
Sample records for reverse-transcriptase inhibitor-based antiretroviral

  1. Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy. (United States)

    Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen


    Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

  2. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,


    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  3. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.


    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  4. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta


    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  5. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor


    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  6. Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

    DEFF Research Database (Denmark)

    Fox, Zoe; Phillips, Andrew; Cohen, Cal


    the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

  7. Nelfinavir and Non-Nucleoside Reverse Transcriptase Inhibitor-Based Salvage Regimes in Heavily Hiv Pretreated Patients

    Directory of Open Access Journals (Sweden)

    Jean-Guy Baril


    Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.

  8. Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens. (United States)

    Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat


    We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

  9. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy. (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad


    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  10. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India. (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami


    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  11. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  12. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy

    DEFF Research Database (Denmark)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah


    -AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...

  13. Reverse transcriptase inhibitors as microbicides. (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido


    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  14. Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

    DEFF Research Database (Denmark)

    Mocroft, A; Horban, A; Clumeck, N


    increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

  15. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor. (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko


    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  16. Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals. (United States)

    Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi


    The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

  17. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy? (United States)

    Nolan, David


    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  18. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)


    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  19. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors


    Nicolas Sluis-Cremer


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  20. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase


    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami


    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  1. Reverse transcriptase inhibitors as potential colorectal microbicides. (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J


    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  2. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors]. (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V


    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  3. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor. (United States)

    Sharma, Mamta; Saravolatz, Louis D


    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  4. Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study. (United States)

    Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A


    Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

  5. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer


    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  6. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors. (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda


    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  7. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran


    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  8. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P


    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  9. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  10. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.


    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  11. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos


    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.


    African Journals Online (AJOL)


    Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).

  13. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)


    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  14. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe


    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  15. The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors. (United States)

    Sluis-Cremer, Nicolas


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  16. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer


    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  17. 4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor. (United States)

    Markowitz, Martin; Sarafianos, Stefan G


    4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

  18. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi


    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  19. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ † (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.


    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  20. A second chance for telomerase reverse transcriptase in anticancer immunotherapy. (United States)

    Zanetti, Maurizio


    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  1. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.


    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  2. New targets and novel antiretrovirals | Wood | Southern African ...

    African Journals Online (AJOL)

    Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...

  3. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.


    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  4. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase. (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami


    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  5. TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats (United States)

    Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin


    In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

  6. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India. (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind


    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  7. HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial. (United States)

    Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H


    Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. ( NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

  8. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.


    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  9. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin


    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  10. Diabetes mellitus in HIV-infected patients receiving antiretroviral ...

    African Journals Online (AJOL)

    Primary analysis using conditional logistic regression was employed to estimate univariate .... Refers to first-line regimen in Botswana – either non-nucleoside reverse transcriptase inhibitor-based regimen (NVP or. EFV) or .... Public Health.

  11. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.


    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  12. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang


    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  13. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens


    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  14. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele


    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  15. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina


    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  16. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors. (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M


    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  17. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand. (United States)

    Zhao, Chen; Pyle, Anna Marie


    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.


    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  19. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão


    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  20. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors. (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A


    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  1. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology. (United States)

    Collins, Kathleen; Nilsen, Timothy W


    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  2. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics. (United States)

    Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S


    The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    DEFF Research Database (Denmark)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy


    Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

  4. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder. (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao


    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  5. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.


    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  6. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma


    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei


    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  7. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B


    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  8. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo


    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  9. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.


    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  10. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase. (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano


    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  11. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  12. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1. (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F


    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  13. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors. (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M


    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  14. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics


    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.


    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

  15. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals. (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L


    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  16. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE. (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan


    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  18. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  19. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase. (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari


    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  20. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors. (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X


    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  1. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas


    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  2. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors. (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A


    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition. (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis


    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  4. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP. (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  5. Treatment Failure in HIV-Infected Children on Second-line Protease Inhibitor-Based Antiretroviral Therapy. (United States)

    Suaysod, Rapeepan; Ngo-Giang-Huong, Nicole; Salvadori, Nicolas; Cressey, Tim R; Kanjanavanit, Suparat; Techakunakorn, Pornchai; Krikajornkitti, Sawitree; Srirojana, Sakulrat; Laomanit, Laddawan; Chalermpantmetagul, Suwalai; Lallemant, Marc; Le Cœur, Sophie; McIntosh, Kenneth; Traisathit, Patrinee; Jourdain, Gonzague


    Human immunodeficiency virus (HIV)-infected children failing second-line antiretroviral therapy (ART) have no access to third-line antiretroviral drugs in many resource-limited settings. It is important to identify risk factors for second-line regimen failure. HIV-infected children initiating protease inhibitor (PI)-containing second-line ART within the Program for HIV Prevention and Treatment observational cohort study in Thailand between 2002 and 2010 were included. Treatment failure was defined as confirmed HIV type 1 RNA load >400 copies/mL after at least 6 months on second-line regimen or death. Adherence was assessed by drug plasma levels and patient self-report. Cox proportional hazards regression analyses were used to identify risk factors for failure. A total of 111 children started a PI-based second-line regimen, including 59 girls (53%). Median first-line ART duration was 1.9 years (interquartile range [IQR], 1.4-3.3 years), and median age at second-line initiation was 10.7 years (IQR, 6.3-13.4 years). Fifty-four children (49%) experienced virologic failure, and 2 (2%) died. The risk of treatment failure 24 months after second-line initiation was 41%. In multivariate analyses, failure was independently associated with exposure to first-line ART for >2 years (adjusted hazard ratio [aHR], 1.8; P = .03), age >13 years (aHR, 2.9; P < .001), body mass index-for-age z score < -2 standard deviations at second-line initiation (aHR, 2.8; P = .03), and undetectable drug levels within 6 months following second-line initiation (aHR, 4.5; P < .001). Children with longer exposure to first-line ART, entry to adolescence, underweight, and/or undetectable drug levels were at higher risk of failing second-line ART and thus should be closely monitored. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail:

  6. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments. (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen


    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  7. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.


    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  8. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  9. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

    DEFF Research Database (Denmark)

    Sabin, Caroline A; Worm, Signe W; Weber, Rainer


    cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

  10. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng


    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  11. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo


    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  12. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali


    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  13. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase. (United States)

    Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V


    Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

  14. Reverse transcriptase directs viral evolution in a deep ocean methane seep (United States)

    Paul, B. G.; Bagby, S. C.


    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  15. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen


    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  16. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly


    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  17. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak


    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  18. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado


    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  19. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma. (United States)

    Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei


    Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

  20. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.


    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  1. Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages (United States)

    Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis


    Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

  2. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki


    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  3. Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains. (United States)

    Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania


    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿


    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.


    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  5. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P


    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  6. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar


    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  7. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel


    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  8. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos


    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  9. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee


    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  10. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna


    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  11. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado


    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  12. Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide. (United States)

    Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D


    TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

  13. The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients (United States)

    Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita


    Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

  14. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)


    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: // imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  15. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter. (United States)

    Wang, Shuwen; Zhu, Jiyue


    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  16. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods. (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit


    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  17. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

    Directory of Open Access Journals (Sweden)

    Soo-Huey Yap


    Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

  18. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.


    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  19. Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis. (United States)

    Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato


    Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

  20. [Diagnostic significance of serum free DNA human telomerase reverse transcriptase quantitative determination on spinal cord injury]. (United States)

    Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B


    Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.

  1. Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro. (United States)

    Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L


    Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

  2. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics (United States)

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.


    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

  3. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae). (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna


    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  4. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides† (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul


    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  5. Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H. (United States)

    Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng


    The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

  6. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  7. Efficacy and durability of nevirapine in antiretroviral drug naive patients

    NARCIS (Netherlands)

    Lange, Joep M. A.


    Nevirapine is a non-nucleoside reverse transcriptase inhibitor (NNRTI) that was first reported in the scientific literature in 1990. Varying doses of nevirapine (NVP) and a number of regimens containing this NNRTI have been studied in antiretroviral (ARV) naive patients. Four key studies have

  8. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki


    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  9. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)


    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  10. Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ren, He, E-mail: [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)


    The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

  11. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA? (United States)

    Schuster, W; Brennicke, A


    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  12. In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations. (United States)

    Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark


    BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

  13. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008. (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J


    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  14. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  15. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)


    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  16. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko


    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  17. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.


