Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
DEFF Research Database (Denmark)
Jakobsen, Martin Roelsgaard; Tolstrup, M; Bertelsen, L
2007-01-01
on real-time PCR and amplification refractory mutation system (ARMS). RESULTS: The 103N and 184V mutations were not detected in patients with stable low viremia. Patients previously exposed to mono or dual therapy often carried minor viral populations of either one or both mutations in plasma. The viral......BACKGROUND: Viral populations defined by 103K/N and 184M/V as linked or single mutations in the HIV-1 reverse transcriptase gene were investigated in plasma samples and compared with previous findings in the CD45RO(+)T cell compartment. OBJECTIVE: To develop an ARMS assay for plasma virions...... an unequal distribution of linked-mutation populations in plasma and CD45RO(+)T cells. Furthermore, the linked 103N-184V mutation may be more fit than the single 184V mutation and this linked population emerges rapidly under inadequate drug pressure. Udgivelsesdato: 2007-Jul...
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Aulicino, Paula C; Rocco, Carlos A; Mecikovsky, Debora; Bologna, Rosa; Mangano, Andrea; Sen, Luisa
2010-01-01
Patterns and pathways of HIV type-1 (HIV-1) antiretroviral (ARV) drug resistance-associated mutations in clinical isolates are conditioned by ARV history and factors such as viral subtype and fitness. Our aim was to analyse the frequency and association of ARV drug resistance mutations in a group of long-term vertically infected patients from Argentina. Plasma samples from 71 patients (38 children and 33 adolescents) were collected for genotypic HIV-1 ARV resistance testing during the period between February 2006 and October 2008. Statistically significant pairwise associations between ARV resistance mutations in pol, as well as associations between mutations and drug exposure, were identified using Fisher's exact tests with Bonferroni and false discovery rate corrections. Phylogenetic analyses were performed for subtype assignment. In protease (PR), resistance-associated mutations M46I/L, I54M/L/V/A/S and V82A/F/T/S/M/I were associated with each other and with minor mutations at codons 10, 24 and 71. Mutations V82A/F/T/S/M/I were primarily selected by the administration of ritonavir (RTV) in an historical ARV regimen. In reverse transcriptase, thymidine analogue mutation (TAM)1 profile was more common than TAM2. The non-nucleoside K103N+L100I mutations were observed at high frequency (15.5%) and were significantly associated with the nucleoside mutation L74V in BF recombinants. Associations of mutations at PR sites reflect the frequent use of RTV at an early time in this group of patients and convergent resistance mechanisms driven by the high exposure to protease inhibitors, as well as local HIV-1 diversity. The results provide clinical evidence of a molecular interaction between K103N+L100I and L74V mutations at the reverse transcriptase gene in vivo, limiting the future use of second-generation non-nucleoside reverse transcriptase inhibitors such as etravirine.
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
Picchio, Gaston R; Rimsky, Laurence T; Van Eygen, Veerle; Haddad, Mojgan; Napolitano, Laura A; Vingerhoets, Johan
2014-01-01
The prevalence of rilpivirine resistance-associated mutations (RAMs) in the USA, and their effect on phenotypic susceptibility to rilpivirine and etravirine, was evaluated in clinical samples from HIV-1-infected patients. In total, 15,991 samples submitted to Monogram Biosciences (South San Francisco, CA, USA) for routine resistance testing between January 2010 and June 2011 were assessed for the presence of known rilpivirine RAMs K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, Y188L, H221Y, F227C and M230I/L; non-nucleoside reverse transcriptase inhibitor (NNRTI) RAMs K103N, L100I and L100I+K103N; and the nucleoside reverse transcriptase inhibitor (NRTI) RAMs M184I/V and their combinations with rilpivirine RAMs. Phenotypic susceptibility (PhenoSenseGT(®) assay; Monogram Biosciences) was evaluated, with reduced susceptibility defined as fold change (FC) in 50% inhibitory concentration (IC50)>2.0 for rilpivirine and FC>2.9 for etravirine. Of the 15,991 samples, 17% harboured ≥1 rilpivirine RAMs. The prevalence of most rilpivirine RAMs and combinations of NNRTI RAMs of interest was low (≤3%), except for Y181C (7%). Rilpivirine RAMs were often associated with reduced rilpivirine phenotypic susceptibility. Median FC values >2.0 were observed for clinical isolates with rilpivirine RAMs K101P, E138Q/R, Y181C/I/V, Y188L or M230L, and for the combination of E138K with M184I/V, and K101E with M184I. Most rilpivirine FC values >2.0 were associated with etravirine FC values >2.9 for individual rilpivirine RAMs and those combined with M184I/V. There was no relationship between the presence of K103N and rilpivirine FC. However, the L100I+K103N combination (without rilpivirine RAMs), at 2.0. Based on 15,991 US clinical samples from HIV-1-infected patients, the frequency of most known rilpivirine RAMs apart from Y181C was low.
Rachman, B. E.; Khairunisa, S. Q.; Witaningrum, A. M.; Yunifiar, M. Q.; Widiyanti, P.; Nasronudin
2018-03-01
Increased use of antiretroviral therapy did not completely reduce the incidence of HIV/AIDShospitalization. Various factors can be involved. The aim of this study is to examine HIV-1 drug resistance mutations profile in drug-treated HIV/AIDS patients who underwent hospitalization. HIV/AIDS patients who are admitted to hospital who had received ART are included in the study and then examined for the presence of drug resistance-associated mutations. A total of 17 samples were included in the study, but only 11 samples that could be sequence analyzed. On the mutation examination of drug resistance in reverse transcriptase gene, it werefound a major mutation in K103N (9%) and G190A (9%). Most minor mutations were found in A98S (18.1%), followed by M41L, M184V, L210W, T215Y, V108l, Y181C and H221Y at 9% each. Whereas, on examination of drug resistance mutations in protease genes, there is a major mutation in I84V of 9%. Most minor mutations on M36I (45.4%), followed by L10I (36.3%), H69K (36.3%), I93L (27.2%), G16E, L89M, K20R 18.1%, L64V and V771I 9% respectively.A large number of mutated samples pose a challenge in long-term antiretroviral treatment, so a breakthrough policy is needed to minimize the impact.
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)
2017-12-15
Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis
2013-12-23
At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
Directory of Open Access Journals (Sweden)
Jie Xu
Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki
2014-01-01
Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake
2017-11-22
Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.
International Nuclear Information System (INIS)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin
2008-01-01
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
Measurement of the Ec.m.=184 keV Resonance Strength in the 26gAl(p,γ)27Si Reaction
International Nuclear Information System (INIS)
Ruiz, C.; Buchmann, L.; Caggiano, J. A.; Davids, B.; Davis, C.; Hutcheon, D.A.; Olin, A.; Ottewell, D.F.; Ruprecht, G.; Trinczek, M.; Vockenhuber, C.; Parikh, A.; Clark, J.A.; Deibel, C.; Lewis, R.; Parker, P.; Wrede, C.; Jose, J.; Chen, A.A.; Ouellet, C.V.
2006-01-01
The strength of the E c.m. =184 keV resonance in the 26g Al(p,γ) 27 Si reaction has been measured in inverse kinematics using the DRAGON recoil separator at TRIUMF's ISAC facility. We measure a value of ωγ=35±7 μeV and a resonance energy of E c.m. =184±1 keV, consistent with p-wave proton capture into the 7652(3) keV state in 27 Si, and discuss the implications of these values for 26g Al nucleosynthesis in typical oxygen-neon white-dwarf novae
Update on HIV-1 acquired and transmitted drug resistance in Africa.
Ssemwanga, Deogratius; Lihana, Raphael W; Ugoji, Chinenye; Abimiku, Alash'le; Nkengasong, John; Dakum, Patrick; Ndembi, Nicaise
2015-01-01
The last ten years have witnessed a significant scale-up and access to antiretroviral therapy in Africa, which has improved patient quality of life and survival. One major challenge associated with increased access to antiretroviral therapy is the development of antiretroviral resistance due to inconsistent drug supply and/or poor patient adherence. We review the current state of both acquired and transmitted drug resistance in Africa over the past ten years (2001-2011) to identify drug resistance associated with the different drug regimens used on the continent and to help guide affordable strategies for drug resistance surveillance. A total of 161 references (153 articles, six reports and two conference abstracts) were reviewed. Antiretroviral resistance data was available for 40 of 53 African countries. A total of 5,541 adult patients from 99 studies in Africa were included in this analysis. The pooled prevalence of drug resistance mutations in Africa was 10.6%, and Central Africa had the highest prevalence of 54.9%. The highest prevalence of nucleoside reverse transcriptase inhibitor mutations was in the west (55.3%) and central (54.8%) areas; nonnucleoside reverse transcriptase inhibitor mutations were highest in East Africa (57.0%) and protease inhibitors mutations highest in Southern Africa (16.3%). The major nucleoside reverse transcriptase inhibitor mutation in all four African regions was M184V. Major nonnucleoside reverse transcriptase inhibitor as well as protease inhibitor mutations varied by region. The prevalence of drug resistance has remained low in several African countries although the emergence of drug resistance mutations varied across countries. Continued surveillance of antiretroviral therapy resistance remains crucial in gauging the effectiveness of country antiretroviral therapy programs and strategizing on effective and affordable strategies for successful treatment.
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
Directory of Open Access Journals (Sweden)
Barbara A Rath
Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
LENUS (Irish Health Repository)
Bansode, Vijay B
2011-10-13
Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
DEFF Research Database (Denmark)
Mohey, Rajesh; Jørgensen, Anne Louise; Møller, Bjarne K
2005-01-01
and incorporation of resistant forms in the long-lived CD4+ T cellular DNA compartment is not clear. Objective To investigate the relationship between lamivudine associated mutant-type 184V and the wild-type 184M proviral forms in the circulating CD4+ T cells of patients and low-level viremia. Study design Cross-sectional......Background Highly active anti-retroviral therapy (HAART) effectively reduces HIV replication but does not completely hinder it. Sub-optimal therapy leads to HIV resistance to the drugs administered. However, the role of low-level viremia (viral-load less than 1000 copies/ml) on mutation genesis...... study of 50 patients on long-term HAART, with a viremia of less than 1000 copies/ml. Patients were stratified into three groups; on lamivudine, group I (viral load
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Directory of Open Access Journals (Sweden)
Crumpacker Clyde S
2011-01-01
Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
International Nuclear Information System (INIS)
Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong
2005-01-01
The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
Directory of Open Access Journals (Sweden)
Benedikt B Kaufer
2011-10-01
Full Text Available Telomerase reverse transcriptase (TERT and telomerase RNA (TR represent the enzymatically active components of telomerase. In the complex, TR provides the template for the addition of telomeric repeats to telomeres, a protective structure at the end of linear chromosomes. Human TR with a mutation in the template region has been previously shown to inhibit proliferation of cancer cells in vitro. In this report, we examined the effects of a mutation in the template of a virus encoded TR (vTR on herpesvirus-induced tumorigenesis in vivo. For this purpose, we used the oncogenic avian herpesvirus Marek's disease virus (MDV as a natural virus-host model for lymphomagenesis. We generated recombinant MDV in which the vTR template sequence was mutated from AATCCCAATC to ATATATATAT (vAU5 by two-step Red-mediated mutagenesis. Recombinant viruses harboring the template mutation replicated with kinetics comparable to parental and revertant viruses in vitro. However, mutation of the vTR template sequence completely abrogated virus-induced tumor formation in vivo, although the virus was able to undergo low-level lytic replication. To confirm that the absence of tumors was dependent on the presence of mutant vTR in the telomerase complex, a second mutation was introduced in vAU5 that targeted the P6.1 stem loop, a conserved region essential for vTR-TERT interaction. Absence of vTR-AU5 from the telomerase complex restored virus-induced lymphoma formation. To test if the attenuated vAU5 could be used as an effective vaccine against MDV, we performed vaccination-challenge studies and determined that vaccination with vAU5 completely protected chickens from lethal challenge with highly virulent MDV. Taken together, our results demonstrate 1 that mutation of the vTR template sequence can completely abrogate virus-induced tumorigenesis, likely by the inhibition of cancer cell proliferation, and 2 that this strategy could be used to generate novel vaccine candidates
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin
2017-01-01
Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
Directory of Open Access Journals (Sweden)
Serge C Billong
Full Text Available BACKGROUND: Scale-up of antiretroviral therapy (ART in resource-limited settings has drastically reduced HIV-related morbidity and mortality. However, challenges in long-term ART, adherence and HIV drug resistance (HIVDR itself, require monitoring to limit HIVDR emergence among ART-experienced populations, in order to ensure regimen efficacy. METHODS: A longitudinal study was conducted from 2009-2011 in a cohort of 141 HIV-infected adult patients (aged >21 at the national social insurance centre hospital in Yaounde, Cameroon. As per-WHO HIVDR protocol, HIV-1 protease-reverse transcriptase genotyping was performed at baseline and at endpoint (12 months on first-line ART using ViroSeq™ Genotyping kit. RESULTS: At baseline, a prevalence of 3.6% (5/139 HIVDR was observed [protease inhibitors M46I (1/5, G73A (1/5, L90LM (1/5; nucleoside reverse transcriptase inhibitors: M184V (1/5, T215F (1/5; non-nucleoside reverse transcriptase inhibitors: K103N (1/5, Y181Y/C (2/5, M230ML (1/5]. At endpoint, 54.0% (76 patients were followed-up, 9.2% (13 died, and 3.5% (5 transferred, 38.5% (47 lost to follow-up (LTFU. 69.7% (53/76 of those followed-up had viremia <40 copies/ml and 90.8% (69/76 <1000 copies/ml. 4/7 patients with viremia ≥1000 copies/ml harbored HIVDR (prevalence: 5.3%; 4/76, with M184V/I (4/4 and K103K/N (3/4 being the most prevalent mutations. LTFU was favored by costs for consultation/laboratory tests, drug shortages, workload (physician/patient ratio: 1/180 and community disengagement. CONCLUSIONS: Low levels of HIVDR at baseline and at endpoint suggest a probable effectiveness of ART regimens used in Cameroon. However the possible high rate of HIVDR among LTFUs limited the strengths of our findings. Evaluating HIVDR among LTFU, improving adherence, task shifting, subsidizing/harmonizing costs for routine follow-up, are urgent measures to ensure an improved success of the country ART performance.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
Mukerji, Shibani S; Misra, Vikas; Lorenz, David R; Uno, Hajime; Morgello, Susan; Franklin, Donald; Ellis, Ronald J; Letendre, Scott; Gabuzda, Dana
2018-04-03
Cerebrospinal fluid (CSF) viral escape occurs in 4-20% of HIV-infected adults, yet the impact of antiretroviral therapy (ART) on CSF escape is unclear. Prospective study of 1063 participants with baseline plasma viral load (VL) ≤400 copies/ml between 2005-2016. Odds ratio for ART regimens (PI with nucleoside reverse transcriptase inhibitor [PI+NRTI] versus other ART) and CSF escape was estimated using mixed-effects models. Drug resistance mutation frequencies were calculated. Baseline mean age was 46, median plasma VL, CD4 nadir, and CD4 count were 50 copies/mL, 88 cells/μL, and 424 cells/μL, respectively; 48% on PI+NRTI, 33% on non-NRTI, and 6% on integrase inhibitors. During median follow-up of 4.4 years, CSF escape occurred in 77 participants (7.2%). PI+NRTI use was an independent predictor of CSF escape (OR 3.1 [95% CI 1.8-5.0]) in adjusted analyses and models restricted to plasma VL ≤50 copies/ml (pCSF viral escape than non-ATV PI+NRTI regimens. Plasma and CSF M184V/I combined with thymidine-analog mutations were more frequent in CSF escape versus no escape (23% vs. 2.3%). Genotypic susceptibility score-adjusted CNS penetration-effectiveness (CPE) values were calculated for CSF escape with M184V/I mutations (n=34). Adjusted CPE values were low (CSF and plasma in 27 (79%) and 13 (38%), respectively, indicating suboptimal CNS drug availability. PI+NRTI regimens are independent predictors of CSF escape in HIV-infected adults. Reduced CNS ART bioavailability may predispose to CSF escape in patients with M184V/I mutations. Optimizing ART regimens may reduce risk of CSF escape.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
Mou, Yi; Athar, Muhammad Ammar; Wu, Yuzhen; Xu, Ye; Wu, Jianhua; Xu, Zhenxing; Hayder, Zulfiqar; Khan, Saeed; Idrees, Muhammad; Nasir, Muhammad Israr; Liao, Yiqun; Li, Qingge
2016-11-01
Detection of anti-hepatitis B virus (HBV) drug resistance mutations is critical for therapeutic decisions for chronic hepatitis B virus infection. We describe a real-time PCR-based assay using multicolor melting curve analysis (MMCA) that could accurately detect 24 HBV nucleotide mutations at 10 amino acid positions in the reverse transcriptase region of the HBV polymerase gene. The two-reaction assay had a limit of detection of 5 copies per reaction and could detect a minor mutant population (5% of the total population) with the reverse transcriptase M204V amino acid mutation in the presence of the major wild-type population when the overall concentration was 10 4 copies/μl. The assay could be finished within 3 h, and the cost of materials for each sample was less than $10. Clinical validation studies using three groups of samples from both nucleos(t)ide analog-treated and -untreated patients showed that the results for 99.3% (840/846) of the samples and 99.9% (8,454/8,460) of the amino acids were concordant with those of Sanger sequencing of the PCR amplicon from the HBV reverse transcriptase region (PCR Sanger sequencing). HBV DNA in six samples with mixed infections consisting of minor mutant subpopulations was undetected by the PCR Sanger sequencing method but was detected by MMCA, and the results were confirmed by coamplification at a lower denaturation temperature-PCR Sanger sequencing. Among the treated patients, 48.6% (103/212) harbored viruses that displayed lamivudine monoresistance, adefovir monoresistance, entecavir resistance, or lamivudine and adefovir resistance. Among the untreated patients, the Chinese group had more mutation-containing samples than did the Pakistani group (3.3% versus 0.56%). Because of its accuracy, rapidness, wide-range coverage, and cost-effectiveness, the real-time PCR assay could be a robust tool for the detection if anti-HBV drug resistance mutations in resource-limited countries. Copyright © 2016, American Society for
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Directory of Open Access Journals (Sweden)
Dieter Hoffmann
Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002
Directory of Open Access Journals (Sweden)
Watitpun Chotip
2003-03-01
Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.
Directory of Open Access Journals (Sweden)
Rami Kantor
2005-04-01
Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.
Directory of Open Access Journals (Sweden)
Art F Y Poon
Full Text Available Human immunodeficiency virus type 1 (HIV-1 genomes often carry one or more mutations associated with drug resistance upon transmission into a therapy-naïve individual. We assessed the prevalence and clinical significance of transmitted drug resistance (TDR in chronically-infected therapy-naïve patients enrolled in a multi-center cohort in North America. Pre-therapy clinical significance was quantified by plasma viral load (pVL and CD4+ cell count (CD4 at baseline. Naïve bulk sequences of HIV-1 protease and reverse transcriptase (RT were screened for resistance mutations as defined by the World Health Organization surveillance list. The overall prevalence of TDR was 14.2%. We used a Bayesian network to identify co-transmission of TDR mutations in clusters associated with specific drugs or drug classes. Aggregate effects of mutations by drug class were estimated by fitting linear models of pVL and CD4 on weighted sums over TDR mutations according to the Stanford HIV Database algorithm. Transmitted resistance to both classes of reverse transcriptase inhibitors was significantly associated with lower CD4, but had opposing effects on pVL. In contrast, position-specific analyses of TDR mutations revealed substantial effects on CD4 and pVL at several residue positions that were being masked in the aggregate analyses, and significant interaction effects as well. Residue positions in RT with predominant effects on CD4 or pVL (D67 and M184 were re-evaluated in causal models using an inverse probability-weighting scheme to address the problem of confounding by other mutations and demographic or risk factors. We found that causal effect estimates of mutations M184V/I (-1.7 log₁₀pVL and D67N/G (-2.1[³√CD4] and 0.4 log₁₀pVL were compensated by K103N/S and K219Q/E/N/R. As TDR becomes an increasing dilemma in this modern era of highly-active antiretroviral therapy, these results have immediate significance for the clinical management of HIV-1
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
DEFF Research Database (Denmark)
Thomassen, Mads; Pedersen, Inge Søkilde; Vogel, Ida
2011-01-01
Inherited mutations in the tumor suppressor genes BRCA1 and BRCA2 predispose carriers to breast and ovarian cancer. The authors have identified a mutation in BRCA2, 7845+1G>A (c.7617+1G>A), not previously regarded as deleterious because of incorrect mapping of the splice junction in the originally...... published genomic reference sequence. This reference sequence is generally used in many laboratories and it maps the mutation 16 base pairs inside intron 15. However, according to the recent reference sequences the mutation is located in the consensus donor splice sequence. By reverse transcriptase analysis......, loss of exon 15 in the final transcript interrupting the open reading frame was demonstrated. Furthermore, the mutation segregates with a cancer phenotype in 18 Danish families. By genetic analysis of more than 3,500 Danish breast/ovarian cancer risk families, the mutation was identified as the most...
TERT promoter mutations are highly recurrent in SHH subgroup medulloblastoma
M. Remke (Marc); E.A. Ramaswamy; M. Peacock (Munro); D.J.H. Shih (David J.); C. Koelsche (Christian); P.A. Northcott (Paul A.); N. Hill (Nadia); S. Cavalli (Silvia); M. Kool (Marcel); X. Wang (Xin); S. Mack (Stephen); M. Barszczyk (Mark); A.S. Morrissy (A. Sorana); X. Wu (Xiaochong); S. Agnihotri (Sameer); P. Luu (Phan); D. Jones (David); L. Garzia (Livia); A.M. Dubuc (Adrian); N. Zhukova (Nataliya); R. Vanner (Robert); J.M. Kros (Johan); P.J. French (Pim); E.G. van Meir (Erwin); R. Vibhakar (Rajeev); K. Zitterbart (Karel); J.A. Chan (Jennifer); L. Bognár (László); A. Klekner (Almos); B. Lach (Boleslaw); S. Jung (Shin); F. Saad (Fred); L.M. Liau (Linda); S. Albrecht (Steffen); M. Zollo (Maurizio); M.K. Cooper (Michael); R.C. Thompson (Reid); O. Delattre (Olivier); F. Bourdeaut (Franck); F.F. Doz (François); M. Garami (Miklós); P. Hauser (Peter); C.G. Carlotti (Carlos); T.E. Van Meter (Timothy); L. Massimi (Luca); D. Fults (Daniel); L.W. Pomeroy (Laura); T. Kumabe (Toshiro); Y.S. Ra (Young Shin); J.R. Leonard (Jeffrey); S.K. Elbabaa (Samer); J. Mora (Jaume); J.B. Rubin (Joshua); Y.-J. Cho (Yoon-Jae); R.E. McLendon (Roger); D.D. Bigner (Darell); C.G. Eberhart (Charles); M. Fouladi (Maryam); R.J. Wechsler-Reya (Robert); R. Faria (Rui); S.E. Croul (Sidney); A. Huang (Anding); E. Bouffet (Eric); C.E. Hawkins (Cynthia); M. Dirks (Maaike); W.A. Weiss (William); U. Schüller (Ulrich); A. Pollack (Aaron); P. Rutkowski (Piotr); D. Meyronet (David); A. Jouvet (Anne); M. Fèvre-Montange (Michelle); N. Jabado (Nada); M. Perek-Polnik (Marta); W.A. Grajkowska (Wieslawa); S.-K. Kim (Seung-Ki); J.T. Rutka (James); E. Malkin (Elissa); U. Tabori (Uri); S.M. Pfister (Stefan); A. Korshunov (Andrey); A. von Deimling (Andreas); M.D. Taylor (Michael)
2013-01-01
textabstractTelomerase reverse transcriptase (TERT) promoter mutations were recently shown to drive telomerase activity in various cancer types, including medulloblastoma. However, the clinical and biological implications of TERT mutations in medulloblastoma have not been described. Hence, we sought
Directory of Open Access Journals (Sweden)
Elmi Abar Aden
2012-10-01
Full Text Available Abstract In this study we report the prevalence of antiretroviral drug resistant HIV-1 genotypes of virus isolated from Djiboutian patients who failed first-line antiretroviral therapy (ART and from ART naïve patients. Patients and methods A total of 35 blood samples from 16 patients who showed first-line ART failure (>1000 viral genome copies/ml and 19 ART-naïve patients were collected in Djibouti from October 2009 to December 2009. Both the protease (PR and reverse transcriptase (RT genes were amplified and sequenced using National Agency for AIDS Research (ANRS protocols. The Stanford HIV database algorithm was used for interpretation of resistance data and genotyping. Results Among the 16 patients with first-line ART failure, nine (56.2% showed reverse transcriptase inhibitor-resistant HIV-1 strains: two (12.5% were resistant to nucleoside (NRTI, one (6.25% to non-nucleoside (NNRTI reverse transcriptase inhibitors, and six (37.5% to both. Analysis of the DNA sequencing data indicated that the most common mutations conferring drug resistance were M184V (38% for NRTI and K103N (25% for NNRTI. Only NRTI primary mutations K101Q, K103N and the PI minor mutation L10V were found in ART naïve individuals. No protease inhibitor resistant strains were detected. In our study, we found no detectable resistance in ∼ 44% of all patients who experienced therapeutic failure which was explained by low compliance, co-infection with tuberculosis and malnutrition. Genotyping revealed that 65.7% of samples were infected with subtype C, 20% with CRF02_AG, 8.5% with B, 2.9% with CRF02_AG/C and 2.9% with K/C. Conclusion The results of this first study about drug resistance mutations in first-line ART failures show the importance of performing drug resistance mutation test which guides the choice of a second-line regimen. This will improve the management of HIV-infected Djiboutian patients. Virtual slides The virtual slide(s for this article can be found
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Etiebet, Mary-Ann A; Shepherd, James; Nowak, Rebecca G; Charurat, Man; Chang, Harry; Ajayi, Samuel; Elegba, Olufunmilayo; Ndembi, Nicaise; Abimiku, Alashle; Carr, Jean K; Eyzaguirre, Lindsay M; Blattner, William A
2013-02-20
In resource-limited settings, HIV-1 drug resistance testing to guide antiretroviral therapy (ART) selection is unavailable. We retrospectively conducted genotypic analysis on archived samples from Nigerian patients who received targeted viral load testing to confirm treatment failure and report their drug resistance mutation patterns. Stored plasma from 349 adult patients on non-nucleoside reverse transcriptase inhibitor (NNRTI) regimens was assayed for HIV-1 RNA viral load, and samples with more than 1000 copies/ml were sequenced in the pol gene. Analysis for resistance mutations utilized the IAS-US 2011 Drug Resistance Mutation list. One hundred and seventy-five samples were genotyped; the majority of the subtypes were G (42.9%) and CRF02_AG (33.7%). Patients were on ART for a median of 27 months. 90% had the M184V/I mutation, 62% had at least one thymidine analog mutation, and 14% had the K65R mutation. 97% had an NNRTI resistance mutation and 47% had at least two etravirine-associated mutations. In multivariate analysis tenofovir-based regimens were less likely to have at least three nucleoside reverse transcriptase inhibitor (NRTI) mutations after adjusting for subtype, previous ART, CD4, and HIV viral load [P < 0.001, odds ratio (OR) 0.04]. 70% of patients on tenofovir-based regimens had at least two susceptible NRTIs to include in a second-line regimen compared with 40% on zidovudine-based regimens (P = 0.04, OR = 3.4). At recognition of treatment failure, patients on tenofovir-based first-line regimens had fewer NRTI drug-resistant mutations and more active NRTI drugs available for second-line regimens. These findings can inform strategies for ART regimen sequencing to optimize long-term HIV treatment outcomes in low-resource settings.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Directory of Open Access Journals (Sweden)
Lizeth Taylor-Castillo
2005-12-01
Full Text Available INTRODUCTION: Information about HIV phenotypes of resistant to available ART and the influence of different risk factors on virological failures (VF in Costa Rican HIV positive patients prior or during HAART is unknown. MATERIALS AND METHODS: Eighty nine samples, 72 VF and 17 basal (before treatment were analyzed by examining resistant mutants in reverse transcriptase (RT and protease (PT regions using Trugene or LIPA genotyping kits. Sixty eight control patients were selected and relevant information was collected in a questionnaire. RESULTS: Poor adherence, presence of resistant mutations and number of treatment's changes were the only significant factors found (p = 0.006, 0.04 and 0.01 respectively. From 66 sequenced samples, 78%, 50% and 50% showed resistance to NRTI (nucleoside reverse transcriptase inhibitors, NNRT (non-nucleoside reverse transcriptase inhibitors and PI (protease inhibitors, respectively. The most frequent mutations were M41L, M184V, and T215FY in RT and L62PI, L10FIRV and M36I in PT. DISCUSSION: The most important factor related to treatment response in this study was adherence to treatment. Mutations in RT were related to the treatment failure while the ones found in PT were secondary mutations which have been previously described to influence the selection of primary resistance mutations in these regions. The study reveals the urgency to detect resistant mutations in VF to be considered by physicians for selection of treatment schedule, to analyze basal HIV patients for monitoring of the spread of resistant mutations and the importance to reinforce the adherence in the patients for overall treatment outcome.En Costa Rica no se tiene información a cerca de genotipos de resistencia para los tratamientos anti-retrovirales disponibles y la influencia de diferentes factores de riego en la falla virológica (FV de pacientes VIH positivos previo o durante su tratamiento. Ochenta y nueve muestras, 72 FV y 17 basales, fueron
Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X
2014-07-01
Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.
DEFF Research Database (Denmark)
Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels
2011-01-01
Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...
DEFF Research Database (Denmark)
Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels
2011-01-01
Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
HIV genotype resistance testing in antiretroviral (ART) exposed Indian children--a need of the hour.
Shah, Ira; Parikh, Shefali
2013-04-01
Development of drug resistance in HIV infected children with treatment failure is a major impediment to selection of appropriate therapy. HIV genotype resistance assays predict drug resistance on the basis of mutations in the viral genome. However, their clinical utility, especially in a resource limited setting is still a subject of debate. The authors report two cases in which both the children suffered from treatment failure of various antiretroviral therapy regimes. In both the cases, Genotype Resistance Testing (GRT) prompted a radical change from proposed failure therapy as per existing guidelines. GRT was specifically important for the selection of a new dual Nucleoside reverse transcriptase inhibitors (NRTI) component of failure regimen by identifying TAMS and M184V mutations in the HIV genome. These case reports highlight the importance of GRT in children failing multiple antiretroviral regimes; and emphasizes the need to recognize situations where GRT is absolutely essential to guide appropriate therapy, even in a resource limited setting.
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Energy Technology Data Exchange (ETDEWEB)
Desviat, L.R.; Perez, B.; De Lucca, M. [Universidad Autonoma de Madrid, (Spain)] [and others
1995-08-01
Phenylketonuria mutation V388M is frequent in the Iberian Peninsula. In vitro, the V388M mutant enzyme has similar immunoreactive protein and phenylalanine hydroxylase mRNA and had 43% residual activity, which correlates well with the mild phenotype exhibited by the homozygous patients. In Spain it has been detected in 5.7% of the mutant alleles and is always associated with haplotype 1.7. This mutation is also present in high frequency in some Latin American countries (Brazil, 9% Chile, 13%). It is interesting that in Chile most of the alleles bearing this mutation carry haplotype 4.3, although in Brazil it is found only on the background of haplotype 1.7. The origin of V388M in Spain on haplotype 1.7 and in Chile on haplotype 4.3 is clearly different. Recurrence is the most plausible explanation, because the mutation involves a CpG dinucleotide, and a recombination event transferring the mutation from haplotype 1 to 4 is unlikely. 29 refs., 2 figs., 3 tabs.
Enthesitis in a 16-Year-Old Boy with M694V Mutation
Directory of Open Access Journals (Sweden)
Syert Luidolf Nienhuis
2016-01-01
Full Text Available Introduction. FMF (Familial Mediterranean Fever is characterized by recurrent attacks of fever and articular pain. Enthesitis is the hallmark of pain in spondyloarthropathy. Literature suggests association of M694V mutation and enthesitis. We report a case of a 16-year-old boy with enthesitis and FMF. Case Presentation. A 16-year-old boy of Turkish origin with a history of FMF presented with localized tenderness of the heel and severe disability. MRI showed an enthesitis of the plantar fascia. Standard treatment of FMF and enthesitis was not successful. After referral to a university hospital and expert opinion of a professor in rheumatology, this enthesitis should be treated as an enthesitis related arthritis. With this treatment, our patient fully recovered 8 months after the onset of the disease symptoms. Conclusion. M694V mutation related enthesitis should be considered in FMF patients with enthesitis. We would suggest treatment for enthesitis related arthritis in similar cases. This is of clinical importance because the treatment is different from treatment of enthesitis or articular pain caused by FMF.
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Directory of Open Access Journals (Sweden)
Luis E. Soto-Ramirez
2010-01-01
Full Text Available Our goal was to describe the presence of HIV drug resistance among HIV-1-infected, antiretroviral (ARV naïve children and adolescents in Latin America and to examine resistance in these children in relation to drug exposure in the mother. Genotyping was performed on plasma samples obtained at baseline from HIV-1-infected participants in a prospective cohort study in Brazil, Argentina, and Mexico (NISDI Pediatric Study. Of 713 HIV-infected children enrolled, 69 were ARV naïve and eligible for the analysis. At enrollment, mean age was 7.3 years; 81.2% were infected with HIV perinatally. Drug resistance mutations (DRMs were detected in 6 (8.7%; 95% confidence interval 3.1–18.2% ARV-naïve subjects; none of the mothers of these 6 received ARVs during their pregnancies and none of the children received ARV prophylaxis. Reverse transcriptase mutations K70R and K70E were detected in 3 and 2 subjects, respectively; protease mutation I50 V was detected in 1 subject. Three of the 6 children with DRMs initiated ARV therapy during followup, with a good response in 2. The overall rate of primary drug resistance in this pediatric HIV-infected population was low, and no subjects had more than 1 DRM. Mutations associated with resistance to nucleoside reverse transcriptase inhibitors were the most prevalent.
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong
2018-01-01
As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick C K; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher K C; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance - Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥ 2 TAMs; or M184V+≥ 1 TAM. Virological suppression was defined as viral load (VL) failure and (2) factors associated with virological suppression after 12 months on second-line. A total of 105 patients from 10 sites in Thailand, Hong Kong, Indonesia, Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥ 1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥ 2 TAMs; and 32 with M184V+≥ 1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤ 200 cells/µL at genotyping (OR=4.43, 95% CI [1.59-12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39-16.36], pfailure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving virological response. This emphasizes the importance of continued adherence counselling well into second-line therapy.
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Directory of Open Access Journals (Sweden)
Petrova Anna
2007-07-01
Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n
On the 1285,0 keV; 55-184WW state structure
International Nuclear Information System (INIS)
Kupryashkin, V.T.; Muzalev, P.N.; Feoktistov, A.I.
1977-01-01
The structure of the 184 W (1285.0 keV; 5 - ) states is discussed. Decay of this level is shown schematically. The data on multiplicities and probabilities of the γ-transitions for the levels 1285.0 keV; 5 - of 184 W and 1621.4 keV; 5 - of 182 W are presented. The transition amplitude parameters are plotted for different probabilities B(E3;5 - → I + ). The relation between the collective transition amplitudes is established. Transition amplitude parameters and their collective and two-particle components, as well as impurity amplitudes of collective excitation wave functions and matrix elements are given
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
DEFF Research Database (Denmark)
Jørgensen, Louise B; Christensen, Marianne B; Gerstoft, Jan
2003-01-01
The aim of this study was to monitor the prevalence of drug resistance mutations in newly diagnosed HIV-1 positive individuals in Denmark. In addition we assessed the prevalence of non-B subtypes based on phylogenetic analysis of the pol gene. Plasma samples from 104 newly diagnosed HIV-1 positive...... patients were obtained in the year 2000. The entire protease gene and 320 amino acids of the reverse transcriptase gene were genotyped. Sequences were obtained from 97 patients. No subjects displayed primary resistance mutations in the protease gene, whereas all carried 1 or more secondary mutations....... Resistance mutations in the RT-gene associated with NRTI-resistance were found in 1 patient, who was infected with zidovudine resistant HIV-1 harbouring the M41L mutation in combination with T215S and L210S. The T215S mutation has been showed to be associated with reversion of zidovudine resistance. The T215...
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
Directory of Open Access Journals (Sweden)
Ying Zhou
2016-01-01
Full Text Available Antiretroviral therapy (ART has been shown to improve survival of patients with Human Immunodeficiency Virus (HIV infection and to reduce HIV-1 transmission. Therefore, the Chinese central government initiated a national program to provide ART free of charge to HIV-1 patients. We conducted a cross-sectional survey in Jiangsu province to determine the level of drug resistance (DR in HIV-1 infected patients and the correlates of DR in virological failures in 2012. Approximately 10.4% of the HIV-1 patients in the study experienced virological failure after one year of ART and were divided into drug sensitive and drug resistant groups based on genotype determination. The viral loads (VLs in the drug resistant group were significantly lower than the drug sensitive group. There were two independent predictors of virological failure: male gender and increasing duration of treatment. The primary mutations observed in the study were against nucleoside reverse transcriptase inhibitors (NRTIs which were M184V (79.45% and K103N (33.70% in nonnucleoside reverse transcriptase inhibitors (NNRTIs. The overall rate of DR in Jiangsu province is still relatively low among treated patients. However, close monitoring of drug resistance in male patients in the early stages of treatment is vital to maintaining and increasing the benefits of HIV ART achieved to date.
