP was reproducibly more sustained than that to 2MeSATP. 4. Stimulation of BAE cells with 100 microM UTP plus 30 microM 2MeSATP produced a response statistically indistinguishable from that predicted by addition of the responses to the two agonists in isolation. 5. The Ins(1,4,5)P3 response to UTP was attenuated to 25% of control by pretreatment of BAE cells with pertussis toxin. Responses to 2MeSATP and ADP were essentially unaffected. ATP stimulation was reduced to 65% of control. 6. Activation of protein kinase C with tetradecanoyl phorbol acetate (TPA) profoundly inhibited Ins(1,4,5)P3 responses to 2MeSATP and ADP but had no effect on UTP stimulation. The protein kinase C inhibitor, Ro 31-8220, enhanced responses to 2MeSATP, ADP and ATP but no effect was observed on UTP stimulation. 7. These observations show that nucleotide and P2Y-receptors mobilise the second messenger Ins(1,4,5)P3 by separate routes resulting in different patterns of generation and suggest that while ATP activates both receptors, ADP principally influences these cells by interacting with the P2Y-purinoceptors.

  4. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  5. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  6. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  7. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  8. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  9. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  10. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  11. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  12. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  14. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  15. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  16. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  17. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  18. On one pion exchange potential with quark exchange in the resonating group method

    International Nuclear Information System (INIS)

    Braeuer, K.; Faessler, A.; Fernandez, F.; Shimizu, K.

    1985-01-01

    The effect of quark exchange between different nucleons on the one pion exchange potential is studied in the framework of the resonating group method. The calculated phase shifts including the one pion exchange potential with quark exchange in addition to the one gluon plus sigma meson exchange are shown to be consistent with experiments. Especially the p-wave phase shifts are improved by taking into account the quark exchange on the one pion exchange potential. (orig.)

  19. A continuous exchange factor method for radiative exchange in enclosures with participating media

    International Nuclear Information System (INIS)

    Naraghi, M.H.N.; Chung, B.T.F.; Litkouhi, B.

    1987-01-01

    A continuous exchange factor method for analysis of radiative exchange in enclosures is developed. In this method two types of exchange functions are defined, direct exchange function and total exchange function. Certain integral equations relating total exchange functions to direct exchange functions are developed. These integral equations are solved using Gaussian quadrature integration method. The results obtained based on the present approach are found to be more accurate than those of the zonal method

  20. Experimental test of exchange degeneracy in hypercharge exchange reactions

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1978-10-01

    Two pairs of line-reversed reactions π + P → K + Σ + , K - p → π - Σ + and π + p → K + Y* + (1385), K - p → π - Y* + (1385) provide an experimental test of exchange degeneracy in hypercharge exchange reactions. From their study it is concluded that in contrast to the lower energy data, the 11.5 results for the two pairs of reactions are consistent with exchange degeneracy predictions for both helicity-flip and nonflip amplitudes. The Y(1385) decay angular distributions indicate that the quark model and Stodolsky--Sakurai predictions are in agreement with the main features of the data. However, small violations are observed at small momentum transfer. While the Y(1385) vertex is helicity-flip dominated, the nonvanishing of T/sub 3/2 - 1/2/ and T/sub -3/2 1/2/ suggests some finite helicity nonflip contribution in the forward direction. 23 references

  1. Estimating Exchange Market Pressure and the Degree of Exchange Market Intervention for Finland during the Floating Exchange Rate Regime

    OpenAIRE

    Pösö, Mika; Spolander, Mikko

    1997-01-01

    In this paper, we use a fairly simple monetary macro model to calculate the quarterly measures of exchange market pressure and the degree of the Bank of Finland's intervention during the time the markka was floated. Exchange market pressure measures the size of the exchange rate change that would have occurred if the central bank had unexpectedly refrained from intervening in the foreign exchange market. Intervention activity of the central bank is measured as the proportion of exchange marke...

  2. Conflict and Fairness in Social Exchange

    Science.gov (United States)

    Molm, Linda D.; Collett, Jessica L.; Schaefer, David R.