    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  18. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  19. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.


    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  20. Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice. (United States)

    Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue


    To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

  1. The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family. (United States)

    Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong


    1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

  2. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis. (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi


    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  3. Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase. (United States)

    Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio


    We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

  4. In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

    Directory of Open Access Journals (Sweden)

    Johannes Van Staden


    Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

  5. Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies. (United States)

    Gnanasekaran, Ramachandran


    We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

  6. Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

    Directory of Open Access Journals (Sweden)

    Oluwafeyisetan O. Adebiyi


    Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

  7. Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Alessandra M. T. de Souza


    Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

  8. A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties. (United States)

    Fang, Evandro Fei; Ng, Tzi Bun


    Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

  9. Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor. (United States)

    Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R


    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

  10. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿ (United States)

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.


    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

  11. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi


    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  12. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  13. Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility. (United States)

    Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W


    Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

  14. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors. (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan


    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at:

  15. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil. (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino


    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  16. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes. (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis


    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  17. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti


    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  18. A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

    DEFF Research Database (Denmark)

    Kirk, Ole; Lundgren, Jens D; Pedersen, Court


    BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

  19. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli


    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  20. Virologic failure of protease inhibitor-based second-line antiretroviral therapy without resistance in a large HIV treatment program in South Africa.

    Directory of Open Access Journals (Sweden)

    Julie H Levison

    Full Text Available We investigated the prevalence of wild-type virus (no major drug resistance and drug resistance mutations at second-line antiretroviral treatment (ART failure in a large HIV treatment program in South Africa.HIV-infected patients ≥ 15 years of age who had failed protease inhibitor (PI-based second-line ART (2 consecutive HIV RNA tests >1000 copies/ml on lopinavir/ritonavir, didanosine, and zidovudine were identified retrospectively. Patients with virologic failure were continued on second-line ART. Genotypic testing for drug resistance was performed on frozen plasma samples obtained closest to and after the date of laboratory confirmed second-line ART failure. Of 322 HIV-infected patients on second-line ART, 43 were adults with confirmed virologic failure, and 33 had available plasma for viral sequencing. HIV-1 RNA subtype C predominated (n = 32, 97%. Mean duration on ART (SD prior to initiation of second-line ART was 23 (17 months, and time from second-line ART initiation to failure was 10 (9 months. Plasma samples were obtained 7(9 months from confirmed failure. At second-line failure, 22 patients (67% had wild-type virus. There was no major resistance to PIs found. Eleven of 33 patients had a second plasma sample taken 8 (5.5 months after the first. Median HIV-1 RNA and the genotypic resistance profile were unchanged.Most patients who failed second-line ART had wild-type virus. We did not observe evolution of resistance despite continuation of PI-based ART after failure. Interventions that successfully improve adherence could allow patients to continue to benefit from second-line ART therapy even after initial failure.

  1. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method


    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao


    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  2. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice (United States)

    Li, Runqin; Zhang, Yinglin


    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  3. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR


    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin


    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  4. Diagnosis, antiretroviral therapy, and emergence of resistance to antiretroviral agents in HIV-2 infection: a review

    Directory of Open Access Journals (Sweden)

    Maia Hightower

    Full Text Available Human immunodeficiency virus type 1 (HIV-1 and type 2 (HIV-2 are the causative agents of AIDS. HIV-2 is prevalent at moderate to high rates in West African countries, such as Senegal, Guinea, Gambia, and Cape Verde. Diagnosis of HIV-2 is made with a positive HIV-1/HIV-2 ELISA or simple/rapid assay, followed by one or two confirmatory tests specific for HIV-2. Following CD4+ T cell counts, HIV-2 viral burden and clinical signs and symptoms of immunodeficiency are beneficial in monitoring HIV-2 disease progression. Although non-nucleoside reverse transcriptase inhibitors are ineffective in treating HIV-2, nucleoside reverse transcriptase inhibitors and protease inhibitors can be effective in dual and triple antiretroviral regimens. Their use can decrease HIV-2 viral load, increase CD4+ T cell counts and improve AIDS-related symptoms. HIV-2 resistance to various nucleoside reverse transcriptase inhibitors and protease inhibitors, including zidovudine, lamivudine, ritonavir and indinavir, has been identified in some HIV-2 infected patients on antiretroviral therapy. The knowledge of HIV-2 peculiarities, when compared to HIV-1, is crucial to helping diagnose and guide the clinician in the choice of the initial antiretroviral regimen and for monitoring therapy success.

  5. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase. (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha


    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  6. Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

    Directory of Open Access Journals (Sweden)

    Cha YJ


    Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

  7. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires. (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z


    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  8. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler


    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  9. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  10. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas


    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  11. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase. (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S


    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  12. Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.


    The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

  13. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong


    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  14. Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu Tiantian


    Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

  15. Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Su X


    Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

  16. Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

    Directory of Open Access Journals (Sweden)

    Warrilow David


    Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

  17. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie


    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  18. Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage. (United States)

    Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X


    Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

  19. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis. (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine


    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  20. Clinical outcome of HIV-infected patients with sustained virologic response to antiretroviral therapy: long-term follow-up of a multicenter cohort.

    Directory of Open Access Journals (Sweden)

    Félix Gutierrez

    Full Text Available BACKGROUND: Limited information exists on long-term prognosis of patients with sustained virologic response to antiretroviral therapy. We aimed to assess predictors of unfavorable clinical outcome in patients who maintain viral suppression with HAART. METHODS: Using data collected from ten clinic-based cohorts in Spain, we selected all antiretroviral-naive adults who initiated HAART and maintained plasma HIV-1 RNA levels <500 copies/mL throughout follow-up. Factors associated with disease progression were determined by Cox proportional-hazards models. RESULTS: Of 2,613 patients who started HAART, 757 fulfilled the inclusion criteria. 61% of them initiated a protease inhibitor-based HAART regimen, 29.7% a nonnucleoside reverse-transcriptase inhibitor-based regimen, and 7.8% a triple-nucleoside regimen. During 2,556 person-years of follow-up, 22 (2.9% patients died (mortality rate 0.86 per 100 person-years, and 40 (5.3% died or developed a new AIDS-defining event. The most common causes of death were neoplasias and liver failure. Mortality was independently associated with a CD4-T cell response <50 cells/L after 12 months of HAART (adjusted hazard ratio [AHR], 4.26 [95% confidence interval {CI}, 1.68-10.83]; P = .002, and age at initiation of HAART (AHR, 1.06 per year; 95% CI, 1.02-1.09; P = .001. Initial antiretroviral regimen chosen was not associated with different risk of clinical progression. CONCLUSIONS: Patients with sustained virologic response on HAART have a low mortality rate over time. Long-term outcome of these patients is driven by immunologic response at the end of the first year of therapy and age at the time of HAART initiation, but not by the initial antiretroviral regimen selected.

  1. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro. (United States)

    Patick, A K; Boritzki, T J; Bloom, L A


    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

  2. Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Markus Hecht

    Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

  3. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V


    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  4. Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy


    HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

  5. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase. (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki


    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  6. Effects of Combined CCR5/Integrase Inhibitors-Based Regimen on Mucosal Immunity in HIV-Infected Patients Naïve to Antiretroviral Therapy: A Pilot Randomized Trial.