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Directory of Open Access Journals (Sweden)
İpek Yönal
2016-05-01
Full Text Available Objective: The JAK2V617F mutation is present in the majority of patients with essential thrombocythemia (ET and primary myelofibrosis (PMF. The impact of this mutation on disease phenotype in ET and PMF is still a matter of discussion. This study aims to determine whether there are differences in clinical presentation and disease outcome between ET and PMF patients with and without the JAK2V617F mutation. Materials and Methods: In this single-center study, a total of 184 consecutive Philadelphia-negative chronic myeloproliferative neoplasms, 107 cases of ET and 77 cases of PMF, were genotyped for JAK2V617F mutation using the JAK2 Ipsogen MutaScreen assay, which involves allele-specific polymerase chain reaction. Results: ET patients positive for JAK2V617F mutation had higher hemoglobin (Hb and hematocrit (Hct levels, lower platelet counts, and more prevalent splenomegaly at diagnosis compared to patients negative for the JAK2V617F mutation, but rates of major thrombotic events, arterial thrombosis, and venous thrombosis were comparable between the groups. At presentation, PMF patients with JAK2V617F mutation had significantly higher Hb and Hct levels and leukocyte counts than patients without the mutation. Similar to the findings of ET patients, thromboembolic rates were similar in PMF patients with and without theJAK2V617F mutation. For ET and PMF patients, no difference was observed in rates of death with respect to JAK2V617F mutational status. Moreover, leukemic transformation rate was not different in our PMF patients with and without JAK2V617F mutation. Conclusion: We conclude that JAK2V617F-mutated ET patients express a polycythemia vera-like phenotype and JAK2V617F mutation in PMF patients is associated with a more pronounced myeloproliferative phenotype.
Study of the decay 184Hg→184Au (Tsub(1/2)=30s)
International Nuclear Information System (INIS)
Nettles, W.G.; Beraud, R.; Cole, J.D.; Hamilton, J.H.; Ramayya, A.V.; Kawakami, H.; Spejewski, E.H.
1978-01-01
The radioactive decay of 184 Hg to 184 Au was studied on line with the UNISOR isotope separator. The 184 mass chain was entered at 184 Tl and 184 Hg by bombarding an isotopically-enriched target of 180 W with 14 N ions of 177 MeV. Multiscale singles and γ-γ-time coincidence studies were carried out. No previous levels have been assigned to 184 Au. From the coincidence data eight levels at 156.2, 159.1, 247.7, 282.8, 295.1, 392.4, 418.0 and 412.4 keV are assigned and two tentative levels at 534.0 and 551.6 keV are proposed. By using the delayed coincidence technique, a half-life of 36+-6 nanoseconds was measured for the 156.2 keV first-excited level and upper limits of 2 nanoseconds were determined for the half-lives of levels at 159.1, 247.7, 295.1 and 392.4 keV [fr
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
DEFF Research Database (Denmark)
Mora, Cristina; Serzanti, Marialaura; Giacomelli, Alessio
2017-01-01
the molecular mechanisms underlying AF, we reprogrammed to pluripotency polymorphonucleated leukocytes isolated from the blood of a patient carrying a PITX2 p.M200V mutation, using a commercially available non-integrating expression system. The generated iPSCs expressed pluripotency markers and differentiated...... toward cells belonging to the three embryonic germ layers. Moreover, the cells showed a normal karyotype and retained the PITX2 p.M200V mutation....
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
Directory of Open Access Journals (Sweden)
Pedersen Niels C
2007-04-01
Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yonal-Hindilerden I
2015-06-01
Full Text Available Ipek Yonal-Hindilerden, Aynur Daglar-Aday, Basak Akadam-Teker, Ceylan Yilmaz, Meliha Nalcaci, Akif Selim Yavuz, Deniz SarginDivision of Hematology, Department of Internal Medicine, Istanbul Medical Faculty, Istanbul University, Fatih-Istanbul, Turkey Background: Despite insights into the genetic basis of Philadelphia-negative myeloproliferative neoplasms (Ph-negative MPNs, a significant proportion of essential thrombocythemia (ET and primary myelofibrosis (PMF patients present with no known MPN disease alleles. There were no previous studies investigating the impact of ASXL1 mutations in Ph-negative MPNs in Turkey. In the current study, we investigated the prognostic significance of ASXL1 mutations in Turkish MPN patients. We also aimed to determine the prognostic significance of JAK2V617F allele burden and the relationship of JAK2V617F mutation with ASXL1 mutations in Ph-negative MPNs. Methods: About 184 patients from a single center diagnosed with Ph-negative MPNs were screened for ASXL1, JAK2V617F mutations, and JAK2V617F allele burden: 107 ET and 77 PMF. Results: A total of 29 ASXL1 mutations were detected in 24.7% of PMF and 8.4% of ET patients. ASXL1-mutated ET patients showed a trend toward an increase in the incidence of cerebrovascular events and higher total leukocyte counts. ASXL1-mutation in PMF was associated with older age and a higher prevalence of bleeding complications. In univariate analysis, overall survival (OS was significantly reduced in ASXL1-mutated PMF patients. In multivariate analysis, Dynamic International Prognostic Scoring System-plus high-risk category and ASXL1 mutation status were independently associated with shorter survival in PMF. In PMF, mutational status and allele burden of JAK2V617F showed no difference in terms of OS and leukemia-free survival. Conclusion: We conclude that ASXL1 mutations are molecular predictors of short OS in PMF. Keywords: Philadelphia-negative myeloproliferative neoplasms (Ph
Ma, Xiongchao; Sun, Baozhen; Zhu, Fei
2018-02-01
This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
From bad to good: Fitness reversals and the ascent of deleterious mutations.
Directory of Open Access Journals (Sweden)
Matthew C Cowperthwaite
2006-10-01
Full Text Available Deleterious mutations are considered a major impediment to adaptation, and there are straightforward expectations for the rate at which they accumulate as a function of population size and mutation rate. In a simulation model of an evolving population of asexually replicating RNA molecules, initially deleterious mutations accumulated at rates nearly equal to that of initially beneficial mutations, without impeding evolutionary progress. As the mutation rate was increased within a moderate range, deleterious mutation accumulation and mean fitness improvement both increased. The fixation rates were higher than predicted by many population-genetic models. This seemingly paradoxical result was resolved in part by the observation that, during the time to fixation, the selection coefficient (s of initially deleterious mutations reversed to confer a selective advantage. Significantly, more than half of the fixations of initially deleterious mutations involved fitness reversals. These fitness reversals had a substantial effect on the total fitness of the genome and thus contributed to its success in the population. Despite the relative importance of fitness reversals, however, the probabilities of fixation for both initially beneficial and initially deleterious mutations were exceedingly small (on the order of 10(-5 of all mutations.
García-Guerrero, Julio; Herrero, Agustín; Vera, Enrique; Almenara, José M; Araújo, Rosa; Saurí, Vicente V; Castellano, Juan C; Fernández-Clemente, Luis; Bedia, Miguel; Llorente, María I; González-Morán, Francisco
2002-03-02
Our purpose was to determine the prevalence of mutations of resistance to nucleoside inhibitors of reverse transcriptase (NIRT) and protease inhibitors (PI) in the HIV-1 genotype of naïve infected subjects in the prisons of the Autonomous Community of Valencia, Spain. Multicentric, descriptive, cross-sectional study of prevalence including a systematic stratified and randomised sampling by centres. Demographic, clinical, virological and immunological data were collected. The HIV gene of protease and transcriptase was studied in peripheral blood plasma samples by means of double PCR amplification and subsequent automatic sequence. Reference: wild strain HXB2. Plasma was obtained from 133 individuals (119 men and 14 women). 117 samples were selected and the rest did not have enough copies for transcription. With regard to NIRT, 7 samples (5.2% of total) showed some mutation of resistance: M41L, D67N, L210W and K219Q, all them secondary to and associated with resistance to zidovudine, abacavir as well as group B multinucleoside-resistance. With regard to PI, only one sample showed a primary mutation, M46I, which was associated with resistance to indinavir. Moreover, a further 41 samples were found to express some secondary mutation. In our series, there was a low number of primary mutations of resistance. These results allow us to exclude the systematic use of resistance tests before an initiation antiretroviral therapy.
Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin
2010-01-01
The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
Young, Thomas P.; Parkin, Neil T.; Stawiski, Eric; Pilot-Matias, Tami; Trinh, Roger; Kempf, Dale J.; Norton, Michael
2010-01-01
Patterns of HIV-1 protease inhibitor (PI) resistance-associated mutations (RAMs) and effects on PI susceptibility associated with the L76V mutation were studied in a large database. Of 20,501 sequences with ≥1 PI RAM, 3.2% contained L76V; L76V was alone in 0.04%. Common partner mutations included M46I, I54V, V82A, I84V, and L90M. L76V was associated with a 2- to 6-fold decrease in susceptibility to lopinavir, darunavir, amprenavir, and indinavir and a 7- to 8-fold increase in susceptibility to atazanavir and saquinavir. PMID:20805393
Directory of Open Access Journals (Sweden)
Hubert Barennes
Full Text Available INTRODUCTION: In resource limited settings, patients entering an antiretroviral therapy (ART program comprise ART naive and ART pre-treated patients who may show differential virological outcomes. METHODS: This retrospective study, conducted in 2010-2012 in the HIV clinic of Calmette Hospital located in Phnom Penh (Cambodia assessed virological failure (VF rates and patterns of drug resistance of naive and pre-treated patients. Naive and ART pre-treated patients were included when a Viral Load (VL was performed during the first year of ART for naive subjects or at the first consultation for pre-treated individuals. Patients showing Virological failure (VF (>1,000 copies/ml underwent HIV DR genotyping testing. Interpretation of drug resistance mutations was done according to 2013 version 23 ANRS algorithms. RESULTS: On a total of 209 patients, 164 (78.4% were naive and 45 (21.5% were ART pre-treated. Their median initial CD4 counts were 74 cells/mm3 (IQR: 30-194 and 279 cells/mm3 (IQR: 103-455 (p<0.001, respectively. Twenty seven patients (12.9% exhibited VF (95% CI: 8.6-18.2%, including 10 naive (10/164, 6.0% and 17 pre-treated (17/45, 37.8% patients (p<0.001. Among these viremic patients, twenty-two (81.4% were sequenced in reverse transcriptase and protease coding regions. Overall, 19 (86.3% harbored ≥1 drug resistance mutations (DRMs whereas 3 (all belonging to pre-treated patients harbored wild-types viruses. The most frequent DRMs were M184V (86.3%, K103N (45.5% and thymidine analog mutations (TAMs (40.9%. Two (13.3% pre-treated patients harbored viruses that showed a multi-nucleos(tide resistance including Q151M, K65R, E33A/D, E44A/D mutations. CONCLUSION: In Cambodia, VF rates were low for naive patients but the emergence of DRMs to NNRTI and 3TC occurred relatively quickly in this subgroup. In pre-treated patients, VF rates were much higher and TAMs were relatively common. HIV genotypic assays before ART initiation and for ART pre
Directory of Open Access Journals (Sweden)
Turyadi Turyadi
2018-01-01
Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase. Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
Porter, Danielle P; Toma, Jonathan; Tan, Yuping; Solberg, Owen; Cai, Suqin; Kulkarni, Rima; Andreatta, Kristen; Lie, Yolanda; Chuck, Susan K; Palella, Frank; Miller, Michael D; White, Kirsten L
2016-02-01
Antiretroviral regimen switching may be considered for HIV-1-infected, virologically-suppressed patients to enable treatment simplification or improve tolerability, but should be guided by knowledge of pre-existing drug resistance. The current study examined the impact of pre-existing drug resistance mutations on virologic outcomes among virologically-suppressed patients switching to Rilpivirine (RPV)/emtricitabine (FTC)/tenofovir disoproxil fumarate (TDF). SPIRIT was a phase 3b study evaluating the safety and efficacy of switching to RPV/FTC/TDF in virologically-suppressed HIV-1-infected patients. Pre-existing drug resistance at baseline was determined by proviral DNA genotyping for 51 RPV/FTC/TDF-treated patients with known mutations by historical RNA genotype and matched controls and compared with clinical outcome at Week 48. Drug resistance mutations in protease or reverse transcriptase were detected in 62.7% of patients by historical RNA genotype and in 68.6% by proviral DNA genotyping at baseline. Proviral DNA sequencing detected 89% of occurrences of NRTI and NNRTI resistance-associated mutations reported by historical genotype. Mutations potentially affecting RPV activity, including E138A/G/K/Q, Y181C, and H221Y, were detected in isolates from 11 patients by one or both assays. None of the patients with single mutants had virologic failure through Week 48. One patient with pre-existing Y181Y/C and M184I by proviral DNA genotyping experienced virologic failure. Nineteen patients with K103N present by historical genotype were confirmed by proviral DNA sequencing and 18/19 remained virologically-suppressed. Virologic success rates were high among virologically-suppressed patients with pre-existing NRTI and NNRTI resistance-associated mutations who switched to RPV/FTC/TDF in the SPIRIT study. While plasma RNA genotyping remains preferred, proviral DNA genotyping may provide additional value in virologically-suppressed patients for whom historical resistance
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
Directory of Open Access Journals (Sweden)
Shuai Chang
Full Text Available This study was designed to identify common HIV-1 mutation complexes affecting the slope of inhibition curve, and to propose a new parameter incorporating both the IC50 and the slope to evaluate phenotypic resistance.Utilizing site-directed mutagenesis, we constructed 22 HIV-1 common mutation complexes. IC50 and slope of 10 representative approved drugs and a novel agent against these mutations were measured to determine the resistance phenotypes. The values of new parameter incorporating both the IC50 and the slope of the inhibition curve were calculated, and the correlations between parameters were assessed.Depending on the class of drug, there were intrinsic differences in how the resistance mutations affected the drug parameters. All of the mutations resulted in large increases in the IC50s of nucleoside reverse transcriptase inhibitors. The effects of the mutations on the slope were the most apparent when examining their effects on the inhibition of non-nucleoside reverse transcriptase inhibitors and protease inhibitors. For example, some mutations, such as V82A, had no effect on IC50, but reduced the slope. We proposed a new concept, termed IIPatoxic, on the basis of IC50, slope and the maximum limiting concentrations of the drug. The IIPatoxic values of 10 approved drugs and 1 novel agent were calculated, and were closely related to the IIPmax values (r > 0.95, p < 0.001.This study confirms that resistance mutations cannot be accurately assessed by IC50 alone, because it tends to underestimate the degree of resistance. The slope parameter is of very importance in the measurement of drug resistance and the effect can be applied to more complex patterns of resistance. This is the most apparent when testing the effects of the mutations on protease inhibitors activity. We also propose a new index, IIPatoxic, which incorporates both the IC50 and the slope. This new index could complement current IIP indices, thereby enabling predict the
International Nuclear Information System (INIS)
Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key
2016-01-01
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)
2016-08-26
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Telomere biology and telomerase mutations in cirrhotic patients with hepatocellular carcinoma.
Directory of Open Access Journals (Sweden)
Flávia S Donaires
Full Text Available Telomeres are repetitive DNA sequences at linear chromosome termini, protecting chromosomes against end-to-end fusion and damage, providing chromosomal stability. Telomeres shorten with mitotic cellular division, but are maintained in cells with high proliferative capacity by telomerase. Loss-of-function mutations in telomere-maintenance genes are genetic risk factors for cirrhosis development in humans and murine models. Telomerase deficiency provokes accelerated telomere shortening and dysfunction, facilitating genomic instability and oncogenesis. Here we examined whether telomerase mutations and telomere shortening were associated with hepatocellular carcinoma (HCC secondary to cirrhosis. Telomere length of peripheral blood leukocytes was measured by Southern blot and qPCR in 120 patients with HCC associated with cirrhosis and 261 healthy subjects. HCC patients were screened for telomerase gene variants (in TERT and TERC by Sanger sequencing. Age-adjusted telomere length was comparable between HCC patients and healthy subjects by both Southern blot and qPCR. Four non-synonymous TERT heterozygous variants were identified in four unrelated patients, resulting in a significantly higher mutation carrier frequency (3.3% in patients as compared to controls (p = 0.02. Three of the four variants (T726M, A1062T, and V1090M were previously observed in patients with other telomere diseases (severe aplastic anemia, acute myeloid leukemia, and cirrhosis. A novel TERT variant, A243V, was identified in a 65-year-old male with advanced HCC and cirrhosis secondary to chronic hepatitis C virus (HCV and alcohol ingestion, but direct assay measurements in vitro did not detect modulation of telomerase enzymatic activity or processivity. In summary, constitutional variants resulting in amino acid changes in the telomerase reverse transcriptase were found in a small proportion of patients with cirrhosis-associated HCC.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Berman, Andrea J; Gooding, Anne R; Cech, Thomas R
2010-10-01
The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.
Study of the decay /sup 184/Hg. -->. /sup 184/Au (Tsub(1/2)=30s). [Lifetime, upper limits
Energy Technology Data Exchange (ETDEWEB)
Nettles, W G; Beraud, R; Cole, J D; Hamilton, J H; Ramayya, A V; Kawakami, H [Vanderbilt Univ., Nashville, TN (USA). Dept. of Physics; Sastry, K S.R. [Massachusetts Univ., Amherst (USA); Spejewski, E H
1978-04-01
The radioactive decay of /sup 184/Hg to /sup 184/Au was studied on line with the UNISOR isotope separator. The 184 mass chain was entered at /sup 184/Tl and /sup 184/Hg by bombarding an isotopically-enriched target of /sup 180/W with /sup 14/N ions of 177 MeV. Multiscale singles and ..gamma..-..gamma..-time coincidence studies were carried out. No previous levels have been assigned to /sup 184/Au. From the coincidence data eight levels at 156.2, 159.1, 247.7, 282.8, 295.1, 392.4, 418.0 and 412.4 keV are assigned and two tentative levels at 534.0 and 551.6 keV are proposed. By using the delayed coincidence technique, a half-life of 36+-6 nanoseconds was measured for the 156.2 keV first-excited level and upper limits of 2 nanoseconds were determined for the half-lives of levels at 159.1, 247.7, 295.1 and 392.4 keV.
Ellis, Giovanina M; Huang, Sharon; Hitti, Jane; Frenkel, Lisa M
2011-11-01
Compare the risk of HIV drug resistance in women stopping suppressive nelfinavir (NFV)-based or Nevirapine (NVP)-based antiretroviral therapy (ART) after pregnancy. Specimens collected after stopping ART were tested for drug resistance by an oligonucleotide ligation assay and consensus sequencing. When postpartum drug resistance was detected, specimens obtained at study entry and during ART were evaluated. Sixteen of 38 women with ART-induced suppression of viral replication suspended ART postpartum. Resistance mutations were detected in 75% who stopped NFV-ART and in 50% who stopped NVP-ART. M184V, associated with Lamivudine resistance, was more frequent among those randomized to NFV-ART compared with NVP-ART (6 of 8 versus 1 of 8; P = 0.04), and nonnucleoside reverse transcriptase inhibitor resistance was detected in 4 of 8 stopping NVP-ART. HIV drug resistance was frequently observed among women who stopped suppressive NVP-ART or NFV-ART postpartum. This suggests that NFV-ART may have suboptimal potency, that staggering discontinuation of NVP-ART may be warranted, and/or ART adherence may be lax in women who choose to stop ART postpartum.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Tabassum, Najia; Saboor, Mohammed; Ghani, Rubina; Moinuddin, Moinuddin
2014-01-01
Co-existence of myeloproliferative disorders (MPD) and Janus associated kinase 2 mutation (JAK2 V617F) is a well-established fact. Only few case reports are available showing presence of JAK2 V617F mutation in chronic myeloid leukemia (CML). Purpose of this study was to determine the frequency of JAK2 V617F mutation in Philadelphia Chromosome positive (Ph (+)) CML patients in Pakistan. The study was conducted from August 2009 to July 2010 at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed for Breakpoint Cluster Region - Abelson (BCR-ABL) rearrangement. Conventional PCR was performed for JAK2 V617F mutation on BCR-ABL positive samples. All 25 samples showed BCR-ABL rearrangement. Out of these 11 samples (44%) had JAK2 V617F mutation; the remaining 14 (56%) cases showed JAK2 617V wild type. It is concluded that the co-existence of Ph (+)CML and JAK2 V617F mutation is possible.
Moura, Maria Edileuza Soares; da Guarda Reis, Mônica Nogueira; Lima, Yanna Andressa Ramos; Eulálio, Kelsen Dantas; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo
2015-05-01
HIV-1 transmitted-drug-resistance and genetic diversity are dynamic and may differ in distinct locations/risk groups. In Brazil, increased AIDS incidence and related mortality have been detected in the Northeast region, differently from the epicenter in the Southeast. This cross-sectional study describes transmitted-dru- resistance and HIV-1 subtypes in protease/PR and reverse transcriptase/RT regions among antiretroviral naïve patients from Piauí State, Northeast Brazil. Among 96 patients recruited 89 (92.7%) had HIV-1 PR/RT regions sequenced: 44 females and 45 males, 22 self-declared as men who have sex with men. Transmitted-drug-resistance was investigated by CPR tool (Stanford HIV-1 Drug Resistance/SDRM). HIV-1 subtypes were assigned by REGA and phylogenetic inference. Overall, transmitted-drug-resistance rate was 11.2% (10/89; CI 95%: 5.8-19.1%); 22.7% among men who have sex with men (5/22; CI 95%: 8.8-43.4%), 10% in heterosexual men (2/20; CI 95%: 1.7-29.3%) and 6.8% in women (3/44; CI 95%: 1.8-17.4%). Singleton mutations to protease-inhibitor/PI, nucleoside-reverse-transcriptase-inhibitor/NRTI or non-nucleoside-reverse-transcriptase-inhibitor/NNRTI predominated (8/10): PI mutations (M46L, V82F, L90M); NRTI mutations (M41L, D67N) and NNRTI mutations (K103N/S). Dual class resistance mutations to NRTI and NNRTI were observed: T215L (NRTI), Y188L (NNRTI) and T215N (NRTI), F227L (NNRTI). Subtype B prevailed (86.6%; 77/89), followed by subtype F1 (1.1%, 1/89) and subtype C (1.1%, 1/89). B/F1 and B/C intersubtype recombinants represented 11.2% (10/89). In Piauí State extensive testing of incidence and transmitted-drug-resistance in all populations with risk behaviors may help control AIDS epidemic locally. © 2015 Wiley Periodicals, Inc.
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
Introduction First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance – Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥2 TAMs; or M184V+≥1 TAM. Virological suppression was defined as viral load (VL) Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥2 TAMs; and 32 with M184V+≥1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤200 cells/µL at genotyping (OR=4.43, 95% CI [1.59–12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39–16.36], p<0.001). Among 87/105 patients with available VL at 12 months after switch to second-line ART, virological suppression was achieved in 85%. The median genotypic susceptibility score (GSS) for the second-line regimen was 2.00. Patients with ART adherence ≥95% were more likely to be virologically suppressed (OR=9.33, 95% CI (2.43–35.81), p=0.001). Measures of patient resistance to second-line ART, including the GSS, were not significantly associated with virological outcome. Conclusions Multi-NRTI RAMs at first-line failure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving
Eshleman, Susan H; Laeyendecker, Oliver; Parkin, Neil; Huang, Wei; Chappey, Colombe; Paquet, Agnes C; Serwadda, David; Reynolds, Steven J; Kiwanuka, Noah; Quinn, Thomas C; Gray, Ronald; Wawer, Maria
2009-04-27
To analyze antiretroviral drug susceptibility in HIV from recently infected adults in Rakai, Uganda, prior to the availability of antiretroviral drug treatment. Samples obtained at the time of HIV seroconversion (1998-2003) were analyzed using the GeneSeq HIV and PhenoSense HIV assays (Monogram Biosciences, Inc., South San Francisco, California, USA). Test results were obtained for 104 samples (subtypes: 26A, 1C, 66D, 9A/D, 1C/D, 1 intersubtype recombinant). Mutations used for genotypic surveillance of transmitted antiretroviral drug resistance were identified in six samples: three had nucleoside reverse transcriptase inhibitor (NRTI) surveillance mutations (two had M41L, one had K219R), and three had protease inhibitor surveillance mutations (I47V, F53L, N88D); none had nonnucleoside reverse transcriptase inhibitor (NNRTI) surveillance mutations. Other resistance-associated mutations were identified in some samples. However, none of the samples had a sufficient number of mutations to predict reduced antiretroviral drug susceptibility. Ten (9.6%) of the samples had reduced phenotypic susceptibility to at least one drug (one had partial susceptibility to didanosine, one had nevirapine resistance, and eight had resistance or partial susceptibility to at least one protease inhibitor). Fifty-three (51%) of the samples had hypersusceptibility to at least one drug (seven had zidovudine hypersusceptibility, 28 had NNRTI hypersusceptibility, 34 had protease inhibitor hypersusceptibility). Delavirdine hypersusceptibility was more frequent in subtype A than D. In subtype D, efavirenz hypersusceptibility was associated with substitutions at codon 11 in HIV-reverse transcriptase. Phenotyping detected reduced antiretroviral drug susceptibility and hypersusceptibility in HIV from some antiretroviral-naive Ugandan adults that was not predicted by genotyping. Phenotyping may complement genotyping for analysis of antiretroviral drug susceptibility in populations with nonsubtype B
Directory of Open Access Journals (Sweden)
Gronenborn Angela M
2010-05-01
Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.
Reversible Congenital Hypogonadotropic Hypogonadism in Patients with CHD7, FGFR1 or GNRHR Mutations
Laitinen, Eeva-Maria; Tommiska, Johanna; Sane, Timo; Vaaralahti, Kirsi; Toppari, Jorma; Raivio, Taneli
2012-01-01
Background Congenital hypogonadotropic hypogonadism (HH) is a rare cause for delayed or absent puberty. These patients may recover from HH spontaneously in adulthood. To date, it is not possible to predict who will undergo HH reversal later in life. Herein we investigated whether Finnish patients with reversal of congenital hypogonadotropic hypogonadism (HH) have common phenotypic or genotypic features. Methods and Findings Thirty-two male HH patients with anosmia/hyposmia (Kallmann Syndrome, KS; n = 26) or normal sense of smell (nHH; n = 6) were enrolled (age range, 18–61 yrs). The patients were clinically examined, and reversal of HH was assessed after treatment withdrawal. KAL1, FGFR1, FGF8, PROK2, PROKR2, CHD7, WDR11, GNRHR, GNRH1, KISS1R, KISS1, TAC3, TACR3, and LHβ were screened for mutations. Six HH patients (2 KS, 4 nHH) were verified to have reversal of HH. In the majority of cases, reversal occurred early in adulthood (median age, 23 yrs; range, 21–39 yrs). All had spontaneous testicular growth while on testosterone replacement therapy (TRT). One nHH subject was restarted on TRT due to a decline in serum T. Two reversal variants had a same GNRHR mutation (R262Q), which was accompanied by another GNRHR mutation (R139H or del309F). In addition, both of the KS patients had a mutation in CHD7 (p.Q51X) or FGFR1 (c.91+2T>A). Conclusions Considerable proportion of patients with HH (8% of KS probands) may recover in early adulthood. Spontaneous testicular enlargement during TRT was highly suggestive for reversal of HH. Those with the GNRHR mutation R262Q accompanied by another GNRHR mutation may be prone to reversal, although even patients with a truncating mutation in CHD7 or a splice-site mutation in FGFR1 can recover. We recommend that all adolescents and young adults with congenital HH should be informed on the possibility of reversal. PMID:22724017
Reversible congenital hypogonadotropic hypogonadism in patients with CHD7, FGFR1 or GNRHR mutations.
Directory of Open Access Journals (Sweden)
Eeva-Maria Laitinen
Full Text Available BACKGROUND: Congenital hypogonadotropic hypogonadism (HH is a rare cause for delayed or absent puberty. These patients may recover from HH spontaneously in adulthood. To date, it is not possible to predict who will undergo HH reversal later in life. Herein we investigated whether Finnish patients with reversal of congenital hypogonadotropic hypogonadism (HH have common phenotypic or genotypic features. METHODS AND FINDINGS: Thirty-two male HH patients with anosmia/hyposmia (Kallmann Syndrome, KS; n = 26 or normal sense of smell (nHH; n = 6 were enrolled (age range, 18-61 yrs. The patients were clinically examined, and reversal of HH was assessed after treatment withdrawal. KAL1, FGFR1, FGF8, PROK2, PROKR2, CHD7, WDR11, GNRHR, GNRH1, KISS1R, KISS1, TAC3, TACR3, and LHβ were screened for mutations. Six HH patients (2 KS, 4 nHH were verified to have reversal of HH. In the majority of cases, reversal occurred early in adulthood (median age, 23 yrs; range, 21-39 yrs. All had spontaneous testicular growth while on testosterone replacement therapy (TRT. One nHH subject was restarted on TRT due to a decline in serum T. Two reversal variants had a same GNRHR mutation (R262Q, which was accompanied by another GNRHR mutation (R139H or del309F. In addition, both of the KS patients had a mutation in CHD7 (p.Q51X or FGFR1 (c.91+2T>A. CONCLUSIONS: Considerable proportion of patients with HH (8% of KS probands may recover in early adulthood. Spontaneous testicular enlargement during TRT was highly suggestive for reversal of HH. Those with the GNRHR mutation R262Q accompanied by another GNRHR mutation may be prone to reversal, although even patients with a truncating mutation in CHD7 or a splice-site mutation in FGFR1 can recover. We recommend that all adolescents and young adults with congenital HH should be informed on the possibility of reversal.
Phenotype, Genotype, and Drug Resistance in Subtype C HIV-1 Infection.
Derache, Anne; Wallis, Carole L; Vardhanabhuti, Saran; Bartlett, John; Kumarasamy, Nagalingeswaran; Katzenstein, David
2016-01-15
Virologic failure in subtype C is characterized by high resistance to first-line antiretroviral (ARV) drugs, including efavirenz, nevirapine, and lamivudine, with nucleoside resistance including type 2 thymidine analog mutations, K65R, a T69del, and M184V. However, genotypic algorithms predicting resistance are mainly based on subtype B viruses and may under- or overestimate drug resistance in non-B subtypes. To explore potential treatment strategies after first-line failure, we compared genotypic and phenotypic susceptibility of subtype C human immunodeficiency virus 1 (HIV-1) following first-line ARV failure. AIDS Clinical Trials Group 5230 evaluated patients failing an initial nonnucleoside reverse-transcriptase inhibitor (NNRTI) regimen in Africa and Asia, comparing the genotypic drug resistance and phenotypic profile from the PhenoSense (Monogram). Site-directed mutagenesis studies of K65R and T69del assessed the phenotypic impact of these mutations. Genotypic algorithms overestimated resistance to etravirine and rilpivirine, misclassifying 28% and 32%, respectively. Despite K65R with the T69del in 9 samples, tenofovir retained activity in >60%. Reversion of the K65R increased susceptibility to tenofovir and other nucleosides, while reversion of the T69del showed increased resistance to zidovudine, with little impact on other NRTI. Although genotype and phenotype were largely concordant for first-line drugs, estimates of genotypic resistance to etravirine and rilpivirine may misclassify subtype C isolates compared to phenotype. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
ANXA11 mutations prevail in Chinese ALS patients with and without cognitive dementia.
Zhang, Kang; Liu, Qing; Liu, Keqiang; Shen, Dongchao; Tai, Hongfei; Shu, Shi; Ding, Qingyun; Fu, Hanhui; Liu, Shuangwu; Wang, Zhili; Li, Xiaoguang; Liu, Mingsheng; Zhang, Xue; Cui, Liying
2018-06-01
To investigate the genetic contribution of ANXA11 , a gene associated with amyotrophic lateral sclerosis (ALS), in Chinese ALS patients with and without cognitive dementia. Sequencing all the coding exons of ANXA11 and intron-exon boundaries in 18 familial amyotrophic lateral sclerosis (FALS), 353 unrelated sporadic amyotrophic lateral sclerosis (SALS), and 12 Chinese patients with ALS-frontotemporal lobar dementia (ALS-FTD). The transcripts in peripheral blood generated from a splicing mutation were examined by reverse transcriptase PCR. We identified 6 nonsynonymous heterozygous mutations (5 novel and 1 recurrent), 1 splice site mutation, and 1 deletion of 10 amino acids (not accounted in the mutant frequency) in 11 unrelated patients, accounting for a mutant frequency of 5.6% (1/18) in FALS, 2.3% (8/353) in SALS, and 8.3% (1/12) in ALS-FTD. The deletion of 10 amino acids was detected in 1 clinically undetermined male with an ALS family history who had atrophy in hand muscles and myotonic discharges revealed by EMG. The novel p. P36R mutation was identified in 1 FALS index, 1 patient with SALS, and 1 ALS-FTD. The splicing mutation (c.174-2A>G) caused in-frame skipping of the entire exon 6. The rest missense mutations including p.D40G, p.V128M, p.S229R, p.R302C and p.G491R were found in 6 unrelated patients with SALS. The ANXA11 gene is one of the most frequently mutated genes in Chinese patients with SALS. A canonical splice site mutation leading to skipping of the entire exon 6 further supports the loss-of-function mechanism. In addition, the study findings further expand the ANXA11 phenotype, first highlighting its pathogenic role in ALS-FTD.
Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang
2010-01-01
A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408
Directory of Open Access Journals (Sweden)
Yanrui Li
2010-01-01
Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Reversal or protection by light of the ethidium bromide induced petite mutation in yeast
International Nuclear Information System (INIS)
Hixon, S.C.; Burnham, A.D.; Irons, R.L.
1979-01-01
An intermediate in the ethidium bromide (EB) induced petite mutation pathway may be destabilized by daylight light to cause a reversion to the normal grande phenotype. Starved cells preincubated in the dark for up to 6 h with 100μg/ml EB could be reverted to grandes after one hour of light exposure, whereas similarly treated cells maintained in the dark expresse the petite mutation in more than 80 percent of the population. In addition, the production of petite mutants by EB in buffer could be prevented if cell suspensions were exposed to light immediately upon the addition of EB. Photoreversal of the EB-derived petite mutation in growing cells as less efficient presumably because the availability of an energy source caused a continuation of mutation events beyond the light revertible step to a non-reversible fixation of the mutation. Cells treated with EB in growth and reversal of the mutation. This may be due to the cold inhibition of an enzyme which comes into play beyond the light sensitive step in the mutation pathway. (orig.) [de
Highly preferential association of NonF508del CF mutations with the M470 allele.
Ciminelli, B M; Bonizzato, A; Bombieri, C; Pompei, F; Gabaldo, M; Ciccacci, C; Begnini, A; Holubova, A; Zorzi, P; Piskackova, T; Macek, M; Castellani, C; Modiano, G; Pignatti, P F
2007-01-01
On the basis of previous findings on random individuals, we hypothesized a preferential association of CF causing mutations with the M allele of the M470V polymorphic site of the CFTR gene. We have determined the M/V-CF mutation haplotype in a series of 201 North East Italian and 73 Czech CF patients who were not F508del homozygotes, as F508del was already known to be fully associated with the M allele. Out of 358 not F508del CF genes, 84 carried the V allele and 274 the less common M allele. In the N-E Italian population, MM subjects have a risk of carrying a CF causing mutation 6.9x greater than VV subjects when F508del is excluded and 15.4x when F508del is included. In the Czech population a similar, although less pronounced, association is observed. Besides the possible biological significance of this association, the possibility of exploiting it for a pilot screening program has been explored in a local North East Italian population for which CF patients were characterized for their CF mutation. General M470V genotyping followed by common CF mutation screening limited to couples in which each partner carries at least one M allele would need testing only 39% of the couples, which contribute 89% of the total risk, with a cost benefit.
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Vairo, Francesco; Nicastri, Emanuele; Liuzzi, Giuseppina; Chaula, Zainab; Nguhuni, Boniface; Bevilacqua, Nazario; Forbici, Federica; Amendola, Alessandra; Fabeni, Lavinia; De Nardo, Pasquale; Perno, Carlo Federico; Cannas, Angela; Sakhoo, Calistus; Capobianchi, Maria Rosaria; Ippolito, Giuseppe
2013-09-21
HIV resistance affects virological response to therapy and efficacy of prophylaxis in mother-to-child-transmission. The study aims to assess the prevalence of HIV primary resistance in pregnant women naïve to antiretrovirals. Cross sectional baseline analysis of a cohort of HIV + pregnant women (HPW) enrolled in the study entitled Antiretroviral Management of Antenatal and Natal HIV Infection (AMANI, peace in Kiswahili language). The AMANI study began in May 2010 in Dodoma, Tanzania. In this observational cohort, antiretroviral treatment was provided to all women from the 28th week of gestation until the end of the breastfeeding period. Baseline CD4 cell count, viral load and HIV drug-resistance genotype were collected. Drug-resistance analysis was performed on 97 naïve infected-mothers. The prevalence of all primary drug resistance and primary non-nucleoside reverse-transcriptase inhibitors resistance was 11.9% and 7.5%, respectively. K103S was found in two women with no M184V detection. HIV-1 subtype A was the most commonly identified, with a high prevalence of subtype A1, followed by C, D, C/D recombinant, A/C recombinant and A/D recombinant. HIV drug- resistance mutations were detected in A1 and C subtypes. Our study reports an 11.9% prevalence rate of primary drug resistance in naïve HIV-infected pregnant women from a remote area of Tanzania. Considering that the non-nucleoside reverse-transcriptase inhibitors are part of the first-line antiretroviral regimen in Tanzania and all of Africa, resistance surveys should be prioritized in settings where antiretroviral therapy programs are scaled up.
Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.
Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M
2001-10-01
Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Barker, Emily N; Stranieri, Angelica; Helps, Chris R; Porter, Emily L; Davidson, Andrew D; Day, Michael J; Knowles, Toby; Kipar, Anja; Tasker, Séverine
2017-10-05
Feline infectious peritonitis (FIP) is a fatal disease of cats, and a sequela of systemic feline coronavirus (FCoV) infection. Mutations in the viral spike (S) gene have been associated with FCoVs found in tissues from cats with FIP, but not FCoVs found in faeces from healthy cats, and are implicated in monocyte/macrophage tropism and systemic spread. This study was designed to determine whether S gene mutation analysis can reliably diagnose FIP. Cats were categorised as with FIP (n = 57) or without FIP (n = 45) based on gross post-mortem and histopathological examination including immunohistochemistry for FCoV antigen. RNA was purified from available tissue, fluid and faeces. Reverse-transcriptase quantitative-PCR (RT-qPCR) was performed on all samples using FCoV-specific primers, followed by sequencing of a section of the S gene on RT-qPCR positive samples. Samples were available from a total of 102 cats. Tissue, fluid, and faecal samples from cats with FIP were more likely to be FCoV RT-qPCR-positive (90.4, 78.4 and 64.6% respectively) than those from cats without FIP (7.8, 2.1 and 20% respectively). Identification of S gene mutated FCoVs as an additional step to the detection of FCoV alone, only moderately increased specificity for tissue samples (from 92.6 to 94.6%) but specificity was unchanged for fluid samples (97.9%) for FIP diagnosis; however, sensitivity was markedly decreased for tissue (from 89.8 to 80.9%) and fluid samples (from 78.4 to 60%) for FIP diagnosis. These findings demonstrate that S gene mutation analysis in FCoVs does not substantially improve the ability to diagnose FIP as compared to detection of FCoV alone.
Search for Chargino and Neutralino Production at $\\sqrt{s}$ = 181-184 GeV at LEP
Abbiendi, G; Alexander, Gideon; Allison, J; Altekamp, N; Anderson, K J; Anderson, S; Arcelli, S; Asai, S; Ashby, S F; Axen, D A; Azuelos, Georges; Ball, A H; Barberio, E; Barlow, R J; Bartoldus, R; Batley, J Richard; Baumann, S; Bechtluft, J; Behnke, T; Bell, K W; Bella, G; Bellerive, A; Bentvelsen, Stanislaus Cornelius Maria; Bethke, Siegfried; Betts, S; Biebel, O; Biguzzi, A; Bird, S D; Blobel, Volker; Bloodworth, Ian J; Bobinski, M; Bock, P; Böhme, J; Bonacorsi, D; Boutemeur, M; Braibant, S; Bright-Thomas, P G; Brigliadori, L; Brown, R M; Burckhart, Helfried J; Burgard, C; Bürgin, R; Capiluppi, P; Carnegie, R K; Carter, A A; Carter, J R; Chang, C Y; Charlton, D G; Chrisman, D; Ciocca, C; Clarke, P E L; Clay, E; Cohen, I; Conboy, J E; Cooke, O C; Couyoumtzelis, C; Coxe, R L; Cuffiani, M; Dado, S; Dallavalle, G M; Davis, R; De Jong, S; del Pozo, L A; de Roeck, A; Desch, Klaus; Dienes, B; Dixit, M S; Dubbert, J; Duchovni, E; Duckeck, G; Duerdoth, I P; Eatough, D; Estabrooks, P G; Etzion, E; Evans, H G; Fabbri, Franco Luigi; Fanti, M; Faust, A A; Fiedler, F; Fierro, M; Fleck, I; Folman, R; Fürtjes, A; Futyan, D I; Gagnon, P; Gary, J W; Gascon, J; Gascon-Shotkin, S M; Gaycken, G; Geich-Gimbel, C; Giacomelli, G; Giacomelli, P; Gibson, V; Gibson, W R; Gingrich, D M; Glenzinski, D A; Goldberg, J; Gorn, W; Grandi, C; Gross, E; Grunhaus, Jacob; Gruwé, M; Hanson, G G; Hansroul, M; Hapke, M; Harder, K; Hargrove, C K; Hartmann, C; Hauschild, M; Hawkes, C M; Hawkings, R; Hemingway, Richard J; Herndon, M; Herten, G; Heuer, R D; Hildreth, M D; Hill, J C; Hillier, S J; Hobson, P R; Höcker, Andreas; Homer, R James; Honma, A K; Horváth, D; Hossain, K R; Howard, R; Hüntemeyer, P; Igo-Kemenes, P; Imrie, D C; Ishii, K; Jacob, F R; Jawahery, A; Jeremie, H; Jimack, Martin Paul; Jones, C R; Jovanovic, P; Junk, T R; Karlen, D A; Kartvelishvili, V G; Kawagoe, K; Kawamoto, T; Kayal, P I; Keeler, Richard K; Kellogg, R G; Kennedy, B W; Klier, A; Kluth, S; Kobayashi, T; Kobel, M; Koetke, D S; Kokott, T P; Kolrep, M; Komamiya, S; Kowalewski, R V; Kress, T; Krieger, P; Von Krogh, J; Kühl, T; Kyberd, P; Lafferty, G D; Lanske, D; Lauber, J; Lautenschlager, S R; Lawson, I; Layter, J G; Lazic, D; Lee, A M; Lellouch, Daniel; Letts, J; Levinson, L; Liebisch, R; List, B; Littlewood, C; Lloyd, A W; Lloyd, S L; Loebinger, F K; Long, G D; Losty, Michael J; Ludwig, J; Liu, D; Macchiolo, A; MacPherson, A L; Mader, W F; Mannelli, M; Marcellini, S; Markopoulos, C; Martin, A J; Martin, J P; Martínez, G; Mashimo, T; Mättig, P; McDonald, W J; McKenna, J A; McKigney, E A; McMahon, T J; McPherson, R A; Meijers, F; Menke, S; Merritt, F S; Mes, H; Meyer, J; Michelini, Aldo; Mihara, S; Mikenberg, G; Miller, D J; Mir, R; Mohr, W; Montanari, A; Mori, T; Nagai, K; Nakamura, I; Neal, H A; Nellen, B; Nisius, R; O'Neale, S W; Oakham, F G; Odorici, F; Ögren, H O; Oreglia, M J; Orito, S; Pálinkás, J; Pásztor, G; Pater, J R; Patrick, G N; Patt, J; Pérez-Ochoa, R; Petzold, S; Pfeifenschneider, P; Pilcher, J E; Pinfold, James L; Plane, D E; Poffenberger, P R; Polok, J; Przybycien, M B; Rembser, C; Rick, Hartmut; Robertson, S; Robins, S A; Rodning, N L; Roney, J M; Roscoe, K; Rossi, A M; Rozen, Y; Runge, K; Runólfsson, O; Rust, D R; Sachs, K; Saeki, T; Sahr, O; Sang, W M; Sarkisyan-Grinbaum, E; Sbarra, C; Schaile, A D; Schaile, O; Scharf, F; Scharff-Hansen, P; Schieck, J; Schmitt, B; Schmitt, S; Schöning, A; Schröder, M; Schumacher, M; Schwick, C; Scott, W G; Seuster, R; Shears, T G; Shen, B C; Shepherd-Themistocleous, C H; Sherwood, P; Siroli, G P; Sittler, A; Skuja, A; Smith, A M; Snow, G A; Sobie, Randall J; Söldner-Rembold, S; Sproston, M; Stahl, A; Stephens, K; Steuerer, J; Stoll, K; Strom, D; Ströhmer, R; Surrow, B; Talbot, S D; Tanaka, S; Taras, P; Tarem, S; Teuscher, R; Thiergen, M; Thomson, M A; Von Törne, E; Torrence, E; Towers, S; Trigger, I; Trócsányi, Z L; Tsur, E; Turcot, A S; Turner-Watson, M F; Van Kooten, R; Vannerem, P; Verzocchi, M; Voss, H; Wäckerle, F; Wagner, A; Ward, C P; Ward, D R; Watkins, P M; Watson, A T; Watson, N K; Wells, P S; Wermes, N; White, J S; Wilson, G W; Wilson, J A; Wyatt, T R; Yamashita, S; Yekutieli, G; Zacek, V; Zer-Zion, D
1999-01-01
A search for charginos and neutralinos, predicted by supersymmetric theories, has been performed using a data sample of 57 pb-1 at centre-of-mass energies of 181-184 GeV taken with the OPAL detector at LEP. No evidence for chargino or neutralino production has been found. Upper limits on chargino and neutralino pair production cross-sections are obtained as a function of the chargino mass, the lightest neutralino mass, and the second lightest neutralino mass. For large chargino masses the limits have been improved with respect to the previous analyses at lower centre-of-mass energies. Exclusion regions at 95% confidence level of parameters of the Constrained Minimal Supersymmetric Standard Model are determined for the case of a large universal scalar mass, m_0, implying heavy scalar fermions, and for the case of a small m_0 resulting in light scalar fermions and giving the worst-case limits. Within this framework and for the lightest chargino-neutralino mass difference greater than 5 GeV the 95% C.L. lower li...
Llibre, J M; Santos, J R; Puig, T; Moltó, J; Ruiz, L; Paredes, R; Clotet, B
2008-11-01
To evaluate the expected activity of etravirine in clinical samples, according to mutational patterns associated with decreased virological response (VR). We identified 1586 routine clinical samples with resistance-associated mutations (RAMs) to nevirapine and efavirenz (K103N 60%, Y181C 37%, G190A 27%, V108I 13%). Concerning in vitro identified etravirine mutations, samples with F227C, Y181I, M230L or L100I plus K103N plus Y181C were considered highly resistant. Samples with two RAMs plus Y181C or V179D or K101E or Y188L were considered intermediate. The prevalence of 13 RAMs recently associated with decreased VR to etravirine in the DUET clinical trials was also investigated. Most samples (69%) harboured more than one IAS-USA RAM to first-generation non-nucleoside reverse transcriptase inhibitors (NNRTIs): 42% harboured two RAMs, 21% three RAMs and 6% four or more RAMs. The prevalence of 13 specific etravirine RAMs was V179F 0.12%, G190S 3.9%, Y181V 0.1%, V106I 2.6%, V179D 1.6%, K101P 2.0%, K101E 10.1%, Y181C 36.9%, A98G 5.9%, V90I 6.9%, Y181I 3.6%, G190A 27% and L100I 9.1%. The five RAMs with the most impact on VR (V179F/D, G190S, Y181V and V106I) occurred less often. Overall, 8.2% of the samples had three or more etravirine RAMs and only 1.1% had four or more. In addition, patterns of RAMs previously associated with intermediate etravirine resistance were present in 26.2% of the samples, whereas 4.85% displayed patterns of high-degree resistance. For RAMs associated with decreased VR, etravirine resistance in routine clinical samples was lower than previously reported. High-degree resistance was uncommon, even in patients with resistance to first-generation NNRTIs, whereas low-to-intermediate etravirine resistance was more common.
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Directory of Open Access Journals (Sweden)
Niu Meijuan
2004-10-01
Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.
Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J
2011-12-01
More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.
DEFF Research Database (Denmark)
Al-Saaidi, Rasha Abdelkadhem; Rasmussen, Torsten Bloch; Palmfeldt, Johan
2013-01-01
Dilated cardiomyopathy (DCM) is a disease of the heart muscle characterized by cardiac chamber enlargement and reduced systolic function of the left ventricle. Mutations in the LMNA gene represent the most frequent known genetic cause of DCM associated with disease of the conduction systems...... however are still not clearly established. In this study, we used a representative LMNA nonsense mutation, p.Arg321Ter, to shed light on the molecular disease mechanisms. Cultured fibroblasts from three DCM patients carrying this mutation were analyzed. Quantitative reverse transcriptase PCR...
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
Finding Relational Associations in HIV Resistance Mutation Data
Richter, Lothar; Augustin, Regina; Kramer, Stefan
HIV therapy optimization is a hard task due to rapidly evolving mutations leading to drug resistance. Over the past five years, several machine learning approaches have been developed for decision support, mostly to predict therapy failure from the genotypic sequence of viral proteins and additional factors. In this paper, we define a relational representation for an important part of the data, namely the sequences of a viral protein (reverse transcriptase), their mutations, and the drug resistance(s) associated with those mutations. The data were retrieved from the Los Alamos National Laboratories' (LANL) HIV databases. In contrast to existing work in this area, we do not aim directly for predictive modeling, but take one step back and apply descriptive mining methods to develop a better understanding of the correlations and associations between mutations and resistances. In our particular application, we use the Warmr algorithm to detect non-trivial patterns connecting mutations and resistances. Our findings suggest that well-known facts can be rediscovered, but also hint at the potential of discovering yet unknown associations.
Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita
2018-01-01
Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673
Influence of 2 MeV electrons irradiation on gallium phosphide light-emitting diodes reverse currents
Directory of Open Access Journals (Sweden)
V. G. Vorobiov
2015-10-01
Full Text Available Results of reverse electrophysical characteristics study of red and green LEDs, initial and irradiated with 2 MeV electrons were given. It was found that reverse current was predominantly caused by carriers tunneling at Urev ≤ 9 V, and by the avalanche multiplication at Urev ≥ 13 V, in the range U = 9 ÷ 13 V both mechanisms are available. Current increase at high voltage areas (Urev > 19 V is limited by the base resistance of diode. In the case of significant reverse currents (I > 1 mA irradiation of diodes leads to the shift of reverse current-voltage characteristics into the high voltages direction.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Novel mutations underlying argininosuccinic aciduria in Saudi Arabia
Directory of Open Access Journals (Sweden)
Rashed Mohamed S
2010-03-01
Full Text Available Abstract Background Argininosuccinic aciduria (ASAuria is an autosomal recessive disorder of the urea cycle relatively common in Saudi Arabia as a consequence of extensive consanguinity. It is the most common urea cycle disorder identified in the Saudi population, which therefore prioritizes the need to delineate the underlying molecular defects leading to disease. Findings We utilized Whole Genome Amplification (WGA, PCR and direct sequencing to identify mutations underlying ASAuria cases diagnosed by our institution. A missense mutation that accounts for 50% of Saudi ASAuria patients was recently reported by our laboratory. In this study we report a further six novel mutations (and one previously reported found in Saudi patients with ASAuria. The novel four missense, one nonsense and one splice-site mutation were confirmed by their absence in >300 chromosomes from the normal population. Pathogenicity of the novel splice-site mutation was also confirmed using reverse transcriptase-PCR analysis. Cross species amino acid conservation at the substituted residues described were observed in some but not all instances. Conclusions Together, the eight mutations described by our laboratory, encompass >90% of ASAuria patients in Saudi Arabia and add to about 45 other ASAuria mutations reported worldwide.
Properties of the reverse transcription reaction in mRNA quantification
DEFF Research Database (Denmark)
Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie
2004-01-01
BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...
AT-101 enhances gefitinib sensitivity in non-small cell lung cancer with EGFR T790M mutations
International Nuclear Information System (INIS)
Zhao, Ren; Zhou, Shun; Xia, Bing; Zhang, Cui-ying; Hai, Ping; Zhe, Hong; Wang, Yan-yang
2016-01-01
Although epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) have become the standard care of patients with advanced EGFR-mutant non-small cell lung cancer (NSCLC), development of acquired resistance is inevitable. A secondary mutation of threonine 790 (T790M) is associated with approximately half of the cases of acquired resistance. Strategies or agents to overcome this type of resistance are still limited. In this study, enhanced antitumor effect of AT-101, a-pan-Bcl-2 inhibitor, on gefitinib was explored in NSCLC with T790M mutation. The effect of cotreatment with AT-101 and gefitinib on the viability of NSCLC cell lines harboring acquired T790M mutation was investigated using the MTT assay. The cellular apoptosis of NSCLC cells after cotreatment with AT-101 and gefitinib was assessed by FITC-annexin V/PI assay and Western blots analysis. The potential underlying mechanisms of the enhanced therapeutic effect for AT-101 was also studied using Western blots analysis. The in vivo anti-cancer efficacy of the combination with AT-101 and gefitinib was examined in a mouse xenograft model. In this study, we found that treatment with AT-101 in combination with gefitinib significantly inhibited cell proliferation, as well as promoted apoptosis of EGFR TKIs resistant lung cancer cells. The apoptotic effects of the use of AT-101 was related to the blocking of antiapoptotic protein: Bcl-2, Bcl-xl, and Mcl-1 and downregrulation of the molecules in EGFR pathway. The observed enhancements of tumor growth suppression in xenografts supported the reverse effect of AT-101 in NSCLC with T790M mutation, which has been found in in vitro studies before. AT-101 enhances gefitinib sensitivity in NSCLC with EGFR T790M mutations. The addition of AT-101 to gefitinib is a promising strategy to overcome EGFR TKIs resistance in NSCLC with EGFR T790M mutations
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Sangl, Laura; Matiasek, Kaspar; Felten, Sandra; Gründl, Stefanie; Bergmann, Michele; Balzer, Hans-Jörg; Pantchev, Nikola; Leutenegger, Christian M; Hartmann, Katrin
2018-03-01
Objectives The amino acid substitutions M1058L and S1060A in the spike protein of feline coronavirus (FCoV) have been postulated to be responsible for the development of the pathogenic feline infectious peritonitis virus (FIPV), which causes feline infectious peritonitis (FIP). The aim of the following study was to investigate the presence of mutated virus in tissue samples of cats with and without FIP. Methods The study population consisted of 64 cats, 34 of which were diagnosed with FIP and 30 control cats. All cases underwent autopsy, histopathology and immunohistochemistry (IHC) for FCoV. Furthermore, a genotype-discriminating quantitative reverse transcriptase PCR (RT-qPCR) was performed on shavings of paraffin-embedded tissues to discriminate between cats with FIP and controls, and the sensitivity and specificity of this discriminating RT-qPCR were calculated using 95% confidence intervals (CIs). Results Specificity of genotype-discriminating RT-qPCR was 100.0% (95% CI 88.4-100.0), sensitivity was 70.6% (95% CI 52.5-84.9). In cats with FIP, 24/34 cats tested positive for FIPV. In samples of three control cats and in seven cats with FIP, FCoV was found, but genotyping was not possible owing to low FCoV RNA concentrations. Out of the positive samples, 23 showed the amino acid substitution M1058L in the spike protein and none the substitution S1060A. One sample in a cat with FIP revealed a mixed population of non-mutated FCoV and FIPV (mixed genotype). For one sample genotyping was not possible despite high viral load, and two samples were negative for FCoV. Conclusions and relevance As none of the control animals showed FCoV amino acid substitutions previously demonstrated in cats with FIP, it can be presumed that the substitution M1058L correlates with the presence of FIP. FCoV was detected in low concentration in tissues of control animals, confirming the ability of FCoV to spread systemically. The fact that no negative controls were included in the IHC
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Directory of Open Access Journals (Sweden)
Isabel Hostettler
2014-12-01
Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.
Germline TERT promoter mutations are rare in familial melanoma
DEFF Research Database (Denmark)
Harland, Mark; Petljak, Mia; Robles-Espinoza, Carla Daniela
2016-01-01
Germline CDKN2A mutations occur in 40 % of 3-or-more case melanoma families while mutations of CDK4, BAP1, and genes involved in telomere function (ACD, TERF2IP, POT1), have also been implicated in melanomagenesis. Mutation of the promoter of the telomerase reverse transcriptase (TERT) gene (c.-57...... T>G variant) has been reported in one family. We tested for the TERT promoter variant in 675 multicase families wild-type for the known high penetrance familial melanoma genes, 1863 UK population-based melanoma cases and 529 controls. Germline lymphocyte telomere length was estimated in carriers....... The c.-57 T>G TERT promoter variant was identified in one 7-case family with multiple primaries and early age of onset (earliest, 15 years) but not among population cases or controls. One family member had multiple primary melanomas, basal cell carcinomas and a bladder tumour. The blood leukocyte...
Oumar, A A; Jnaoui, K; Kabamba-Mukadi, B; Yombi, J C; Vandercam, B; Goubau, P; Ruelle, J
2010-01-01
Etravirine is a second-generation non-nucleoside reverse transcriptase inhibitor (NNRTI) with a pattern of resistance mutations quite distinct from the current NNRTIs. We collected all routine samples of HIV-1 patients followed in the AIDS reference laboratory of UCLouvain (in 2006 and 2007) carrying resistance-associated mutations to nevirapine (NVP) or efavirenz (EFV). The sensitivity to Etravirine was estimated using three different drug resistance algorithms: ANRS (July 2008), IAS (December 2008) and Stanford (November 2008). We also verified whether the mutations described as resistance mutations are not due to virus polymorphisms by the study of 58 genotypes of NNRTI-naive patients. Sixty one samples harboured resistance to NVP and EFV: 41/61 had at least one resistance mutation to Etravirine according to ANRS-IAS algorithms; 42/61 samples had at least one resistance mutation to Etravirine according to the Stanford algorithm. 48 and 53 cases were fully sensitive to Etravirine according to ANRS-IAS and Stanford algorithms, respectively. Three cases harboured more than three mutations and presented a pattern of high-degree resistance to Etravirine according to ANRS-IAS algorithm, while one case harboured more than three mutations and presented high degree resistance to Etravirine according to the Stanford algorithm. The V1061 and V179D mutations were more frequent in the ARV-naive group than in the NNRTI-experienced one. According to the currently available algorithms, Etravirine can still be used in the majority of patients with virus showing resistance to NVP and/or EFV, if a combination of other active drugs is included.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
Structural dataset for the PPARγ V290M mutant
Directory of Open Access Journals (Sweden)
Ana C. Puhl
2016-06-01
Full Text Available Loss-of-function mutation V290M in the ligand-binding domain of the peroxisome proliferator activated receptor γ (PPARγ is associated with a ligand resistance syndrome (PLRS, characterized by partial lipodystrophy and severe insulin resistance. In this data article we discuss an X-ray diffraction dataset that yielded the structure of PPARγ LBD V290M mutant refined at 2.3 Å resolution, that allowed building of 3D model of the receptor mutant with high confidence and revealed continuous well-defined electron density for the partial agonist diclofenac bound to hydrophobic pocket of the PPARγ. These structural data provide significant insights into molecular basis of PLRS caused by V290M mutation and are correlated with the receptor disability of rosiglitazone binding and increased affinity for corepressors. Furthermore, our structural evidence helps to explain clinical observations which point out to a failure to restore receptor function by the treatment with a full agonist of PPARγ, rosiglitazone.
Directory of Open Access Journals (Sweden)
Warrilow David
2008-12-01
Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-04-17
The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Directory of Open Access Journals (Sweden)
Roe Bruce A
2007-04-01
Full Text Available Abstract Background The long bone abnormality (lbab mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael
2012-01-01
Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...
Common mutations of hepatitis B virus and their clinical significance
Directory of Open Access Journals (Sweden)
HU Airong
2016-06-01
Full Text Available Hepatitis B virus (HBV tends to mutate easily due to its special structure and life cycle. Mutation changes the biological behavior of HBV and its sensitivity to antiviral drugs and even affects therapeutic effect and accelerate disease progression. The point mutations are commonly see in the pre-S/S open reading frame (ORF, which may be associated with immune escape and occult HBV infection. The G1896A mutation is often observed in the pre-C/C-ORF and is associated with the development of HBeAg-negative chronic hepatitis B (CHB, hepatocellular carcinoma (HCC, and severe chronic hepatitis (liver failure. The mutations in P-ORF mainly occur in the reverse transcriptase (RT domain and are closely related to the resistance to nucleos(tide analogues. The A1762T and G1764A mutations occur in the basal core promoter (BCP, which overlaps with X-ORF, and may be associated with HBeAg-negative CHB, HCC, and severe chronic hepatitis (liver failure. Clarification of the association between these mutations and diseases helps to develop tailor-made diagnostic and therapeutic regimens for patients with HBV infection.
Factor V Leiden mutation in pregnancy.
Cohen, Susan Murphy
2004-01-01
Normal maternal adaptation to pregnancy significantly increases the risk for thrombus formation. Inherited thrombophilias further increase risk for deep venous thrombosis and adverse outcome in pregnancy. Factor V Leiden mutation is the most common inherited thrombophilia, occurring in approximately 5% of the White and 1% of the Black populations. Nurses should be knowledgeable about screening for and diagnosis of factor V Leiden mutation, risk reduction counseling, recommended care of the affected patient, and implications of anticoagulant therapy during the perinatal period.
Directory of Open Access Journals (Sweden)
Jose Manuel Vazquez-Guillen
Full Text Available Although Structured Treatment Interruptions (STI are currently not considered an alternative strategy for antiretroviral treatment, their true benefits and limitations have not been fully established. Some studies suggest the possibility of improving the quality of life of patients with this strategy; however, the information that has been obtained corresponds mostly to studies conducted in adults, with a lack of knowledge about its impact on children. Furthermore, mutations associated with antiretroviral resistance could be selected due to sub-therapeutic levels of HAART at each interruption period. Genotyping methods to determine the resistance profiles of the infecting viruses have become increasingly important for the management of patients under STI, thus low-abundance antiretroviral drug-resistant mutations (DRM's at levels under limit of detection of conventional genotyping (<20% of quasispecies could increase the risk of virologic failure. In this work, we analyzed the protease and reverse transcriptase regions of the pol gene by ultra-deep sequencing in pediatric patients under STI with the aim of determining the presence of high- and low-abundance DRM's in the viral rebounds generated by the STI. High-abundance mutations in protease and high- and low-abundance mutations in reverse transcriptase were detected but no one of these are directly associated with resistance to antiretroviral drugs. The results could suggest that the evaluated STI program is virologically safe, but strict and carefully planned studies, with greater numbers of patients and interruption/restart cycles, are still needed to evaluate the selection of DRM's during STI.
International Nuclear Information System (INIS)
Nettles, W.G.; Beraud, R.; Cole, J.D.; Hamilton, J.H.; Ramayya, A.V.; Spejewski, E.H.; Sastry, K.S.R.
1977-01-01
Levels in 184 Au were investigated by e--γ--t and γ--γ--t coincidence techniques. A level scheme with eight definite and two tentative levels is presented; gamma branching ratios are shown. The state at 156 keV was found to have a lifetime of 36 +- 6 ns; for four of the next five levels, T 1 / 2 was less than 2 ns. 2 figures
Clinical Outcomes of Lung Transplantation in Patients with Telomerase Mutations
Tokman, Sofya; Singer, Jonathan P.; Devine, Megan S.; Westall, Glen P.; Aubert, John-David; Tamm, Michael; Snell, Gregory I.; Lee, Joyce S.; Goldberg, Hilary J.; Kukreja, Jasleen; Golden, Jeffrey A.; Leard, Lorriana E.; Garcia, Christine K.; Hays, Steven R.
2017-01-01
Background Successful lung transplantation (LT) for patients with pulmonary fibrosis from telomerase mutations is limited by systemic complications of telomerase dysfunction including myelosuppression, cirrhosis, and malignancy. We describe clinical outcomes among 14 LT recipients with telomerase mutations. Methods Subjects underwent LT between February 2005 and April 2014 at 5 LT centers. We abstracted data from medical records, focusing on outcomes reflecting post-LT treatment effects likely to be complicated by telomerase mutations. Results The median age of subjects was 60.5 years (IQR 52.0–62.0), 64.3% were male, and the mean post-LT observation time was 3.2 years (SD ±2.9). Eleven subjects had a mutation in telomerase reverse transcriptase, 2 in telomerase RNA component, and 1 had an uncharacterized mutation. Ten subjects were leukopenic post-LT; leukopenia prompted cessation of mycophenolate mofetil in 5 and treatment with filgrastim in 4. Six subjects had recurrent lower respiratory tract infections (LRTI), 7 had acute cellular rejection (ACR) (A1), and 4 developed chronic lung allograft dysfunction (CLAD). Ten LT recipients developed chronic renal insufficiency and 8 experienced acute, reversible renal failure. Three developed cancer, none had cirrhosis. Thirteen subjects were alive at data censorship. Conclusions The clinical course for LT recipients with telomerase mutations is complicated by renal disease, leukopenia prompting a change in the immunosuppressive regimen, and recurrent LTRI. In contrast, cirrhosis was absent, ACR was mild, and development of CLAD was comparable to other LT populations. While posing challenges, lung transplantation may be feasible for patients with pulmonary fibrosis due to telomerase mutations. PMID:26169663
KRAS mutation is a predictor of oxaliplatin sensitivity in colon cancer cells.
Directory of Open Access Journals (Sweden)
Yu-Lin Lin
Full Text Available Molecular biomarkers to determine the effectiveness of targeted therapies in cancer treatment have been widely adopted in colorectal cancer (CRC, but those to predict chemotherapy sensitivity remain poorly defined. We tested our hypothesis that KRAS mutation may be a predictor of oxaliplatin sensitivity in CRC. KRAS was knocked-down in KRAS-mutant CRC cells (DLD-1(G13D and SW480(G12V by small interfering RNAs (siRNA and overexpressed in KRAS-wild-type CRC cells (COLO320DM by KRAS-mutant vectors to generate paired CRC cells. These paired CRC cells were tested by oxaliplatin, irinotecan and 5FU to determine the change in drug sensitivity by MTT assay and flow cytometry. Reasons for sensitivity alteration were further determined by western blot and real-time quantitative reverse transcriptase polymerase chain reaction (qRT -PCR. In KRAS-wild-type CRC cells (COLO320DM, KRAS overexpression by mutant vectors caused excision repair cross-complementation group 1 (ERCC1 downregulation in protein and mRNA levels, and enhanced oxaliplatin sensitivity. In contrast, in KRAS-mutant CRC cells (DLD-1(G13D and SW480(G12V, KRAS knocked-down by KRAS-siRNA led to ERCC1 upregulation and increased oxaliplatin resistance. The sensitivity of irinotecan and 5FU had not changed in the paired CRC cells. To validate ERCC1 as a predictor of sensitivity for oxaliplatin, ERCC1 was knocked-down by siRNA in KRAS-wild-type CRC cells, which restored oxaliplatin sensitivity. In contrast, ERCC1 was overexpressed by ERCC1-expressing vectors in KRAS-mutant CRC cells, and caused oxaliplatin resistance. Overall, our findings suggest that KRAS mutation is a predictor of oxaliplatin sensitivity in colon cancer cells by the mechanism of ERCC1 downregulation.
Directory of Open Access Journals (Sweden)
Liu Tiantian
2010-05-01
Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
The second activating glucokinase mutation (A456V)
DEFF Research Database (Denmark)
Christesen, Henrik B T; Jacobsen, Bendt B; Odili, Stella
2002-01-01
for mutations in candidate genes revealed a heterozygous glucokinase mutation in exon 10, substituting valine for alanine at codon 456 (A456V) in the proband and his mother. The purified recombinant glutathionyl S-transferase fusion protein of the A456V glucokinase revealed a decreased glucose S(0.5) (the...
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Barate, R; Décamp, D; Ghez, P; Goy, C; Lees, J P; Lucotte, A; Minard, M N; Nief, J Y; Pietrzyk, B; Boix, G; Casado, M P; Chmeissani, M; Crespo, J M; Delfino, M C; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Morawitz, P; Park, I C; Pascual, A; Perlas, J A; Riu, I; Sánchez, F; Colaleo, A; Creanza, D; De Palma, M; Gelao, G; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Alemany, R; Becker, U; Bright-Thomas, P G; Casper, David William; Cattaneo, M; Cerutti, F; Ciulli, V; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Hagelberg, R; Hansen, J B; Harvey, J; Janot, P; Jost, B; Lehraus, Ivan; Mato, P; Minten, Adolf G; Moneta, L; Pacheco, A; Pusztaszeri, J F; Ranjard, F; Rolandi, Luigi; Rousseau, D; Schlatter, W D; Schmitt, M; Schneider, O; Tejessy, W; Teubert, F; Tomalin, I R; Vreeswijk, M; Wachsmuth, H W; Wagner, A; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Proriol, J; Rosnet, P; Fearnley, Tom; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Rumpf, M; Valassi, Andrea; Videau, H L; Boccali, T; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Hühn, T; Jaffe, D E; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Felici, G; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Curtis, L; Dorris, S J; Halley, A W; Lynch, J G; Negus, P; O'Shea, V; Raine, C; Scarr, J M; Smith, K; Teixeira-Dias, P; Thompson, A S; Thomson, E; Thomson, F; Ward, J; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Graefe, G; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Martin, E B; Marinelli, N; Moutoussi, A; Nash, J; Sedgbeer, J K; Spagnolo, P; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Betteridge, A P; Bowdery, C K; Buck, P G; Colrain, P; Crawford, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Whelan, E P; Williams, M I; Giehl, I; Hoffmann, C; Jakobs, K; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Van Gemmeren, P; Zeitnitz, C; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Bujosa, G; Carr, J; Coyle, P; Ealet, A; Fouchez, D; Leroy, O; Motsch, F; Payre, P; Talby, M; Sadouki, A; Thulasidas, M; Tilquin, A; Trabelsi, K; Aleppo, M; Antonelli, M; Ragusa, F; Berlich, R; Blum, Walter; Büscher, V; Dietl, H; Ganis, G; Gotzhein, C; Kroha, H; Lütjens, G; Lutz, Gerhard; Mannert, C; Männer, W; Moser, H G; Richter, R H; Rosado-Schlosser, A; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Höcker, A; Jacholkowska, A; Kado, M; Kim, D W; Le Diberder, F R; Lefrançois, J; Lutz, A M; Schune, M H; Serin, L; Tournefier, E; Veillet, J J; Videau, I; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Bozzi, C; Calderini, G; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Steinberger, Jack; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Bryant, L M; Chambers, J T; Coles, J; Green, M G; Medcalf, T; Perrodo, P; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Haywood, S; Maley, P; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Faïf, G; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Przysiezniak, H; Rander, J; Renardy, J F; Rosowsky, A; Roussarie, A; Trabelsi, A; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Brew, C A J; Cartwright, S L; Combley, F; Kelly, M S; Lehto, M H; Reeve, J; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Cowan, G D; Foss, J; Grupen, Claus; Smolik, L; Stephan, F; Apollonio, M; Bosisio, L; Della Marina, R; Giannini, G; Gobbo, B; Musolino, G; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Charles, E; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Greening, T C; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nachtman, J M; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Wu Sau Lan; Wu, X; Yamartino, J M; Zobernig, G
1998-01-01
The four jet topology is analysed in the ALEPH data taken between November 1995 and November 1997, at centre-of-mass energies ranging from 130 to 184 GeV. While an unexpected accumulation of events with a dijet mas sum around 105 GeV/c**2 had been observed during the first run in 1995 at 130/136 GeV, corresponding to an integrated luminosity of 5.7 pb-1, no significant differences between data and standard model prediction is noticed, either in the high energy runs (81.1 pb-1 taken at centre-of-mass energies from 161 to 184 GeV) or in the 7.1 pb-1 recorded during a new short run at 130/136 GeV in 1997. We have found no other explanation for the earlier reported ``four jet anomaly'' than a statistical fluctuation.