    2006-01-01

    Inherent to all social exchange relations are elements of both cooperation and competition. We develop and test a theoretical model which proposes that the relative salience of the competitive, conflictual elements of exchange mediate and explain the negative effects of negotiated exchange, as compared with reciprocal exchange, on actors'…

  3. Pu Anion Exchange Process Intensification

    International Nuclear Information System (INIS)

    Taylor-Pashow, Kathryn M. L.

    2017-01-01

    This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.

  4. Fair Exchange in Strand Spaces

    Directory of Open Access Journals (Sweden)

    Joshua D. Guttman

    2009-10-01

    Full Text Available Many cryptographic protocols are intended to coordinate state changes among principals. Exchange protocols coordinate delivery of new values to the participants, e.g. additions to the set of values they possess. An exchange protocol is fair if it ensures that delivery of new values is balanced: If one participant obtains a new possession via the protocol, then all other participants will, too. Fair exchange requires progress assumptions, unlike some other protocol properties. The strand space model is a framework for design and verification of cryptographic protocols. A strand is a local behavior of a single principal in a single session of a protocol. A bundle is a partially ordered global execution built from protocol strands and adversary activities. The strand space model needs two additions for fair exchange protocols. First, we regard the state as a multiset of facts, and we allow strands to cause changes in this state via multiset rewriting. Second, progress assumptions stipulate that some channels are resilient-and guaranteed to deliver messages-and some principals are assumed not to stop at certain critical steps. This method leads to proofs of correctness that cleanly separate protocol properties, such as authentication and confidentiality, from invariants governing state evolution. G. Wang's recent fair exchange protocol illustrates the approach.

  5. Tokamak rotation and charge exchange

    International Nuclear Information System (INIS)

    Hazeltine, R.D.; Rowan, W.L.; Solano, E.R.; Valanju, P.M.

    1991-01-01

    In the absence of momentum input, tokamak toroidal rotation rates are typically small - no larger in particular than poloidal rotation - even when the radial electric field is strong, as near the plasma edge. This circumstance, contradicting conventional neoclassical theory, is commonly attributed to the rotation damping effect of charge exchange, although a detailed comparison between charge-exchange damping theory and experiment is apparently unavailable. Such a comparison is attempted here in the context of recent TEXT experiments, which compare rotation rates, both poloidal and toroidal, in helium and hydrogen discharges. The helium discharges provide useful data because they are nearly free of ion-neutral charge exchange; they have been found to rotate toroidally in reasonable agreement with neoclassical predictions. The hydrogen experiments show much smaller toroidal motion as usual. The theoretical calculation uses the full charge-exchange operator and assumes plateau collisionality, roughly consistent with the experimental conditions. The authors calculate the ion flow as a function of v cx /v c , where v cx is the charge exchange rate and v c the Coulomb collision frequency. The results are in reasonable accord with the observations. 1 ref

  6. Pu Anion Exchange Process Intensification

    Energy Technology Data Exchange (ETDEWEB)

    Taylor-Pashow, Kathryn M. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-10-06

    This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.

  7. Heat exchanger. [Nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Molina, C; Brisseaux, A

    1976-01-19

    This invention concerns a heat exchanger between a fluid flowing through a tube and a gas. Such an exchanger can be used, inter alia, for removing calories that cannot be used for generating electricity in a thermal or nuclear power station. This exchanger can withstand any pressure surges in the system and even the use of a high vapour pressure coolant such as ammonia, since the fluid flows in a round tube with low pressure drops (both with respect to the fluid to be cooled and the cooling air). It is rigid enough to stand up to being moved and handled as well as to gusts of wind. It is formed of units that can be handled without difficulty and that are easily dismantable and interchangeable, even in service, and it is easily maintained. The exchange area is high for a minimum frontal area and this enables the size of the supporting frame to be reduced and makes it easy to hide it behind a screen of trees should this prove necessary. Finally, it is composed of a small number of standard units thus reducing the industrial production cost. These units are rectangular plates, each one being a flat tubular coil fitted between two flat parallel sheet metal plates having on their outer sides flat top raised bosses. These units are assembled together by the tops of the bosses so as to form an exchanger bank, each bank comprising two collectors to which the bank coils are tightly connected.