    Directory of Open Access Journals (Sweden)

    Sergio Serrano-Villar


    Full Text Available Whether initiation of antiretroviral therapy (ART regimens aimed at achieving greater concentrations within gut associated lymphoid tissue (GALT impacts the level of mucosal immune reconstitution, inflammatory markers and the viral reservoir remains unknown. We included 12 HIV- controls and 32 ART-naïve HIV patients who were randomized to efavirenz, maraviroc or maraviroc+raltegravir, each with fixed-dose tenofovir disoproxil fumarate/emtricitabine. Rectal and duodenal biopsies were obtained at baseline and at 9 months of ART. We performed a comprehensive assay of T-cell subsets by flow cytometry, T-cell density in intestinal biopsies, plasma and tissue concentrations of antiretroviral drugs by high-performance liquid chromatography/mass spectroscopy, and plasma interleukin-6 (IL-6, lipoteichoic acid (LTA, soluble CD14 (sCD14 and zonulin-1 each measured by ELISA. Total cell-associated HIV DNA was measured in PBMC and rectal and duodenal mononuclear cells. Twenty-six HIV-infected patients completed the follow-up. In the duodenum, the quadruple regimen resulted in greater CD8+ T-cell density decline, greater normalization of mucosal CCR5+CD4+ T-cells and increase of the naïve/memory CD8+ T-cell ratio, and a greater decline of sCD14 levels and duodenal HIV DNA levels (P = 0.004 and P = 0.067, respectively, with no changes in HIV RNA in plasma or tissue. Maraviroc showed the highest drug distribution to the gut tissue, and duodenal concentrations correlated well with other T-cell markers in duodenum, i.e., the CD4/CD8 ratio, %CD4+ and %CD8+ HLA-DR+CD38+ T-cells. Maraviroc use elicited greater activation of the mucosal naïve CD8+ T-cell subset, ameliorated the distribution of the CD8+ T-cell maturational subsets and induced higher improvement of zonulin-1 levels. These data suggest that combined CCR5 and integrase inhibitor based combination therapy in ART treatment naïve patients might more effectively reconstitute duodenal immunity, decrease

  7. 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase. (United States)

    Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong


    We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  8. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR. (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M


    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  9. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.


    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  10. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication. (United States)

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon


    The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

  11. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis. (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M


    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  12. In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection. (United States)

    Giacobbi, Nicholas S; Sluis-Cremer, Nicolas


    Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

  13. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells. (United States)

    Ngai, Patrick H K; Ng, T B


    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  14. Expression of human telomerase reverse transcriptase protein in oral epithelial dysplasia and oral squamous cell carcinoma: An immunohistochemical study (United States)

    Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao


    Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were

  15. Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

    Directory of Open Access Journals (Sweden)

    Turyadi Turyadi


    Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

  16. The safety and pharmacokinetics of a reverse transcriptase inhibitor, 3TC, in patients with HIV infection: a phase I study

    NARCIS (Netherlands)

    van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.


    To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient

  17. A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

    International Nuclear Information System (INIS)

    Ferkous, F.; Saihi, Y.


    Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

  18. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase. (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C


    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  19. Drug resistance mutations in HIV type 1 isolates from naive patients eligible for first line antiretroviral therapy in JJ Hospital, Mumbai, India. (United States)

    Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J


    More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.

  20. [The efficacy of autocatalytic casapse-3 driven by human telomerase reverse transcriptase promoter on human ovarian carcinoma]. (United States)

    Song, Yue; Shen, Keng; Yu, Jing-rong


    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase

  1. Maternal Nutritional Status Predicts Adverse Birth Outcomes among HIV-Infected Rural Ugandan Women Receiving Combination Antiretroviral Therapy (United States)

    Young, Sera; Murray, Katherine; Mwesigwa, Julia; Natureeba, Paul; Osterbauer, Beth; Achan, Jane; Arinaitwe, Emmanuel; Clark, Tamara; Ades, Veronica; Plenty, Albert; Charlebois, Edwin; Ruel, Theodore; Kamya, Moses; Havlir, Diane; Cohan, Deborah


    Objective Maternal nutritional status is an important predictor of birth outcomes, yet little is known about the nutritional status of HIV-infected pregnant women treated with combination antiretroviral therapy (cART). We therefore examined the relationship between maternal BMI at study enrollment, gestational weight gain (GWG), and hemoglobin concentration (Hb) among 166 women initiating cART in rural Uganda. Design Prospective cohort. Methods HIV-infected, ART-naïve pregnant women were enrolled between 12 and 28 weeks gestation and treated with a protease inhibitor or non-nucleoside reverse transcriptase inhibitor-based combination regimen. Nutritional status was assessed monthly. Neonatal anthropometry was examined at birth. Outcomes were evaluated using multivariate analysis. Results Mean GWG was 0.17 kg/week, 14.6% of women experienced weight loss during pregnancy, and 44.9% were anemic. Adverse fetal outcomes included low birth weight (LBW) (19.6%), preterm delivery (17.7%), fetal death (3.9%), stunting (21.1%), small-for-gestational age (15.1%), and head-sparing growth restriction (26%). No infants were HIV-infected. Gaining pregnancy, grossly inadequate GWG was common. Infants whose mothers gained <0.1 kg/week were at increased risk for LBW, preterm delivery, and composite adverse birth outcomes. cART by itself may not be sufficient for decreasing the burden of adverse birth outcomes among HIV-infected women. Trial Registration NCT00993031 PMID:22879899

  2. Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase. (United States)

    Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang


    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity. (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A


    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Adipocytes Impair Efficacy of Antiretroviral Therapy (United States)

    Couturier, Jacob; Winchester, Lee C.; Suliburk, James W.; Wilkerson, Gregory K.; Podany, Anthony T.; Agarwal, Neeti; Chua, Corrine Ying Xuan; Nehete, Pramod N.; Nehete, Bharti P.; Grattoni, Alessandro; Sastry, K. Jagannadha; Fletcher, Courtney V.; Lake, Jordan E.; Balasubramanyan, Ashok; Lewis, Dorothy E.


    Adequate distribution of antiretroviral drugs to infected cells in HIV patients is critical for viral suppression. In humans and primates, HIV- and SIV-infected CD4 T cells in adipose tissues have recently been identified as reservoirs for infectious virus. To better characterize adipose tissue as a pharmacological sanctuary for HIV-infected cells, in vitro experiments were conducted to assess antiretroviral drug efficacy in the presence of adipocytes, and drug penetration in adipose tissue cells (stromal-vascular-fraction cells and mature adipocytes) was examined in treated humans and monkeys. Co-culture experiments between HIV-1-infected CD4 T cells and primary human adipocytes showed that adipocytes consistently reduced the antiviral efficacy of the nucleotide reverse transcriptase inhibitor tenofovir and its prodrug forms tenofovir disoproxil fumarate (TDF) and tenofovir alafenamide (TAF). In HIV-infected persons, LC-MS/MS analysis of intracellular lysates derived from adipose tissue stromal-vascular-fraction cells or mature adipocytes suggested that integrase inhibitors penetrate adipose tissue, whereas penetration of nucleoside/nucleotide reverse transcriptase inhibitors such as TDF, emtricitabine, abacavir, and lamivudine is restricted. The limited distribution and functions of key antiretroviral drugs within fat depots may contribute to viral persistence in adipose tissue. PMID:29630975

  5. Challenges in Initiating Antiretroviral Therapy in 2010

    Directory of Open Access Journals (Sweden)

    Cécile L Tremblay


    Full Text Available Many clinical trials have shown that initiating antiretroviral therapy (ART at higher rather than lower CD4 T cell-positive counts results in survival benefit. Early treatment can help prevent end-organ damage associated with HIV replication and can decrease infectivity. The mainstay of treatment is either a non-nucleoside reverse transcriptase inhibitor or a ritonavir-boosted protease inhibitor in combination with two nucleoside reverse transcriptase inhibitors. While effective at combating HIV, ART can produce adverse alterations of lipid parameters, with some studies suggesting a relationship between some anti-retroviral agents and cardiovascular disease. As the HIV-positive population ages, issues such as hypertension and diabetes must be taken into account when initiating ART. Adhering to ART can be difficult; however, nonoptimal adherence to ART can result in the development of resistance; thus, drug characteristics and the patient’s preparedness to begin therapy must be considered. Reducing the pill burden through the use of fixed-dose antiretroviral drug combinations can facilitate adherence.