ALEPH Collaboration; Barate, R.; Buskulic, D.; Decamp, D.; Ghez, P.; Goy, C.; Lees, J.-P.; Lucotte, A.; Minard, M.-N.; Nief, J.-Y.; Pietrzyk, B.; Boix, G.; Casado, M. P.; Chmeissani, M.; Crespo, J. M.; Delfino, M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, Ll.; Graugès, E.; Juste, A.; Martinez, M.; Merino, G.; Miquel, R.; Mir, Ll. M.; Morawitz, P.; Park, I. C.; Pascual, A.; Perlas, J. A.; Riu, I.; Sanchez, F.; Colaleo, A.; Creanza, D.; de Palma, M.; Gelao, G.; Iaselli, G.; Maggi, G.; Maggi, M.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Alemany, R.; Becker, U.; Bright-Thomas, P.; Casper, D.; Cattaneo, M.; Cerutti, F.; Ciulli, V.; Dissertori, G.; Drevermann, H.; Forty, R. W.; Frank, M.; Gianotti, F.; Hagelberg, R.; Hansen, J. B.; Harvey, J.; Janot, P.; Jost, B.; Lehraus, I.; Mato, P.; Minten, A.; Moneta, L.; Pacheco, A.; Pusztaszeri, J.-F.; Ranjard, F.; Rolandi, L.; Rousseau, D.; Schlatter, D.; Schmitt, M.; Schneider, O.; Tejessy, W.; Teubert, F.; Tomalin, I. R.; Vreeswijk, M.; Wachsmuth, H.; Wagner, A.; Ajaltouni, Z.; Badaud, F.; Chazelle, G.; Deschamps, O.; Falvard, A.; Ferdi, C.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.-C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rosnet, P.; Fearnley, T.; Hansen, J. D.; Hansen, J. R.; Hansen, P. H.; Nilsson, B. S.; Rensch, B.; Wäänänen, A.; Daskalakis, G.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Blondel, A.; Brient, J.-C.; Machefert, F.; Rougé, A.; Rumpf, M.; Valassi, A.; Videau, H.; Boccali, T.; Focardi, E.; Parrini, G.; Zachariadou, K.; Cavanaugh, R.; Corden, M.; Georgiopoulos, C.; Huehn, T.; Jaffe, D. E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G. P.; Passalacqua, L.; Pepe-Altarelli, M.; Curtis, L.; Dorris, S. J.; Halley, A. W.; Lynch, J. G.; Negus, P.; O'Shea, V.; Raine, C.; Scarr, J. M.; Smith, K.; Teixeira-Dias, P.; Thompson, A. S.; Thomson, E.; Thomson, F.; Buchmüller, O.; Dhamotharan, S.; Geweniger, C.; Graefe, G.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E. E.; Putzer, A.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D. M.; Cameron, W.; Dornan, P. J.; Girone, M.; Goodsir, S.; Martin, E. B.; Marinelli, N.; Moutoussi, A.; Nash, J.; Sedgbeer, J. K.; Spagnolo, P.; Williams, M. D.; Ghete, V. M.; Girtler, P.; Kneringer, E.; Kuhn, D.; Rudolph, G.; Betteridge, A. P.; Bowdery, C. K.; Buck, P. G.; Colrain, P.; Crawford, G.; Finch, A. J.; Foster, F.; Hughes, G.; Jones, R. W. L.; Whelan, E. P.; Williams, M. I.; Giehl, I.; Hoffmann, C.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.-G.; van Gemmeren, P.; Zeitnitz, C.; Aubert, J. J.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Carr, J.; Coyle, P.; Ealet, A.; Fouchez, D.; Leroy, O.; Motsch, F.; Payre, P.; Talby, M.; Sadouki, A.; Thulasidas, M.; Tilquin, A.; Trabelsi, K.; Aleppo, M.; Antonelli, M.; Ragusa, F.; Berlich, R.; Blum, W.; Büscher, V.; Dietl, H.; Ganis, G.; Gotzhein, C.; Kroha, H.; Lütjens, G.; Lutz, G.; Mannert, C.; Männer, W.; Moser, H.-G.; Richter, R.; Rosado-Schlosser, A.; Schael, S.; Settles, R.; Seywerd, H.; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Chen, S.; Davier, M.; Duflot, L.; Grivaz, J.-F.; Heusse, Ph.; Höcker, A.; Jacholkowska, A.; Kado, M. M.; Kim, D. W.; Le Diberder, F.; Lefrançois, J.; Lutz, A.-M.; Schune, M.-H.; Serin, L.; Tournefier, E.; Veillet, J.-J.; Videau, I.; Zerwas, D.; Azzurri, P.; Bagliesi, G.; Bettarini, S.; Bozzi, C.; Calderini, G.; dell'Orso, R.; Fantechi, R.; Ferrante, I.; Giassi, A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P. S.; Messineo, A.; Palla, F.; Rizzo, G.; Sanguinetti, G.; Sciabà, A.; Sguazzoni, G.; Steinberger, J.; Tenchini, R.; Vannini, C.; Venturi, A.; Verdini, P. G.; Blair, G. A.; Bryant, L. M.; Chambers, J. T.; Coles, J.; Green, M. G.; Medcalf, T.; Perrodo, P.; Strong, J. A.; von Wimmersperg-Toeller, J. H.; Botterill, D. R.; Clifft, R. W.; Edgecock, T. R.; Haywood, S.; Maley, P.; Norton, P. R.; Thompson, J. C.; Wright, A. E.; Bloch-Devaux, B.; Colas, P.; Fabbro, B.; Faïf, G.; Lançon, E.; Lemaire, M.-C.; Locci, E.; Perez, P.; Przysiezniak, H.; Rander, J.; Renardy, J.-F.; Rosowsky, A.; Roussarie, A.; Trabelsi, A.; Vallage, B.; Black, S. N.; Dann, J. H.; Kim, H. Y.; Konstantinidis, N.; Litke, A. M.; McNeil, M. A.; Taylor, G.; Booth, C. N.; Brew, C. A. J.; Cartwright, S.; Combley, F.; Kelly, M. S.; Lehto, M.; Reeve, J.; Thompson, L. F.; Affholderbach, K.; Böhrer, A.; Brandt, S.; Cowan, G.; Foss, J.; Grupen, C.; Smolik, L.; Stephan, F.; Apollonio, M.; Bosisio, L.; della Marina, R.; Giannini, G.; Gobbo, B.; Musolino, G.; Putz, J.; Rothberg, J.; Wasserbaech, S.; Williams, R. W.; Armstrong, S. R.; Charles, E.; Elmer, P.; Ferguson, D. P. S.; Gao, Y.; González, S.; Greening, T. C.; Hayes, O. J.; Hu, H.; Jin, S.; McNamara, P. A., III; Nachtman, J. M.; Nielsen, J.; Orejudos, W.; Pan, Y. B.; Saadi, Y.; Scott, I. J.; Walsh, J.; Wu, Sau Lan; Wu, X.; Yamartino, J. M.; Zobernig, G.
1998-02-01
The four jet topology is analysed in the ALEPH data taken between November 1995 and October 1997, at centre-of-mass energies ranging from 130 to 184 GeV. While an unexpected accumulation of events with a dijet mass sum around 105 GeV/c2 had been observed during the first run in 1995 at 130/136 GeV, corresponding to an integrated luminosity of 5.7 pb-1, no significant differences between data and standard model prediction is seen, either in the high energy runs (81.1 pb-1 taken at centre-of-mass energies from 161 to 184 GeV) or in the 7.1 pb-1 recorded during a new short run at 130/136 GeV in 1997. We have found no other explanation for the earlier reported ``four jet anomaly'' than a statistical fluctuation.
The mutual dependence of M1 fertility and M2 mutations in rice
International Nuclear Information System (INIS)
Gopinathan Nair, V.
1982-01-01
The mutual dependence of M 1 fertility and M 2 mutations in rice was studied after treatment with gamma rays and EMS. The frequency of chlorophyll mutations increased with decrease in seed fertility when M 1 ears were selected at random. However, at the lowest fertility class the mutation frequency was low. This reduction is attributed to the elimination of mutants in the high sterility class. The mutation yield can therefore be significantly enhanced by selecting M 1 ears of low fertility. The segregation ratio of mutants increased as fertility decreased. Mutation spectrum was however not influenced by M 1 fertility. This makes selection for fertility quite ineffective in altering the mutation spectrum. (author)
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Karchava, Marine; Pulver, Wendy; Smith, Lou; Philpott, Sean; Sullivan, Timothy J.; Wethers, Judith; Parker, Monica M.
2010-01-01
Summary Prevalence studies indicate that transmission of drug-resistant HIV has been rising in the adult population, but data from the perinatally infected pediatric population are limited. In this retrospective study, we sequenced the pol region of HIV from perinatally infected infants diagnosed in New York State in 2001–2002. Analyses of drug resistance, subtype diversity, and perinatal antiretroviral exposure were conducted, and the results were compared with those from a previous study of HIV-infected infants identified in 1998–1999. Eight of 42 infants (19.1%) had provirus carrying at least 1 drug-resistance mutation, an increase of 58% over the 1998–1999 results. Mutations conferring resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors were detected in 7.1%, 11.9%, and 2.4% of specimens, respectively. Consistent with previous results, perinatal antiretroviral exposure was not associated with drug resistance (P = 0.70). Phylogenetic analysis indicated that 16.7% of infants were infected with a non–subtype B strain of HIV. It seems that drug-resistant and non–subtype B strains of HIV are becoming increasingly common in the perinatally infected population. Our results highlight the value of resistance testing for all HIV-infected infants upon diagnosis and the need to consider subtype diversity in diagnostic and treatment strategies. PMID:16868498
Directory of Open Access Journals (Sweden)
Rodrigo Pessôa
Full Text Available An improved understanding of the prevalence of low-abundance transmitted drug-resistance mutations (TDRM in therapy-naïve HIV-1-infected patients may help determine which patients are the best candidates for therapy. In this study, we aimed to obtain a comprehensive picture of the evolving HIV-1 TDRM across the massive parallel sequences (MPS of the viral entire proviral genome in a well-characterized Brazilian blood donor naïve to antiretroviral drugs.The MPS data from 128 samples used in the analysis were sourced from Brazilian blood donors and were previously classified by less-sensitive (LS or "detuned" enzyme immunoassay as non-recent or longstanding HIV-1 infections. The Stanford HIV Resistance Database (HIVDBv 6.2 and IAS-USA mutation lists were used to interpret the pattern of drug resistance. The minority variants with TDRM were identified using a threshold of ≥ 1.0% and ≤ 20% of the reads sequenced. The rate of TDRM in the MPS data of the proviral genome were compared with the corresponding published consensus sequences of their plasma viruses.No TDRM were detected in the integrase or envelope regions. The overall prevalence of TDRM in the protease (PR and reverse transcriptase (RT regions of the HIV-1 pol gene was 44.5% (57/128, including any mutations to the nucleoside analogue reverse transcriptase inhibitors (NRTI and non-nucleoside analogue reverse transcriptase inhibitors (NNRTI. Of the 57 subjects, 43 (75.4% harbored a minority variant containing at least one clinically relevant TDRM. Among the 43 subjects, 33 (76.7% had detectable minority resistant variants to NRTIs, 6 (13.9% to NNRTIs, and 16 (37.2% to PR inhibitors. The comparison of viral sequences in both sources, plasma and cells, would have detected 48 DNA provirus disclosed TDRM by MPS previously missed by plasma bulk analysis.Our findings revealed a high prevalence of TDRM found in this group, as the use of MPS drastically increased the detection of these
Directory of Open Access Journals (Sweden)
Hugues Charest
Full Text Available BACKGROUND: HIV drug resistance represents a major threat for effective treatment. We assessed the trends in the frequency of drug resistance mutations and the monitored viral load (VL in treatment-naïve (TN and treatment-experienced (TE individuals infected with HIV-1 in Québec, Canada, between 2001 and 2011. METHODS AND FINDINGS: Resistance data were obtained from 4,105 and 5,086 genotypic tests performed on TN and TE patients, respectively. Concomitantly, 274,161 VL tests were carried out in the Province. Changes over time in drug resistance frequency and in different categories of VL were assessed using univariate logistic regression. Multiple logistic regression was used to evaluate associations between the rates of certain mutations and antiretroviral prescriptions. From 2001 to 2011, the proportion of undetectable VL test results continually increased, from 42.1% to 75.9%, while a significant decrease in the frequency of resistance mutations associated with protease inhibitors [PI (from 54% to 16%], nucleoside [NRTI (from 78% to 37% and non-nucleoside reverse transcriptase inhibitors [NNRTI (from 44% to 31%] was observed in TE patients. In TN individuals, the overall frequency of transmitted drug resistance was 13.1%. A multiple logistic regression analysis indicated that the introduction of co-formulated emtricitabine/tenofovir or emtricitabine/tenofovir/efavirenz was positively associated with the decrease of the frequency of the M184I/V mutations observed overtime (p = 0.0004. CONCLUSIONS: We observed a significant decrease in the frequency of drug resistance mutations in TE patients, concomitant with a decrease in the proportion of patients with detectable viremia. These findings may be related to both the increased potencies and adherence to therapy associated with newer antiretroviral regimens. Nevertheless, our data demonstrate that broad use of antiretrovirals does not increase the level of circulating drug resistant
Chen, L; Ding, X P; Wei, X; Li, L X
2014-03-12
We investigated the molecular genetic mechanism of sex reversal by exploring the relationship between mutations in the sex-determining genes SRY, SOX9, and DAX1 with genetic sex reversal disease. Mutations in the three key genes were detected by polymerase chain reaction (PCR) and sequencing after karyotype analysis. The mutations detected were then aligned with a random sample of 100 normal sequences and the NCBI sequence database in order to confirm any new mutations. Furthermore, the copy number of SOX9 was measured by fluorescence quantitative PCR. Seven of the 10 male sex reversal patients (46, XX) contained an excess copy of the SRY gene, while one of the eight female sex reversal patients (46, XY) was lacking the SRY gene. Additionally, a new mutation (T-A, Asp24Lys) was detected in one female sex reversal patient (46, XY). No other mutation was detected in the analysis of SOX9 and DAX1, with the exception of an insertion mutation (c.35377791insG) found in the testicular-specific enhancer (TESCO) sequences in an SRY-positive female sex reversal patient (46, XY). Eight of the 18 sex reversal cases (44.4%) showed obvious connections with SRY gene translocations, mutations, or deletions, which was significantly higher than that reported previously (33.3%), indicating a need to further expand the range of sample collection. Overall, these results indicated that the main mechanism of sex reversal are not associated with mutations in the coding regions of SOX9 and DAX1 or copy number variations of SOX9, which is consistent with results of previous studies.
21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...
Porter, Danielle P; Daeumer, Martin; Thielen, Alexander; Chang, Silvia; Martin, Ross; Cohen, Cal; Miller, Michael D; White, Kirsten L
2015-12-07
At Week 96 of the Single-Tablet Regimen (STaR) study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF) developed resistance mutations compared to those treated with efavirenz (EFV)/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq) was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33), as well as baseline samples from control subjects with virologic response (n = 118). Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20%) were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.
Directory of Open Access Journals (Sweden)
Danielle P. Porter
2015-12-01
Full Text Available At Week 96 of the Single-Tablet Regimen (STaR study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF developed resistance mutations compared to those treated with efavirenz (EFV/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33, as well as baseline samples from control subjects with virologic response (n = 118. Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20% were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
Directory of Open Access Journals (Sweden)
Stefanou Nikolaos
2010-08-01
Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.
Directory of Open Access Journals (Sweden)
Soo-Yon Rhee
2017-04-01
Full Text Available Tenofovir disoproxil fumarate (TDF genotypic resistance defined by K65R/N and/or K70E/Q/G occurs in 20% to 60% of individuals with virological failure (VF on a WHO-recommended TDF-containing first-line regimen. However, the full spectrum of reverse transcriptase (RT mutations selected in individuals with VF on such a regimen is not known. To identify TDF regimen-associated mutations (TRAMs, we compared the proportion of each RT mutation in 2873 individuals with VF on a WHO-recommended first-line TDF-containing regimen to its proportion in a cohort of 50,803 antiretroviral-naïve individuals. To identify TRAMs specifically associated with TDF-selection pressure, we compared the proportion of each TRAM to its proportion in a cohort of 5805 individuals with VF on a first-line thymidine analog-containing regimen. We identified 83 TRAMs including 33 NRTI-associated, 40 NNRTI-associated, and 10 uncommon mutations of uncertain provenance. Of the 33 NRTI-associated TRAMs, 12 – A62V, K65R/N, S68G/N/D, K70E/Q/T, L74I, V75L, and Y115F – were more common among individuals receiving a first-line TDF-containing compared to a first-line thymidine analog-containing regimen. These 12 TDF-selected TRAMs will be important for monitoring TDF-associated transmitted drug-resistance and for determining the extent of reduced TDF susceptibility in individuals with VF on a TDF-containing regimen.
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
APOBEC3G inhibits elongation of HIV-1 reverse transcripts.
Directory of Open Access Journals (Sweden)
Kate N Bishop
2008-12-01
Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.
International Nuclear Information System (INIS)
Yamamoto, Kazuo
1985-01-01
The effect of photoreactivation of the ultraviolet radiation induced reversion of a trpE9777 frameshift mutation was studied in a uvr A6 derivative of Escherichia coli K12. Two different photoreactivation treatments were used, one providing a single flash of photoreactivating light and another providing 10 min of light from fluorescent lamps. The reversion frequency of the trpE9777 frameshift mutation was strongly reduced when subsueqently exposed to visible light. The dose modification factor (the ratio of equally effective doses), for cells challenged with single-flash photoreactivation, for survival and induction of reversion to Trp + was 3.6 and 3.4, respectively. UV induction of RecA protein synthesis was not reversed by a single flash of photoreactivation. The dose modification factor for 10 min of fluorescent lamp photoreactivation for survival and for induction of reversion to Trp + was 6.5 and 6.3, respectively. The dose modification factor for 10 min of photoreactivation for induction of RecA protein was 1.7-2.5. Photoreactivation decreased the reversion of trpE9777 and increased survival to the same extent. We concluded that cyclobutyl pyrimidine dimers are the premutagenic lesions of UV mutagenesis of the trpE9777 allele in a uvr A6 background. (orig.)
Directory of Open Access Journals (Sweden)
Mónica Fernández-Cancio
2018-04-01
Full Text Available The CYP17A1 gene regulates sex steroid biosynthesis in humans through 17α-hydroxylase/17,20 lyase activities and is a target of anti-prostate cancer drug abiraterone. In a 46, XY patient with female external genitalia, together with a loss of function mutation S441P, we identified a novel missense mutation V366M at the catalytic center of CYP17A1 which preferentially impaired 17,20 lyase activity. Kinetic experiments with bacterially expressed proteins revealed that V366M mutant enzyme can bind and metabolize pregnenolone to 17OH-pregnenolone, but 17OH-pregnenolone binding and conversion to dehydroepiandrosterone (DHEA was impaired, explaining the patient’s steroid profile. Abiraterone could not bind and inhibit the 17α-hydroxylase activity of the CYP17A1-V366M mutant. Molecular dynamics (MD simulations showed that V366M creates a “one-way valve” and suggests a mechanism for dual activities of human CYP17A1 where, after the conversion of pregnenolone to 17OH-pregnenolone, the product exits the active site and re-enters for conversion to dehydroepiandrosterone. The V366M mutant also explained the effectiveness of the anti-prostate cancer drug abiraterone as a potent inhibitor of CYP17A1 by binding tightly at the active site in the WT enzyme. The V366M is the first human mutation to be described at the active site of CYP17A1 that causes isolated 17,20 lyase deficiency. Knowledge about the specificity of CYP17A1 activities is of importance for the development of treatments for polycystic ovary syndrome and inhibitors for prostate cancer therapy.
Wang, Na; Liu, Tiantian; Sofiadis, Anastasios; Juhlin, C Christofer; Zedenius, Jan; Höög, Anders; Larsson, Catharina; Xu, Dawei
2014-10-01
The telomerase reverse transcriptase (TERT) promoter mutations C228T and C250T have been found in many malignancies, including in thyroid carcinomas. However, it is unclear how early these mutations occur in thyroid tumorigenesis. The study included primary tumors from 58 patients initially diagnosed with follicular thyroid adenoma (FTA), a benign entity, 18 with atypical FTA (AFTA) having an uncertain malignant potential, and 52 with follicular thyroid carcinoma (FTC). Sanger sequencing was used to investigate the mutational status of the TERT promoter. Telomere length and TERT messenger RNA (mRNA) expression were determined using quantitative polymerase chain reaction (PCR). Telomerase activity was assessed using a Telomerase PCR enzyme-linked immunosorbent assay kit. The C228T mutation was identified in 1 of 58 FTA (2%) and 3 of 18 AFTA (17%) samples. These 4 tumors all expressed TERT mRNA and telomerase activity, whereas the majority of C228T-negative adenomas lacked TERT expression (C228T versus wild-type, P = .008). The C228T mutation was associated with NRAS gene mutations (P = .016). The patient with C228T-mutated FTA later developed a scar recurrence and died of FTC, whereas none of the remaining 57 patients with FTA had recurrence. No recurrence occurred in 3 patients with AFTA who carried C228T during the follow-up period (36-285 months). Nine of the 52 FTCs (17%) exhibited the TERT mutation (8 of 9 C228T and 1 of 9 C250T), and the presence of the mutation was associated with shorter patient survival. TERT promoter mutations may occur as an early genetic event in thyroid follicular tumors that have not developed malignant features on routine histopathological workup. © 2014 American Cancer Society.
Heterozygous RTEL1 mutations are associated with familial pulmonary fibrosis.
Kannengiesser, Caroline; Borie, Raphael; Ménard, Christelle; Réocreux, Marion; Nitschké, Patrick; Gazal, Steven; Mal, Hervé; Taillé, Camille; Cadranel, Jacques; Nunes, Hilario; Valeyre, Dominique; Cordier, Jean François; Callebaut, Isabelle; Boileau, Catherine; Cottin, Vincent; Grandchamp, Bernard; Revy, Patrick; Crestani, Bruno
2015-08-01
Pulmonary fibrosis is a fatal disease with progressive loss of respiratory function. Defective telomere maintenance leading to telomere shortening is a cause of pulmonary fibrosis, as mutations in the telomerase component genes TERT (reverse transcriptase) and TERC (RNA component) are found in 15% of familial pulmonary fibrosis (FPF) cases. However, so far, about 85% of FPF remain genetically uncharacterised.Here, in order to identify new genetic causes of FPF, we performed whole-exome sequencing, with a candidate-gene approach, of 47 affected subjects from 35 families with FPF without TERT and TERC mutations.We identified heterozygous mutations in regulator of telomere elongation helicase 1 (RTEL1) in four families. RTEL1 is a DNA helicase with roles in DNA replication, genome stability, DNA repair and telomere maintenance. The heterozygous RTEL1 mutations segregated as an autosomal dominant trait in FPF, and were predicted by structural analyses to severely affect the function and/or stability of RTEL1. In agreement with this, RTEL1-mutated patients exhibited short telomeres in comparison with age-matched controls.Our results provide evidence that heterozygous RTEL1 mutations are responsible for FPF and, thereby, extend the clinical spectrum of RTEL1 deficiency. Thus, RTEL1 enlarges the number of telomere-associated genes implicated in FPF. Copyright ©ERS 2015.
Depression of pyrimidine dimer excision from the aspects of U.V. reversibility of irradiated cells
International Nuclear Information System (INIS)
Slamenova, D.; Slezarikova, V.; Masek, F.
1977-01-01
Depression of pyrimidine dimer excision induced in U.V. irradiated E.coli B/r T - trp - Hcr + cells by preirradiation cultivation in conditions of starving for the essential amino acid and thymine does not increase U.V.-reversibility of irradiated cells and does not influence the time of expression of trp + reversions. The expression of mutations becomes completed in control and prestarved cells prior to restoration of postradiation division. Genetic deficiency leads up to their high sensitivity to the mutagenic activity of U.V. irradiation. Expression of trp + revertants in Hcr - type cells does not become completed until after commencement of the postradiation division of irradiated cells. Prestarved E.coli B/r T - trp - Hcr + cells exhibited depression of excision even with postradiation cultivation in the absence of an essential amino acid, which is associated with greater stability of newly synthesized DNA and overall decrease of the death rate of cells. In postradiation starvation for the essential amino acid E.coli B/r T - trp - Hcr - cells irradiated with low U.V. light doses behaved similarly. Control E.coli B/r T - trp - Hcr + cells, cultivated after irradiation without amino acid, excised pyrimidine dimers; they are characterised by high degradation of newly synthesized DNA and increased death rate of cells. (author)
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley
2014-06-01
Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.
DEFF Research Database (Denmark)
Gagliardi, M; Maynard, S; Bojovic, B
2001-01-01
The CEF-4/9E3 chemokine gene is expressed constitutively in chicken embryo fibroblasts (CEF) transformed by the Rous sarcoma virus (RSV). This aberrant induction is controlled at the transcriptional and post-transcriptional levels. Transcriptional activation depends on multiple elements of the CEF....../EBPbeta binds to a second element located in proximity of the TRE. A mutation of this distal CAAT box impaired the activation of the CEF-4 promoter by pp60(v-src) indicating that this element is also part of the SRU. Using the RCASBP retroviral vector, we expressed a dominant negative mutant of C....../EBPbeta (designated Delta184-C/EBPbeta) in RSV-transformed CEF. Delta184-C/EBPbeta decreased the accumulation of the CEF-4 mRNA and activation of the CEF-4 promoter by pp60(v-src). The induction of the Cox-2 gene (CEF-147) was also reduced by Delta184-C/EBPbeta. The effect of the dominant negative mutant was observed...
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
Degan, Massimo; Bomben, Riccardo; Bo, Michele Dal; Zucchetto, Antonella; Nanni, Paola; Rupolo, Maurizio; Steffan, Agostino; Attadia, Vincenza; Ballerini, Pier Ferruccio; Damiani, Daniela; Pucillo, Carlo; Poeta, Giovanni Del; Colombatti, Alfonso; Gattei, Valter
2004-07-01
Cases of B-cell chronic lymphocytic leukaemia (B-CLL) with mutated (M) IgV(H) genes have a better prognosis than unmutated (UM) cases. We analysed the IgV(H) mutational status of B-CLL according to the features of a canonical somatic hypermutation (SHM) process, correlating this data with survival. In a series of 141 B-CLLs, 124 cases were examined for IgV(H) gene per cent mutations and skewing of replacement/silent mutations in the framework/complementarity-determining regions as evidence of antigen-driven selection; this identified three B-CLL subsets: significantly mutated (sM), with evidence of antigen-driven selection, not significantly mutated (nsM) and UM, without such evidence and IgV(H) gene per cent mutations above or below the 2% cut-off. sM B-CLL patients had longer survival within the good prognosis subgroup that had more than 2% mutations of IgV(H) genes. sM, nsM and UM B-CLL were also characterized for the biased usage of IgV(H) families, intraclonal IgV(H) gene diversification, preference of mutations to target-specific nucleotides or hotspots, and for the expression of enzymes involved in SHM (translesion DNA polymerase zeta and eta and activation-induced cytidine deaminase). These findings indicate the activation of a canonical SHM process in nsM and sM B-CLLs and underscore the role of the antigen in defining the specific clinical and biological features of B-CLL.
Mutations in the SRY, DAX1, SF1 and WNT4 genes in Brazilian sex-reversed patients
Directory of Open Access Journals (Sweden)
S. Domenice
2004-01-01
Full Text Available In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N, was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade.
Gao, Ke; Li, Gang; Qu, Yiping; Wang, Maode; Cui, Bo; Ji, Meiju; Shi, Bingyin; Hou, Peng
2016-02-23
Increasing evidences have implicated somatic gain-of-function mutations at the telomerase reverse transcriptase (TERT) promoter as one of the major mechanisms that promote transcriptional activation of TERT and subsequently maintain telomere length in human cancers including glioma. To investigate the prognostic value of these mutations and telomere length, individually and their coexistence, in gliomas, we analyzed two somatic mutations C228T and C250T in the TERT promoter, relative telomere length (RTL), IDH1 mutation and MGMT methylation in 389 glioma patients, and explored their associations with patient characteristics and clinical outcomes. Our data showed that C228T and C250T mutations were found in 17.0% (66 of 389) and 11.8% (46 of 389) of gliomas, respectively, and these two mutations were mutually exclusive in this cancer. Moreover, they were significantly associated with WHO grade. We also found that the RTL was significant longer in gliomas than in meningiomas and normal brain tissues (Median, 0.89 vs. 0.44 and 0.50; P radiotherapy. Collectively, TERT promoter mutations and long RTL are not only prognostic factors for poor clinical outcomes, but also the predictors of radiotherapy resistance in gliomas.
Directory of Open Access Journals (Sweden)
Wan-Lin Yang
2015-03-01
Full Text Available Transmission of drug-resistant pathogens presents an almost-universal challenge for fighting infectious diseases. Transmitted drug resistance mutations (TDRM can persist in the absence of drugs for considerable time. It is generally believed that differential TDRM-persistence is caused, at least partially, by variations in TDRM-fitness-costs. However, in vivo epidemiological evidence for the impact of fitness costs on TDRM-persistence is rare. Here, we studied the persistence of TDRM in HIV-1 using longitudinally-sampled nucleotide sequences from the Swiss-HIV-Cohort-Study (SHCS. All treatment-naïve individuals with TDRM at baseline were included. Persistence of TDRM was quantified via reversion rates (RR determined with interval-censored survival models. Fitness costs of TDRM were estimated in the genetic background in which they occurred using a previously published and validated machine-learning algorithm (based on in vitro replicative capacities and were included in the survival models as explanatory variables. In 857 sequential samples from 168 treatment-naïve patients, 17 TDRM were analyzed. RR varied substantially and ranged from 174.0/100-person-years;CI=[51.4, 588.8] (for 184V to 2.7/100-person-years;[0.7, 10.9] (for 215D. RR increased significantly with fitness cost (increase by 1.6[1.3,2.0] per standard deviation of fitness costs. When subdividing fitness costs into the average fitness cost of a given mutation and the deviation from the average fitness cost of a mutation in a given genetic background, we found that both components were significantly associated with reversion-rates. Our results show that the substantial variations of TDRM persistence in the absence of drugs are associated with fitness-cost differences both among mutations and among different genetic backgrounds for the same mutation.
Utility of BRAF V600E mutation detection in cytologically indeterminate thyroid nodules
Directory of Open Access Journals (Sweden)
Rowe Leslie R
2006-04-01
Full Text Available Abstract Background Fine needle aspiration (FNA is widely utilized for evaluation of patients with thyroid nodules. However, approximately 30% are indeterminate for malignancy. Recently, a mutation in the BRAF gene has been reported to be the most common genetic event in papillary thyroid carcinoma (PTC. In this retrospective study, we assessed the utility of BRAF V600E mutation detection for refining indeterminate preoperative cytologic diagnoses in patients with PTC. Methods Archival indeterminate thyroid FNAs and corresponding formalin-fixed, paraffin-embedded (FFPE surgical samples with PTC were identified in our patient files. DNA extracted from slide scape lysates and 5 μm FFPE sections were evaluated for the BRAF V600E mutation using LightCycler PCR and fluorescent melting curve analysis (LCPCR. Amplification products that showed deviation from the wild-type genomic DNA melting peak, discordant FNA and FFPE matched pairs, and all benign control samples, underwent direct DNA sequencing. Results A total of 19 indeterminate thyroid FNAs demonstrating PTC on FFPE surgical samples were included in the study. Using BRAF mutation analysis, the preoperative diagnosis of PTC was confirmed in 3/19 (15.8% FNA samples that could not be conclusively diagnosed on cytology alone. However, 9/19 (47.4% FFPE tissue samples were positive for the V600E mutation. Of the discordant pairs, 5/6 FNAs contained less than 50% tumor cells. Conclusion When used with indeterminate FNA samples, BRAF mutation analysis may be a useful adjunct technique for confirming the diagnosis of malignancy in an otherwise equivocal case. However, overall tumor cell content of some archival FNA smear slides is a limiting factor for mutation detection.
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis
BRAF V600E mutational status in bile duct adenomas and hamartomas.
Pujals, Anaïs; Bioulac-Sage, Paulette; Castain, Claire; Charpy, Cécile; Zafrani, Elie Serge; Calderaro, Julien
2015-10-01
Bile duct adenomas (BDA) and bile duct hamartomas (BDH) are benign bile duct lesions considered neoplastic or secondary to ductal plate malformation, respectively. We have reported previously a high prevalence of BRAF V600E mutations detected by allele-specific polymerase chain reaction assay in BDA, and suggested that BDA may be precursors to a subset of intrahepatic cholangiocarcinomas harbouring V600E mutations. The aim of the present study was to assess the existence of BRAF V600E mutations, using immunohistochemical methods, in additional BDA as well as in BDH. Fifteen BDA and 35 BDH were retrieved from the archives of the pathology departments of two French university hospitals. All cases were reviewed by two pathologists specialized in liver diseases. BRAF V600E mutational status was investigated by immunohistochemistry. Mutated BRAF mutant protein was detected in 53% of the BDA and in none of the cases of BDH. Our findings suggest that BDA and BDH are different processes, and that BDA represent true benign neoplasms. They also support the hypothesis that mutated BDA might precede the development of the subset of intrahepatic cholangiocarcinomas harbouring BRAF V600E mutations. © 2015 John Wiley & Sons Ltd.
Gnanasekaran, Ramachandran
2017-11-08
We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.
Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis
2010-01-01
Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
The Association of Factor V Leiden Mutation with Recurrent Pregnancy Loss
International Nuclear Information System (INIS)
Kashif, M.; Saeed, A.
2015-01-01
Objective: To determine the association of factor V Leiden mutation with recurrent pregnancy loss. Methods: The case-control study was conducted at the Department of Haematology, Armed Forces Institute of Pathology, Rawalpindi, Pakistan, from January to June 2012, and comprised women of 18 to 45 years of age who had a history of recurrent pregnancy loss, and controls with no history of pregnancy loss. All the subjects belonged to Punjabi ethnic group. Three ml blood was taken from cases and controls and deoxyribonucleic acid was extracted. In order to identify Factor V Leiden mutation, polymerase chain reaction method was utilised combined with the amplification refractory mutation system. Data was analysed using SPSS 17. Results: Of the 112 subjects, 56(50 percent) were in each of the two groups. The presence of factor V Leiden mutation among the cases was 3(5.4 percent) while it was absent among the controls. The mutation was significantly associated with recurrent pregnancy loss (p=0.017).Recurrent pregnancy loss was higher in cases than controls (p=0.001). Conclusion: Factor V Leiden mutation was significantly associated with recurrent pregnancy loss. It should be considered one of the causes of recurrent pregnancy loss. (author)
Level structures in odd-odd deformed nucleus {sup 184}Ta
Energy Technology Data Exchange (ETDEWEB)
Gowrishankar, R.; Sood, P.C. [Sri Sathya Sai Institute of Higher Learning, Department of Physics, Prasanthinilayam (India)
2016-02-15
A detailed low-energy level scheme of the odd-odd n-rich nucleus {sub 73}{sup 184}Ta{sub 111} is constructed using the well tested Two-Quasiparticle Rotor Model (TQRM) for calculating the bandhead energies of physically admissible 2qp configurations with the inclusion of residual n-p interaction contribution. The presently available data on this level scheme from {sup 184}Hf decay are shown to be in agreement with these calculations. Our analysis concludes that {sup 184}Hf (Q{sub β} = 1340(30) keV) decay admits of 7 additional (to the 3 presently reported) β -branches to {sup 184}Ta with J = 0 or 1 and 8 more physically admissible weak (1f{sup u}) β -branches populating J{sup π} = 2{sup -} levels in {sup 184}Ta. Further, a close examination of our level scheme clearly indicates the existence of a low-lying (E{sub x} = 260(40) keV) high-spin (J{sup π} = 10{sup -}) long-lived isomer in this nucleus. (orig.)
Wang, Chung-Chieh; Huang, Chao-Yuan; Jhuang, Yu-Lin; Chen, Chih-Chi; Jeng, Yung-Ming
2018-04-01
Mutations in FGFR3 and the promoter region of the telomerase reverse transcriptase (TERT) gene have been found frequently in urothelial carcinoma of the urinary bladder. However, related data for papillary urothelial neoplasm of low malignant potential (PUNLMP) are limited. In this study, we investigated the mutation status of the TERT promoter, FGFR3 and HRAS in low-grade papillary urothelial neoplasms and evaluated their prognostic significance. The cases included in this study comprised 21 inverted papillomas, 30 PUNLMPs and 34 low-grade non-invasive papillary urothelial carcinomas (NIPUCs). TERT promoter mutations were observed in 10 (33%) PUNLMPs and 17 (50%) low-grade NIPUCs, but not in any inverted papilloma. FGFR3 mutations were observed more frequently in PUNLMP and low-grade NIPUC than in inverted papillomas (P = 0.009), whereas the opposite trend was noted for HRAS mutations (P low-grade NIPUC (P = 0.530). Notably, PUNLMP cases with TERT promoter mutations had a similar recurrence rate to that in low-grade NIPUC cases (P = 0.487). Our results suggest that the status of the TERT promoter mutation may serve as a biomarker of prognostic stratification in patients with PUNLMP. © 2017 John Wiley & Sons Ltd.
Low prevalence of primary HIV resistance in western Massachusetts.
Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J
2010-01-01
Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.
Quantification and analysis of reverse mutations at the hgprt locus in Chinese hamster ovary cells
Energy Technology Data Exchange (ETDEWEB)
Fuscoe, J.C.; O' Neill, J.P.; Machanoff, R.; Hsie, A.W.
1982-01-01
An assay is described for the quantification of reverse mutations at the hypoxanthine-guanine phosphoribosyltransferase (hgprt) locus in Chinese hamster ovary cells utilizing the selective agent L-azaserine (AS). Conditions are defined in terms of optimal AS concentration, cell density, and phenotypic expression time. After treatment, replicate cultures of 10/sup 6/ cells are allowed a 48-h phenotypic expression time in 100-mm plates. AS (10..mu..M) is then added directly to the growing culture and AS-resistant (AS/sup r/) cells form visible colonies. This assay is used to quantify ICR-191-, ICR-170-, and N-ethyl-N-nitrosourea-induced reversion of independently isolated HGPRT/sup -/ clones. The AS/sup r/ phenotype is characterized both physiologically and biochemically. All AS/sup r/ clones isolated are stably resistant to AS and aminopterin but sensitive to 6-thioguanine. They also have re-expressed HGPRT enzyme. In addition, several revertants are shown to contain altered HGPRT.
Grgic, Ivana; Lunar, Maja M.; Poljak, Mario; Vince, Adriana; Vrakela, Ivana Baca; Planinic, Ana; Seme, Katja; Begovac, Josip
2013-01-01
Abstract The aim of this study was to determine the prevalence of transmitted drug resistance (TDR) in newly diagnosed and treatment-naive HIV-infected patients from Croatia and evaluate a possible contribution of transmission clusters to the spread of resistant virus. The study enrolled treatment-naive HIV-infected patients that entered clinical care at the Croatian Reference Center for HIV/AIDS between 2006 and 2008. The protease gene and a part of the reverse transcriptase gene of the HIV-1 genome were sequenced by using the Trugene HIV-1 Genotyping System. The prevalence of transmitted drug resistance was analyzed by using the surveillance drug resistance mutations (SDRM) list recommended by the WHO in 2009. We report findings for 118 of 180 eligible patients (65.6% coverage). SDRM were detected in 26 of 118 patients (22.0%) who were infected with subtype B and belonged mostly to the men having sex with men (MSM). The majority of patients with primary resistance carried SDRM associated with resistance to nucleoside analogues reverse transcriptase inhibitors (NRTIs, 23 of 118 patients, 19.5%). The most frequently found NRTI SDRM was T215S (17 of 118 patients, 14.4%). SDRM associated with resistance to nonnucleoside reverse transcriptase inhibitors were detected in three (2.5%) patients and primary resistance to protease inhibitors was not detected. Non-B subtypes were detected in 13/118 patients (11%). A total of 12 transmission pairs and eight distinct transmission clusters were identified with the largest cluster harboring sequences from 19 patients; among them all but two were carrying the T215S mutation. This study showed a high prevalence of TDR in newly diagnosed MSM from Croatia and is an important contribution concerning the relationship between local transmission clusters and the spread of resistant virus. PMID:22906365
Directory of Open Access Journals (Sweden)
André F A Santos
Full Text Available BACKGROUND: Although extensive HIV drug resistance information is available for the first 400 amino acids of its reverse transcriptase, the impact of antiretroviral treatment in C-terminal domains of Pol (thumb, connection and RNase H is poorly understood. METHODS AND FINDINGS: We wanted to characterize conserved regions in RT C-terminal domains among HIV-1 group M subtypes and CRF. Additionally, we wished to identify NRTI-related mutations in HIV-1 RT C-terminal domains. We sequenced 118 RNase H domains from clinical viral isolates in Brazil, and analyzed 510 thumb and connection domain and 450 RNase H domain sequences collected from public HIV sequence databases, together with their treatment status and histories. Drug-naïve and NRTI-treated datasets were compared for intra- and inter-group conservation, and differences were determined using Fisher's exact tests. One third of RT C-terminal residues were found to be conserved among group M variants. Three mutations were found exclusively in NRTI-treated isolates. Nine mutations in the connection and 6 mutations in the RNase H were associated with NRTI treatment in subtype B. Some of them lay in or close to amino acid residues which contact nucleic acid or near the RNase H active site. Several of the residues pointed out herein have been recently associated to NRTI exposure or increase drug resistance to NRTI. CONCLUSIONS: This is the first comprehensive genotypic analysis of a large sequence dataset that describes NRTI-related mutations in HIV-1 RT C-terminal domains in vivo. The findings into the conservation of RT C-terminal domains may pave the way to more rational drug design initiatives targeting those regions.