  8. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  9. Uranium isotope separation using styrene cation exchangers

    International Nuclear Information System (INIS)

    Kahovec, J.

    1980-01-01

    The separation of 235 U and 238 U isotopes is carried out either by simple isotope exchange in the system uranium-cation exchanger (sulphonated styrene divinylbenzene resin), or by combination of isotope exchange in a uranium-cation exchanger (Dowex 50, Amberlite IR-120) system and a chemical reaction. A review is presented of elution agents used, the degree of cation exchanger cross-linking, columns length, and 235 U enrichment. The results are described of the isotope effect study in a U(IV)-U(VI)-cation exchanger system conducted by Japanese and Romanian authors (isotope exchange kinetics, frontal analysis, reverse (indirect) frontal analysis). (H.S.)

  10. Exchange effects in Relativistic Schroedinger Theory

    International Nuclear Information System (INIS)

    Sigg, T.; Sorg, M.

    1998-01-01

    The Relativistic Schroedinger Theory predicts the occurrence of exchange and overlap effects in many-particle systems. For a 2-particle system, the interaction energy of the two particles consists of two contributions: Coulomb energy and exchange energy, where the first one is revealed to be the same as in standard quantum theory. However the exchange energy is mediated by an exchange potential, contrary to the kinematical origin of the exchange term in the standard theory

  11. Exchange Rate Policy in Philippine Development

    OpenAIRE

    Bautista, Romeo M.

    2003-01-01

    This paper examines the conduct of exchange rate policy in the Philippines since the early 1980s, paying particular attention to the influence of exchange rate adjustments on relative production incentives. While primary interest is in the exchange rate regime and its incentive effects, the role of trade policy has to be simultaneously analyzed in view of its influence on the conduct of exchange rate policy as well as its direct effect on the real exchange rate. Moreover, there are analytical...

  12. Effective Exchange Rate Classifications and Growth

    OpenAIRE

    Justin M. Dubas; Byung-Joo Lee; Nelson C. Mark

    2005-01-01

    We propose an econometric procedure for obtaining de facto exchange rate regime classifications which we apply to study the relationship between exchange rate regimes and economic growth. Our classification method models the de jure regimes as outcomes of a multinomial logit choice problem conditional on the volatility of a country's effective exchange rate, a bilateral exchange rate and international reserves. An `effective' de facto exchange rate regime classification is then obtained by as...

  13. Value Appropriation in Business Exchange

    DEFF Research Database (Denmark)

    Ellegaard, Chris; Medlin, Christopher J.; Geersbro, Jens

    2014-01-01

    value creation. Originality/value – To the authors’ knowledge, this paper represents the first attempt at reviewing the management literature on value appropriation in business exchange. The authors provide overview, details, comparisons, and frame a research agenda as a first step towards establishing......Purpose – Value appropriation is a central, yet neglected aspect in business exchange research. The purpose of the paper is to generate an overview of research on active value appropriation in business exchange and provide the foundation for further research into value appropriation, as well...... as some initial guidance for managers. Design/methodology/approach – Literatures investigating value appropriation were identified by the means of a systematic review of the overall management literature. Findings – The authors provide an overview and comparison of the literatures and find that they apply...

  14. Knowledge Exchange and Management Research

    DEFF Research Database (Denmark)

    Bager, Torben

    2018-01-01

    for ‘interesting’ discoveries has a potential to lift off papers with a high level of scientific rigor as well as a high level of relevance for practice. Originality: An outcome focus on the relationship between knowledge exchange activities and management research is to our knowledge new in the debate about......Purpose: The growing involvement of management researchers in knowledge exchange activities and collaborative research does not seem to be reflected in a growing academic output. The purpose of this paper is to explore barriers for academic output from these activities as well as the potential...... derived from knowledge exchange activities and Mode 2 research into academic papers such as low priority of case study research in leading management journals, a growing practice orientation in the research funding systems, methodological challenges due to limited researcher control, and disincentives...