  6. Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1: 96 week results from the NEAT001/ANRS143 randomised non-inferiority trial

    NARCIS (Netherlands)

    Raffi, François; Babiker, Abdel G.; Richert, Laura; Molina, Jean-Michel; George, Elizabeth C.; Antinori, Andrea; Arribas, Jose R.; Grarup, Jesper; Hudson, Fleur; Schwimmer, Christine; Saillard, Juliette; Wallet, Cédrick; Jansson, Per O.; Allavena, Clotilde; van Leeuwen, Remko; Delfraissy, Jean-François; Vella, Stefano; Chêne, Geneviève; Pozniak, Anton; Dedes, Nikos; Autran, Brigitte; Bucciardini, Raffaella; Horban, Andrzej; Arribas, José; Boffito, Marta; Pillay, Deenan; Franquet, Xavier; Schwarze, Siegfried; Fischer, Aurélie; Diallo, Alpha; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; Gatell, José; Sandström, Eric; Flepp, Markus; Ewings, Fiona; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Soussi, Malika; Taieb, Audrey; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, André; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Raffi, Francois; Ragnaud, Jean Marie; Weiss, Laurence; Yazdanpanah, Yazdan; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; Eeden, Van; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Gonzalez Garcia, Juan; López Aldeguer, José; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Pilar Miralles, Martin; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Boucher, Charles; Calvez, Vincent; Collins, Simon; Dunn, David; Fox, Zoe; Perno, Carlo Federico; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; Arribas, Jose; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria


    Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. Between August, 2010, and September, 2011, we

  7. Bone mineral density and inflammatory and bone biomarkers after darunavir-ritonavir combined with either raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults with HIV-1: a substudy of the NEAT001/ANRS143 randomised trial

    NARCIS (Netherlands)

    Bernardino, Jose I.; Mocroft, Amanda; Mallon, Patrick W.; Wallet, Cedrick; Gerstoft, Jan; Russell, Charlotte; Reiss, Peter; Katlama, Christine; de Wit, Stephane; Richert, Laura; Babiker, Abdel; Buño, Antonio; Castagna, Antonella; Girard, Pierre-Marie; Chene, Genevieve; Raffi, Francois; Arribas, Jose R.; Dedes, Nikos; Allavena, Clotilde; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raffaella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurelie; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jurgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Prins, Jan; Wit, Ferdinand W. N. M.; Nieuwkerk, Pythia


    Osteopenia, osteoporosis, and low bone mineral density are frequent in patients with HIV. We assessed the 96 week loss of bone mineral density associated with a nucleoside or nucleotide reverse transcriptase inhibitor (NtRTI)-sparing regimen. Antiretroviral-naive adults with HIV were enrolled in 78

  8. HIV-1 drug resistance before initiation or re-initiation of first-line antiretroviral therapy in low-income and middle-income countries: a systematic review and meta-regression analysis

    NARCIS (Netherlands)

    Gupta, Ravindra K.; Gregson, John; Parkin, Neil; Haile-Selassie, Hiwot; Tanuri, Amilcar; Andrade Forero, Liliana; Kaleebu, Pontiano; Watera, Christine; Aghokeng, Avelin; Mutenda, Nicholus; Dzangare, Janet; Hone, San; Hang, Zaw Zaw; Garcia, Judith; Garcia, Zully; Marchorro, Paola; Beteta, Enrique; Giron, Amalia; Hamers, Raph; Inzaule, Seth; Frenkel, Lisa M.; Chung, Michael H.; de Oliveira, Tulio; Pillay, Deenan; Naidoo, Kogie; Kharsany, Ayesha; Kugathasan, Ruthiran; Cutino, Teresa; Hunt, Gillian; Avila Rios, Santiago; Doherty, Meg; Jordan, Michael R.; Bertagnolio, Silvia


    Pretreatment drug resistance in people initiating or re-initiating antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTIs) might compromise HIV control in low-income and middle-income countries (LMICs). We aimed to assess the scale of this problem and whether

  9. Enhanced activity of carbosilane dendrimers against HIV when combined with reverse transcriptase inhibitor drugs: searching for more potent microbicides

    Directory of Open Access Journals (Sweden)

    Vacas-Córdoba E


    Full Text Available Enrique Vacas-Córdoba,1–3 Marta Galán,3,4 Francisco J de la Mata,3,4 Rafael Gómez,3,4 Marjorie Pion,1–3 M Ángeles Muñoz-Fernández1–3 1Laboratorio InmunoBiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain; 2Instituto de Investigación Sanitaria del Gregorio Marañón, Madrid, Spain; 3Networking Research Center on Bioengineering, Biomaterials and Nanomedicine, (CIBER-BBN, Madrid, Spain; 4Dendrimers for Biomedical Applications Group (BioInDen, University of Alcalá, Madrid, Spain Abstract: Self-administered topical microbicides or oral preexposure prophylaxis could be very helpful tools for all risk groups to decrease the human immunodeficiency virus (HIV-1 infection rates. Up until now, antiretrovirals (ARVs have been the most advanced microbicide candidates. Nevertheless, the majority of clinical trials has failed in HIV-1 patients. Nanotechnology offers suitable approaches to develop novel antiviral agents. Thereby, new nanosystems, such as carbosilane dendrimers, have been shown to be safe and effective compounds against HIV with great potential as topical microbicides. In addition, because most of the attempts to develop effective topical microbicides were unsuccessful, combinatorial strategies could be a valid approach when designing new microbicides. We evaluated various combinations of anionic carbosilane dendrimers with sulfated (G3-S16 and naphthyl sulfonated (G2-NF16 ended groups with different ARVs against HIV-1 infection. The G3-S16 and G2-NF16 dendrimers showed a synergistic or additive activity profile with zidovudine, efavirenz, and tenofovir in the majority of the combinations tested against the X4 and R5 tropic HIV-1 in cell lines, as well as in human primary cells. Therefore, the combination of ARVs and polyanionic carbosilane dendrimers enhances the antiviral potency of the individual compounds, and our findings support further clinical research on combinational approaches as

  10. Impact of switching antiretroviral therapy on lipodystrophy and other metabolic complications: a review

    DEFF Research Database (Denmark)

    Hansen, Birgitte Rønde; Haugaard, Steen B; Iversen, Johan


    Following the introduction of highly active antiretroviral therapy (HAART), metabolic and morphological complications known as HIV associated lipodystrophy syndrome (HALS) have been increasingly common. The approaches to target these complications span from resistance exercise, diet and use...... with the disfiguring body-alterations known as HALS. More recently, however, regimens containing nucleoside reverse-transcriptase inhibitors (NRTI) have attracted attention. Reviewing switch studies regarding metabolic parameters and body shape changes, certain trends emerge. Switching from PI, the metabolic...

  11. Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen

    Directory of Open Access Journals (Sweden)

    Colebunders Robert


    Full Text Available Abstract Background Vitamin D is an important determinant of bone health and also plays a major role in the regulation of the immune system. Interestingly, vitamin D status before the start of highly active antiretroviral therapy (HAART has been recently associated with HIV disease progression and overall mortality in HIV-positive pregnant women. We prospectively studied vitamin D status in HIV individuals on HAART in Belgium. We selected samples from HIV-positive adults starting HAART with a pre-HAART CD4 T-cell count >100 cells/mm3 followed up for at least 12 months without a treatment change. We compared 25-hydroxyvitamin D plasma [25-(OHD] concentration in paired samples before and after 12 months of HAART. 25-(OHD levels are presented using two different cut-offs: Results Vitamin D deficiency was common before HAART, the frequency of plasma 25-(OHD concentrations below 20 ng/ml and 30 below ng/ml was 43.7% and 70.1% respectively. After 12 months on HAART, the frequency increased to 47.1% and 81.6%. HAART for 12 months was associated with a significant decrease of plasma 25-(OHD concentration (p = 0.001. Decreasing plasma 25-(OHD concentration on HAART was associated in the multivariate model with NNRTI-based regimen (p = 0.001 and lower body weight (p = 0.008. Plasma 25-(OHD concentrations decreased significantly in both nevirapine and efavirenz-containing regimens but not in PI-treated patients. Conclusions Vitamin D deficiency is frequent in HIV-positive individuals and NNRTI therapy further decreases 25-(OHD concentrations. Consequently, vitamin D status need to be checked regularly in all HIV-infected patients and vitamin D supplementation should be given when needed.

  12. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study. (United States)

    Spackman, Erica; Suarez, David L


    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  13. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers. (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake


    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  14. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    International Nuclear Information System (INIS)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin


    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

  15. Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H. (United States)

    Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang


    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression. (United States)

    Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong


    In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

  17. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan


    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  18. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta


    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  19. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang


    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  20. Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system. (United States)

    Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi


    We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

  1. Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations. (United States)

    Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P


    Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

  2. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu


    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  3. Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA. (United States)

    Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin


    The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

  4. A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

    International Nuclear Information System (INIS)

    Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun


    Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

  5. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.