Annunziata, Clorinda; Pezzuto, Francesca; Greggi, Stefano; Ionna, Franco; Losito, Simona; Botti, Gerardo; Buonaguro, Luigi; Buonaguro, Franco M; Tornesello, Maria Lina
2018-03-31
Two recurrent mutations (-124 G > A and -146 G > A) in the core promoter region of the human telomerase reverse transcriptase (TERT) gene create consensus binding sites for ETS transcription factors and cause increased TERT expression in several tumour types. We analyzed TERT promoter mutations and TERT mRNA levels in head and neck cancer, cervical carcinoma and cervical intraepithelial neoplasia (CIN) as well as in C-4I, CaSki, HeLa and SiHa cervical cell lines. Nucleotide sequence analysis of TERT promoter region showed that 33.3% of oral squamous cell carcinoma (SCC) and 16.8% of cervical SCC harboured mutually exclusive G to A transitions at nucleotide position -124 or -146. TERT promoter was mutated at nucleotide -146 (G > A) in SiHa cell line. Other nucleotide changes creating in some cases putative ETS binding sites were more frequent in oral SCC (26.7%) than in cervical carcinoma (4.8%). The frequency of mutations was independent of human papillomavirus (HPV) tumour status in both cervical and oral cancer. Expression of TERT gene was significantly higher in TERT promoter mutated (-124G > A or -146G > A) cervical SCC compared to not mutated SCC irrespective of HPV16 E6 and E7 levels. Such hot spot changes were not detected in oropharyngeal SCC, cervical adenocarcinoma and CIN lesions. Our results suggest that TERT promoter mutations play a relevant role in oral SCC as well as in cervical SCC, besides the already known effect of HPV16 E6 protein on TERT expression. © 2018 UICC.
International Nuclear Information System (INIS)
Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.
1999-01-01
We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Urreizti, Roser; Asteggiano, Carla; Bermudez, Marta; Córdoba, Alfonso; Szlago, Marina; Szlago, Mariana; Grosso, Carola; de Kremer, Raquel Dodelson; Vilarinho, Laura; D'Almeida, Vania; Martínez-Pardo, Mercedes; Peña-Quintana, Luís; Dalmau, Jaime; Bernal, Jaime; Briceño, Ignacio; Couce, María Luz; Rodés, Marga; Vilaseca, Maria Antonia; Balcells, Susana; Grinberg, Daniel
2006-01-01
Classical homocystinuria is due to cystathionine beta-synthase (CBS) deficiency. More than 130 mutations, which differ in prevalence and severity, have been described at the CBS gene. Mutation p.I278T is very prevalent, has been found in all European countries where it has been looked for with the exception of the Iberian peninsula, and is known to respond to vitamin B6. On the other hand, mutation p.T191M is prevalent in Spain and Portugal and does not respond to B6. We analysed 30 pedigrees from Spain, Portugal, Colombia and Argentina, segregating for homocystinuria. The p.T191M mutation was detected in patients from all four countries and was particularly prevalent in Colombia. The number of p.T191M alleles described in this study, together with those previously published, is 71. The prevalence of p.T191M among CBS mutant alleles in the different countries was: 0.75 in Colombia, 0.52 in Spain, 0.33 in Portugal, 0.25 in Venezuela, 0.20 in Argentina and 0.14 in Brazil. Haplotype analyses suggested a double origin for this mutation. No genotype-phenotype correlation other than the B6-nonresponsiveness could be established for the p.T191M mutation. Additionally, three new mutations, p.M173V, p.I429del and c.69_70+8del10, were found. The p.M173V was associated with a mild, B6-responsive, phenotype.
Martin-Odoom, Alexander; Adiku, Theophilus; Delgado, Elena; Lartey, Margaret; Ampofo, William K
2017-03-01
Access to antiretroviral therapy in Ghana has been scaled up across the country over the last decade. This study sought to determine the occurrence of transmitted HIV-1 drug resistance in pregnant HIV-1 positive women yet to initiate antiretroviral therapy at selected HIV Care Centres in Ghana. Plasma specimens from twenty-six (26) HIV seropositive pregnant women who were less than 28weeks pregnant with their first pregnancy and ART naïve were collected from selected HIV care centres in three (3) regions in Ghana. Genotypic testing was done for the reverse transcriptase gene and the sequences generated were analyzed for HIV-1 drug resistance mutations using the Stanford University HIV Drug Resistance Database. Resistance mutations associated with the reverse transcriptase gene were detected in 4 (15.4%) of the participants. At least one major drug resistance mutation in the reverse transcriptase gene was found in 3 (11.5%) of the women. The detection of transmitted HIV-1 drug resistance in this drug-naïve group in two regional HIV care sites is an indication of the need for renewed action in monitoring the emergence of transmitted HIV-1 drug resistance in Ghana. None declared.
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
DEFF Research Database (Denmark)
Krakauer, M.; Sorensen, P.; Khademi, M.
2008-01-01
volunteers served to confirm initial findings. mRNA was analyzed by real-time reverse transcriptase polymerase chain reaction (PCR). RESULTS: We found elevated expression of interleukin (IL)-23 and IL-10 in untreated MS patients. IFN-beta therapy increased IL-10 and decreased IL-23 expression independently...... of the regulatory cytokine IL-10. The elevated IL-23 mRNA levels in MS patients are noteworthy in view of the newly discovered IL-23-driven Th17 T-cell subset, which is crucial in animal models of MS. Since IFN-beta therapy resulted in decreased IL-23 mRNA levels, the Th17 axis could be another target of IFN...
[Genetic mutation and clinical features of osteogenesis imperfecta type V].
Guan, Shizhen; Bai, Xue; Wang, Yi; Liu, Zhigang; Ren, Xiuzhi; Zhang, Tianke; Ju, Mingyan; Li, Keqiu; Li, Guang
2017-12-10
To explore genetic mutations and clinical features of osteogenesis imperfecta type V. Clinical record of five patients (including one familial case) with osteogenesis imperfecta type V were retrospectively analyzed. Peripheral blood samples of the patients, one family member, as well as healthy controls were collected. Mutation of IFITM5 gene was identified by PCR amplification and Sanger sequencing. A heterozygous mutation (c.-14C>T) in the 5-UTR of the IFITM5 gene was identified in all of the patients and one mother. The clinical findings included frequent fractures and spine and/or extremities deformities, absence of dentinogenesis imperfecta, absence of hearing impairment, and blue sclera in 1 case. Radiographic findings revealed calcification of the interosseous membrane between the radius-ulna in all cases. Hyperplastic callus formation was found in 3 cases. Four had radial-head dislocation. A single heterozygous mutation c.-14C>T was found in the 5-UTR of the IFITM5 gene in 5 patients with osteogensis imperfecta type V. The patients showed specific radiological features including calcification of interosseous membrane, hyperplastic callus formation, and radial-head dislocation.
Janjigian, Yelena Y.; Smit, Egbert F.; Groen, Harry J. M.; Horn, Leora; Gettinger, Scott; Camidge, D. Ross; Riely, Gregory J.; Wang, Bushi; Fu, Yali; Chand, Vikram K.; Miller, Vincent A.; Pao, William
EGFR-mutant lung cancers responsive to reversible EGFR inhibitors (gefitinib/erlotinib) develop acquired resistance, mediated by second-site EGFR T790M mutation in >50% of cases. Preclinically, afatinib (irreversible ErbB family blocker) plus cetuximab (anti-EGFR monoclonal antibody) overcomes
Goh, Gerald; Walradt, Trent; Markarov, Vladimir; Blom, Astrid; Riaz, Nadeem; Doumani, Ryan; Stafstrom, Krista; Moshiri, Ata; Yelistratova, Lola; Levinsohn, Jonathan; Chan, Timothy A; Nghiem, Paul; Lifton, Richard P; Choi, Jaehyuk
2016-01-19
Merkel cell carcinoma (MCC) is a rare but highly aggressive cutaneous neuroendocrine carcinoma, associated with the Merkel cell polyomavirus (MCPyV) in 80% of cases. To define the genetic basis of MCCs, we performed exome sequencing of 49 MCCs. We show that MCPyV-negative MCCs have a high mutation burden (median of 1121 somatic single nucleotide variants (SSNVs) per-exome with frequent mutations in RB1 and TP53 and additional damaging mutations in genes in the chromatin modification (ASXL1, MLL2, and MLL3), JNK (MAP3K1 and TRAF7), and DNA-damage pathways (ATM, MSH2, and BRCA1). In contrast, MCPyV-positive MCCs harbor few SSNVs (median of 12.5 SSNVs/tumor) with none in the genes listed above. In both subgroups, there are rare cancer-promoting mutations predicted to activate the PI3K pathway (HRAS, KRAS, PIK3CA, PTEN, and TSC1) and to inactivate the Notch pathway (Notch1 and Notch2). TP53 mutations appear to be clinically relevant in virus-negative MCCs as 37% of these tumors harbor potentially targetable gain-of-function mutations in TP53 at p.R248 and p.P278. Moreover, TP53 mutational status predicts death in early stage MCC (5-year survival in TP53 mutant vs wild-type stage I and II MCCs is 20% vs. 92%, respectively; P = 0.0036). Lastly, we identified the tumor neoantigens in MCPyV-negative and MCPyV-positive MCCs. We found that virus-negative MCCs harbor more tumor neoantigens than melanomas or non-small cell lung cancers (median of 173, 65, and 111 neoantigens/sample, respectively), two cancers for which immune checkpoint blockade can produce durable clinical responses. Collectively, these data support the use of immunotherapies for virus-negative MCCs.
Hamers, Raph L; Sigaloff, Kim C E; Wensing, Annemarie M; Wallis, Carole L; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S; Rinke de Wit, Tobias F; Schuurman, Rob
2012-06-01
Human immunodeficiency virus type 1 (HIV-1) drug resistance may limit the benefits of antiretroviral therapy (ART). This cohort study examined patterns of drug-resistance mutations (DRMs) in individuals with virological failure on first-line ART at 13 clinical sites in 6 African countries and predicted their impact on second-line drug susceptibility. A total of 2588 antiretroviral-naive individuals initiated ART consisting of different nucleoside reverse transcriptase inhibitor (NRTI) backbones (zidovudine, stavudine, tenofovir, or abacavir, plus lamivudine or emtricitabine) with either efavirenz or nevirapine. Population sequencing after 12 months of ART was retrospectively performed if HIV RNA was >1000 copies/mL. The 2010 International Antiviral Society-USA list was used to score major DRMs. The Stanford algorithm was used to predict drug susceptibility. HIV-1 sequences were generated for 142 participants who virologically failed ART, of whom 70% carried ≥1 DRM and 49% had dual-class resistance, with an average of 2.4 DRMs per sequence (range, 1-8). The most common DRMs were M184V (53.5%), K103N (28.9%), Y181C (15.5%), and G190A (14.1%). Thymidine analogue mutations were present in 8.5%. K65R was frequently selected by stavudine (15.0%) or tenofovir (27.7%). Among participants with ≥1 DRM, HIV-1 susceptibility was reduced in 93% for efavirenz/nevirapine, in 81% for lamivudine/emtricitabine, in 59% for etravirine/rilpivirine, in 27% for tenofovir, in 18% for stavudine, and in 10% for zidovudine. Early failure detection limited the accumulation of resistance. After stavudine failure in African populations, zidovudine rather than tenofovir may be preferred in second-line ART. Strategies to prevent HIV-1 resistance are a global priority.
Germline V repertoires: Origin, maintenance, diversification.
Steele, E J; Lindley, R A
2018-06-01
In our view, Melvin Cohn (Scand J Immunol. 2018;87:e12640) has set out the logical guidelines towards a resolution of the very real enigma of the selectability of vertebrate germline Ig V repertoires under the current evolutionary paradigm…" A somatically derived repertoire scrambles this (germline VL + VH) substrate so that its specificities are lost, making it un-selectable in the germline. Consequently, evolution faced an incompatibility." It is argued here in Reply that a reverse transcriptase-based soma-to-germline process (S->G) targeting germline V segment arrays goes some considerable way to resolving fundamental contradictions on the origin, maintenance and then real-time adaptive diversification of these limited sets of V segments encoded within various V repertoire arrays. © 2018 The Foundation for the Scandinavian Journal of Immunology.
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Presence of SNPs in GDF9 mRNA of Iranian Afshari Sheep
Directory of Open Access Journals (Sweden)
Talat Saiedi
2012-01-01
Full Text Available Background: Multiple births occur frequently in some Iranian sheep breeds, while infertilityscarcely occurs. Mutation detection in major fecundity genes has been explored in most of Iraniansheep flocks over the last decade. However, previously reported single nucleotide polymorphisms(SNPs for bone morphogenetic protein receptor-(BMPR-1B and growth differentiation factor GDF9( known to affect fertility have not been detected. This study was conducted to assess whetherany significant mutations in GDF9 were extracted from slaughtered ewe ovaries of Iranian Afsharisheep breed.Materials and Methods: Ovaries defined as poor, fair, and excellent quality based on externalvisual appearance of follicles were used for histology and RNA extraction processes. High qualityRNAs underwent reverse transcriptase-polymerase chain reaction (RT-PCR from GDF9 mRNA,and the products sequenced.Results: No streak ovaries, which are considered indicators of infertility due to homozygocity forsome mutations in GDF9 and BMP15, were found. Sequencing results from GDF9 cDNA showedthat G2 (C471T, G3 (G477A, and G4 (G721A mutations were observed from 1, 4, and 1 out of12 ewes, respectively. Though all 3 mutations were previously reported, this is the first report ontheir presence in Iranian breeds. The first and second mutations do not alter the amino acids, whileG4 is a non-conservative mutation leading to E241K in the prohormone.Conclusion: As the G4 mutation was observed only in ovaries defined superficially as top quality,it could be considered as one of reasons for higher ovulation rate in some sheep. Furthermore sincemultiple mutations were observed in some cases, it might be possible that combinations of minormutations in GDF9 and BMP15 interact to affect fecundity in some Iranian sheep breeds.
Mutation breeding in ornamental plants
International Nuclear Information System (INIS)
Datta, S.K.
1990-01-01
Full text: Mutation induction produced a large number of new promising varieties in ornamental species. 37 new mutants of Chrysanthemum and 14 of rose have been developed by mutations and released for commercialisation. The mutations in flower colour/shape were detected as chimeras in M 1 V 1 , M 1 V 2 , M 1 V 3 generations. The mutation frequency varied with the cultivar and exposure to gamma rays. Comparative analysis of original cultivars and their respective induced mutants on cytomorphological, anatomical and biochemical characters are being carried out for better understanding of the mechanism involved in the origin and evolution of somatic flower colour/shape mutations. Cytological analysis with reference to chromosomal aberrations, chromosome number, ICV, INV and DNA content gave no differences between the original and mutant cultivars. Analysis of florets/petal pigments by TLC and spectrophotometric methods indicated both qualitative and quantitative changes. (author)
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Andrea Hauser
Full Text Available Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS and allele-specific real-time PCR (ASPCR for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT.Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F. In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System.Drug-resistant HIV-variants were identified in 69% (20/29 of women by UDS and in 45% (13/29 by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24. By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41. The proportions of variants quantified by UDS were approximately 2-3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml, resulting in missing or insufficient sequence coverage.Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in the HIV-1 quasispecies.
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
Preclinical test: bacterial reverse mutation test for 18F-fluorocholine produced in CDTN
International Nuclear Information System (INIS)
Mendes, Bruno M.; Bispo, Ana Carolina A.; Campos, Danielle C.; Silva, Juliana B.
2013-01-01
The choline labeled with fluorine-18 (18FCH) is being considered as a great importance radiopharmaceutical due to its effective detection of many type of malignant neoplasm. The research related to 18 F-fluorocholine synthesis in CDTN was initiated in 2010. In order to obtain clinical research approval, as well as to register 18 FCH for marketing, safety and efficacy preclinical testing are required. The present work evaluated the 18 FCH genotoxic potential through the bacterial reverse mutation test (Ames test) using Salmonella typhimurium TA-98, TA-100, TA-1535 and TA-1537 strains and Escherichia coli WP2 uvrA strain. The reverse mutation test in bacteria for fluorcolina was conducted in two stages. Initially the method was applied to 'cold' fluorocholine molecule (19FCH). Subsequently, the decayed product of 18 FCH synthesis was evaluated. The first step was performed in order to examine the FCH molecule mutagenicity. The second was carried out to determine the mutagenic potential of final product. All strains were tested in triplicate for each exposure concentration, in the presence and absence of metabolic activation (S-9 mix - 10%). There were no statistically significant increases in revertant colonies rate for any strains tested after their exposure to decayed 18 FCH or 19 FCH. The number of revertant colonies in positive controls was significantly higher than that observed in significant increases in revertant colonies rate for any strains tested after their exposure to decayed 18 FCH or 19 FCH. The number of revertant colonies in positive controls was significantly higher than that observed in negative controls. Based on results of this assay, 18 FCH and 19 FCH, at tested doses, were found to be non-mutagenic in bacterial reverse mutation test. (author)
Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong
2016-10-01
Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.
Quantitation of the mRNA expression of the epidermal growth factor system
DEFF Research Database (Denmark)
Sørensen, B S; Tørring, N; Bor, M V
2000-01-01
) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...
Vega, Ana Isabel; Pérez-Cerdá, Celia; Abia, David; Gámez, Alejandra; Briones, Paz; Artuch, Rafael; Desviat, Lourdes R; Ugarte, Magdalena; Pérez, Belén
2011-08-01
Deficiency of phosphomannomutase (PMM2, MIM#601785) is the most common congenital disorder of glycosylation. Herein we report the genetic analysis of 22 Spanish PMM2 deficient patients and the functional analysis of 14 nucleotide changes in a prokaryotic expression system in order to elucidate their molecular pathogenesis. PMM2 activity assay revealed the presence of six protein changes with no enzymatic activities (p.R123Q, p.R141H, p.F157S, p.P184T, p.F207S and p.D209G) and seven mild protein changes with residual activities ranging from 16 to 54% (p.L32R, p.V44A p.D65Y, p.P113L p.T118S, p.T237M and p.C241S) and also one variant change with normal activity (p.E197A). The results obtained from Western blot analysis, degradation time courses of 11 protein changes and structural analysis of the PMM2 protein, suggest that the loss-of-function of most mutant proteins is based on their increased susceptibility to degradation or aggregation compared to the wild type protein, considering PMM2 deficiency as a conformational disease. We have identified exclusively catalytic protein change (p.D209G), catalytic protein changes affecting protein stability (p.R123Q and p.R141H), two protein changes disrupting the dimer interface (p.P113L and p.T118S) and several misfolding changes (p.L32R, p.V44A, p.D65Y, p.F157S, p.P184T, p.F207S, p.T237M and p.C241S). Our current work opens a promising therapeutic option using pharmacological chaperones to revert the effect of the characterized misfolding mutations identified in a wide range of PMM2 deficient patients.
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Directory of Open Access Journals (Sweden)
Dib-Hajj Sulayman D
2008-01-01
Full Text Available Abstract Background Primary erythromelalgia is an autosomal dominant pain disorder characterized by burning pain and skin redness in the extremities, with onset of symptoms during the first decade in the families whose mutations have been physiologically studied to date. Several mutations of voltage-gated Na+ channel NaV1.7 have been linked with primary erythromelalgia. Recently, a new substitution NaV1.7/I136V has been reported in a Taiwanese family, in which pain appeared at later ages (9–22 years, with onset at 17 years of age or later in 5 of 7 family members, with relatively slow progression (8–10 years to involvement of the hands. The proband reported onset of symptoms first in his feet at the age of 11, which then progressed to his hands at the age of 19. The new mutation is located in transmembrane segment 1 (S1 of domain I (DI in contrast to all NaV1.7 mutations reported to date, which have been localized in the voltage sensor S4, the linker joining segments S4 and S5 or pore-lining segments S5 and S6 in DI, II and III. Results In this study, we characterized the gating and kinetic properties of I136V mutant channels in HEK293 cells using whole-cell patch clamp. I136V shifts the voltage-dependence of activation by -5.7 mV, a smaller shift in activation than the other erythromelalgia mutations that have been characterized. I136V also decreases the deactivation rate, and generates larger ramp currents. Conclusion The I136V substitution in NaV1.7 alters channel gating and kinetic properties. Each of these changes may contribute to increased excitability of nociceptive dorsal root ganglion neurons, which underlies pain in erythromelalgia. The smaller shift in voltage-dependence of activation of NaV1.7, compared to the other reported cases of inherited erythromelalgia, may contribute to the later age of onset and slower progression of the symptoms reported in association with this mutation.
Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda
2016-06-01
To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.
Walsh, Ann W; Langley, David R; Colonno, Richard J; Tenney, Daniel J
2010-02-12
Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I +/- L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (K(i)) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (k(cat)) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position
Directory of Open Access Journals (Sweden)
Ann W Walsh
Full Text Available BACKGROUND: Entecavir (ETV is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT domain involve lamivudine-resistance (LVDr substitutions in the conserved YMDD motif (M204V/I +/- L180M, plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. METHODS/PRINCIPAL FINDINGS: To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (K(i for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (k(cat in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of
Molecular characterization of three novel Fanconi anemia mutations in Israeli Arabs.
Tamary, Hannah; Dgany, Orly; Toledano, Helen; Shalev, Zvi; Krasnov, Tatyana; Shalmon, Lea; Schechter, Tali; Bercovich, Dani; Attias, Dina; Laor, Ruth; Koren, Ariel; Yaniv, Isaac
2004-05-01
In a previous study, we investigated the molecular basis of Fanconi anemia (FA) in 13 unrelated Israeli Jewish FA patients and identified four ethnicity specific mutations. In the present study we extended our study to Israeli Arab patients. We studied three consanguineous families with nine FA patients and an additional unrelated patient. DNA single-strand conformation polymorphism of each exon of the FANCA and FANCG genes was followed by sequence analysis of the aberrantly migrating fragments and by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of the splice-site mutations identified. Three unique disease-causing mutations were identified: (i) FANCA gross deletion of exons 6-31; (ii) FANCA splice-site mutation IVS 42-2A>C; (iii) FANCG splice-site mutation IVS4+3A>G. Sequence analysis of the FANCA gross deletion revealed recombination between two highly homologous Alu elements. cDNA analysis of the two splice mutations suggested intron 42 retention in FANCA IVS 42-2A>C and exon 4 skipping in FANCG IVS4+3A>G. The clinical condition of eight patients with FANCA mutations was severe. Two unique FANCA mutations and one FANCG mutation were identified in Israeli Arab FA patients. Deletion of FANCA exon 6-31 as in previously described gross deletions was within introns rich in Alu repeats. To the best of our knowledge, the FANCA IVS 42-2A>C mutation is the first in this gene to result in intron retention. Further analysis of FA mutations will enable prenatal diagnosis and a rational therapeutic approach including frequent monitoring and early bone marrow transplantation. Copyright Blackwell Munksgaard 2004.
Huebner, Claudia; Weber, Remeny; Lloydd, Richard
2017-12-01
Melanoma patients with BRAF V600E and V600K mutations show complete or partial response to vemurafenib. Detection assays often scan for the common V600E mutation rather than the rare V600K variant, although this mutation can be found in a high proportion of melanoma patients in the South Pacific. Herein, we describe a BRAF high resolution melting (HRM) assay that can differentiate low level of V600E and V600K mutations using formalin fixed, paraffin embedded (FFPE) reference standards for assay validation. The assay is based on the competitive amplification of differentially melting amplicons (CADMA principle) and has a limit of detection of 0.8% mutant allele for V600K and 1.4% mutant allele for V600E. A differentiation between the two mutations based on the melting profile is possible even at low mutation level. Sixty FFPE specimens were scanned and mutations could be scored correctly as confirmed by castPCR. In summary, the developed HRM assay is suitable for detection of V600K and V600E mutations and proved to be reliable and cost effective in a diagnostic environment. Copyright © 2017 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.
Study of hTERT and Histone 3 Mutations in Medulloblastoma.
Viana-Pereira, Marta; Almeida, Gisele Caravina; Stavale, João Norberto; Malheiro, Susana; Clara, Carlos; Lobo, Patrícia; Pimentel, José; Reis, Rui Manuel
2017-01-01
Hotspot activating mutations of the telomerase reverse transcriptase (hTERT) promoter region were recently described in several tumor types. These mutations lead to enhanced expression of telomerase, being responsible for telomere maintenance and allowing continuous cell division. Additionally, there are alternative telomere maintenance mechanisms, associated with histone H3 mutations, responsible for disrupting the histone code and affecting the regulation of transcription. Here, we investigated the clinical relevance of these mechanistically related molecules in medulloblastoma. Sixty-nine medulloblastomas, formalin fixed and paraffin embedded, from a cohort of patients aged 1.5-70 years, were used to investigate the hotspot mutations of the hTERT promoter region, i.e. H3F3A and HIST1H3B, using Sanger sequencing. We successfully sequenced hTERT in all 69 medulloblastoma samples and identified a total of 19 mutated cases (27.5%). c.-124:G>A and c.-146:G>A mutations were detected, respectively, in 16 and 3 samples. Similar to previous reports, hTERT mutations were more frequent in older patients (p < 0.0001), being found only in 5 patients <20 years of age. In addition, hTERT-mutated tumors were more frequently recurrent (p = 0.026) and hTERT mutations were significantly enriched in tumors located in the right cerebellar hemisphere (p = 0.039). No mutations were found on the H3F3A or HIST1H3B genes. hTERT promoter mutations are frequent in medulloblastoma and are associated with older patients, prone to recurrence and located in the right cerebellar hemisphere. On the other hand, histone 3 mutations do not seem to be present in medulloblastoma. © 2016 S. Karger AG, Basel.
Pardanani, A; Hood, J; Lasho, T; Levine, R L; Martin, M B; Noronha, G; Finke, C; Mak, C C; Mesa, R; Zhu, H; Soll, R; Gilliland, D G; Tefferi, A
2007-08-01
JAK2V617F and MPLW515L/K represent recently identified mutations in myeloproliferative disorders (MPD) that cause dysregulated JAK-STAT signaling, which is implicated in MPD pathogenesis. We developed TG101209, an orally bioavailable small molecule that potently inhibits JAK2 (IC(50)=6 nM), FLT3 (IC(50)=25 nM) and RET (IC(50)=17 nM) kinases, with significantly less activity against other tyrosine kinases including JAK3 (IC(50)=169 nM). TG101209 inhibited growth of Ba/F3 cells expressing JAK2V617F or MPLW515L mutations with an IC(50) of approximately 200 nM. In a human JAK2V617F-expressing acute myeloid leukemia cell line, TG101209-induced cell cycle arrest and apoptosis, and inhibited phosphorylation of JAK2V617F, STAT5 and STAT3. Therapeutic efficacy of TG101209 was demonstrated in a nude mouse model. Furthermore, TG101209 suppressed growth of hematopoietic colonies from primary progenitor cells harboring JAK2V617F or MPL515 mutations.
Identification of HIV Mutation as Diagnostic Biomarker through Next Generation Sequencing.
Shaw, Wen Hui; Lin, Qianqian; Muhammad, Zikry Zhiwei Bin Roslee; Lee, Jia Jun; Khong, Wei Xin; Ng, Oon Tek; Tan, Eng Lee; Li, Peng
2016-07-01
Current clinical detection of Human immunodeficiency virus 1 (HIV-1) is used to target viral genes and proteins. However, the immunoassay, such as viral culture or Polymerase Chain Reaction (PCR), lacks accuracy in the diagnosis, as these conventional assays rely on the stable genome and HIV-1 is a highly-mutated virus. Next generation sequencing (NGS) promises to be transformative for the practice of infectious disease, and the rapidly reducing cost and processing time mean that this will become a feasible technology in diagnostic and research laboratories in the near future. The technology offers the superior sensitivity to detect the pathogenic viruses, including unknown and unexpected strains. To leverage the NGS technology in order to improve current HIV-1 diagnosis and genotyping methods. Ten blood samples were collected from HIV-1 infected patients which were diagnosed by RT PCR at Singapore Communicable Disease Centre, Tan Tock Seng Hospital from October 2014 to March 2015. Viral RNAs were extracted from blood plasma and reversed into cDNA. The HIV-1 cDNA samples were cleaned up using a PCR purification kit and the sequencing library was prepared and identified through MiSeq. Two common mutations were observed in all ten samples. The common mutations were identified at genome locations 1908 and 2104 as missense and silent mutations respectively, conferring S37N and S3S found on aspartic protease and reverse transcriptase subunits. The common mutations identified in this study were not previously reported, therefore suggesting the potential for them to be used for identification of viral infection, disease transmission and drug resistance. This was especially the case for, missense mutation S37N which could cause an amino acid change in viral proteases thus reducing the binding affinity of some protease inhibitors. Thus, the unique common mutations identified in this study could be used as diagnostic biomarkers to indicate the origin of infection as being
Directory of Open Access Journals (Sweden)
Subrata Biswas
Full Text Available Mutations in the cytoplasmic tail (CT of voltage gated sodium channels cause a spectrum of inherited diseases of cellular excitability, yet to date only one mutation in the CT of the human skeletal muscle voltage gated sodium channel (hNaV1.4F1705I has been linked to cold aggravated myotonia. The functional effects of altered regulation of hNaV1.4F1705I are incompletely understood. The location of the hNaV1.4F1705I in the CT prompted us to examine the role of Ca(2+ and calmodulin (CaM regulation in the manifestations of myotonia. To study Na channel related mechanisms of myotonia we exploited the differences in rat and human NaV1.4 channel regulation by Ca(2+ and CaM. hNaV1.4F1705I inactivation gating is Ca(2+-sensitive compared to wild type hNaV1.4 which is Ca(2+ insensitive and the mutant channel exhibits a depolarizing shift of the V1/2 of inactivation with CaM over expression. In contrast the same mutation in the rNaV1.4 channel background (rNaV1.4F1698I eliminates Ca(2+ sensitivity of gating without affecting the CaM over expression induced hyperpolarizing shift in steady-state inactivation. The differences in the Ca(2+ sensitivity of gating between wild type and mutant human and rat NaV1.4 channels are in part mediated by a divergence in the amino acid sequence in the EF hand like (EFL region of the CT. Thus the composition of the EFL region contributes to the species differences in Ca(2+/CaM regulation of the mutant channels that produce myotonia. The myotonia mutation F1705I slows INa decay in a Ca(2+-sensitive fashion. The combination of the altered voltage dependence and kinetics of INa decay contribute to the myotonic phenotype and may involve the Ca(2+-sensing apparatus in the CT of NaV1.4.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
Losekoot, M.; Broekman, A. J.; Breuning, M. H.; de Koning, E. J. P.; Romijn, J. A.; Maassen, J. A.
2005-01-01
To describe the results of mutation analysis of the genes involved in maturity onset diabetes of the young (MODY) types 1-3. Descriptive. In the period July 2000-October 2003 the DNA from 184 possible MODY patients was analysed for the presence of mutations of the genes involved in MODY types 1, 2
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
Liu, Yan-chen; Huang, Ai-long; Hu, Yuan; Hu, Jie-li; Lai, Guo-qi; Zhang, Wen-lu
2011-12-01
To establish a detection method for HBV drug-resistant mutations related to lamivudine, adefovir and entecavir by optimization and assessment of reverse hybridization system. 26 degenerated probes covering 10 drug-resistant hotspots of 3 drugs were synthesized and immobilized on the same positively charged nylon membrane. PCR products labeled with digoxigenin were hybridized with corresponding probes. To improve the sensitivity and specificity, 4 reaction steps of reverse hybridization were optimized including the number of labeled digoxigenin, the energy intensity of UV cross-linking, hybridization and stringency wash conditions. To prove the feasibility, the specificity, sensitivity and accuracy of this system were assessed respectively. Sensitive and specific results are obtained by the optimization of the following 4 reaction steps: the primers labeled with 3 digoxigenin, energy intensity of UV cross-linking for 1500 x 0.1 mJ/cm², hybridization at 42 degrees C and stringency wash with 0.5 x SSC and 0.1% SDS solution at 44 degrees C for 30 min. In the assessment of system, the majority of probes have high specificity. The quantity of PCR product with a concentration of 10 ng/μl or above can be detected by this method. The concordant rate between reverse hybridization and direct sequencing is 93.9% in the clinical sample test. Though the specificity of several probes needs to be improved further, it is a simple, rapid and sensitive method which can detect HBV resistant mutations related to lamivudine, adefovir and entecavir simultaneously. Due to the short distance between 180 and 181, likewise 202 and 204, the sequence of the same probe covers two codon positions, and hybridization will be interfered by each other. To avoid such interference, the possible solution is that probes are designed by arranging and combining various forms of two near codons.
Influence of the factor V Leiden mutation on infectious disease susceptibility and outcome
DEFF Research Database (Denmark)
Benfield, Thomas L; Dahl, Mortens; Nordestgaard, Borge G
2005-01-01
The effect of the coagulation factor V Leiden mutation on infectious disease susceptibility and outcome is controversial.......The effect of the coagulation factor V Leiden mutation on infectious disease susceptibility and outcome is controversial....
In vitro resistance profile of the candidate HIV-1 microbicide drug dapivirine.
Schader, Susan M; Oliveira, Maureen; Ibanescu, Ruxandra-Ilinca; Moisi, Daniela; Colby-Germinario, Susan P; Wainberg, Mark A
2012-02-01
Antiretroviral-based microbicides may offer a means to reduce the sexual transmission of HIV-1. Suboptimal use of a microbicide may, however, lead to the development of drug resistance in users that are already, or become, infected with HIV-1. In such cases, the efficacy of treatments may be compromised since the same (or similar) antiretrovirals used in treatments are being developed as microbicides. To help predict which drug resistance mutations may develop in the context of suboptimal use, HIV-1 primary isolates of different subtypes and different baseline resistance profiles were used to infect primary cells in vitro in the presence of increasing suboptimal concentrations of the two candidate microbicide antiretrovirals dapivirine (DAP) and tenofovir (TFV) alone or in combination. Infections were ongoing for 25 weeks, after which reverse transcriptase genotypes were determined and scrutinized for the presence of any clinically recognized reverse transcriptase drug resistance mutations. Results indicated that suboptimal concentrations of DAP alone facilitated the emergence of common nonnucleoside reverse transcriptase inhibitor resistance mutations, while suboptimal concentrations of DAP plus TFV gave rise to fewer mutations. Suboptimal concentrations of TFV alone did not frequently result in the development of resistance mutations. Sensitivity evaluations for stavudine (d4T), nevirapine (NVP), and lamivudine (3TC) revealed that the selection of resistance as a consequence of suboptimal concentrations of DAP may compromise the potential for NVP to be used in treatment, a finding of potential relevance in developing countries.
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Madeleine Zerbato
Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.
Nonsense mutations in the human β-globin gene affect mRNA metabolism
International Nuclear Information System (INIS)
Baserga, S.J.; Benz, E.J. Jr.
1988-01-01
A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation
Directory of Open Access Journals (Sweden)
Priscila Da Silva Figueiredo Celestino Gomes
Full Text Available The colony stimulating factor-1 receptor (CSF-1R and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs, are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR and facilitated its departure from the kinase domain (KD. In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind.
Da Silva Figueiredo Celestino Gomes, Priscila; Panel, Nicolas; Laine, Elodie; Pascutti, Pedro Geraldo; Solary, Eric; Tchertanov, Luba
2014-01-01
The colony stimulating factor-1 receptor (CSF-1R) and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs), are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR) and facilitated its departure from the kinase domain (KD). In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind. PMID:24828813
RBE-LET relationships of high-LET radiations in drosophila mutations
International Nuclear Information System (INIS)
Yoshikawa, Isao; Takatsuji, Toshihiro; Nagano, Masaaki; Takada, Jun; Endo, Satoru; Hoshi, Masaharu
1999-01-01
The relative biological effectiveness (RBE) of 252 Cf neutrons and synchrotron-generated high-energy charged particles for mutation induction was evaluated as a function of linear energy transfer (LET), using the loss of heterozygosity for wing-hair mutations and the reversion of the mutant white-ivory eye-color in Drosophila melanogaster. Loss of heterozygosity for wing-hair mutations results predominantly from mitotic crossing over induced in wing anlage cells of larvae, while the reverse mutation of eye-color is due to an intragenic structural change (2.96 kb-DNA excision) in the white locus on the X-chromosome. The measurements were performed in a combined mutation assay system so that induced mutant wing-hair clones as well as revertant eye-color clone can be detected simultaneously in the same individual. Larvae were irradiated at the age of 3 days post oviposition with 252 Cf neutrons, carbon beam or neon beam. For the neutron irradiation, the RBE values for wing-hair mutations were larger than that for eye-color mutation by about 7 fold. The RBE of carbon ions for producing the wing-hair mutations increased with increase in LET. The estimated RBE values were found to be in the range 2 to 6.5 for the wing-hair. For neon beam irradiation, the RBE values for wing-hair mutations peak near 150 keV/μm and decrease with further increase in LET. On the other hand, the RBE values for the induction of the eye-color mutation are nearly unity in 252 Cf neutrons and both ions throughout the LET range irradiated. We discuss the relationships between the initial DNA damage and LET in considering the mechanism of somatic mutation induction. (author)
International Nuclear Information System (INIS)
Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.