  15. Inflationary trispectrum from graviton exchange

    DEFF Research Database (Denmark)

    Seery, David; Sloth, Martin Snoager; Vernizzi, Filippo

    2009-01-01

    We compute the connected four-point correlation function of the primordial curvature perturbation generated during inflation with standard kinetic terms, where the correlation is established via exchange of a graviton between two pairs of scalar fluctuations. Any such correlation yields a contrib......We compute the connected four-point correlation function of the primordial curvature perturbation generated during inflation with standard kinetic terms, where the correlation is established via exchange of a graviton between two pairs of scalar fluctuations. Any such correlation yields...... where the momentum of the graviton which is exchanged becomes much smaller than the external momenta. We conclude that the total non-linearity parameter generated by single-field models of slow-roll inflation is at maximum tauNL ~ r....

  16. Determination of total ribonucleotide pool in plant materials by high-pH anion-exchange high-performance liquid chromatography following extraction with potassium hydroxide.

    Science.gov (United States)

    Riondet, Christophe; Morel, Sylvain; Alcaraz, Gérard

    2005-06-10

    A new, improved method that only requires a potassium hydroxide extraction procedure is presented for the analysis of a full nucleotide pool in plant materials. Quantification was performed by high-pH anion-exchange chromatography (HPAEC) with UV detection after a potassium hydroxide extraction, and allowed the quantification of 13 linear ribonucleotides in a single run. The method has been validated by comparison of six extraction methods and also by measurement of the intracellular nucleotide levels of three plant species (cell cultures and leaves). The evolution of the nucleotide pool of Nicotiana tabacum cell culture during growth has also been measured, and showed an increase in the pool until the fifth day, where the growth rate reaches a maximum, after which a decrease was observed.

  17. Membrane association of the Arabidopsis ARF exchange factor GNOM involves interaction of conserved domains

    DEFF Research Database (Denmark)

    Anders, Nadine; Nielsen, Michael M.; Keicher, Jutta

    2008-01-01

    vesicle formation by activating ARF GTPases on specific membranes in animals, plants, and fungi. However, apart from the catalytic exchange activity of the SEC7 domain, the functional significance of other conserved domains is virtually unknown. Here, we show that a distinct N-terminal domain of GNOM......The GNOM protein plays a fundamental role in Arabidopsis thaliana development by regulating endosome-to-plasma membrane trafficking required for polar localization of the auxin efflux carrier PIN1. GNOM is a family member of large ARF guanine nucleotide exchange factors (ARF-GEFs), which regulate...... mediates dimerization and in addition interacts heterotypically with two other conserved domains in vivo. In contrast with N-terminal dimerization, the heterotypic interaction is essential for GNOM function, as mutations abolishing this interaction inactivate the GNOM protein and compromise its membrane...

  18. EXTERNALITIES IN EXCHANGE NETWORKS AN ADAPTATION OF EXISTING THEORIES OF EXCHANGE NETWORKS

    NARCIS (Netherlands)

    Dijkstra, Jacob

    2009-01-01

    The present paper extends the focus of network exchange research to externalities in exchange networks. Externalities of exchange are defined as direct effects on an actor's utility, of an exchange in which this actor is not involved. Existing theories in the field of network exchange do not inform

  19. Statistical thermodynamics and energy exchanges

    International Nuclear Information System (INIS)

    Oudet, X.

    1987-01-01

    The probability of finding the energy of a particle in the vicinity of a given energy is determined, taking into account of the conservation of energy during the exchanges of energy. As a result the exchanges which determine the different probabilities also introduce a dependence between them, allowing a full calculation. The solution has the main properties of the distribution of Fermi-Dirac, with the mean energy per particle as variable in place of temperature. It allows to propose a localized model for the conduction electrons [fr

  20. The Picture Exchange Communication System.

    Science.gov (United States)

    Bondy, A; Frost, L

    2001-10-01

    The Picture Exchange Communication System (PECS) is an alternative/augmentative communication system that was developed to teach functional communication to children with limited speech. The approach is unique in that it teaches children to initiate communicative interactions within a social framework. This article describes the advantages to implementing PECS over traditional approaches. The PECS training protocol is described wherein children are taught to exchange a single picture for a desired item and eventually to construct picture-based sentences and use a variety of attributes in their requests. The relationship of PECS's implementation to the development of speech in previously nonvocal students is reviewed.