    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  6. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  7. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

    International Nuclear Information System (INIS)

    Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha


    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

  8. Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants. (United States)

    Berman, Andrea J; Gooding, Anne R; Cech, Thomas R


    The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

  9. Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission. (United States)

    Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido


    Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

  10. Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses. (United States)

    Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun


    The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission. (United States)

    Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia


    Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

  12. A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

    Directory of Open Access Journals (Sweden)

    Johnson Barry C


    Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

  13. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction. (United States)

    Amendola, R


    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  14. Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

    International Nuclear Information System (INIS)

    Freeman-Wittig, M.J.B.


    The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

  15. Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration. (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M


    Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

  16. Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M


    Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

  17. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang


    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  18. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li


    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  19. Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase (United States)

    Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni


    Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

  20. Antiretroviral drug susceptibility among drug-naive adults with recent HIV infection in Rakai, Uganda. (United States)

    Eshleman, Susan H; Laeyendecker, Oliver; Parkin, Neil; Huang, Wei; Chappey, Colombe; Paquet, Agnes C; Serwadda, David; Reynolds, Steven J; Kiwanuka, Noah; Quinn, Thomas C; Gray, Ronald; Wawer, Maria


    To analyze antiretroviral drug susceptibility in HIV from recently infected adults in Rakai, Uganda, prior to the availability of antiretroviral drug treatment. Samples obtained at the time of HIV seroconversion (1998-2003) were analyzed using the GeneSeq HIV and PhenoSense HIV assays (Monogram Biosciences, Inc., South San Francisco, California, USA). Test results were obtained for 104 samples (subtypes: 26A, 1C, 66D, 9A/D, 1C/D, 1 intersubtype recombinant). Mutations used for genotypic surveillance of transmitted antiretroviral drug resistance were identified in six samples: three had nucleoside reverse transcriptase inhibitor (NRTI) surveillance mutations (two had M41L, one had K219R), and three had protease inhibitor surveillance mutations (I47V, F53L, N88D); none had nonnucleoside reverse transcriptase inhibitor (NNRTI) surveillance mutations. Other resistance-associated mutations were identified in some samples. However, none of the samples had a sufficient number of mutations to predict reduced antiretroviral drug susceptibility. Ten (9.6%) of the samples had reduced phenotypic susceptibility to at least one drug (one had partial susceptibility to didanosine, one had nevirapine resistance, and eight had resistance or partial susceptibility to at least one protease inhibitor). Fifty-three (51%) of the samples had hypersusceptibility to at least one drug (seven had zidovudine hypersusceptibility, 28 had NNRTI hypersusceptibility, 34 had protease inhibitor hypersusceptibility). Delavirdine hypersusceptibility was more frequent in subtype A than D. In subtype D, efavirenz hypersusceptibility was associated with substitutions at codon 11 in HIV-reverse transcriptase. Phenotyping detected reduced antiretroviral drug susceptibility and hypersusceptibility in HIV from some antiretroviral-naive Ugandan adults that was not predicted by genotyping. Phenotyping may complement genotyping for analysis of antiretroviral drug susceptibility in populations with nonsubtype B

  1. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia


    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin


    Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...

  2. Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase


    Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael


    Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

  3. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus. (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen


    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  4. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies. (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi


    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  5. The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

    Directory of Open Access Journals (Sweden)

    Gronenborn Angela M


    Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

  6. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss. (United States)

    Zhu, Tao; Niu, Deng-Ke


    Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

  7. Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions. (United States)

    Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo


    In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail:

  8. 3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors. (United States)

    de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão


    A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

  9. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.


    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  10. K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

    Directory of Open Access Journals (Sweden)

    Atsuko Hachiya


    Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

  11. Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Marius Lazea


    Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

  12. Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy. (United States)

    Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N


    To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

  13. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay. (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B


    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  14. Pre-existing mutations in reverse transcriptase of hepatitis B virus in treatment-naive Chinese patients with chronic hepatitis B.

    Directory of Open Access Journals (Sweden)

    Jie Xu

    Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.

  15. Molecular cloning of Kuruma shrimp Marsupenaeus japonicus endonuclease-reverse transcriptase and its positive role in white spot syndrome virus and Vibrio alginolyticus infection. (United States)

    Ma, Xiongchao; Sun, Baozhen; Zhu, Fei


    This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.


    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  17. Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors. (United States)

    Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi


    Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

  18. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    International Nuclear Information System (INIS)

    Lund, Kaleb C.; Wallace, Kendall B.


    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

  19. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR. (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin


    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

    International Nuclear Information System (INIS)

    Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong


    The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

  1. Selective suppression of autocatalytic caspase-3 driven by two-step transcriptional amplified human telomerase reverse transcriptase promoter on ovarian carcinoma growth in vitro and in mice. (United States)

    Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng


    The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.

  2. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue. (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram


    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  3. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures. (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis


    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  4. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    International Nuclear Information System (INIS)

    Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key


    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  5. MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Lin Bai

    Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.

  6. Hypoxia induces telomerase reverse transcriptase (TERT gene expression in non-tumor fish tissues in vivo: the marine medaka (Oryzias melastigma model

    Directory of Open Access Journals (Sweden)

    Mok Helen OL


    Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This

  7. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems. (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd


    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  8. Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects. (United States)

    Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R


    Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

  9. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs. (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W


    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  10. A new fluorescence/PET probe for targeting intracellular human telomerase reverse transcriptase (hTERT) using Tat peptide-conjugated IgM

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)


    Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.

  11. Maternal nutritional status predicts adverse birth outcomes among HIV-infected rural Ugandan women receiving combination antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Sera Young

    Full Text Available Maternal nutritional status is an important predictor of birth outcomes, yet little is known about the nutritional status of HIV-infected pregnant women treated with combination antiretroviral therapy (cART. We therefore examined the relationship between maternal BMI at study enrollment, gestational weight gain (GWG, and hemoglobin concentration (Hb among 166 women initiating cART in rural Uganda.Prospective cohort.HIV-infected, ART-naïve pregnant women were enrolled between 12 and 28 weeks gestation and treated with a protease inhibitor or non-nucleoside reverse transcriptase inhibitor-based combination regimen. Nutritional status was assessed monthly. Neonatal anthropometry was examined at birth. Outcomes were evaluated using multivariate analysis.Mean GWG was 0.17 kg/week, 14.6% of women experienced weight loss during pregnancy, and 44.9% were anemic. Adverse fetal outcomes included low birth weight (LBW (19.6%, preterm delivery (17.7%, fetal death (3.9%, stunting (21.1%, small-for-gestational age (15.1%, and head-sparing growth restriction (26%. No infants were HIV-infected. Gaining <0.1 kg/week was associated with LBW, preterm delivery, and a composite adverse obstetric/fetal outcome. Maternal weight at 7 months gestation predicted LBW. For each g/dL higher mean Hb, the odds of small-for-gestational age decreased by 52%.In our cohort of HIV-infected women initiating cART during pregnancy, grossly inadequate GWG was common. Infants whose mothers gained <0.1 kg/week were at increased risk for LBW, preterm delivery, and composite adverse birth outcomes. cART by itself may not be sufficient for decreasing the burden of adverse birth outcomes among HIV-infected NCT00993031.

  12. Lower genetic variability of HIV-1 and antiretroviral drug resistance in pregnant women from the state of Pará, Brazil. (United States)

    Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães


    The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.