2006-01-01
Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)
Frequency of factor V Leiden mutation
International Nuclear Information System (INIS)
Nasiruddin; Ali, W.; Rehman, Z.; Anwar, M.; Ayyub, M.; Ali, W.; Ahmed, S.
2005-01-01
Objective: To determine the frequency of factor V Leiden mutation. Design: Observational study. Patients and Methods: Two hundred subjects each of apparently healthy and unrelated Punjabi and Pathan origins were included in the study. Peripheral blood samples were collected in EDTA and DNA extracted by phenol- chloroform extraction method. DNA analysis was done by PCR for restriction fragment length polymorphism. The product was digested overnight with Mn/1 and electrophoresed on acrylamide gel to detect 67 and 153 base pair fragments of factor V Leiden against 37, 67 and 116 base pair fragments of normal factor V. Results: In the 400 subjects studied, only 5 cases of heterozygotes for factor V Leiden were detected. The overall carrier rate was 1.3% (95% CI 0.2-2.2%). The carrier rate in Punjabis and Pathans was 1 % and 1.5% respectively. Conclusion: This study confirms that the prevalence of factor V Leiden is low in Asians and Africans as compared to the European population. (author)
International Nuclear Information System (INIS)
Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong
2007-01-01
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation
Energy Technology Data Exchange (ETDEWEB)
Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn
2007-04-06
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.
Liu, Senquan; Ye, Zhaohui; Gao, Yongxing; He, Chaoxia; Williams, Donna W; Moliterno, Alison; Spivak, Jerry; Huang, He; Cheng, Linzhao
2017-01-01
Activating point mutations in the MPL gene encoding the thrombopoietin receptor are found in 3%-10% of essential thrombocythemia (ET) and myelofibrosis patients. Here, we report the derivation of induced pluripotent stem cells (iPSCs) from an ET patient with a heterozygous MPL V501L mutation. Peripheral blood CD34 + progenitor cells were reprogrammed by transient plasmid expression of OCT4, SOX2, KLF4, c-MYC plus BCL2L1 (BCL-xL) genes. The derived line M494 carries a MPL V501L mutation, displays typical iPSC morphology and characteristics, are pluripotent and karyotypically normal. Upon differentiation, the iPSCs are able to differentiate into cells derived from three germ layers. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Preclinical test: bacterial reverse mutation test for {sup 18}F-fluorocholine produced in CDTN
Energy Technology Data Exchange (ETDEWEB)
Mendes, Bruno M.; Bispo, Ana Carolina A.; Campos, Danielle C.; Silva, Juliana B., E-mail: bmm@cdtn.br, E-mail: acab@cdtn.br, E-mail: dcc@cdtn.br, E-mail: silvajb@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)
2013-07-01
The choline labeled with fluorine-18 (18FCH) is being considered as a great importance radiopharmaceutical due to its effective detection of many type of malignant neoplasm. The research related to {sup 18}F-fluorocholine synthesis in CDTN was initiated in 2010. In order to obtain clinical research approval, as well as to register {sup 18}FCH for marketing, safety and efficacy preclinical testing are required. The present work evaluated the {sup 18}FCH genotoxic potential through the bacterial reverse mutation test (Ames test) using Salmonella typhimurium TA-98, TA-100, TA-1535 and TA-1537 strains and Escherichia coli WP2 uvrA strain. The reverse mutation test in bacteria for fluorcolina was conducted in two stages. Initially the method was applied to 'cold' fluorocholine molecule (19FCH). Subsequently, the decayed product of {sup 18}FCH synthesis was evaluated. The first step was performed in order to examine the FCH molecule mutagenicity. The second was carried out to determine the mutagenic potential of final product. All strains were tested in triplicate for each exposure concentration, in the presence and absence of metabolic activation (S-9 mix - 10%). There were no statistically significant increases in revertant colonies rate for any strains tested after their exposure to decayed {sup 18}FCH or {sup 19}FCH. The number of revertant colonies in positive controls was significantly higher than that observed in significant increases in revertant colonies rate for any strains tested after their exposure to decayed {sup 18}FCH or {sup 19}FCH. The number of revertant colonies in positive controls was significantly higher than that observed in negative controls. Based on results of this assay, {sup 18}FCH and {sup 19}FCH, at tested doses, were found to be non-mutagenic in bacterial reverse mutation test. (author)
Intracellular HIV-1 Gag localization is impaired by mutations in the nucleocapsid zinc fingers
Directory of Open Access Journals (Sweden)
Muriaux Delphine
2007-08-01
Full Text Available Abstract Background The HIV-1 nucleocapsid protein (NC is formed of two CCHC zinc fingers flanked by highly basic regions. HIV-1 NC plays key roles in virus structure and replication via its nucleic acid binding and chaperoning properties. In fact, NC controls proviral DNA synthesis by reverse transcriptase (RT, gRNA dimerization and packaging, and virion assembly. Results We previously reported a role for the first NC zinc finger in virion structure and replication 1. To investigate the role of both NC zinc fingers in intracellular Gag trafficking, and in virion assembly, we generated series of NC zinc fingers mutations. Results show that all Zinc finger mutations have a negative impact on virion biogenesis and maturation and rendered defective the mutant viruses. The NC zinc finger mutations caused an intracellular accumulation of Gag, which was found either diffuse in the cytoplasm or at the plasma membrane but not associated with endosomal membranes as for wild type Gag. Evidences are also provided showing that the intracellular interactions between NC-mutated Gag and the gRNA were impaired. Conclusion These results show that Gag oligomerization mediated by gRNA-NC interactions is required for correct Gag trafficking, and assembly in HIV-1 producing cells and the release of infectious viruses.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
DEFF Research Database (Denmark)
Mens, Helene; Jørgensen, Louise Bruun; Kronborg, Gitte
2009-01-01
BACKGROUND: Little is known about the underlying causes of differences in immunological response to antiretroviral therapy during multidrug-resistant (MDR) HIV type-1 (HIV-1) infection. This study aimed to identify virological factors associated with immunological response during therapy failure...... for analysis. In a longitudinal mixed-effects model, plasma HIV-1 RNA only tended to predict immunological response (P=0.06), whereas minor protease inhibitor (PI) and nucleoside reverse transcriptase (NRTI) mutations at baseline correlated significantly with CD4+ T-cell count slopes (r= -0.56, P=0.04 and r......= -0.64, P=0.008, respectively). Interestingly, synonymous mutations of env correlated inversely with CD4+ T-cell count slopes (r=-0.60; P=0.01) and individuals with codons under positive selection had significantly better CD4+ T-cell responses than individuals without (0.42 versus -5.34; P=0...
Hsiao, Hui-Hua; Yang, Ming-Yu; Liu, Yi-Chang; Lee, Ching-Ping; Yang, Wen-Chi; Liu, Ta-Chih; Chang, Chao-Sung; Lin, Sheng-Fung
2007-11-01
The Janus kinase 2 mutation, JAK2 (V617F), and megakaryocytic mutations, MPL (W515L/K), have been identified and correlated with a subtype of essential thrombocythemia (ET) patients. We investigated the frequency of mutations in ET patients and analyzed the relationship with their clinical features. Fifty-three ET patients were enrolled in the study. The amplification refractory mutation system was applied for the mutation survey of the JAK2V617F, while the polymerase chain reaction with sequencing was used for the mutation survey of MPLW515L/K. Thirty-five (66%) patients harboring the JAK2 (V617F) mutation, including 3 homozygous and 32 heterozygous changes, but no MPLW515L/K mutation, were found. During follow-up, 17 (32.1%) patients suffered from documented thrombotic events, with 15 having JAK2V617F mutations. Statistical analysis showed that patients with the JAK2 mutation had significantly higher leukocytes, hemoglobin level, and thrombotic event (p = 0.043, p = 0.001, and p = 0.029, respectively). Thrombotic events were also significantly correlated with leukocytosis and older age. The JAK2V617F mutation was noted in a certain population of ET patients and correlated with leukocytosis, high hemoglobin level, and thrombosis. Therefore, detection of the JAK2V617F mutation can affect not only the diagnosis, but also the management of ET patients.
Nuzzo, F; Bulato, C; Nielsen, B I; Lee, K; Wielders, S J; Simioni, P; Key, N S; Castoldi, E
2015-03-01
Coagulation factor V (FV) deficiency is a rare autosomal recessive bleeding disorder. We investigated a patient with severe FV deficiency (FV:C mutation in exon 4 (c.578G>C, p.Cys193Ser), predicting the abolition of a conserved disulphide bridge, and an apparently synonymous variant in exon 8 (c.1281C>G). The observation that half of the patient's F5 mRNA lacked the last 18 nucleotides of exon 8 prompted us to re-evaluate the c.1281C>G variant for its possible effects on splicing. Bioinformatics sequence analysis predicted that this transversion would activate a cryptic donor splice site and abolish an exonic splicing enhancer. Characterization in a F5 minigene model confirmed that the c.1281C>G variant was responsible for the patient's splicing defect, which could be partially corrected by a mutation-specific morpholino antisense oligonucleotide. The aberrantly spliced F5 mRNA, whose stability was similar to that of the normal mRNA, encoded a putative FV mutant lacking amino acids 427-432. Expression in COS-1 cells indicated that the mutant protein is poorly secreted and not functional. In conclusion, the c.1281C>G mutation, which was predicted to be translationally silent and hence neutral, causes FV deficiency by impairing pre-mRNA splicing. This finding underscores the importance of cDNA analysis for the correct assessment of exonic mutations. © 2014 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Okada, Gensaku; Kaneko, Ichiro; Mitsui, Hideki.
1987-01-01
The effects of nicotinamide (NA) deficiency and added NA and 3-aminobenzamide (3AB) on the cytotoxicity and the induction of mutations in Chinese hamster V79-14 cells were investigated. In NA deficiency the addition of NA (up to 4 mM) and 3AB (up to 7.5 mM) was not cytotoxic. The presence of NA prior to exposure to mitomycin C (MMC) or γ-rays produced a dose-dependent increase in the relative cloning ability of DNA-damaged cells. The lethality of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was significantly potentiated by pre-treatment with 5 mM 3AB, but no potentiation by 3AB was observed for MMC, ultraviolet (UV)-B light, or γ-rays. Among cells pre-cultured in NA-free medium there were increased frequencies of mutations at both the hypoxanthineguanine phosphoribosyltransferase (HGPRT) and the adenine phosphoribosyltransferase (APRT) loci following DNA damage. The enhancing effect by NA deficiency was time-dependent. Incubation with NA prior to DNA damage produced a significant reduction in the frequency of mutations. The addition of 3AB to the nicotinamide adenine dinucleotide (NAD + )-depleted cell cultures before or after the DNA damage also strongly increased the frequency of induced mutations, with increasing concentrations of 3AB up to 5 mM, but the frequency was reduced at higher concentrations. The interaction between NA deficiency and the addition of 3AB appears to act synergistically on mutation induction. A correlation was observed between the potential of inhibiting poly (ADP-ribose) polymerase and the enhancement of mutation frequency. (author)
Influenza A virus NS1 gene mutations F103L and M106I increase replication and virulence
Directory of Open Access Journals (Sweden)
Ping Jihui
2011-01-01
Full Text Available Abstract Background To understand the evolutionary steps required for a virus to become virulent in a new host, a human influenza A virus (IAV, A/Hong Kong/1/68(H3N2 (HK-wt, was adapted to increased virulence in the mouse. Among eleven mutations selected in the NS1 gene, two mutations F103L and M106I had been previously detected in the highly virulent human H5N1 isolate, A/HK/156/97, suggesting a role for these mutations in virulence in mice and humans. Results To determine the selective advantage of these mutations, reverse genetics was used to rescue viruses containing each of the NS1 mouse adapted mutations into viruses possessing the HK-wt NS1 gene on the A/PR/8/34 genetic backbone. Both F103L and M106I NS1 mutations significantly enhanced growth in vitro (mouse and canine cells and in vivo (BALB/c mouse lungs as well as enhanced virulence in the mouse. Only the M106I NS1 mutation enhanced growth in human cells. Furthermore, these NS1 mutations enhanced early viral protein synthesis in MDCK cells and showed an increased ability to replicate in mouse interferon β (IFN-β pre-treated mouse cells relative to rPR8-HK-NS-wt NS1. The double mutant, rPR8-HK-NS-F103L + M106I, demonstrated growth attenuation late in infection due to increased IFN-β induction in mouse cells. We then generated a rPR8 virus possessing the A/HK/156/97 NS gene that possesses 103L + 106I, and then rescued the L103F + I106M mutant. The 103L + 106I mutations increased virulence by >10 fold in BALB/c mice. We also inserted the avian A/Ck/Beijing/1/95 NS1 gene (the source lineage of the A/HK/156/97 NS1 gene that possesses 103L + 106I, onto the A/WSN/33 backbone and then generated the L103F + I106M mutant. None of the H5N1 and H9N2 NS containing viruses resulted in increased IFN-β induction. The rWSN-A/Ck/Beijing/1/95-NS1 gene possessing 103L and 106I demonstrated 100 fold enhanced growth and >10 fold enhanced virulence that was associated with increased tropism for lung
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. V M Jali. Articles written in Bulletin of Materials Science. Volume 25 Issue 3 June 2002 pp 191-196 Thermal Properties. Synthesis and thermal expansion hysteresis of Ca1–SrZr4P6O24 · Basavaraj Angadi V M Jali M T Lagare N S Kini A M Umarji · More Details Abstract ...
Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R
2018-01-01
The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
Sensitive KIT D816V mutation analysis of blood as a diagnostic test in mastocytosis
DEFF Research Database (Denmark)
Kielsgaard Kristensen, Thomas; Vestergaard, Hanne; Bindslev-Jensen, Carsten
2014-01-01
The recent progress in sensitive KIT D816V mutation analysis suggests that mutation analysis of peripheral blood (PB) represents a promising diagnostic test in mastocytosis. However, there is a need for systematic assessment of the analytical sensitivity and specificity of the approach in order...... to establish its value in clinical use. We therefore evaluated sensitive KIT D816V mutation analysis of PB as a diagnostic test in an entire case-series of adults with mastocytosis. We demonstrate for the first time that by using a sufficiently sensitive KIT D816V mutation analysis, it is possible to detect...... the mutation in PB in nearly all adult mastocytosis patients. The mutation was detected in PB in 78 of 83 systemic mastocytosis (94%) and 3 of 4 cutaneous mastocytosis patients (75%). The test was 100% specific as determined by analysis of clinically relevant control patients who all tested negative. Mutation...
Scherrer, A U; Hasse, B; von Wyl, V; Yerly, S; Böni, J; Bürgisser, P; Klimkait, T; Bucher, H C; Ledergerber, B; Günthard, H F
2009-11-01
Etravirine (ETV) is a novel nonnucleoside reverse transcriptase inhibitor (NNRTI) with reduced cross-resistance to first-generation NNRTIs, which has been primarily studied in randomized clinical trials and not in routine clinical settings. ETV resistance-associated mutations (RAMs) were investigated by analysing 6072 genotypic tests. The antiviral activity of ETV was predicted using different interpretation systems: International AIDS Society-USA (IAS-USA), Stanford, Rega and Agence Nationale de Recherches sur le Sida et les hépatites virales (ANRS). The prevalence of ETV RAMs was higher in NNRTI-exposed patients [44.9%, 95% confidence interval (CI) 41.0-48.9%] than in treatment-naïve patients (9.6%, 95% CI 8.5-10.7%). ETV RAMs in treatment-naïve patients mainly represent polymorphism, as prevalence estimates in genotypic tests for treatment-naïve patients with documented recent (IAS-USA mutations (L100I, K101E/H/P and Y181C/I/V) reduced the treatment response at week 24. Most ETV RAMs in drug-naïve patients are polymorphisms rather than transmitted RAMs. Uncertainty regarding predictions of antiviral activity for ETV in NNRTI-treated patients remains high. The lowest activity was predicted for patients harbouring extensive multidrug-resistant viruses, thus limiting ETV use in those who are most in need.
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Sukrit Silas
2017-07-01
Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.
JAK2V617F mutation is associated with special alleles in essential thrombocythemia.
Hsiao, Hui-Hua; Liu, Yi-Chang; Tsai, Hui-Jen; Lee, Ching-Ping; Hsu, Jui-Feng; Lin, Sheng-Fung
2011-03-01
Janus kinase 2 mutation (JAK2V617F) has been identified in myeloproliferative neoplasms. Furthermore, special single nucleoside polymorphisms (SNPs) have been found to be associated with the JAK2V617F mutation. Therefore, the associations among JAK2V617F and special SNPs and the allelic location between them were investigated in patients with essential thrombocythemia (ET). A total of 61 patients with ET and 106 healthy individuals were enrolled. The PCR-RFLP method was applied to investigate the pattern of three SNPs, rs10974944, rs12343867, and rs12340895. Allele-specific PCR was used to examine the allelic location between rs10974944 and JAK2V617F. Among the patients with ET, 34 (55.7%, 34/61) were JAK2V617F positive (heterozygous) while the other 27 (44.3%, 27/61) were negative, and there were no MPLW515L/K mutations noted. The pattern of special SNPs in JAK2V617F(+) was significantly different from that in normal individuals (p <0.05), while there was no difference between JAK2V617F(-) patients and normal individuals. Allele-specific PCR showed high association of a cis-location between the special G-allele of rs10974944 and JAK2V617F(+). Based on this small numbered study, the results show the association between special SNPs and JAK2V617F mutation and a cis-location between the special G-allelic form of rs10974944 and the JAK2V617F mutation. These data highlight a close relationship between them in patients with ET.
A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques
International Nuclear Information System (INIS)
Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong
2015-01-01
This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)
His+ reversions caused in Salmonella typhimurium by different types of ionizing radiation
International Nuclear Information System (INIS)
Roos, H.; Thomas, W.H.; Fitzek, M.; Kellerer, A.M.
1988-01-01
The yield of his+ reversions in the Ames Salmonella tester strain TA2638 has been determined for 60Co gamma rays, 140 kV X rays, 5.4 keV characteristic X rays, 2.2 MeV protons, 3.1 MeV alpha particles, and 18 MeV/U Fe ions. Inactivation studies were performed with the same radiations. For both mutation and inactivation, the maximum effectiveness per unit absorbed dose was obtained for the characteristic X rays, which have a dose averaged linear energy transfer (LET) of roughly 10 keV/micron. The ratio of the effectiveness of this radiation to gamma rays was 2 for inactivation and about 1.4 for the his+ reversion. For both end points the effectiveness decreases substantially at high LET, i.e., for the alpha particles and the Fe ions. The composition of the bottom and the top agar was the one recommended by Maron and Ames for application in chemical mutagenicity tests. The experiments with the less penetrating radiations differed from the usual protocol by utilization of a technique of plating the bacteria on the surface of the top agar. As in an earlier study greatly enhanced yields of mutations, relative to the spontaneous reversion rate, were obtained in these experiments by performing the irradiations 6 h after plating, which differs from the conventional procedure to irradiate the bacteria shortly after plating
Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães
2017-04-12
The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.
Zeng, Rui-Chao; Jin, Lang-Ping; Chen, En-Dong; Dong, Si-Yang; Cai, Ye-Feng; Huang, Guan-Li; Li, Quan; Jin, Chun; Zhang, Xiao-Hua; Wang, Ou-Chen
2016-04-01
The purpose of this study was to evaluate the potential relationship between Hashimoto's thyroiditis and BRAF(V600E) mutation status in patients with papillary thyroid carcinoma (PTC). A total of 619 patients with PTC who underwent total thyroidectomy with lymph node dissection were enrolled in this study. Univariable and multivariate analyses were used. Hashimoto's thyroiditis was present in 35.9% (222 of 619) of PTCs. Multivariate logistic regressions showed that BRAF(V600E) mutation, sex, extrathyroidal extension, and lymph node metastasis were independent factors for Hashimoto's thyroiditis. Female sex, more frequent extrathyroidal extension, and a higher incidence of lymph node metastasis were significantly associated with PTCs accompanied by BRAF(V600E) mutation without Hashimoto's thyroiditis compared with PTCs accompanied by BRAF(V600E) mutation with Hashimoto's thyroiditis. Hashimoto's thyroiditis was negatively associated with BRAF(V600E) mutation, extrathyroidal extension, and lymph node metastasis. In addition, Hashimoto's thyroiditis was related to less lymph node metastasis and extrathyroidal extension in PTCs with BRAF(V600E) mutation. Therefore, Hashimoto's thyroiditis is a potentially protective factor in PTC. © 2015 Wiley Periodicals, Inc. Head Neck 38: E1019-E1025, 2016. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Mizrokhi, L.Yu.; Georgieva, S.G.; Obolenkova, L.A.; Priimyagi, A.F.; Gerasimova, T.I.; Il'in, Yu.V.
1988-01-01
A segment of the cut locus containing an mdg4 insertion as a result of ct MR and ct MRp10 mutations was cloned. Clones were obtained for the phenotypically different ct MR2 and ct MRpN10 mutants and for stable and unstable revertants. All mutations studied are associated with mdg4 insertion at an identical nucleotide sequence of the cut locus, the same site at which mdg4 is inserted at the ct 6 allele. The ct MRpN line differs from ct MR2 in that the mobile element jockey (3 kbp) is inserted in mdg4. Jockey is represented by about 1,000 copies per genome; it is homogeneous and lacks long terminal repeats (LTRs). In stable ct + reversions, mdg4 is completely excised. In unstable ct + reversions, in which there is a high degree of reverse directed transposition of mdg4 to the cut locus, an LTR of mdg4 is preserved at the site of the mutation. It is a sequence along which new copies of mdg4 or jockey-containing mdg4 are inserted into the genome. The authors discuss a molecular mechanism for transpositional memory involving homologous recombination of the remnant LTR and circular extrachromosomal copies of mdg4
Directory of Open Access Journals (Sweden)
Erich Heidenreich
2016-12-01
Full Text Available Research on the mechanisms of adaptive mutagenesis in resting, i.e. non-replicating cells relies on appropriate mutation assays. Here we provide a novel procedure for the detection of frameshift-reverting mutations in yeast. Proliferation of non-reverted cells in this assay is suppressed by the lack of a fermentable carbon source. The test allele was constructed in a way that the reversions mimic microsatellite instability, a condition often found in cancer cells. We show the cell numbers during these starvation conditions and provide a DNA sequence spectrum of a representative set of revertants. The data in this article support the publication "Glucose starvation as a selective tool for the study of adaptive mutations in Saccharomyces cerevisiae" (Heidenreich and Steinboeck, 2016 [1].
Gyromagnetic ratios of the 4+ and 6+ rotational states of 184W
International Nuclear Information System (INIS)
Alzner, A.; Bodenstedt, E.; Herrmann, C.; Herzog, P.; Muenning, H.; Reif, H.; Vianden, R.; Wrede, U.
1982-01-01
The nuclear Larmor precession has been observed for the 2 + , 4 + and 6 + rotational states of 184 W in the hyperfine field of WFe by application of the TDPAC and the IPAC techniques. A carrier free radioactive source of 184 sup(m)Re alloyed with high purity iron was used for all three measurements. From the Larmor precession observed in the 2 + state by TDPAC ωsub(L) = 944(15) MHz and the known g-factor the hyperfine field Bsup(hf)sub(300K) = f(WFe) = 69.6(27)T was derived. The deviation from the result of a spin echo experiment with 183 WFe extrapolated to room temperature may be caused by the Bohr-Weisskopf effect (hyperfine anomaly). IPAC measurements with the same sample polarized in an external magnetic field of 1.6 T gave for the 4 + and 6 + rotational states: ωsub(L)tau(4 + ) = 0.0609(22) and ωsub(L)tau(6 + ) = 0.00707(98). By use of experimental B(E2)-values the gsub(R)-factors were derived as gsub(R)(4 + ) = +0.276(26) and gsub(R)(6 + ) = +0.270(43). The directional correlation of the 537-384 keV γ-γ cascade has been analysed in terms of an E1/M2/E3 mixture for the K-forbidden 573 keV transition. We obtained the mixing ratios delta(M2/E1) = +0.086(16), delta(E3/E1) = -0.028(5) with the sign convention of Krane and Steffen. (orig.)
FTO, m6 Am , and the hypothesis of reversible epitranscriptomic mRNA modifications.
Mauer, Jan; Jaffrey, Samie R
2018-05-12
The fate of mRNA is regulated by epitranscriptomic nucleotide modifications, the most abundant of which is N 6 -methyladenosine (m 6 A). Although the pattern and distribution of m 6 A in mRNA is mediated by specific methyltransferases, a recent hypothesis is that specific demethylases or 'erasers' allow m 6 A to be dynamically reversed by signaling pathways. In this Review, we discuss the data in support and against this model. New insights into the function of fat mass and obesity-associated protein (FTO), the original enzyme thought to be an m 6 A eraser, reveal that its physiologic target is not m 6 A, but instead is N 6 ,2'-O-dimethyladenosine (m 6 A m ). Another m 6 A demethylase, ALKBH5, appears to have functions limited to sperm development in normal mice. Overall, the majority of the data suggest that m 6 A is generally not reversible, although m 6 A may be susceptible to demethylation in pathophysiological states such as cancer. © 2018 Federation of European Biochemical Societies.
JAK2V617F mutation in chronic myeloid leukemia predicts early disease progression
International Nuclear Information System (INIS)
Pahore, Z.A.A.; Shamsi, T.S.; Taj, M.; Farzana, T.; Ansari, S.H.; Nadeem, M.; Ahmad, M.; Naz, A.
2011-01-01
Objective: To determine the association of JAK2V617F mutation along with BCR-ABL translocation or Philadelphia chromosome in chronic myeloid leukemia with early disease progression to advanced stages (accelerated phase or blast crisis) and poor outcome. Study Design: Case series. Place and Duration of Study: National Institute of Blood Diseases and Bone Marrow Transplantation, Karachi, from February 2008 to August 2009. Methodology: All the newly diagnosed cases of BCR-ABL or Philadelphia positive CML were tested for JAK2V617F mutation by Nested PCR. Demographic data, spleen size, hemoglobin levels, white blood cell and platelet counts were recorded. Independent sample t-test was used for age, haemoglobin level and spleen size. Fisher's exact test was applied to compare disease progression in JAK2V617F mutation positive and negative cases. Results: Out of 45 newly diagnosed cases of CML, 40 were in chronic phase, 01 in accelerated phase and 04 in blast crisis. JAK2V617F mutation was detected in 12 (26.7%) patients; 09 (22.5%) in chronic phase, none in accelerated phase and 03 (75%) in blast crisis. During a mean follow-up of 8 months, 03 patients in chronic phase transformed in blast crisis and 02 into accelerated phase. Overall 08 out of 11 (73%) JAK2V617F positive patients either had advanced disease or showed disease progression. Only 2 of 20 (10%) available patients, negative for the mutation, showed disease progression by transforming into blast crisis (p < 0.001). No statistically significant difference was seen in the age, spleen size, haemoglobin levels, white blood cells and platelets counts in JAK2V617F positive patients. Conclusion: JAK2V617F mutation was detected in 26.7% cases of chronic myeloid leukemia. A significant proportion of them showed early disease progression. (author)
Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato
2012-06-06
Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
International Nuclear Information System (INIS)
Zhu Hanneng; Chen Wenying; Xiong Sidong
2000-01-01
Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)
Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat
2018-01-01
The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.
Liu, Zhao; Yu, Mu-Chuan; Zhao, Rui; Liu, Yan-Feng; Zeng, Jian-Ping; Wang, Xian-Qiang; Tan, Jing-Wang
2015-02-07
To evaluate the feasibility, safety, and efficacy of laparoscopic pancreaticoduodenectomy (LPD) using a reverse-"V" approach with four ports. This is a retrospective study of selected patients who underwent LPD at our center between April 2011 and April 2012. The following data were collected and reviewed: patient characteristics, tumor histology, surgical outcome, resection margins, morbidity, and mortality. All patients were thoroughly evaluated preoperatively by complete hematologic investigations, triple-phase helical computed tomography, upper gastrointestinal endoscopy, and biopsy of ampullary lesions (when present). Magnetic resonance cholangiopancreatography was performed for doubtful cases of lower common bile duct lesions. There was no perioperative mortality. LPD was performed with tumor-free margins in all patients, including patients with pancreatic ductal adenocarcinoma (n = 6), ampullary carcinoma (n = 6), intra-ductal papillary mucinous neoplasm (n = 2), pancreatic cystadenocarcinoma (n = 2), pancreatic head adenocarcinoma (n = 3), and bile duct cancer (n = 2). The mean patient age was 65 years (range, 42-75 years). The median blood loss was 240 mL, and the mean operative time was 368 min. LPD using a reverse-"V" approach can be performed safely and yields good results in elective patients. Our preliminary experience showed that LDP can be performed via a reverse-"V" approach. This approach can be used to treat localized malignant lesions irrespective of histopathology.
International Nuclear Information System (INIS)
Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun
2007-01-01
Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers
Liu, Yutao; Li, Yan; Ou, Qiuxiang; Wu, Xue; Wang, Xiaonan; Shao, Yang W; Ying, Jianming
2018-04-01
Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are promising targeted therapies for EGFR-mutated non-small-cell lung cancer (NSCLC) patients. However, acquired resistance inevitably develops. Comprehensive and dynamic companion genomic diagnosis can gain insights into underlying resistance mechanisms, thereby help oncologists and patients to make informed decision on the potential benefit of the treatment. A 67-year-old male who was initially diagnosed of EGFR L858R-mediated NSCLC received multiple lines of chemotherapy and EGFR TKI therapies after surgery. The EGFR mutational status of individual metastatic lesion was determined by genetic testing of the tumor tissue biopsies using next generation sequencing (NGS) throughout the patient's clinical course. An acquired potentially drug-resistant EGFR mutation was functionally validated in vitro and its sensitivity to different EGFR TKIs was assessed simultaneously. We have identified distinct resistance mechanisms to EGFR blockade in different metastatic lung lesions. Acquired EGFR T790M was first detected that leads to the resistance to the gefitinib treatment. Consequently, osimertinib was administrated and the response lasted until disease progressed. We identified a newly acquired EGFR L718V mutation in one lesion in conjunction with L858R, but not T790M, which showed stable disease on the following erlotinib treatment, while EGFR C797S together with L858R/T790M was detected in the other lesion that continuously progressed. In vitro functional studies demonstrated that EGFR-L858R/L718V confers resistance to osimertinib, but retains sensitivity to the second generation TKI afatinib. We reported that distinct resistance mechanisms could arise in different metastases within the same patient in response to EGFR blockade. We also demonstrated in vitro that EGFR L718V mutation mediates resistance to osimertinib, but retains sensitivity to afatinib. We evidenced that dynamic companion genomic
F4-related mutation and expression analysis of the aminopeptidase N gene in pigs.
Goetstouwers, T; Van Poucke, M; Nguyen, V U; Melkebeek, V; Coddens, A; Deforce, D; Cox, E; Peelman, L J
2014-05-01
Intestinal infections with F4 enterotoxigenic Escherichia coli (ETEC) are worldwide an important cause of diarrhea in neonatal and recently weaned pigs. Adherence of F4 ETEC to the small intestine by binding to specific receptors is mediated by F4 fimbriae. Porcine aminopeptidase N (ANPEP) was recently identified as a new F4 receptor. In this study, 7 coding mutations and 1 mutation in the 3' untranslated region (3' UTR)were identified in ANPEP by reverse transcriptase (RT-) PCR and sequencing using 3 F4 receptor-positive (F4R+) and 2 F4 receptor-negative (F4R-) pigs, which were F4 phenotyped based on the MUC4 TaqMan, oral immunization, and the in vitro villous adhesion assay. Three potential differential mutations (g.2615C > T, g.8214A > G, and g.16875C > G) identified by comparative analysis between the 3 F4R+ and 2 F4R- pigs were genotyped in 41 additional F4 phenotyped pigs. However, none of these 3 mutations could be associated with F4 ETEC susceptibility. In addition, the RT-PCR experiments did not reveal any differential expression or alternative splicing in the small intestine of F4R+ and F4R- pigs. In conclusion, we hypothesize that the difference in F4 binding to ANPEP is due to modifications in its carbohydrate moieties.
Mitochondrial DNA mutation load in a family with the m.8344A>G point mutation and lipomas
DEFF Research Database (Denmark)
Jeppesen, Tina Dysgaard; Al-Hashimi, Noor; Duno, Morten
2017-01-01
Studies have shown that difference in mtDNA mutation load among tissues is a result of postnatal modification. We present five family members with the m.8344A>G with variable phenotypes but uniform intrapersonal distribution of mutation load, indicating that there is no postnatal modification of mt......DNA mutation load in this genotype....
DEFF Research Database (Denmark)
Kielsgaard Kristensen, Thomas; Broesby-Olsen, Sigurd; Vestergaard, Hanne
2013-01-01
Most adults with systemic mastocytosis (SM) carry the somatic KIT D816V mutation, but the occurrence of the mutation in lesional skin remains to be characterized.......Most adults with systemic mastocytosis (SM) carry the somatic KIT D816V mutation, but the occurrence of the mutation in lesional skin remains to be characterized....
Directory of Open Access Journals (Sweden)
Paula González-Alonso
2015-08-01
Full Text Available Mutations in Human Epidermal Growth Factor Receptors (HER are associated with poor prognosis of several types of solid tumors. Although HER-mutation detection methods are currently available, such as Next-Generation Sequencing (NGS, alternative pyrosequencing allow the rapid characterization of specific mutations. We developed specific PCR-based pyrosequencing assays for identification of most prevalent HER2 and HER3 mutations, including S310F/Y, R678Q, L755M/P/S/W, V777A/L/M, 774-776 insertion, and V842I mutations in HER2, as well as M91I, V104M/L, D297N/V/Y, and E332E/K mutations in HER3. We tested 85 Formalin Fixed and Paraffin Embbeded (FFPE samples and we detected three HER2-V842I mutations in colorectal carcinoma (CRC, ovarian carcinoma, and pancreatic carcinoma patients, respectively, and a HER2-L755M mutation in a CRC specimen. We also determined the presence of a HER3-E332K mutation in an urothelial carcinoma sample, and two HER3-D297Y mutations, in both gastric adenocarcinoma and CRC specimens. The D297Y mutation was previously detected in breast and gastric tumors, but not in CRC. Moreover, we found a not-previously-described HER3-E332E synonymous mutation in a retroperitoneal leiomyosarcoma patient. The pyrosequencing assays presented here allow the detection and characterization of specific HER2 and HER3 mutations. These pyrosequencing assays might be implemented in routine diagnosis for molecular characterization of HER2/HER3 receptors as an alternative to complex NGS approaches.
Chen, Sijie; Zhang, Hefei; Wang, Fenghua; Zhang, Wei; Peng, Gang
2016-09-15
Sex determinations are diverse in vertebrates. Although many sex-determining genes and pathways are conserved, the mechanistic roles of these genes and pathways in the genetic sex determination are not well understood. DAX1 (encoded by the NR0B1 gene) is a vertebrate specific orphan nuclear receptor that regulates gonadal development and sexual determination. In human, duplication of the NR0B1 gene leads to male-to-female sex reversal. In mice, Nr0b1 shows both pro-testis and anti-testis functions. We generated inheritable nr0b1 mutation in the zebrafish and found the nr0b1 mutation caused homozygous mutants to develop as fertile males due to female-to-male sex reversal. The nr0b1 mutation did not increase Caspase-3 labeling nor tp53 expression in the developing gonads. Introduction of a tp53 mutation into the nr0b1 mutant did not rescue the sex-reversal phenotype. Further examination revealed reduction in cell proliferation and abnormal somatic cell differentiation in the nr0b1 mutant gonads at the undifferentiated and bi-potential ovary stages. Together, our results suggest nr0b1 regulates somatic cell differentiation and cell proliferation to ensure normal sex development in the zebrafish. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease by haploinsufficiency.
Brockmann, Sarah J; Freischmidt, Axel; Oeckl, Patrick; Müller, Kathrin; Ponna, Srinivas K; Helferich, Anika M; Paone, Christoph; Reinders, Jörg; Kojer, Kerstin; Orth, Michael; Jokela, Manu; Auranen, Mari; Udd, Bjarne; Hermann, Andreas; Danzer, Karin M; Lichtner, Peter; Walther, Paul; Ludolph, Albert C; Andersen, Peter M; Otto, Markus; Kursula, Petri; Just, Steffen; Weishaupt, Jochen H
2018-02-15
Mutations in the mitochondrially located protein CHCHD10 cause motoneuron disease by an unknown mechanism. In this study, we investigate the mutations p.R15L and p.G66V in comparison to wild-type CHCHD10 and the non-pathogenic variant p.P34S in vitro, in patient cells as well as in the vertebrate in vivo model zebrafish. We demonstrate a reduction of CHCHD10 protein levels in p.R15L and p.G66V mutant patient cells to approximately 50%. Quantitative real-time PCR revealed that expression of CHCHD10 p.R15L, but not of CHCHD10 p.G66V, is already abrogated at the mRNA level. Altered secondary structure and rapid protein degradation are observed with regard to the CHCHD10 p.G66V mutant. In contrast, no significant differences in expression, degradation rate or secondary structure of non-pathogenic CHCHD10 p.P34S are detected when compared with wild-type protein. Knockdown of CHCHD10 expression in zebrafish to about 50% causes motoneuron pathology, abnormal myofibrillar structure and motility deficits in vivo. Thus, our data show that the CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease primarily based on haploinsufficiency of CHCHD10. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
Frequency of BRAF V600E Mutation in the Mexican Population of Patients With Metastatic Melanoma
Directory of Open Access Journals (Sweden)
Erika Ruiz-Garcia
2017-06-01
Full Text Available Purpose: The BRAF V600E mutation has been described in melanomas occurring in the Caucasian, European, and Asian populations. However, in the Mexican population, the status and clinical significance of BRAF mutation has not been researched on a large scale. Methods: Consecutive BRAF-tested Mexican patients with metastatic melanoma (n = 127 were analyzed for mutations in exon 15 of the BRAF gene in genomic DNA by real-time polymerase chain reaction technology for amplification and detection. The results were correlated with the clinical-pathologic features and the prognosis of the patients. Results: The frequency of somatic mutation V600E within the BRAF gene was 54.6% (43 of 127 patients. Nodular melanoma was the most prevalent subtype in our population, with BRAF mutations in 37.2% (16 of 55 patients. In contrast, superficial spread had a frequency of 18.6% BRAF mutation (eight of 24. Other clinicopathologic features were assessed to correlate with the mutation status. Conclusion: This study searched for the most prevalent BRAF V600E mutation type in melanoma in a heterogeneous population from Mexico. Nodular melanoma was found to be the most prevalent in metastatic presentation and the presence of BRAF V600E mutation, perhaps related to the mixed ancestry; in the north, ancestry is predominantly European and in the south, it is predominantly Asian. The outcomes of the mutation correlations were similar to those found in other populations.