  1. Proton exchange membrane fuel cells

    CERN Document Server

    Qi, Zhigang

    2013-01-01

    Preface Proton Exchange Membrane Fuel CellsFuel CellsTypes of Fuel CellsAdvantages of Fuel CellsProton Exchange Membrane Fuel CellsMembraneCatalystCatalyst LayerGas Diffusion MediumMicroporous LayerMembrane Electrode AssemblyPlateSingle CellStackSystemCell Voltage Monitoring Module (CVM)Fuel Supply Module (FSM)Air Supply Module (ASM)Exhaust Management Module (EMM)Heat Management Module (HMM)Water Management Module (WMM)Internal Power Supply Module (IPM)Power Conditioning Module (PCM)Communications Module (COM)Controls Module (CM)SummaryThermodynamics and KineticsTheoretical EfficiencyVoltagePo

  2. CHANGES IN EXCHANGE RATE REGIMES

    Directory of Open Access Journals (Sweden)

    Carmen SANDU (TODERASCU

    2014-06-01

    Full Text Available The experience of recentyears showsthat it hasa fundamentalroleformation mechanismof the exchange rateinmacroeconomic stabilization. Global economiccrises, oil shockshave shownthe difficultyoffloatingsustainabilitybyparticipants in the system. EuropeanMonetary System, focused onconcertedfloatingcurrenciestoECU, was formedunder the conditionsin which somecountries have adoptedregional monetaryarrangements(EU countries, with suchbasescurrencyregimeshybridthat combinesspecific mechanismsto those offixedratefree floating. This paperaims to demonstratethe important role thatithasthe choice ofexchange rateregimeas abasic elementin thefoundationofmacroeconomic stabilizationinstruments. Consideredan expression of thestateof the domestic economyandinternationalcompetitiveness, the exchange rate is determined bya complex set ofexternal factorsorinternalstabilityisa prerequisite forthe crisis.

  3. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  4. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  5. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  6. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  7. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  8. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  9. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  10. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  11. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  12. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  13. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  14. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  15. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  16. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  17. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  18. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  19. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  1. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  2. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  3. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  4. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  5. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  6. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  7. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  8. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  9. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  10. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  11. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  12. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  13. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  15. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  16. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  17. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  18. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  19. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  20. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  1. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  2. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  3. Compact heat exchanger for power plants

    International Nuclear Information System (INIS)

    Kinnunen, L.

    2001-01-01

    Vahterus Oy, located at Kalanti, has manufactured heat exchangers since the beginning of 1990s. About 90% of the equipment produced are exported. In the PSHE (Plate and Shell) solution of the Vahterus heat exchanger the heat is transferred by round plated welded to form a compact package, which is assembled into a cylindrical steel casing. The heat exchanger contains no gaskets or soldered joints, which eliminates the leak risks. Traditional heat exchanges are usually operated at higher temperatures and pressures, but the heat transfer capacities of them are lower. Plate heat exchangers, on the other hand, are efficient, but the application range of them is narrow. Additionally, the rubber gasket of the heat exchange plates, sealing the joints of the heat exchanging plates, does not stand high pressures or temperatures, or corroding fluids. The new welded plate heat exchanger combine the pressure and temperature resistance of tube heat exchangers and the high heat exchange capacity of plate heat exchangers. The new corrosion resisting heat exchanger can be applied for especially hard conditions. The operating temperature range of the PSHE heat exchanger is - 200 - 900 deg C. The pressure resistance is as high as 100 bar. The space requirement of PSHE is only one tenth of the space requirement of traditional tube heat exchangers. Adjusting the number of heat exchanging plates can change the capacity of the heat exchanger. Power range of the heat exchanger can be as high as 80 MW. Due to the corrosion preventive construction and the small dimension the PSHE heat exchanger can be applied for refrigerators using ammonia as refrigerant. These kinds of new Vahterus heat exchangers are in use in 60 countries in more than 2000 refrigerators

  4. The effects of noncoding aquaporin-4 single-nucleotide polymorphisms on cognition and functional progression of Alzheimer's disease.