  13. Low Prolactin and High 20-α-Hydroxysteroid Dehydrogenase Levels Contribute to Lower Progesterone Levels in HIV-Infected Pregnant Women Exposed to Protease Inhibitor-Based Combination Antiretroviral Therapy. (United States)

    Papp, Eszter; Balogun, Kayode; Banko, Nicole; Mohammadi, Hakimeh; Loutfy, Mona; Yudin, Mark H; Shah, Rajiv; MacGillivray, Jay; Murphy, Kellie E; Walmsley, Sharon L; Silverman, Michael; Serghides, Lena


    It has been reported that pregnant women receiving protease inhibitor (PI)-based combination antiretroviral therapy (cART) have lower levels of progesterone, which put them at risk of adverse birth outcomes, such as low birth weight. We sought to understand the mechanisms involved in this decline in progesterone level. We assessed plasma levels of progesterone, prolactin, and lipids and placental expression of genes involved in progesterone metabolism in 42 human immunodeficiency virus (HIV)-infected and 31 HIV-uninfected pregnant women. In vitro studies and a mouse pregnancy model were used to delineate the effect of HIV from that of PI-based cART on progesterone metabolism. HIV-infected pregnant women receiving PI-based cART showed a reduction in plasma progesterone levels (P= .026) and an elevation in placental expression of the progesterone inactivating enzyme 20-α-hydroxysteroid dehydrogenase (20α-HSD; median, 2.5 arbitrary units [AU]; interquartile range [IQR], 1.00-4.10 AU), compared with controls (median, 0.89 AU; IQR, 0.66-1.26 AU;P= .002). Prolactin, a key regulator of 20α-HSD, was lower (P= .012) in HIV-infected pregnant women. We observed similar data in pregnant mice exposed to PI-based cART. In vitro inhibition of 20α-HSD activity in trophoblast cells reversed PI-based cART-induced decreases in progesterone levels. Our data suggest that the decrease in progesterone levels observed in HIV-infected pregnant women exposed to PI-based cART is caused, at least in part, by an increase in placental expression of 20α-HSD, which may be due to lower prolactin levels observed in these women. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail

  14. Long-term effectiveness of highly active antiretroviral therapy (HAART) in perinatally HIV-infected children in Denmark

    DEFF Research Database (Denmark)

    Bracher, Linda; Valerius, Niels Henrik; Rosenfeldt, Vibeke


    children treated with HAART. Initial HAART included 2 nucleoside reverse-transcriptase inhibitors in combination with either a protease inhibitor (n =38) or a non-nucleoside reverse-transcriptase inhibitor (n =12). 19 (39%) patients were previously treated with mono- or dual therapy. Baseline......The long-term impact of highly active antiretroviral therapy (HAART) on HIV-1 infected children is not well known. The Danish Paediatric HIV Cohort Study includes all patients ... characteristics were median CD4 percentage 14% and HIV-RNA viral load 4.9 log(10). Within the first 12 weeks of therapy approximately 60% achieved HIV-RNA viral load children changed the components of HAART. The proportion of children with CD4...

  15. HIV drug resistance following a decade of the free antiretroviral therapy programme in India: A review. (United States)

    Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R


    The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. [Predictive factors of clinically significant drug-drug interactions among regimens based on protease inhibitors, non-nucleoside reverse transcriptase inhibitors and raltegravir]. (United States)

    Cervero, Miguel; Torres, Rafael; Jusdado, Juan José; Pastor, Susana; Agud, Jose Luis


    To determine the prevalence and types of clinically significant drug-drug interactions (CSDI) in the drug regimens of HIV-infected patients receiving antiretroviral treatment. retrospective review of database. Centre: Hospital Universitario Severo Ochoa, Infectious Unit. one hundred and forty-two participants followed by one of the authors were selected from January 1985 to December 2014. from their outpatient medical records we reviewed information from the last available visit of the participants, in relation to HIV infection, comorbidities, demographics and the drugs that they were receiving; both antiretroviral drugs and drugs not related to HIV infection. We defined CSDI from the information sheet and/or database on antiretroviral drug interactions of the University of Liverpool ( and we developed a diagnostic tool to predict the possibility of CSDI. By multivariate logistic regression analysis and by estimating the diagnostic performance curve obtained, we identified a quick tool to predict the existence of drug interactions. Of 142 patients, 39 (29.11%) had some type of CSDI and in 11.2% 2 or more interactions were detected. In only one patient the combination of drugs was contraindicated (this patient was receiving darunavir/r and quetiapine). In multivariate analyses, predictors of CSDI were regimen type (PI or NNRTI) and the use of 3 or more non-antiretroviral drugs (AUC 0.886, 95% CI 0.828 to 0.944; P=.0001). The risk was 18.55 times in those receiving NNRTI and 27,95 times in those receiving IP compared to those taking raltegravir. Drug interactions, including those defined as clinically significant, are common in HIV-infected patients treated with antiretroviral drugs, and the risk is greater in IP-based regimens. Raltegravir-based prescribing, especially in patients who receive at least 3 non-HIV drugs could avoid interactions. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  17. High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme (United States)

    Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni


    Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

  18. Early nucleoside reverse transcriptase inhibitors for the treatment of HIV: a brief history of stavudine (D4T) and its comparison with other dideoxynucleosides. (United States)

    Martin, John C; Hitchcock, Michael J M; De Clercq, Erik; Prusoff, William H


    The occasion of this 25th anniversary issue encouraged us to reminisce about the important history of the discovery of the dideoxynucleoside analogues for the treatment of HIV/AIDS and to chronicle our thoughts about a particular exciting and rewarding period of our scientific careers. Following the identification of the anti-HIV activity of zidovudine (AZT), we participated in the urgent quest to discover optimal treatments of HIV infection and AIDS. A number of previously synthesized nucleoside analogues were comparatively evaluated, and stavudine (D4T) emerged as a promising candidate for development. Following clinical evaluation, D4T became a mainstay of the initial antiretroviral combination therapy, prolonging and saving numerous lives. It has only recently been supplanted by better-tolerated treatments. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.

  19. Pharmacokinetics of antiretroviral drugs in anatomical sanctuary sites: the male and female genital tract. (United States)

    Else, Laura J; Taylor, Stephen; Back, David J; Khoo, Saye H


    HIV resides within anatomical 'sanctuary sites', where local drug exposure and viral dynamics may differ significantly from the systemic compartment. Suboptimal antiretroviral concentrations in the genital tract may result in compartmentalized viral replication, selection of resistant mutations and possible re-entry of wild-type/resistant virus into the systemic circulation. Therefore, achieving adequate antiretroviral exposure in the genital tract has implications for the prevention of sexual and vertical transmission of HIV. Penetration of antiretrovirals in the genital tract is expressed by accumulation ratios derived from the measurement of drug concentrations in time-matched seminal plasma/cervicovaginal fluid and plasma samples. Penetration varies by gender and may be drug (as opposed to class) specific with high interindividual variability. Concentrations in seminal plasma are highest for nucleoside analogues and lowest for protease inhibitors and efavirenz. Seminal accumulation of newer agents, raltegravir and maraviroc, is moderate (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitors [lamivudine/zidovudine/tenofovir/didanosine > stavudine/abacavir] > raltegravir > indinavir/maraviroc/nevirapine > efavirenz/protease inhibitors [amprenavir/atazanavir/darunavir > lopinavir/ritonavir > saquinavir] > enfuvirtide). In the female genital tract, the nucleoside analogues exhibit high accumulation ratios, whereas protease inhibitors have limited penetration; however, substantial variability exists between individuals and study centres. Second generation non-nucleoside reverse transcriptase inhibitor etravirine, and maraviroc and raltegravir, demonstrate effective accumulation in cervicovaginal secretions (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitor [zidovudine/lamivudine/didanosine > emtricitabine/tenofovir] > indinavir > maraviroc/raltegravir/darunavir/etravirine > nevirapine

  20. [Construction of autocatalytic caspase-3 driven by amplified human telomerase reverse transcriptase promoter and its enhanced efficacy of inducing apoptosis in human ovarian carcinoma]. (United States)

    Song, Yue; Shen, Keng; He, Chun-Xia


    To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells

  1. Dyslipidemia in HIV Infected Children Receiving Highly Active Antiretroviral Therapy. (United States)

    Mandal, Anirban; Mukherjee, Aparna; Lakshmy, R; Kabra, Sushil K; Lodha, Rakesh


    To assess the prevalence of dyslipidemia and lipodystrophy in Indian children receiving non-nucleoside reverse transcriptase inhibitor (NNRTI) based highly active antiretroviral therapy (HAART) and to determine the associated risk factors for the same. The present cross-sectional study was conducted at a Pediatric Clinic of a tertiary care teaching center in India, from May 2011 through December 2012. HIV infected children aged 5-15 y were enrolled if they did not have any severe disease or hospital admission within last 3 mo or receive any medications known to affect the lipid profile. Eighty-one children were on highly active antiretroviral therapy (HAART) for at least 6 mo and 16 were receiving no antiretroviral therapy (ART). Participants' sociodemographic, nutritional, clinical, and laboratory data were recorded in addition to anthropometry and evidence of lipodystrophy. Fasting lipid profile, apolipoprotein A1 and B levels were done for all the children. Among the children on highly active antiretroviral therapy (HAART), 38.3 % had dyslipidemia and 80.2 % had lipodystrophy, while 25 % antiretroviral therapy (ART) naïve HIV infected children had dyslipidemia. No clinically significant risk factors could be identified that increased the risk of dyslipidemia or lipodystrophy in children on highly active antiretroviral therapy (HAART). There is a high prevalence of dyslipidemia and lipodystrophy in Indian children with HIV infection with an imminent need to establish facilities for testing and treatment of these children for metabolic abnormalities.