Characterization of V71M mutation in the aquaporin-2 gene causing ...
Indian Academy of Sciences (India)
Introduction. The aquaporin-2 (AQP2) water channel plays an important ... X-ray structure of lens aquaporin-0 open form (Lens Mip) as template (pdb. Keywords. AQP2 gene; nephrogenic diabetes insipidus; mutation; structural modelling.
Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.
2016-01-01
SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499
Behavior of the excited deformed band and search for shape isomerism in 184Hg
International Nuclear Information System (INIS)
Cole, J.D.; Hamilton, J.H.; Ramayya, A.V.; Nettles, W.G.; Kawakami, H.; Spejewski, E.H.; Ijaz, M.A.; Toth, K.S.; Robinson, E.L.; Sastry, K.S.R.; Lin, J.; Avignone, F.T.; Brantley, W.H.; Rao, P.V.G.
1976-01-01
The new isotope 184 Tl has been identified with T 1 / 2 =11 +- 1 sec and the levels in 184 Hg investigated from its decay. The 0 + band head of a deformed band was found to drop to 375 keV in agreement with theoretical predictions. The mean life of the 375-keV 0 + level was measured to be 0.9 +- 0.3 nsec which is a factor of 10 faster than theoretically predicted for a shape-isomeric E2 transition
van Pampus, M. G.; Wolf, H.; Koopman, M. M.; van den Ende, A.; Buller, H. R.; Reitsma, P. H.
2001-01-01
The 20210 G-A prothrombin gene variant and the Factor V Leiden mutation are mutations associated with venous thrombotic risk. The aim of our study was to assess the prevalence of these specific mutations in women with a history of preeclampsia or hemolysis elevated liver enzymes, and low platelet
Energy Technology Data Exchange (ETDEWEB)
Gregoire, G.; Pecquenard, B.; Baffier, N. [Centre National de la Recherche Scientifique (CNRS), 75 - Paris (France). Laboratoire de Chimie Appliquee de l`Etat Solide; Soudan, P.; Farcy, J.; Pereira-Ramos, J.P. [Centre National de la Recherche Scientifique (CNRS), 94 - Ivry-sur-Seine (France). Laboratoire d`Electrochimie Catalyse et Synthese Organique
1996-12-31
V{sub 2}O{sub 5} based compounds are interesting low potential materials for rechargeable cathodes of lithium electrochemical generators. However, the ionic conductivity and the reversibility of electrochemical cycling of V{sub 2}O{sub 5} are limited by the possibilities of lithium insertion. This work shows that the doping of vanadium pentoxide by a M{sup 3+} trivalent transition element (M Fe, Al, Cr or La) allows to intercalate a more important amount of lithium and to improve the behaviour of the material during cycling. These materials of M{sub 0.11}V{sub 2}O{sub 5.16} formula are obtained by sol-gel synthesis. the electrochemical study of the Fe compound has shown that it is a mixed oxide with a behaviour similar to V{sub 2}O{sub 5}. The maximum capacity is of about 2 F/mole in the case of Fe, Al and Cr compounds and of about 1.7 F/mole in the case of La. The structural evolution of the Fe compound has been followed during the chemical insertion of Li and the same succession of phases ({alpha}, {epsilon}, {delta} and {gamma}) is observed as in Li{sub x}V{sub 2}O{sub 5} compounds but with a delay. The occurrence of the {gamma} phase, in particular, which is involved in recharging problems is delayed thanks to the (Fe-O){sub n} chains perpendicular to the (V{sub 2}O{sub 5}){sub n} layers. Abstract only. (J.S.) 3 refs.
Energy Technology Data Exchange (ETDEWEB)
Gregoire, G; Pecquenard, B; Baffier, N [Centre National de la Recherche Scientifique (CNRS), 75 - Paris (France). Laboratoire de Chimie Appliquee de l` Etat Solide; Soudan, P; Farcy, J; Pereira-Ramos, J P [Centre National de la Recherche Scientifique (CNRS), 94 - Ivry-sur-Seine (France). Laboratoire d` Electrochimie Catalyse et Synthese Organique
1997-12-31
V{sub 2}O{sub 5} based compounds are interesting low potential materials for rechargeable cathodes of lithium electrochemical generators. However, the ionic conductivity and the reversibility of electrochemical cycling of V{sub 2}O{sub 5} are limited by the possibilities of lithium insertion. This work shows that the doping of vanadium pentoxide by a M{sup 3+} trivalent transition element (M Fe, Al, Cr or La) allows to intercalate a more important amount of lithium and to improve the behaviour of the material during cycling. These materials of M{sub 0.11}V{sub 2}O{sub 5.16} formula are obtained by sol-gel synthesis. the electrochemical study of the Fe compound has shown that it is a mixed oxide with a behaviour similar to V{sub 2}O{sub 5}. The maximum capacity is of about 2 F/mole in the case of Fe, Al and Cr compounds and of about 1.7 F/mole in the case of La. The structural evolution of the Fe compound has been followed during the chemical insertion of Li and the same succession of phases ({alpha}, {epsilon}, {delta} and {gamma}) is observed as in Li{sub x}V{sub 2}O{sub 5} compounds but with a delay. The occurrence of the {gamma} phase, in particular, which is involved in recharging problems is delayed thanks to the (Fe-O){sub n} chains perpendicular to the (V{sub 2}O{sub 5}){sub n} layers. Abstract only. (J.S.) 3 refs.
Nakatani, Takuya; Imamura, Toshihiko; Ishida, Hiroyuki; Wakaizumi, Katsuji; Yamamoto, Tohru; Otabe, Osamu; Ishigami, Tsuyoshi; Adachi, Souichi; Morimoto, Akira
2008-12-01
Pediatric essential thrombocythemia (ET) is a rare and heterogenous disease entity. While several recent studies have focused on the role of the JAK2 V617F mutation in pediatric ET, the frequency of pediatric ET cases with this mutation and the associated clinical features remain unclear. We examined six childhood cases who had been diagnosed with ET according to WHO criteria (onset age: 0.2-14 years) for the presence of the JAK2 V617F mutation, MPLW515L mutation and JAK2 exon 12 mutations. Two sensitive PCR-based methods were used for the JAK2 V617F genotyping. We also examined the expression of polycythemia rubra vera-1 (PRV-1), which is a diagnostic marker for clonal ET. We found that three of the six cases had the JAK2 V617F mutation and that all six cases expressed PRV-1 in their peripheral granulocytes. Neither MPL W515L mutation nor JAK2 exon 12 mutations was detected in the patients without JAK2 V617F mutation. The two patients who developed thrombocythemia during infancy were JAK2 V617F-negative. These findings suggest that the JAK2 V617F mutation is not rare in childhood sporadic ET cases, and that these cases might be older and myeloproliferative features.
Willis, Michael; Kaufmann, Walter A; Wietzorrek, Georg; Hutter-Paier, Birgit; Moosmang, Sven; Humpel, Christian; Hofmann, Franz; Windisch, Manfred; Knaus, Hans-Günther; Marksteiner, Josef
2010-01-01
Cumulative evidence indicates that amyloid-beta peptides exert some of their neurodegenerative effects through modulation of L-type voltage gated calcium channels, which play key roles in a diverse range of CNS functions. In this study we examined the expression of CaV1.2 L-type voltage gated calcium channels in transgenic mice overexpressing human AbetaPP751 with the London (V717I) and Swedish (K670M/N671L) mutations by immunohistochemistry in light and electron microscopy. In hippocampal layers of wild type and transgenic mice, CaV1.2 channels were predominantly localized to somato-dendritic domains of neurons, and to astrocytic profiles with an age-dependent increase in labeling density. In transgenic animals, CaV1.2-like immunoreactive clusters were found in neuronal profiles in association with amyloid-beta plaques. Both the number and density of these clusters depended upon age of animals and number of plaques. The most striking difference between wild type and transgenic mice was the age-dependent expression of CaV1.2 channels in reactive astrocytes. At the age of 6 month, CaV1.2 channels were rarely detected in reactive astrocytes of transgenic mice, but an incremental number of CaV1.2 expressing reactive astrocytes was found with increasing age of animals and number of amyloid-beta plaques. This study demonstrates that CaV1.2 channels are highly expressed in reactive astrocytes of 12-months of age transgenic mice, which might be a consequence of the increasing amyloid burden. Further studies should clarify which functional implications are associated with the higher availability of CaV1.2 channels in late stage Alzheimer's disease.
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. V M Gurame. Articles written in Bulletin of Materials Science. Volume 38 Issue 2 April 2015 pp 483-491. Spray deposited CeO2–TiO2 counter electrode for electrochromic devices · A K Bhosale S R Kulal V M Gurame P S Patil · More Details Abstract Fulltext PDF. Optically ...
Discovery of centrosomal RNA and centrosomal hypothesis of cellular ageing and differentiation.
Chichinadze, Konstantin; Tkemaladze, Jaba; Lazarashvili, Ann
2012-01-01
In 2006, a group of scientists studying centrosomes of Spisula solidissima mollusc oocytes under the leadership of Alliegro (Alliegro, M.C.; Alliegro, M.A.; Palazzo, R.E. Centrosome-associated RNA in surf clam oocytes. Proc. Natl. Acad. Sci. USA 2006, 103(24), 9034-9038) reliably demonstrated the existence of specific RNA in centrosome, called centrosomal RNA (cnRNA). In their first article, five different RNAs (cnRNAs 11, 102, 113, 170, and 184) were described. During the process of full sequencing of the first transcript (cnRNA 11), it was discovered that the transcript contained a conserved structure-a reverse transcriptase domain located together with the most important centrosomal protein, γ-tubulin. In an article published in 2005, we made assumptions about several possible mechanisms for determining the most important functions of centrosomal structures and referred to one of them as a "RNA-dependent mechanism." This idea about participation of hypothetic centrosomal small interference RNA and/or microRNA in the process was made one year prior to the discovery of cnRNA by Alliegro's group. The discovery of specific RNA in a centrosome is indirect evidence of a centrosomal hypothesis of cellular ageing and differentiation. The presence of a reverse transcriptase domain in this type of RNA, together with its uniqueness and specificity, makes the centrosome a place of information storage and reproduction.
A V1143F mutation in the neuronal-enriched isoform 2 of the PMCA pump is linked with ataxia.
Vicario, Mattia; Zanni, Ginevra; Vallese, Francesca; Santorelli, Filippo; Grinzato, Alessandro; Cieri, Domenico; Berto, Paola; Frizzarin, Martina; Lopreiato, Raffaele; Zonta, Francesco; Ferro, Stefania; Sandre, Michele; Marin, Oriano; Ruzzene, Maria; Bertini, Enrico; Zanotti, Giuseppe; Brini, Marisa; Calì, Tito; Carafoli, Ernesto
2018-04-12
The fine regulation of intracellular calcium is fundamental for all eukaryotic cells. In neurons, Ca 2+ oscillations govern the synaptic development, the release of neurotransmitters and the expression of several genes. Alterations of Ca 2+ homeostasis were found to play a pivotal role in neurodegenerative progression. The maintenance of proper Ca 2+ signaling in neurons demands the continuous activity of Ca 2+ pumps and exchangers to guarantee physiological cytosolic concentration of the cation. The plasma membrane Ca 2+ ATPases (PMCA pumps) play a key role in the regulation of Ca 2+ handling in selected sub-plasma membrane microdomains. Among the four basic PMCA pump isoforms existing in mammals, isoforms 2 and 3 are particularly enriched in the nervous system. In humans, genetic mutations in the PMCA2 gene in association with cadherin 23 mutations have been linked to hearing loss phenotypes, while those occurring in the PMCA3 gene were associated with X-linked congenital cerebellar ataxias. Here we describe a novel missense mutation (V1143F) in the calmodulin binding domain (CaM-BD) of the PMCA2 protein. The mutant pump was present in a patient showing congenital cerebellar ataxia but no overt signs of deafness, in line with the absence of mutations in the cadherin 23 gene. Biochemical and molecular dynamics studies on the mutated PMCA2 have revealed that the V1143F substitution alters the binding of calmodulin to the CaM-BD leading to impaired Ca 2+ ejection. Copyright © 2018. Published by Elsevier Inc.
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
Female to male sex reversal was achieved in an emerging agricultural insect pest, Drosophila suzukii, by creating a temperature-sensitive point mutation in the sex-determination gene, transformer-2 (tra-2) using CRISPR/Cas9 (clustered regularly interspaced palindromic repeats/ CRISPR-associated) hom...
Yang, Jiancheng; Ren, F.; Tadjer, Marko; Pearton, S. J.; Kuramata, A.
2018-05-01
A key goal for Ga2O3 rectifiers is to achieve high forward currents and high reverse breakdown voltages. Field-plated β-Ga2O3 Schottky rectifiers with area 0.01 cm2, fabricated on 10 μm thick, lightly-doped drift regions (1.33 x 1016 cm-3) on heavily-doped (3.6 x 1018 cm-3) substrates, exhibited forward current density of 100A.cm-2 at 2.1 V, with absolute current of 1 A at this voltage and a reverse breakdown voltage (VB) of 650V. The on-resistance (RON) was 1.58 x 10-2 Ω.cm2, producing a figure of merit (VB2/RON) of 26.5 MW.cm-2. The Schottky barrier height of the Ni was 1.04 eV, with an ideality factor of 1.02. The on/off ratio was in the range 3.3 x 106 - 5.7 x 109 for reverse biases between 5 and 100V. The reverse recovery time was ˜30 ns for switching from +2V to -5V. The results show the capability of β-Ga2O3 rectifiers to achieve exceptional performance in both forward and reverse bias conditions.
A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.
Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S
2016-03-01
Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hornyák, Ákos; Lipinski, Kai S; Bakonyi, Tamás; Forgách, Petra; Horváth, Ernő; Farsang, Attila; Hedley, Susan J; Palya, Vilmos; Bakács, Tibor; Kovesdi, Imre
2015-01-01
Despite spectacular successes in hepatitis B and C therapies, severe hepatic impairment is still a major treatment problem. The clinically tested infectious bursal disease virus (IBDV) superinfection therapy promises an innovative, interferon-free solution to this great unmet need, provided that a consistent manufacturing process preventing mutations or reversions to virulent strains is obtained. To address safety concerns, a tissue culture adapted IBDV vaccine strain V903/78 was cloned into cDNA plasmids ensuring reproducible production of a reverse engineered virus R903/78. The therapeutic drug candidate was characterized by immunocytochemistry assay, virus particle determination and immunoblot analysis. The biodistribution and potential immunogenicity of the IBDV agent was determined in mice, which is not a natural host of this virus, by quantitative detection of IBDV RNA by a quantitative reverse transcriptase-polymerase chain reaction and virus neutralization test, respectively. Several human cell lines supported IBDV propagation in the absence of visible cytopathic effect. The virus was stable from pH 8 to pH 6 and demonstrated significant resistance to low pH and also proved to be highly resistant to high temperatures. No pathological effects were observed in mice. Single and multiple oral administration of IBDV elicited antibodies with neutralizing activities in vitro. Repeat oral administration of R903/78 was successful despite the presence of neutralizing antibodies. Single oral and intravenous administration indicated that IBDV does not replicate in mammalian liver alleviating some safety related concerns. These data supports the development of an orally delivered anti-hepatitis B virus/ anti-hepatitis C virus viral agent for human use. Copyright © 2015 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV ...
African Journals Online (AJOL)
and LA are related to the use of nucleoside reverse transcriptase ... 4 Discipline of Public HealthMedicine, School of Nursing and Public Health, College of Health Sciences, .... Finally, a multivariable adjusted logistic regression model was also.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
Phenotypic Variability of Osteogenesis Imperfecta Type V Caused by an IFITM5 Mutation
Shapiro, Jay R; Lietman, Caressa; Grover, Monica; Lu, James T; Nagamani, Sandesh CS; Dawson, Brian C; Baldridge, Dustin M; Bainbridge, Matthew N; Cohn, Dan H; Blazo, Maria; Roberts, Timothy T; Brennen, Feng-Shu; Wu, Yimei; Gibbs, Richard A; Melvin, Pamela; Campeau, Philippe M; Lee, Brendan H
2013-01-01
In a large cohort of osteogenesis imperfecta type V (OI type V) patients (17 individuals from 12 families), we identified the same mutation in the 5′ untranslated region (5′UTR) of the interferon-induced transmembrane protein 5 (IFITM5) gene by whole exome and Sanger sequencing (IFITM5 c.–14C > T) and provide a detailed description of their phenotype. This mutation leads to the creation of a novel start codon adding five residues to IFITM5 and was recently reported in several other OI type V families. The variability of the phenotype was quite large even within families. Whereas some patients presented with the typical calcification of the forearm interosseous membrane, radial head dislocation and hyperplastic callus (HPC) formation following fractures, others had only some of the typical OI type V findings. Thirteen had calcification of interosseous membranes, 14 had radial head dislocations, 10 had HPC, 9 had long bone bowing, 11 could ambulate without assistance, and 1 had mild unilateral mixed hearing loss. The bone mineral density varied greatly, even within families. Our study thus highlights the phenotypic variability of OI type V caused by the IFITM5 mutation. PMID:23408678
Directory of Open Access Journals (Sweden)
Parvathi Chary
Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.
Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L
1999-12-17
Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay, E; de Brouwer, A P M; Caylan, R; Nabuurs, S B; Wollnik, B; Karaguzel, A; Heister, J G A M; Erdol, H; Cremers, F P M; Cremers, C W R J; Brunner, H G; Kremer, H
2005-12-01
Homozygosity mapping and linkage analysis in a Turkish family with autosomal recessive prelingual sensorineural hearing loss revealed a 15-cM critical region at 17q25.1-25.3 flanked by the polymorphic markers D17S1807 and D17S1806. The maximum two-point lod score was 4.07 at theta=0.0 for the marker D17S801. The linkage interval contains the Usher syndrome 1G gene (USH1G) that is mutated in patients with Usher syndrome (USH) type 1g and encodes the SANS protein. Mutation analysis of USH1G led to the identification of a homozygous missense mutation D458V at the -3 position of the PDZ binding motif of SANS. This mutation was also present homozygously in one out of 64 additional families from Turkey with autosomal recessive nonsyndromic hearing loss and heterozygously in one out of 498 control chromosomes. By molecular modeling, we provide evidence that this mutation impairs the interaction of SANS with harmonin. Ophthalmologic examination and vestibular evaluation of patients from both families revealed mild retinitis pigmentosa and normal vestibular function. These results suggest that these patients suffer from atypical USH.
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
Detection of CALR and MPL Mutations in Low Allelic Burden JAK2 V617F Essential Thrombocythemia.
Usseglio, Fabrice; Beaufils, Nathalie; Calleja, Anne; Raynaud, Sophie; Gabert, Jean
2017-01-01
Myeloproliferative neoplasms are clonal hematopoietic stem cell disorders characterized by aberrant proliferation and an increased tendency toward leukemic transformation. The genes JAK2, MPL, and CALR are frequently altered in these syndromes, and their mutations are often a strong argument for diagnosis. We analyzed the mutational profiles of these three genes in a cohort of 164 suspected myeloproliferative neoplasms. JAK2 V617F mutation was detected by real-time PCR, whereas high-resolution melting analysis followed by Sanger sequencing were used for searching for mutations in JAK2 exon 12, CALR, and MPL. JAK2 V617F mutation was associated with CALR (n = 4) and MPL (n = 4) mutations in 8 of 103 essential thrombocytosis patients. These cases were harboring a JAK2 V617F allelic burden of MPL genes in myeloproliferative neoplasms and suggest that CALR and MPL should be analyzed not only in JAK2-negative patients but also in low V617F mutation patients. Follow-up of these double-mutation cases will be important for determining whether this group of patients presents particular evolution or complications. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Johannes Van Staden
2010-10-01
Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda
2010-06-05
The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Sugiyama, Kei-Ichi; Yamada, Masami; Awogi, Takumi; Hakura, Atsushi
2016-01-01
The bacterial reverse mutation test, commonly called Ames test, is used worldwide. In Japan, the genetically modified organisms (GMOs) are regulated under the Cartagena Domestic Law, and organisms obtained by self-cloning and/or natural occurrence would be exempted from the law case by case. The strains of Salmonella typhimurium and Escherichia coli recommended for use in the bacterial reverse mutation test (OECD guideline 471), have been considered as non-GMOs because they can be constructed by self-cloning or naturally occurring bacterial strains, or do not disturb the biological diversity. The present article explains the reasons why these tester strains should be classified as non-GMOs.
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Hoffmann, Christopher J; Maritz, Jean; van Zyl, Gert U
2016-02-01
CD4 count decline often triggers antiretroviral regimen switches in resource-limited settings, even when viral load testing is available. We therefore compared CD4 failure and CD4 trends in patients with viraemia with or without antiretroviral resistance. Retrospective cohort study investigating the association of HIV drug resistance with CD4 failure or CD4 trends in patients on first-line antiretroviral regimens during viraemia. Patients with viraemia (HIV RNA >1000 copies/ml) from two HIV treatment programmes in South Africa (n = 350) were included. We investigated the association of M184V and NNRTI resistance with WHO immunological failure criteria and CD4 count trends, using chi-square tests and linear mixed models. Fewer patients with the M184V mutation reached immunologic failure criteria than those without: 51 of 151(34%) vs. 90 of 199 (45%) (P = 0.03). Similarly, 79 of 220 (36%) patients, who had major NNRTI resistance, had immunological failure, whereas 62 of 130 (48%) without (chi-square P = 0.03) did. The CD4 count decline among patients with the M184V mutation was 2.5 cells/mm(3) /year, whereas in those without M184V it was 14 cells/mm(3) /year (P = 0.1), but the difference in CD4 count decline with and without NNRTI resistance was marginal. Our data suggest that CD4 count monitoring may lead to inappropriate delayed therapy switches for patients with HIV drug resistance. Conversely, patients with viraemia but no drug resistance are more likely to have a CD4 count decline and thus may be more likely to be switched to a second-line regimen. © 2015 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)
1995-08-01
The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.
A novel GJA8 mutation (p.V44A causing autosomal dominant congenital cataract.
Directory of Open Access Journals (Sweden)
Yanan Zhu
Full Text Available To examine the mechanism by which a novel connexin 50 (Cx50 mutation, Cx50 V44A, in a Chinese family causes suture-sparing autosomal dominant congenital nuclear cataracts.Family history and clinical data were recorded and direct gene sequencing was used to identify the disease-causing mutation. The Cx50 gene was cloned from a human lens cDNA library. Connexin protein distributions were assessed by fluorescence microscopy. Hemichannel functions were analyzed by dye uptake assay. Formation of functional channels was assessed by dye transfer experiments.Direct sequencing of the candidate GJA8 gene revealed a novel c.131T>C transition in exon 2, which cosegregated with the disease in the family and resulted in the substitution of a valine residue with alanine at codon 44 (p. V44A in the extracellular loop 1 of the Cx50 protein. Both Cx50 and Cx50V44A formed functional gap junctions, as shown by the neurobiotin transfer assay. However, unlike wild-type Cx50, Cx50V44A was unable to form open hemichannels in dye uptake experiments.This work identified a unique congenital cataract in the Chinese population, caused by the novel mutation Cx50V44A, and it showed that the V44A mutation specifically impairs the gating of the hemichannels but not the gap junction channels. The dysfunctional hemichannels resulted in the development of human congenital cataracts.
Leucocytes Mutation load Declines with Age in Carriers of the m.3243A>G Mutation
DEFF Research Database (Denmark)
Langdahl, Jakob Høgild; Larsen, Martin; Frost, Morten
2018-01-01
Carriers of the mitochondrial mutation m.3243A>G presents highly variable phenotypes including mitochondrial encephalomyopaty, lactoacidosis and stroke-like episodes (MELAS). We conducted a follow-up study to evaluate changes in leucocyte heteroplasmy and the clinical phenotypes in m.3243A...
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Lecithin. 184.1400 Section 184.1400 Food and Drugs... Substances Affirmed as GRAS § 184.1400 Lecithin. (a) Commercial lecithin is a naturally occurring mixture of... isolated as a gum following hydration of solvent-extracted soy, safflower, or corn oils. Lecithin is...
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Nitrogen. 184.1540 Section 184.1540 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1540 Nitrogen. (a) Nitrogen (empirical formula N2, CAS Reg. No. 7727-37-9...
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sorbitol. 184.1835 Section 184.1835 Food and Drugs... Substances Affirmed as GRAS § 184.1835 Sorbitol. (a) Sorbitol is the chemical 1,2,3,4,5,6-hexanehexol.... Sorbitol is produced by the electrolytic reduction, or the transition metal catalytic hydrogenation of...
JAK2 V617F, MPL W515L and JAK2 Exon 12 Mutations in Chinese Patients with Primary Myelofibrosis.
Xia, Jun; Lu, Mi-Ze; Jiang, Yuan-Qiang; Yang, Guo-Hua; Zhuang, Yun; Sun, Hong-Li; Shen, Yun-Feng
2012-03-01
JAK2 V617F, MPL W515L and JAK2 exon 12 mutations are novel acquired mutations that induce constitutive cytokine-independent activation of the JAK-STAT pathway in myeloproliferative disorders (MPD). The discovery of these mutations provides novel mechanism for activation of signal transduction in hematopoietic malignancies. This research was to investigate their prevalence in Chinese patients with primary myelofibrosis (PMF). We introduced allele-specific PCR (AS-PCR) combined with sequence analysis to simultaneously screen JAK2 V617F, MPL W515L and JAK2 exon 12 mutations in 30 patients with PMF. Fifteen PMF patients (50.0%) carried JAK2 V617F mutation, and only two JAK2 V617F-negative patients (6.7%) harbored MPL W515L mutation. None had JAK2 exon 12 mutations. Furthermore, these three mutations were not detected in 50 healthy controls. MPL W515L and JAK2 V617F mutations existed in PMF patients but JAK2 exon 12 mutations not. JAK2 V617F and MPL W515L and mutations might contribute to the primary molecular pathogenesis in patients with PMF.
Benedek, Birgit; Ziegler, Andreas; Ottersbach, Peter
2010-03-01
Comfrey (Symphytum officinale L.) root is traditionally used for the topical treatment of contusions, strains and sprains. Besides allantoin and rosmarinic acid, which are discussed as pharmacologically active principles, the drug contains pyrrolizidine alkaloids (PAs) known for their hepatotoxic, carcinogenic and mutagenic properties. The topical herbal medicinal products Kytta-Salbe f and Kytta-Plasma f contain a PA-free liquid extract from comfrey root as active substance. The aim of this study was to demonstrate the absence of genotoxic effects of this special extract in the bacterial reverse mutation assay (Ames test). Briefly, comfrey root liquid extract was investigated for its ability to induce gene mutations in Salmonella typhimurium strains TA 98, TA 100, TA 102, TA 1535 and TA 1537 with and without metabolic activation using the mammalian microsomal fraction S9 mix. Reference mutagens were used to check the validity of the experiments. Comfrey root fluid extract showed no biologically relevant increases in revertant colony numbers of any of the five tester strains, neither in the presence nor in the absence of metabolic activation. In conclusion, the comfrey root fluid extract contained in Kytta-Salbe f and Kytta-Plasma f was not mutagenic in the bacterial reverse mutation assay. (c) 2009 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Sonia Covaceuszach
Full Text Available Dystroglycan (DG is a highly glycosylated protein complex that links the cytoskeleton with the extracellular matrix, mediating fundamental physiological functions such as mechanical stability of tissues, matrix organization and cell polarity. A crucial role in the glycosylation of the DG α subunit is played by its own N-terminal region that is required by the glycosyltransferase LARGE. Alteration in this O-glycosylation deeply impairs the high affinity binding to other extracellular matrix proteins such as laminins. Recently, three missense mutations in the gene encoding DG, mapped in the α-DG N-terminal region, were found to be responsible for hypoglycosylated states, causing congenital diseases of different severity referred as primary dystroglycanopaties.To gain insight on the molecular basis of these disorders, we investigated the crystallographic and solution structures of these pathological point mutants, namely V72I, D109N and T190M. Small Angle X-ray Scattering analysis reveals that these mutations affect the structures in solution, altering the distribution between compact and more elongated conformations. These results, supported by biochemical and biophysical assays, point to an altered structural flexibility of the mutant α-DG N-terminal region that may have repercussions on its interaction with LARGE and/or other DG-modifying enzymes, eventually reducing their catalytic efficiency.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Urea. 184.1923 Section 184.1923 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1923 Urea. (a) Urea (CO(NH2)2, CAS Reg. No. 57-13-6) is the diamide of...
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Whey. 184.1979 Section 184.1979 Food and Drugs FOOD... Substances Affirmed as GRAS § 184.1979 Whey. (a)(1) Whey. Whey is the liquid substance obtained by separating the coagulum from milk, cream, or skim milk in cheesemaking. Whey obtained from a procedure, in which...
DEFF Research Database (Denmark)
Holmstrom, Morten Orebo; Hasselbalch, Hans Carl; Andersen, Mads Hald
2017-01-01
Approximately 90% of patients with the hematological malignancies termed the chronic myeloproliferative neoplasms harbor either the JAK2V617F-mutation or CALR exon 9 mutation. Both of these are recognized by T-cells, which make the mutations ideal targets for cancer immune therapy as they are sha......Approximately 90% of patients with the hematological malignancies termed the chronic myeloproliferative neoplasms harbor either the JAK2V617F-mutation or CALR exon 9 mutation. Both of these are recognized by T-cells, which make the mutations ideal targets for cancer immune therapy...
Reis, Mônica Nogueira da Guarda; de Alcântara, Keila Correa; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo
2014-01-01
The selective pressure of antiretroviral drugs (ARVs) targeting HIV-1 pol can promote drug resistance mutations in other genomic regions, such as env. Drug resistance among women should be monitored to avoid horizontal and mother-to-child transmission. To describe natural resistance to T-20 (enfuvirtide), gp41 env polymorphisms, mutations in pol and HIV-1 subtypes, 124 pregnant women were recruited. For 98 patients, the gp41 env, protease (PR) and reverse transcriptase (RT) fragments were sequenced. The patients were ARV naïve (n = 30), taking mother-to-child transmission prophylaxis (n = 50), or being treated with highly active ARV therapy/HAART (n = 18). The Stanford and IAS/USA databases and other sources were used to analyze PR/RT, gp41 env resistance mutations. The HIV-1 genetic diversity was analyzed by REGA/phylogenetic analyses. The patients' median age was 25 years (range, 16-42), 18.4% had AIDS. The frequency of natural resistance to T-20 (N42D, L44M, and R46M-low-impact mutations) was 6.1% (6/98); 20.4% (20/98) had compensatory mutations in HR2. The prevalence of transmitted drug resistance in the pol was 13.3% (4/30), and the prevalence of secondary drug resistance was 33.3% (6/18). Two patients were infected with multidrug resistant/MDR viruses. The analysis of HIV-1 subtypes (PR/RT/gp41) revealed that 61.2% (60/98) were subtype B, 12.2% (12/98) were subtype C, 4.1% (4/98) were subtype F1, and 22.4% (22/98) were possible recombinants (BF1 = 20.4%; BC = 2%). Natural resistance to T-20 was not associated with pol resistance or previous ARV use. The high rate of secondary resistance, including MDR, indicates that the number of women that may need T-20 salvage therapy may be higher than anticipated. © 2013 Wiley Periodicals, Inc.
TERT promoter hot spot mutations are frequent in Indian cervical and oral squamous cell carcinomas.
Vinothkumar, Vilvanathan; Arunkumar, Ganesan; Revathidevi, Sundaramoorthy; Arun, Kanagaraj; Manikandan, Mayakannan; Rao, Arunagiri Kuha Deva Magendhra; Rajkumar, Kottayasamy Seenivasagam; Ajay, Chandrasekar; Rajaraman, Ramamurthy; Ramani, Rajendren; Murugan, Avaniyapuram Kannan; Munirajan, Arasambattu Kannan
2016-06-01
Squamous cell carcinoma (SCC) of the uterine cervix and oral cavity are most common cancers in India. Telomerase reverse transcriptase (TERT) overexpression is one of the hallmarks for cancer, and activation through promoter mutation C228T and C250T has been reported in variety of tumors and often shown to be associated with aggressive tumors. In the present study, we analyzed these two hot spot mutations in 181 primary tumors of the uterine cervix and oral cavity by direct DNA sequencing and correlated with patient's clinicopathological characteristics. We found relatively high frequency of TERT hot spot mutations in both cervical [21.4 % (30/140)] and oral [31.7 % (13/41)] squamous cell carcinomas. In cervical cancer, TERT promoter mutations were more prevalent (25 %) in human papilloma virus (HPV)-negative cases compared to HPV-positive cases (20.6 %), and both TERT promoter mutation and HPV infection were more commonly observed in advanced stage tumors (77 %). Similarly, the poor and moderately differentiated tumors of the uterine cervix had both the TERT hot spot mutations and HPV (16 and 18) at higher frequency (95.7 %). Interestingly, we observed eight homozygous mutations (six 228TT and two 250TT) only in cervical tumors, and all of them were found to be positive for high-risk HPV. To the best of our knowledge, this is the first study from India reporting high prevalence of TERT promoter mutations in primary tumors of the uterine cervix and oral cavity. Our results suggest that TERT reactivation through promoter mutation either alone or in association with the HPV oncogenes (E6 and E7) could play an important role in the carcinogenesis of cervical and oral cancers.
Radiation-induced mutations in sweet cherry (Prunus avium L.)
Energy Technology Data Exchange (ETDEWEB)
Saamin, S [Cocoa and Coconut Research Division, Malaysian Agricultural Research and Development Institute (Malaysia); Thompson, M M [Department of Horticulture, Oregon State University, Corvallis, OR (United States)
1989-01-01
Full text: Dormant scions of 'Bing' were exposed to 1-2.5 kR gamma radiation. The main buds were excised and the scions grafted to allow the growth of accessory buds into primary shoots. The frequency and types of mutations were described in a population of 3307 M{sub 1}V{sub 2} shoot. The overall mutation frequency was 2.7% incl. 0.15% growth-reduced mutants. The experiment was repeated using 3kR and 4kR fractionated doses in water. Differences in mutation frequency at 3kR and 4kR were not significant. Of 2765 surviving M{sub 1}V{sub 2} shoots derived from irradiation of accessory buds of both standard and V{sub 1} shoots, the overall mutation frequency was 3.3% incl. 1.7% partial leaf mutants, 1.0% leaf mutants, and 0.54% growth-reduced mutants. For maximum mutation rate with adequate survival we suggest acute irradiation of accessory buds in air at dosages approximating LD50. Mutant sectors in M{sub 1}V{sub 1} shoots derived from accessory buds are larger than those from main buds, as revealed by the higher number of mutant repeats. (author)
Directory of Open Access Journals (Sweden)
Arístegui Javier
2011-06-01
Full Text Available Abstract Background Congenital insensitivity to pain with anhidrosis (CIPA is a rare autosomal recessive genetic disease characterized by the lack of reaction to noxious stimuli and anhidrosis. It is caused by mutations in the NTRK1 gene, which encodes the high affinity tyrosine kinase receptor I for Neurotrophic Growth Factor (NGF. Case Presentation We present the case of a female patient diagnosed with CIPA at the age of 8 months. The patient is currently 6 years old and her psychomotor development conforms to her age (RMN, SPECT and psychological study are in the range of normality. PCR amplification of DNA, followed by direct sequencing, was used to investigate the presence of NTRK1 gene mutations. Reverse transcriptase (RT-PCR amplification of RNA, followed by cloning and sequencing of isolated RT-PCR products was used to characterize the effect of the mutations on NTRK1 mRNA splicing. The clinical diagnosis of CIPA was confirmed by the detection of two splice-site mutations in NTRK1, revealing that the patient was a compound heterozygote at this gene. One of these alterations, c.574+1G>A, is located at the splice donor site of intron 5. We also found a second mutation, c.2206-2 A>G, not previously reported in the literature, which is located at the splice acceptor site of intron 16. Each parent was confirmed to be a carrier for one of the mutations by DNA sequencing analysis. It has been proposed that the c.574+1G>A mutation would cause exon 5 skipping during NTRK1 mRNA splicing. We could confirm this prediction and, more importantly, we provide evidence that the novel c.2206-2A>G mutation also disrupts normal NTRK1 splicing, leading to the use of an alternative splice acceptor site within exon 17. As a consequence, this mutation would result in the production of a mutant NTRK1 protein with a seven aminoacid in-frame deletion in its tyrosine kinase domain. Conclusions We present the first description of a CIPA-associated NTRK1 mutation
Kuijpers, Taco W; van Leeuwen, Ester M M; Barendregt, Barbara H; Klarenbeek, Paul; aan de Kerk, Daan J; Baars, Paul A; Jansen, Machiel H; de Vries, Niek; van Lier, René A W; van der Burg, Mirjam
2013-07-01
Mutations in the common gamma chain (γc, CD132, encoded by the IL2RG gene) can lead to B(+)T(-)NK(-) X-linked severe combined immunodeficiency, as a consequence of unresponsiveness to γc-cytokines such as interleukins-2, -7 and -15. Hypomorphic mutations in CD132 may cause combined immunodeficiencies with a variety of clinical presentations. We analyzed peripheral blood mononuclear cells of a 6-year-old boy with normal lymphocyte counts, who suffered from recurrent pneumonia and disseminated mollusca contagiosa. Since proliferative responses of T cells and NK cells to γc -cytokines were severely impaired, we performed IL2RG gene analysis, showing a heterozygous mutation in the presence of a single X-chromosome. Interestingly, an IL2RG reversion to normal predominated in both naïve and antigen-primed CD8(+) T cells and increased over time. Only the revertant CD8(+) T cells showed normal expression of CD132 and the various CD8(+) T cell populations had a different T-cell receptor repertoire. Finally, a fraction of γδ(+) T cells and differentiated CD4(+)CD27(-) effector-memory T cells carried the reversion, whereas NK or B cells were repeatedly negative. In conclusion, in a patient with a novel IL2RG mutation, gene-reverted CD8(+) T cells accumulated over time. Our data indicate that selective outgrowth of particular T-cell subsets may occur following reversion at the level of committed T progenitor cells.