    Science.gov (United States)

    Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J

    2017-09-01

    The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.

  5. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  6. Nonadiabatic exchange dynamics during adiabatic frequency sweeps.

    Science.gov (United States)

    Barbara, Thomas M

    2016-04-01

    A Bloch equation analysis that includes relaxation and exchange effects during an adiabatic frequency swept pulse is presented. For a large class of sweeps, relaxation can be incorporated using simple first order perturbation theory. For anisochronous exchange, new expressions are derived for exchange augmented rotating frame relaxation. For isochronous exchange between sites with distinct relaxation rate constants outside the extreme narrowing limit, simple criteria for adiabatic exchange are derived and demonstrate that frequency sweeps commonly in use may not be adiabatic with regard to exchange unless the exchange rates are much larger than the relaxation rates. Otherwise, accurate assessment of the sensitivity to exchange dynamics will require numerical integration of the rate equations. Examples of this situation are given for experimentally relevant parameters believed to hold for in-vivo tissue. These results are of significance in the study of exchange induced contrast in magnetic resonance imaging. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. SPECTRAL ANALYSIS OF EXCHANGE RATES

    Directory of Open Access Journals (Sweden)

    ALEŠA LOTRIČ DOLINAR

    2013-06-01

    Full Text Available Using spectral analysis is very common in technical areas but rather unusual in economics and finance, where ARIMA and GARCH modeling are much more in use. To show that spectral analysis can be useful in determining hidden periodic components for high-frequency finance data as well, we use the example of foreign exchange rates

  8. Milk fouling in heat exchangers

    NARCIS (Netherlands)

    Jeurnink, T.J.M.

    1996-01-01


    The mechanisms of fouling of heat exchangers by milk were studied. Two major fouling mechanisms were indentified during the heat treatment of milk: (i) the formation and the subsequent deposition of activated serum protein molecules as a result of the heat denaturation; (ii) the

  9. Exchange asymmetry in experimental settings

    Science.gov (United States)

    Thomas C. Brown; Mark D. Morrison; Jacob A. Benfield; Gretchen Nurse Rainbolt; Paul A. Bell

    2015-01-01

    We review past trading experiments and present 11 new experiments designed to show how the trading rate responds to alterations of the experimental procedure. In agreement with earlier studies, results show that if the trade decision is converted to one resembling a choice between goods the exchange asymmetry disappears, but otherwise the asymmetry is...

  10. Baltic Exchange teper v Tallinne

    Index Scriptorium Estoniae

    2007-01-01

    Viimane osa merekonteineritesse kokkupakitud Londoni laevandus- ja merebörsi Baltic Exchange'i endise peakorteri detailidest jõudis 2007. a. juunis Tallinna. Hoone detailid ostnud ärimehed Heiti Hääl ja Eerik-Niiles Kross plaanivad leida hoonele koha Tallinna kesklinnas. E.-N. Krossi kommentaar

  11. SPEEDUPtrademark ion exchange column model

    International Nuclear Information System (INIS)

    Hang, T.

    2000-01-01

    A transient model to describe the process of loading a solute onto the granular fixed bed in an ion exchange (IX) column has been developed using the SpeedUptrademark software package. SpeedUp offers the advantage of smooth integration into other existing SpeedUp flowsheet models. The mathematical algorithm of a porous particle diffusion model was adopted to account for convection, axial dispersion, film mass transfer, and pore diffusion. The method of orthogonal collocation on finite elements was employed to solve the governing transport equations. The model allows the use of a non-linear Langmuir isotherm based on an effective binary ionic exchange process. The SpeedUp column model was tested by comparing to the analytical solutions of three transport problems from the ion exchange literature. In addition, a sample calculation of a train of three crystalline silicotitanate (CST) IX columns in series was made using both the SpeedUp model and Purdue University's VERSE-LC code. All test cases showed excellent agreement between the SpeedUp model results and the test data. The model can be readily used for SuperLigtrademark ion exchange resins, once the experimental data are complete

  12. Dual temperature isotope exchange system

    International Nuclear Information System (INIS)

    Spevack, J.S.