  2. Differences in Lipid Measurements by Antiretroviral Regimen Exposure in Cohorts from Asia and Australia

    Directory of Open Access Journals (Sweden)

    Amit C. Achhra


    Full Text Available We explored the mean differences in routinely measured lipids (total cholesterol, triglycerides, and high-density lipoprotein cholesterol according to exposure to different combination antiretroviral regimens in Asian (n=2051 and Australian (predominantly Caucasian, n=794 cohorts. The regimen was defined as at least 3 antiretroviral drugs with at least 2 nucleoside-reverse transcriptases (NRTIs and either of at least one protease inhibitor (PI or non-nucleoside-reverse transcriptases (NNRTIs. We categorised cART regimens as: NRTIs as tenofovir based or not; NNRTIs as nevirapine or efavirenz (but not both; and PI as atazanavir based or not. We found that the impact of various antiretroviral regimens on lipids in Asian and Australian cohorts was only different by cohort for total cholesterol (P for interaction between regimen and cohort: 0.05. The differences in total cholesterol were however small and unlikely to be of clinical significance. Overall, tenofovir with nevirapine or atazanavir was associated with the most favorable lipids, while the PI regimens without tenofovir and atazanavir were associated with least favorable lipids. We conclude that the impact of various ART regimens on lipids is largely similar in Asian and Australian cohorts and that the newer drugs such as tenofovir and atazanavir are likely to provide similar benefit in terms of lipid profiles in both populations.

  3. Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme. (United States)

    Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan


    The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

  4. Antiretroviral Drug Use in a Cross-Sectional Population Survey in Africa: NIMH Project Accept (HPTN 043). (United States)

    Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H


    Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.

  5. Reverse transcriptase and protease inhibitor resistant mutations in art treatment naïve and treated HIV-1 infected children in India A Short Review

    Directory of Open Access Journals (Sweden)

    Dinesh Bure,


    Full Text Available Introduction of first line and second line antiretroviral therapy has dramatically improved the quality of life and survival of the HIV-1 infected individuals. Extension of this therapy in children has similar effect. However the emergence of drug selected resistance has hampered the response to the therapy. A database of prevalence of drug resistance mutations in the Indian children both ART naïve and treated will help in deciding the appropriate regimen for the individual patient as well as formulating the policies regarding the composition of drugs included in the fixed dose combinations and its periodic review by analysis of the information that is made available from time to time. This will enable us to utilize our limited resources in most prudent way.

  6. Impact of HIV-1 reverse transcriptase polymorphism F214L on virological response to thymidine analogue based regimens in ART-naïve and experienced patients

    DEFF Research Database (Denmark)

    Silberstein, F; Cozzi-Lepri, A; Ruiz, L


    BACKGROUND: A negative association between the polymorphism F214L and type 1 thymidine analogue (TA) mutations (TAMs) has been observed. However, the virological response to TAs according to the detection of F214L has not been evaluated. METHODS: We studied 590 patients from EuroSIDA who started ...... were observed in patients with M41L/T215Y and mixed TAM profiles detected before the initiation of cART. CONCLUSIONS: This study provides evidence that the detection of polymorphism F214L is associated with a favorable virological response to TA-based cART.......BACKGROUND: A negative association between the polymorphism F214L and type 1 thymidine analogue (TA) mutations (TAMs) has been observed. However, the virological response to TAs according to the detection of F214L has not been evaluated. METHODS: We studied 590 patients from EuroSIDA who started TA...... therapy for the first time as part of potent combination antiretroviral therapy (cART) and who were tested for genotypic resistance within the past 6 months. End points were median reduction in the week 24 viral load and time to virological failure (2 consecutive VL measurements >400 copies/mL after...

  7. Second-line failure and first experience with third-line antiretroviral therapy in Mumbai, India

    Directory of Open Access Journals (Sweden)

    Samsuddin Khan


    Full Text Available Background: There are limited data on the failure of second-line antiretroviral therapy (ART and the use of third-line ART in people living with HIV in resource-limited settings. Since 2011, the Médecins Sans Frontières (MSF HIV/tuberculosis programme in Mumbai, India, has been providing third-line ART to patients in care. Objective: To describe the experiences and programmatic challenges during management of suspected second-line ART failure and third-line ART therapy for patients living with HIV, including the use of HIV viral load (VL testing. Design: This was a retrospective, observational cohort study of patients with suspected second-line ART treatment failure, who were followed for at least 12 months between January 2011 and March 2014. Results: A total of 47 patients with suspected second-line failure met the inclusion criteria during the study period. Twenty-nine of them (62% responded to enhanced adherence support, had a subsequent undetectable VL after a median duration of 3 months and remained on second-line ART. The other 18 patients had to be initiated on a third-line ART regimen, which consisted of darunavir–ritonavir, raltegravir, and one or more appropriate nucleoside or nucleotide reverse transcriptase inhibitors, based on the results of HIV genotype testing. Of the 13 patients for whom follow-up VL results were available, 11 achieved virological suppression after a median duration of 3 months on third-line ART (interquartile range: 2.5–3.0. No serious treatment-related adverse events were recorded. Conclusions: With intensive counselling and adherence support in those suspected of failing second-line ART, unnecessary switching to more expensive third-line ART can be averted in the majority of cases. However, there is an increasing need for access to third-line ART medications such as darunavir and raltegravir, for which national ART programmes should be prepared. The cost of such medications and inadequate access to VL

  8. Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1

    DEFF Research Database (Denmark)

    Raffi, François; Babiker, Abdel G; Richert, Laura


    BACKGROUND: Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. METHODS: Between August, 2010......-inferior to standard treatment and represents a treatment option for patients with CD4 cell counts higher than 200 cells per μL. FUNDING: European Union Sixth Framework Programme, Inserm-ANRS, Gilead Sciences, Janssen Pharmaceuticals, Merck Laboratories....

  9. Evaluation of inadequate anti-retroviral treatment in patients with HIV/AIDS

    Directory of Open Access Journals (Sweden)

    Leonardo Carvalho da Fonseca


    Full Text Available INTRODUCTION: Since the emergence of antiretroviral therapy, the survival of patients infected with human immunodeficiency virus has increased. Non-adherence to this therapy is directly related to treatment failure, which allows the emergence of resistant viral strains. METHODS: A retrospective descriptive study of the antiretroviral dispensing records of 229 patients from the Center for Health Care, University Hospital, Federal University of Juiz de Fora, Brazil, was conducted between January and December 2009. RESULTS: The study aimed to evaluate patient compliance and determine if there was an association between non-adherence and the therapy. Among these patients, 63.8% were men with an average age of 44.0 ± 9.9 years. The most used treatment was a combination of 2 nucleoside reverse transcriptase inhibitors with 1 non-nucleoside reverse transcriptase inhibitor (55.5% or with 2 protease inhibitors (28.8%. It was found that patients taking lopinavir/ritonavir with zidovudine and lamivudine had a greater frequency of inadequate treatment than those taking atazanavir with zidovudine and lamivudine (85% and 83.3%, respectively. Moreover, when the combination of zidovudine/ lamivudine was used, the patients were less compliant (χ2 = 4.468, 1 degree of freedom, p = 0.035. CONCLUSIONS: The majority of patients failed to correctly adhere to their treatment; therefore, it is necessary to implement strategies that lead to improved compliance, thus ensuring therapeutic efficacy and increased patient survival.