Chan, Philip A; Huang, Austin; Kantor, Rami
2012-10-15
Tenofovir-containing regimens have demonstrated potential efficacy as pre-exposure prophylaxis (PrEP) in preventing HIV-1 infection. Transmitted drug resistance mutations associated with tenofovir, specifically the reverse transcriptase (RT) mutation K65R, may impact the effectiveness of PrEP. The worldwide prevalence of transmitted tenofovir resistance in different HIV-1 subtypes is unknown. Sequences from treatment-naïve studies and databases were aggregated and analyzed by Stanford Database tools and as per the International AIDS Society (IAS-USA) resistance criteria. RT sequences were collected from GenBank, the Stanford HIV Sequence Database and the Los Alamos HIV Sequence Database. Sequences underwent rigorous quality control measures. Tenofovir-associated resistance mutations included K65R, K70E, T69-insertion and ≥3 thymidine analogue mutations (TAMs), inclusive of M41L or L210W. A total of 19,823 sequences were evaluated across diverse HIV-1 subtypes (Subtype A: 1549 sequences, B: 9783, C: 3198, D: 483, F: 372, G: 594, H: 41, J: 69, K: 239, CRF01_AE: 1797 and CRF02_AG: 1698). Overall, tenofovir resistance prevalence was 0.4% (n=77/19,823, 95% confidence interval or CI: 0.3 to 0.5). K65R was found in 20 sequences (0.1%, 95% CI: 0.06 to 0.15). Differences in the prevalence of K65R between HIV-1 subtypes were not statistically significant. K70E and ≥3 TAMs were found in 0.015% (95% CI: 0.004 to 0.04) and 0.27% (95% CI: 0.2 to 0.4) of sequences, respectively. Prevalence of transmitted K65R and other tenofovir resistance mutations across diverse HIV-1 subtypes and recombinants is low, suggesting minimal effect on tenofovir-containing PrEP regimens.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Riboflavin. 184.1695 Section 184.1695 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1695 Riboflavin. (a) Riboflavin (C17H20N4O6, CAS Reg. No. 83-88-5) occurs...
Low-lying states of 184W and 184Os nuclei
International Nuclear Information System (INIS)
Sharrad, F.I.; Abdullah, Hewa Y.; Al-Dahan, N.; Umran, N.M.; Okhunov, A.A.; Abu Kassim, H.
2013-01-01
The energy levels, transition energy, B(E2) values, intrinsic quadrupole moment Q 0 and potential energy surface for even-even 184 W and 184 Os nuclei were calculated using IBM-1. The predicted energy levels, transition energy, B(E2) values and intrinsic quadrupole moment Q 0 results are reasonably consistent with the experimental data. A contour plot of the potential energy surfaces shows that two interesting nuclei are deformed and have rotational characters. (authors)
Abdel-Azeim, Safwat; Oliva, Romina M.; Chermak, Edrisse; De Cristofaro, Raimondo; Cavallo, Luigi
2014-01-01
Factor X (FX) is one of the major players in the blood coagulation cascade. Upon activation to FXa, it converts prothrombin to thrombin, which in turn converts fibrinogen into fibrin (blood clots). FXa deficiency causes hemostasis defects, such as intracranial bleeding, hemathrosis, and gastrointestinal blood loss. Herein, we have analyzed a pool of pathogenic mutations, located in the FXa catalytic domain and directly associated with defects in enzyme catalytic activity. Using chymotrypsinogen numbering, they correspond to D102N, T135M, V160A, G184S, and G197D. Molecular dynamics simulations were performed for 1.68 μs on the wild-type and mutated forms of FXa. Overall, our analysis shows that four of the five mutants considered, D102N, T135M, V160A, and G184S, have rigidities higher than those of the wild type, in terms of both overall protein motion and, specifically, subpocket S4 flexibility, while S1 is rather insensitive to the mutation. This acquired rigidity can clearly impact the substrate recognition of the mutants.
Abdel-Azeim, Safwat
2014-11-11
Factor X (FX) is one of the major players in the blood coagulation cascade. Upon activation to FXa, it converts prothrombin to thrombin, which in turn converts fibrinogen into fibrin (blood clots). FXa deficiency causes hemostasis defects, such as intracranial bleeding, hemathrosis, and gastrointestinal blood loss. Herein, we have analyzed a pool of pathogenic mutations, located in the FXa catalytic domain and directly associated with defects in enzyme catalytic activity. Using chymotrypsinogen numbering, they correspond to D102N, T135M, V160A, G184S, and G197D. Molecular dynamics simulations were performed for 1.68 μs on the wild-type and mutated forms of FXa. Overall, our analysis shows that four of the five mutants considered, D102N, T135M, V160A, and G184S, have rigidities higher than those of the wild type, in terms of both overall protein motion and, specifically, subpocket S4 flexibility, while S1 is rather insensitive to the mutation. This acquired rigidity can clearly impact the substrate recognition of the mutants.
International Nuclear Information System (INIS)
Ortega L, N.
2005-01-01
The objective of this study was to determine the utility of 99m Tc-(V)- Dmsa whole body planar scan in the diagnostic of skeletal metastases. Nineteen patients were studied, having a recent 99m Tc-HDP bone scan reporting different pathologies (3 normal scans, 5 equivocal scans and 11 with disseminated bone metastases). 72 hours later, a whole body planar scan was obtained at 3 and 24 hours after the i.v. administration of 99m Tc-(V)-Dmsa. Counts per pixel were determined in regions of interest drawn over metastases sites and in normal tissue, and were correlated with the bone scan. Statistical analysis was carried out by using the Kruskal-Wallis analysis of variance followed by Mann Whitney U test. Other comparisons were done with Momios, chi square and t Student tests. 273 lesions were studied in the whole body bone scan and 184 lesions in the 99m Tc-(V)-Dmsa scintigraphy (t Student test n.s.). The tumor to normal tissue ratios were 3.3 (+/- 0.521) and the soft to normal tissue ratios were 1.01 (+/- 0.01), Mann Whitney p 99m Tc-(V)-Dmsa scintigraphy is an useful choice in the diagnostic of bone metastases when the whole body planar bone scan ( 99m Tc- HDP) is equivocal or abnormal. It also points out other lesions such as in bone and in soft tissue. (Author)
Sheikholeslami, M R; Jilani, I; Keating, M; Uyeji, J; Chen, K; Kantarjian, H; O'Brien, S; Giles, F; Albitar, M
2006-07-15
Lack of immunoglobulin heavy chain genes (IgV(H)) mutation in patients with chronic lymphocytic leukemia (CLL) is associated with rapid disease progression and shorter survival. The zeta-chain (T-cell receptor) associated protein kinase 70 kDa (ZAP-70) has been reported to be a surrogate marker for IgV(H) mutation status, and its expression in leukemic cells correlates with unmutated IgV(H). However, ZAP-70 detection by flow cytometry varies significantly dependant on the antibodies used, the method of performing the assay, and the condition of the cells in the specimen. The clinical value of ZAP-70 testing when samples are shipped under poorly controlled conditions is not known. Furthermore, testing in a research environment may differ from testing in a routine clinical laboratory. We validated an assay for ZAP-70 by comparing results with clinical outcome and the mutation status of the IgV(H). Using stored samples, we show significant correlation between ZAP-70 expression and clinical outcome as well as IgV(H) mutation at a cut-off point of 15%. While positive samples (>15% positivity) remain positive when kept in the laboratory environment for 48 h after initial testing, results obtained from samples from CLL patients tested after shipping at room temperature for routine testing showed no correlation with IgV(H) mutation status when 15% cut-off was used. In these samples, cut-point of 10% correlated with the IgV(H) mutation (P = 0.0001). This data suggests that although ZAP-70 positivity correlates with IgV(H) mutation status and survival, variations in sample handling and preparation may influence results. We show that IgV(H) mutation results, unlike ZAP-70 remain correlated with CD38 expression and beta-2 microglobulin in shipped samples, and ZAP-70 testing should not be used as the sole criterion for stratifying patients for therapy. (c) 2006 International Society for Analytical Cytology.
Technetium-99m-labeled annexin V imaging for detecting prosthetic joint infection in a rabbit model.
Tang, Cheng; Wang, Feng; Hou, Yanjie; Lu, Shanshan; Tian, Wei; Xu, Yan; Jin, Chengzhe; Wang, Liming
2015-05-01
Accurate and timely diagnosis of prosthetic joint infection is essential to initiate early treatment and achieve a favorable outcome. In this study, we used a rabbit model to assess the feasibility of technetium-99m-labeled annexin V for detecting prosthetic joint infection. Right knee arthroplasty was performed on 24 New Zealand rabbits. After surgery, methicillin-susceptible Staphylococcus aureus was intra-articularly injected to create a model of prosthetic joint infection (the infected group, n = 12). Rabbits in the control group were injected with sterile saline (n = 12). Seven and 21 days after surgery, technetium-99m-labeled annexin V imaging was performed in 6 rabbits of each group. Images were acquired 1 and 4 hours after injection of technetium-99m-labeled annexin V (150 MBq). The operated-to-normal-knee activity ratios were calculated for quantitative analysis. Seven days after surgery, increased technetium-99m-labeled annexin V uptake was observed in all cases. However, at 21 days a notable decrease was found in the control group, but not in the infected group. The operated-to-normal-knee activity ratios of the infected group were 1.84 ± 0.29 in the early phase and 2.19 ± 0.34 in the delay phase, both of which were significantly higher than those of the control group (P = 0.03 and P = 0.02). The receiver operator characteristic curve analysis showed that the operated-to-normal-knee activity ratios of the delay phase at 21 days was the best indicator, with an accuracy of 80%. In conclusion, technetium-99m-labeled annexin V imaging could effectively distinguish an infected prosthetic joint from an uninfected prosthetic joint in a rabbit model.
Ackerstaff, K.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Clarke, P.E.L.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallapiccola, C.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; de Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Doucet, M.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Evans, M.; Fabbri, F.; Fanfani, A.; Fanti, M.; Faust, A.A.; Feld, L.; Fiedler, F.; Fierro, M.; Fischer, H.M.; Fleck, I.; Folman, R.; Fong, D.G.; Foucher, M.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Geddes, N.I.; Geich-Gimbel, C.; Geralis, T.; Giacomelli, G.; Giacomelli, P.; Giacomelli, R.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Goodrick, M.J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hajdu, C.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Hargrove, C.K.; Hart, P.A.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Hutchcroft, D.E.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jawahery, A.; Jeffreys, P.W.; Jeremie, H.; Jimack, M.; Joly, A.; Jones, C.R.; Jones, M.; Jost, U.; Jovanovic, P.; Junk, T.R.; Kanzaki, J.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kirk, J.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kyberd, P.; Lafferty, G.D.; Lahmann, R.; Lai, W.P.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lefebvre, E.; Lellouch, D.; Letts, J.; Levinson, L.; List, B.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Markus, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mincer, A.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oh, A.; Oldershaw, N.J.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Poli, B.; Posthaus, A.; Rembser, C.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Rooke, A.; Rossi, A.M.; Routenburg, P.; Rozen, Y.; Runge, K.; Runolfsson, O.; Ruppel, U.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schleper, P.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skillman, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Springer, Robert Wayne; Sproston, M.; Stephens, K.; Steuerer, J.; Stockhausen, B.; Stoll, K.; Strom, David M.; Strohmer, R.; Szymanski, P.; Tafirout, R.; Talbot, S.D.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Ueda, I.; Utzat, P.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Vikas, P.; Vokurka, E.H.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.
1998-01-01
Events with four distinct jets from e^+e^- collisions, collected by the OPAL detector at centre-of-mass energies between 130 and 184 GeV, are analysed for a peak in the sum of dijet masses. This search is motivated by the ALEPH Collaboration's observation of a clear excess of events with dijet mass sums close to 105 GeV in data taken at centre-of-mass energies of 130 and 136 GeV in 1995. We have observed no significant excess of four-jet events compared to the Standard Model expectation for any dijet mass sum at any energy. Our observation is inconsistent with the excess observed by ALEPH in 1995. Upper limits are determined on the production cross-section as a function of the dijet mass sum.
International Nuclear Information System (INIS)
Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha
2005-01-01
Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols
A novel homozygous stop-codon mutation in human HFE responsible for nonsense-mediated mRNA decay.
Padula, Maria Carmela; Martelli, Giuseppe; Larocca, Marilena; Rossano, Rocco; Olivieri, Attilio
2014-09-01
HFE-hemochromatosis (HH) is an autosomal disease characterized by excessive iron absorption. Homozygotes for H63D variant, and still less H63D heterozygotes, generally do not express HH phenotype. The data collected in our previous study in the province of Matera (Basilicata, Italy) underlined that some H63D carriers showed altered iron metabolism, without additional factors. In this study, we selected a cohort of 10/22 H63D carriers with severe biochemical iron overload (BIO). Additional analysis was performed for studying HFE exons, exon-intron boundaries, and untranslated regions (UTRs) by performing DNA extraction, PCR amplification and sequencing. The results showed a novel substitution (NM_000410.3:c.847C>T) in a patient exon 4 (GenBankJQ478433); it introduces a premature stop-codon (PTC). RNA extraction and reverse-transcription were also performed. Quantitative real-time PCR was carried out for verifying if our aberrant mRNA is targeted for nonsense-mediated mRNA decay (NMD); we observed that patient HFE mRNA was expressed much less than calibrator, suggesting that the mutated HFE protein cannot play its role in iron metabolism regulation, resulting in proband BIO. Our finding is the first evidence of a variation responsible for a PTC in iron cycle genes. The genotype-phenotype correlation observed in our cases could be related to the additional mutation. Copyright © 2014 Elsevier Inc. All rights reserved.
Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin
2017-04-01
Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.
Chen, Xiuhua; Qi, Xiling; Tan, Yanhong; Xu, Zhifang; Xu, Aining; Zhang, Linlin; Wang, Hongwei
2011-06-15
JAK2V617F mutation has been reported in 90% of patients with polycythemia vera (PV) and about 50% of patients with essential thromobocythemia (ET) and primary myelofibrosis (PMF). Recently, acquired mutations in the transmembrane-juxtamembrane region of MPL (MPLW515 mutations) have been reported in approximately 5% of JAK2V617F-negative PMF and about 1% of all cases of ET. MPL is the receptor for thrombopoietin that regulates the production of platelets by bone marrow. It is likely that some mutations more closely related to ET in MPL exon10 may have been missed by current assays. We inferred that there might be other mutations in MPL exon10 for MPN patients in addition to MPLW515 mutations. To investigate its mutation types and prevalence in Chinese patients with myeloproliferative neoplasms (MPN), we performed mutation detection on MPL exon10 in 103 JAK2V617F-negative MPN patients by single strand conformation polymorphism (SSCP) and allele-specific PCR (AS-PCR) combined with sequencing. As a result, one previously unrecognized MPL mutation (12-bp in-frame insertion) was identified in one patient with ET in addition to an MPLW515K mutation identified in one PMF patient. This confirms our hypothesis that BCR/ABL negative and JAK2V617F-negative MPN patients have other mutations besides W515 mutation in MPL exon10 and mutations other than single nucleotide exchange also exist. In addition, MPL mutation was associated with Chinese MPN patients. Copyright © 2011 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Krečmerová, Marcela
2012-01-01
Roč. 8, č. 1 (2012), s. 18-21 ISSN 1801-2434 Institutional support: RVO:61388963 Keywords : HIV * AIDS * cART * HAART * tenofovir * reverse transcriptase * HIV protease * mikrobicides Subject RIV: CC - Organic Chemistry
Directory of Open Access Journals (Sweden)
Dora Dias-Santagata
2011-03-01
Full Text Available Pleomorphic xanthoastrocytoma (PXA is low-grade glial neoplasm principally affecting children and young adults. Approximately 40% of PXA are reported to recur within 10 years of primary resection. Upon recurrence, patients receive radiation therapy and conventional chemotherapeutics designed for high-grade gliomas. Genetic changes that can be targeted by selective therapeutics have not been extensively evaluated in PXA and ancillary diagnostic tests to help discriminate PXA from other pleomorphic and often more aggressive astrocytic malignancies are limited. In this study, we apply the SNaPshot multiplexed targeted sequencing platform in the analysis of brain tumors to interrogate 60 genetic loci that are frequently mutated in 15 cancer genes. In our analysis we detect BRAF V600E mutations in 12 of 20 (60% WHO grade II PXA, in 1 of 6 (17% PXA with anaplasia and in 1 glioblastoma arising in a PXA. Phospho-ERK was detected in all tumors independent of the BRAF mutation status. BRAF duplication was not detected in any of the PXA cases. BRAF V600E mutations were identified in only 2 of 71 (2.8% glioblastoma (GBM analyzed, including 1 of 9 (11.1% giant cell GBM (gcGBM. The finding that BRAF V600E mutations are common in the majority of PXA has important therapeutic implications and may help in differentiating less aggressive PXAs from lethal gcGBMs and GBMs.
12 CFR 18.4 - Contents of annual disclosure statement.
2010-01-01
...) Schedule RI (Income Statement); (iv) Schedule RI-A (Changes in Equity Capital); and (v) Schedule RI-B... balance sheet and income statement items; and future plans. (d) Disclaimer. The following legend shall be... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Contents of annual disclosure statement. 18.4...
Energy Technology Data Exchange (ETDEWEB)
Tárkányi, F.; Ditrói, F.; Takács, S. [Institute of Nuclear Research (ATOMKI), Debrecen (Hungary); Hermanne, A., E-mail: aherman@vub.ac.be [Cyclotron Department, Vrije Universiteit Brussel, (VUB), Brussels (Belgium)
2017-01-15
New experimental excitation functions for proton induced reactions on {sup nat}W are presented in the 32–65 MeV energy range. The cross-sections for {sup nat}W(p,xn){sup 186,184m,184g,183,} {sup 182m,182g,181}Re, {sup nat}W(p,x){sup 178}W{sup ,} {sup nat}W(p,x){sup 183,182,} {sup 180m,} {sup 177,176,175}Ta, {sup 175}Hf and {sup 177}Lu were measured via an activation method by using a stacked-foil irradiation technique and high resolution gamma-ray spectroscopy. The results were compared with predicted values obtained with the nuclear reaction code TALYS (results taken from the TENDL 2014 and TENDL 2015 on-line libraries). Production routes of the medically relevant radionuclides {sup 186}Re, the {sup 178}W → {sup 178}Ta generator and {sup 181}W are discussed.
Directory of Open Access Journals (Sweden)
Xiao-Nan Zhang
2017-05-01
Full Text Available Objective: To study the relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms. Methods: Patients who were diagnosed with BCR-ABL-negative myeloproliferative neoplasms in Anyang District Hospital between June 2014 and August 2016 were selected, JAK2V617F gene mutation was detected, and according to the test results, the patients were divided into mutation-positive group and mutation-negative group. The expression of JAK2/STATs signaling pathway molecules and cell proliferation genes in bone marrow fluid as well as the coagulation function indexes in peripheral blood were detected. Results: p-JAK2, p-STAT3, p-STAT5, Survivin, C-myc, CyclinD1 and ASXL1 protein expression in myeloproliferative neoplasms of mutation-positive group were significantly higher than those of mutation-negative group, and peripheral blood PT and APTT levels were significantly lower than those of mutation-negative group while TT and FIB levels were not significantly different from those of mutation-negative group. Conclusion: JAK2V617F gene mutation in myeloproliferative neoplasms can promote the cell proliferation and cause the hypercoagulable state.
Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M
2015-11-01
Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.
Zhang, Yu-zhi; Xu, Ting; Cui, Dai; Li, Xiao; Yao, Qing; Gong, Hai-yan; Liu, Xiao-yun; Chen, Huan-huan; Jiang, Lin; Ye, Xin-hua; Zhang, Zhi-hong; Shen, Mei-ping; Duan, Yu; Yang, Tao; Wu, Xiao-hong
2015-11-24
The thyroid imaging reporting and data system (TIRADS) and Bethesda system for reporting thyroid cytopathology (BSRTC) have been used for interpretation of ultrasound and fine-needle aspiration cytology (FNAC) results of thyroid nodules. BRAF(V600E) mutation analysis is a molecular tool in diagnosing thyroid carcinoma. Our objective was to compare the diagnostic value of these methods in differentiating high-risk thyroid nodules. Total 220 patients with high-risk thyroid nodules were recruited in this prospective study. They all underwent ultrasound, FNAC and BRAF(V600E) mutation analysis. The sensitivity and specificity of TIRADS were 73.1% and 88.4%. BSRTC had higher specificity (97.7%) and similar sensitivity (77.6%) compared with TIRADS. The sensitivity and specificity of BRAF(V600E) mutation (85.1%, 100%) were the highest. The combination of BSRTC and BRAF(V600E) mutation analysis significantly increased the efficiency, with 97.8% sensitivity, 97.7% specificity. In patients with BSRTC I-III, the mutation rate of BRAF(V600E) was 64.5% in nodules with TIRADS 4B compared with 8.4% in nodules with TIRADS 3 or 4A (P value in differentiating high-risk thyroid nodules. The TIRADS is useful in selecting high-risk patients for FNAB and patients with BSRTC I-III for BRAF(V600E) mutation analysis.
46 CFR 184.210 - Heating equipment.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Heating equipment. 184.210 Section 184.210 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.210 Heating equipment...
Antiretroviral drug resistance in HIV-1 therapy-naive patients in Cuba.
Pérez, Lissette; Kourí, Vivian; Alemán, Yoan; Abrahantes, Yeisel; Correa, Consuelo; Aragonés, Carlos; Martínez, Orlando; Pérez, Jorge; Fonseca, Carlos; Campos, Jorge; Álvarez, Delmis; Schrooten, Yoeri; Dekeersmaeker, Nathalie; Imbrechts, Stijn; Beheydt, Gertjan; Vinken, Lore; Soto, Yudira; Álvarez, Alina; Vandamme, Anne-Mieke; Van Laethem, Kristel
2013-06-01
In Cuba, antiretroviral therapy rollout started in 2001 and antiretroviral therapy coverage has reached almost 40% since then. The objectives of this study were therefore to analyze subtype distribution, and level and patterns of drug resistance in therapy-naive HIV-1 patients. Four hundred and one plasma samples were collected from HIV-1 therapy-naive patients in 2003 and in 2007-2011. HIV-1 drug resistance genotyping was performed in the pol gene and drug resistance was interpreted according to the WHO surveillance drug-resistance mutations list, version 2009. Potential impact on first-line therapy response was estimated using genotypic drug resistance interpretation systems HIVdb version 6.2.0 and Rega version 8.0.2. Phylogenetic analysis was performed using Neighbor-Joining. The majority of patients were male (84.5%), men who have sex with men (78.1%) and from Havana City (73.6%). Subtype B was the most prevalent subtype (39.3%), followed by CRF20-23-24_BG (19.5%), CRF19_cpx (18.0%) and CRF18_cpx (10.3%). Overall, 29 patients (7.2%) had evidence of drug resistance, with 4.0% (CI 1.6%-4.8%) in 2003 versus 12.5% (CI 7.2%-14.5%) in 2007-2011. A significant increase in drug resistance was observed in recently HIV-1 diagnosed patients, i.e. 14.8% (CI 8.0%-17.0%) in 2007-2011 versus 3.8% (CI 0.9%-4.7%) in 2003 (OR 3.9, CI 1.5-17.0, p=0.02). The majority of drug resistance was restricted to a single drug class (75.8%), with 55.2% patients displaying nucleoside reverse transcriptase inhibitor (NRTI), 10.3% non-NRTI (NNRTI) and 10.3% protease inhibitor (PI) resistance mutations. Respectively, 20.7% and 3.4% patients carried viruses containing drug resistance mutations against NRTI+NNRTI and NRTI+NNRTI+PI. The first cases of resistance towards other drug classes than NRTI were only detected from 2008 onwards. The most frequent resistance mutations were T215Y/rev (44.8%), M41L (31.0%), M184V (17.2%) and K103N (13.8%). The median genotypic susceptibility score for the
Kim, Juwon; Jung, Jinsei; Lee, Min Goo; Choi, Jae Young; Lee, Kyung-A
2015-06-19
GJB2 alleles containing two cis mutations have been rarely found in non-syndromic hearing loss. Herein, we present a Korean patient with non-syndromic hearing loss caused by the R75Q cis mutation with V37I, which arose de novo in the father and was inherited by the patient. Biochemical coupling and hemichannel permeability assays were performed after molecular cloning and transfection of HEK293T cells. Student's t-tests or analysis of variance followed by Tukey's multiple comparison test was used as statistical analysis. Biochemical coupling was significantly reduced in connexin 26 (Cx26)-R75Q- and Cx26-V37I-transfected cells, with greater extent in Cx26-R75Q and Cx26-R75Q+V37I cells. Interestingly, our patient and his father with the mutations had more residual hearing compared with patients with the dominant mutation alone. Although the difference in hemichannel activity between R75Q alone and R75Q in combination with V37I failed to reach significance, it is of note that there is a possibility that V37I located upstream of R75Q might have the ability to ameliorate R75Q expression. Our study emphasizes the importance of cis mutations with R75Q, as the gene effect of R75Q can be modulated depending on the type of additional mutation.
JAK2 and MPL gene mutations in V617F-negative myeloproliferative neoplasms.
Siemiatkowska, A.M.; Bieniaszewska, M.; Hellmann, A.; Limon, J.
2010-01-01
We report three novel mutations in JAK2 exons 12, 19 and 25 in V617F-negative patients with polycythemia vera, essential thrombocythemia and idiopathic myelofibrosis. Scanning of JAK2 exons 12-25 and MPL exon 10 revealed the presence of JAK2 alterations in six and MPL W515L/K mutations in five of 34
Ronde, Anthony de; Dooren, Maaike van; Hoek, Lian van der; Bouwhuis, Denise; Rooij, Esther de; Gemen, Bob van; Boer, R.J. de; Goudsmit, Jaap
2000-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT).
de Ronde, A.; van Dooren, M.; van der Hoek, L.; Bouwhuis, D.; de Rooij, E.; van Gemen, B.; de Boer, R.; Goudsmit, J.
2001-01-01
Sequence analysis of human immunodeficiency virus type 1 (HIV-1) from 74 persons with acute infections identified eight strains with mutations in the reverse transcriptase (RT) gene at positions 41, 67, 68, 70, 215, and 219 associated with resistance to the nucleoside analogue zidovudine (AZT).
21 CFR 184.1631 - Potassium hydroxide.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium hydroxide. 184.1631 Section 184.1631 Food... Specific Substances Affirmed as GRAS § 184.1631 Potassium hydroxide. (a) Potassium hydroxide (KOH, CAS Reg... pellets, flakes, sticks, lumps, and powders. Potassium hydroxide is obtained commercially from the...
46 CFR 184.220 - Cooking equipment.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...
International Nuclear Information System (INIS)
Varma, M.N.; Bond, V.P.
1982-01-01
Microdosimetric spectra for 0.43, 1.8, and 14.7 MeV neutrons, and for 215 kVp x rays and 1250 keV gammas were used in conjunction with relative biological effectiveness (RBE) values for pink mutations in Tradescantia to obtain an effectiveness function (i.e., a cell critical volume dose vs. cell response function). This effectiveness function (or hit size weighting function) provides the probability of inducing a biological effect of interest (in the present study, pink mutations in Tradescantia) as a function of lineal energy density y. In a preliminary analysis the critical value of y above which pink mutations are seen was 4.5 keV/μm, and the value of y at which the probability reaches unity was 115 keV/μm. Idealized but approximate event size distributions for mono-LET particles ranging from 10 to 5000 keV/μm were generated, and these distributions were weighted by the effectiveness function to determine the pink mutation frequencies. Results are compared with measured pink mutation frequencies for 11 keV/μm ( 12 C) and 31 keV/μm ( 20 Ne) ions
Zhao, Shixiang; Zhang, Xiang; Xu, Yang; Feng, Yufeng; Sheng, Wenhong; Cen, Jiannong; Wu, Depei; Han, Yue
2016-01-01
Most patients with polycythemia vera (PV) and half of essential thrombocythemia (ET) possess an activating JAK2V617F mutation. The objective of this study was to better define the effect of JAK2V617F mutant allele burden on clinical phenotypes in Chinese patients, especially thrombosis. By real-time polymerase chain reaction (RT-PCR), the JAK2V617F mutation burden was detected in 170 JAK2V617F-positive patients, including 54 PV and 116 ET. The results showed that JAK2V617F allele burden was higher in PV than in ET (PET (68.5% VS 26.7%) (PET patients showed increased JAK2V617F allele burden in the group with higher hemoglobin (HGB above 150 g/L) (PET. In PV patients, JAK2V617F mutation burden had influence on WBC counts. And the clinical characteristics of ET patients, such as WBC counts, hemoglobin level, splenomegaly and thrombosis, were influenced by JAK2V617F mutation burden. Male, high hemoglobin (HGB above 150 g/L), and increased JAK2V617F mutation burden (JAK2V617F allele burden ≥ 16.5%) were risks of thrombosis (PET patients by Logistic Regression.
Structure of doubly-odd nucleus 184Ir from the decay of 184Pt
International Nuclear Information System (INIS)
Ben Braham, A.; Bourgeois, C.; Kilcher, P.; Roussiere, B.; Sauvage, J.; Kreiner, A.J.; Porquet, M.G.
1987-01-01
States of 184 Ir populated through the β + /EC decay of 184 Pt, were studied using mass-separated sources and on-line γ-ray and e - spectroscopy techniques. A rather complete low-spin level scheme is established. Negative and positive parity structures are interpreted within the two-quasiparticle-plus-rotor model
21 CFR 184.1622 - Potassium chloride.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium chloride. 184.1622 Section 184.1622 Food... Specific Substances Affirmed as GRAS § 184.1622 Potassium chloride. (a) Potassium chloride (KCl, CAS Reg... levels not to exceed current good manufacturing practice. Potassium chloride may be used in infant...
Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B
2018-02-06
Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.
DEFF Research Database (Denmark)
Kielsgaard Kristensen, Thomas; Broesby-Olsen, Sigurd; Vestergaard, Hanne
2016-01-01
mutation levels. In this study, we established an NGS-based KIT mutation analysis and analyzed the sensitivity of D816V detection using the Ion Torrent platform. Eighty-two individual NGS analyses were included in the study. All samples were also analyzed using highly sensitive KIT D816V mutation...
Improving solubility and refolding efficiency of human V(H)s by a novel mutational approach.
Tanha, Jamshid; Nguyen, Thanh-Dung; Ng, Andy; Ryan, Shannon; Ni, Feng; Mackenzie, Roger
2006-11-01
The antibody V(H) domains of camelids tend to be soluble and to resist aggregation, in contrast to human V(H) domains. For immunotherapy, attempts have therefore been made to improve the properties of human V(H)s by camelization of a small set of framework residues. Here, we have identified through sequence comparison of well-folded llama V(H) domains an alternative set of residues (not typically camelid) for mutation. Thus, the solubility and thermal refolding efficiency of a typical human V(H), derived from the human antibody BT32/A6, were improved by introduction of two mutations in framework region (FR) 1 and 4 to generate BT32/A6.L1. Three more mutations in FR3 of BT32/A6.L1 further improved the thermal refolding efficiency while retaining solubility and cooperative melting profiles. To demonstrate practical utility, BT32/A6.L1 was used to construct a phage display library from which were isolated human V(H)s with good antigen binding activity and solubility. The engineered human V(H) domains described here may be useful for immunotherapy, due to their expected low immunogenicity, and in applications involving transient high temperatures, due to their efficient refolding after thermal denaturation.
Phenotypic diversity associated with the mitochondrial m.8313G>A point mutation.
LENUS (Irish Health Repository)
O'Rourke, Killian
2012-02-01
We report the clinical, histochemical, and molecular genetic findings in a patient with progressive mitochondrial cytopathy due to the m.8313G>A point mutation in the mitochondrial tRNA(Lys) (MTTK) gene. The clinical features in this case are severe, including short stature, myopathy, peripheral neuropathy, and osteoporosis, while extensive analysis of maternal relatives indicate that the mutation has arisen de novo and was not maternally inherited. This report of a second case, together with single muscle fiber mutation analysis that shows clear segregation of mutation load with cytochrome c oxidase deficiency, confirms that the mutation is pathologic.
Novel alpha-galactosidase A mutation in a female with recurrent strokes.
Tuttolomondo, Antonino; Duro, Giovanni; Miceli, Salvatore; Di Raimondo, Domenico; Pecoraro, Rosaria; Serio, Antonia; Albeggiani, Giuseppe; Nuzzo, Domenico; Iemolo, Francesco; Pizzo, Federica; Sciarrino, Serafina; Licata, Giuseppe; Pinto, Antonio
2012-11-01
Anderson-Fabry disease (AFD) is an X-linked inborn error of glycosphingolipid catabolism resulting from the deficient activity of the lysosomal exoglycohydrolase, a-galactosidase A. The complete genomic and cDNA sequences of the human alpha-galactosidase A gene have been determined and to date, several disease-causing alpha-galactosidase A mutations have been identified, including missense mutations, small deletions/insertions, splice mutations, and large gene rearrangements We report a case of a 56-year-old woman with recurrent cryptogenic strokes. Ophthalmological examination revealed whorled opacities of the cornea (cornea verticillata) and dilated tortuous conjunctival vessels. She did not show other typical signs of Fabry disease such as acroparesthesias and angiokeratoma. The patient's alpha-galactosidase A activity was 4.13 nmol/mL/h in whole blood. Alpha-galactosidase A gene sequence analysis revealed a heterozygous single nucleotide point mutation at nucleotide c.550T>A in exon 4 in this woman, leading to the p.Tyr184Asn amino acid substitution. Copyright © 2012 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Singdong, Roongrudee; Siriboonpiputtana, Teerapong; Chareonsirisuthigul, Takol; Kongruang, Adcharee; Limsuwanachot, Nittaya; Sirirat, Tanasan; Chuncharunee, Suporn; Rerkamnuaychoke, Budsaba
2016-10-01
Background: The discovery of somatic acquired mutations of JAK2 (V617F) in Philadelphia-negative myeloproliferative neoplasms (Ph-negative MPNs) including polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF) has not only improved rational disease classification and prognostication but also brings new understanding insight into the pathogenesis of diseases. Dosage effects of the JAK2 (V617F) allelic burden in Ph-negative MPNs may partially influence clinical presentation, disease progression, and treatment outcome. Material and Methods: Pyrosequencing was performed to detect JAK2 (V617F) and MPL (W515K/L) and capillary electrophoresis to identify CALR exon 9.0 mutations in 100.0 samples of Ph-negative MPNs (38.0 PV, 55 ET, 4 PMF, and 3 MPN-U). Results: The results showed somatic mutations of JAK2 (V617F) in 94.7% of PV, 74.5% of ET, 25.0% of PMF, and all MPN-U. A high proportion of JAK2 (V617F) mutant allele burden (mutational load > 50.0%) was predominantly observed in PV when compared with ET. Although a high level of JAK2 (V617F) allele burden was strongly associated with high WBC counts in both PV and ET, several hematological parameters (hemoglobin, hematocrit, and platelet count) were independent of JAK2 (V617F) mutational load. MPL (W515K/L) mutations could not be detected whereas CALR exon 9.0 mutations were identified in 35.7% of patients with JAK2 negative ET and 33.3% with JAK2 negative PMF. Conclusions: The JAK2 (V617F) allele burden may be involved in progression of MPNs. Furthermore, a high level of JAK2 (V617F) mutant allele appears strongly associated with leukocytosis in both PV and ET. Creative Commons Attribution License
21 CFR 184.1643 - Potassium sulfate.
2010-04-01
... hydroxide or potassium carbonate. (b) The ingredient meets the specifications of the “Food Chemicals Codex... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium sulfate. 184.1643 Section 184.1643 Food... Specific Substances Affirmed as GRAS § 184.1643 Potassium sulfate. (a) Potassium sulfate (K2SO4, CAS Reg...
21 CFR 184.1702 - Sheanut oil.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sheanut oil. 184.1702 Section 184.1702 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1702 Sheanut oil. (a) Sheanut oil is produced from sheanuts derived from...
21 CFR 184.1555 - Rapeseed oil.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Rapeseed oil. 184.1555 Section 184.1555 Food and... Substances Affirmed as GRAS § 184.1555 Rapeseed oil. (a) Fully hydrogenated rapeseed oil. (1) Fully hydrogenated rapeseed oil is a mixture of triglycerides in which the fatty acid composition is a mixture of...