    1976-01-01

    Improvements in the method for isotope concentration by dual temperature exchange between feed and auxiliary fluids in a multistage system are described. In a preferred embodiment the first is a vaporizable liquid and the auxiliary fluid a gas, comprising steps for improving the heating and/or cooling and/or humidifying and/or dehumidifying operations

  13. Maintenance of CERN telephone exchanges

    CERN Multimedia

    2005-01-01

    A maintenance of CERN telephone exchanges will be performed on 21st, 22nd, 23rd, 24th of September from 7 p.m. to 9 p.m. Disturbances or even interruptions of telephony services may occur during this lapse of time. We apology in advance for any inconveniences that this may cause.

  14. Theory of oxygen isotope exchange

    NARCIS (Netherlands)

    den Otter, M.W.; Boukamp, Bernard A.; Bouwmeester, Henricus J.M.

    2001-01-01

    Transients for oxygen molecular mass numbers 32, 34 and 36 are derived which can be used for the interpretation of oxygen isotope exchange data based on measurement of concentrations of 16O2, 16O18O and 18O2 in the gas phase. Key parameters in the theory are the rate at which oxygen molecules are

  15. H- charge exchange injection systems

    International Nuclear Information System (INIS)

    Ankenbrandt, C.; Curtis, C.; Hojvat, C.; Johnson, R.P.; Owen, C.; Schmidt, C.; Teng, L.; Webber, R.C.

    1980-01-01

    The techniques and components required for injection of protons into cyclic accelerators by means of H - charge exchange processes are reviewed, with emphasis on the experience at Fermilab. The advantages of the technique are described. The design and performance of the system of injection of H - ions into the Fermilab Booster are detailed. (Auth.)

  16. The Commodity and its Exchange

    DEFF Research Database (Denmark)

    Høst, Jeppe Engset

    2015-01-01

    and the value of the quota are examined through the concrete exchange of fishing rights, and it is explained why quota trade can give rise to speculation and monopolies. In the final part of the chapter, it is argued that the value of transferable fishing quotas rely on a social relation between owners...

  17. Primer on nuclear exchange models

    Energy Technology Data Exchange (ETDEWEB)

    Hafemeister, David [Physics Department, Cal Poly University, San Luis Obispo, California (United States)

    2014-05-09

    Basic physics is applied to nuclear force exchange models between two nations. Ultimately, this scenario approach can be used to try and answer the age old question of 'how much is enough?' This work is based on Chapter 2 of Physics of Societal Issues: Calculations on National Security, Environment and Energy (Springer, 2007 and 2014)

  18. Fragmentary model of exchange interactions

    CERN Document Server

    Kotov, V M

    2000-01-01

    This article makes attempt to refusal from using neutrino for explanation continuous distribution of beta particle energy by conversion to characteristic exchange interaction particles in nucleolus. It is taking formulation for nuclear position with many different fragments. It is computing half-value period of spontaneous fission of heavy nucleolus. (author)

  19. Common Knowledge in Email Exchanges

    NARCIS (Netherlands)

    Sietsma, F.; Apt, K.R.

    We consider a framework in which a group of agents communicates by means of emails, with the possibility of replies, forwards and blind carbon copies (BCC). We study the epistemic consequences of such email exchanges by introducing an appropriate epistemic language and semantics. This allows us to

  20. Common knowledge in email exchanges

    NARCIS (Netherlands)

    Sietsma, F.; Apt, K.R.

    2011-01-01

    We consider a framework in which a group of agents communicates by means of emails, with the possibility of replies, forwards and blind carbon copies (BCC). We study the epistemic consequences of such email exchanges by introducing an appropriate epistemic language and semantics. This allows us to