  10. Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

    Directory of Open Access Journals (Sweden)

    Dieter Hoffmann

    Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

  11. Oxidative stress and toxicity induced by the nucleoside reverse transcriptase inhibitor (NRTI)--2',3'-dideoxycytidine (ddC): relevance to HIV-dementia. (United States)

    Opii, Wycliffe O; Sultana, Rukhsana; Abdul, Hafiz Mohmmad; Ansari, Mubeen Ahmad; Nath, Avindra; Butterfield, D Allan


    Human immunodeficiency virus dementia (HIVD) is the most common form of dementia occurring among young adults. In HIVD, neuronal cell loss occurs in the absence of neuronal infection. With the advent of highly active anti-retroviral therapy (HAART), the incidence of HIVD has drastically reduced, though prevalence of milder forms of HIVD continues to rise. Though these agents have been used successfully in suppressing viral production, they have also been associated with a number of side effects. Here we examine the possible role of NRTIs, in particular 2',3'-dideoxycytidine (ddC), in the neuropathology of HIVD. Synaptosomes and isolated mitochondria treated and incubated for 6 h with CSF-achievable concentrations of ddC, i.e., 6-11 ng/ml, were found to show a significant increase in oxidative stress with 40 nM ddC as measured by protein carbonyls and 3-nitrotyrosine (3NT), effects that were not observed in the more tolerable NRTI, 3TC. Protection against protein oxidation induced by ddC was observed when brain mitochondria were isolated from gerbils 1 h after injection i.p. with the brain accessible antioxidant and glutathione mimetic, tricyclodecan-9-yl-xanthogenate (D609). In addition, there is a significant reduction in the levels of anti-apoptotic protein Bcl-2 and a significant increase in cytochrome c release and also a significant increase in the expression of pro-apoptotic protein caspase-3 after mitochondria were treated with 40 nM ddC. The results reported here show that ddC at 40 nM can induce oxidative stress, cause the release of cytochrome c, and in addition, reduce the levels of anti-apoptotic proteins, increase the levels of pro-apoptotic proteins, thereby increasing the possibility for induction of apoptosis. These findings are consistent with the notion of a possible role of the NRTIs, and in particular, ddC, in the mechanisms involved in HIVD.

  12. Does short-term virologic failure translate to clinical events in antiretroviral-naïve patients initiating antiretroviral therapy in clinical practice?

    DEFF Research Database (Denmark)

    NN, NN; Mugavero, Michael J; May, Margaret


    , nevirapine, lopinavir/ritonavir, nelfinavir, or abacavir as third drugs in combination with a zidovudine and lamivudine nucleoside reverse transcriptase inhibitor backbone. MAIN OUTCOME MEASURES: Short-term (24-week) virologic failure (>500 copies/ml) and clinical events within 2 years of ART initiation.......58-2.22), lopinavir/ritonavir (1.32, 95% CI = 1.12-1.57), nelfinavir (3.20, 95% CI = 2.74-3.74), and abacavir (2.13, 95% CI = 1.82-2.50). However, the rate of clinical events within 2 years of ART initiation appeared higher only with nevirapine (adjusted hazard ratio for composite outcome measure 1.27, 95% CI = 1......OBJECTIVE: To determine whether differences in short-term virologic failure among commonly used antiretroviral therapy (ART) regimens translate to differences in clinical events in antiretroviral-naïve patients initiating ART. DESIGN: Observational cohort study of patients initiating ART between...

  13. Cardiovascular disease risk factors in HIV patients--association with antiretroviral therapy. Results from the DAD study

    DEFF Research Database (Denmark)

    Friis-Møller, Nina; Weber, Rainer; Reiss, Peter


    , a prospective multinational cohort study initiated in 1999. METHODS: Cross-sectional analyses of CVD risk factors at baseline. The data collected includes data on demographic variables, cigarette smoking, diabetes mellitus, hypertension, dyslipidaemia, body mass index, stage of HIV infection, antiretroviral...... to the prevalence among antiretroviral therapy (ART)-naive subjects. Subjects who have discontinued ART as well as subjects receiving nucleoside reverse transcriptase inhibitors had similar cholesterol levels to treatment-naive subjects. Higher CD4 cell count, lower plasma HIV RNA levels, clinical signs......OBJECTIVE: To determine the prevalence of risk factors for cardiovascular disease (CVD) among HIV-infected persons, and to investigate any association between such risk factors, stage of HIV disease, and use of antiretroviral therapies. DESIGN: Baseline data from 17,852 subjects enrolled in DAD...

  14. Impact of HIV-1 reverse transcriptase polymorphism F214L on virological response to thymidine analogue-based regimens in antiretroviral therapy (ART)-naive and ART-experienced patients

    DEFF Research Database (Denmark)

    Ceccherini-Silberstein, Francesca; Cozzi-Lepri, Alessandro; Ruiz, Lidia


    A negative association between the polymorphism F214L and type 1 thymidine analogue (TA) mutations (TAMs) has been observed. However, the virological response to TAs according to the detection of F214L has not been evaluated....

  15. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay. (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei


    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  16. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants. (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni


    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  17. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    International Nuclear Information System (INIS)

    Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong


    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

  18. Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors (United States)

    Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.


    The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

  19. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients. (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong


    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  20. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail:


    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

  1. Triple Active Antiretroviral Regimen Including Enfuvirtide Via the Biojector is Effective and Safe

    Directory of Open Access Journals (Sweden)

    Mona Loutfy


    Full Text Available For full HIV virological suppression, three fully active antiretroviral agents are required. New drug classes should be included to ensure that agents are fully active. The addition of enfuvirtide and efavirenz to the present patient’s new antiretroviral regimen ensured that two fully active agents were in use in the setting of a moderate degree of nucleoside resistance and a high level of protease resistance, and where non-nucleoside reverse transcriptase inhibitors were still fully active. Both viral load and CD4 count responded favourably to this regimen. The patient received support from physicians and clinic staff in the introduction and use of enfuvirtide. To reduce injection site reactions, a needle-free injection system (Biojector proved effective.

  2. HIV genotype resistance testing in antiretroviral (ART) exposed Indian children--a need of the hour. (United States)

    Shah, Ira; Parikh, Shefali


    Development of drug resistance in HIV infected children with treatment failure is a major impediment to selection of appropriate therapy. HIV genotype resistance assays predict drug resistance on the basis of mutations in the viral genome. However, their clinical utility, especially in a resource limited setting is still a subject of debate. The authors report two cases in which both the children suffered from treatment failure of various antiretroviral therapy regimes. In both the cases, Genotype Resistance Testing (GRT) prompted a radical change from proposed failure therapy as per existing guidelines. GRT was specifically important for the selection of a new dual Nucleoside reverse transcriptase inhibitors (NRTI) component of failure regimen by identifying TAMS and M184V mutations in the HIV genome. These case reports highlight the importance of GRT in children failing multiple antiretroviral regimes; and emphasizes the need to recognize situations where GRT is absolutely essential to guide appropriate therapy, even in a resource limited setting.

  3. Pharmacy refill adherence compared with CD4 count changes for monitoring HIV-infected adults on antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Gregory P Bisson


    Full Text Available World Health Organization (WHO guidelines for monitoring HIV-infected individuals taking combination antiretroviral therapy (cART in resource-limited settings recommend using CD4(+ T cell (CD4 count changes to monitor treatment effectiveness. In practice, however, falling CD4 counts are a consequence, rather than a cause, of virologic failure. Adherence lapses precede virologic failure and, unlike CD4 counts, data on adherence are immediately available to all clinics dispensing cART. However, the accuracy of adherence assessments for predicting future or detecting current virologic failure has not been determined. The goal of this study therefore was to determine the accuracy of adherence assessments for predicting and detecting virologic failure and to compare the accuracy of adherence-based monitoring approaches with approaches monitoring CD4 count changes.We conducted an observational cohort study among 1,982 of 4,984 (40% HIV-infected adults initiating non-nucleoside reverse transcriptase inhibitor-based cART in the Aid for AIDS Disease Management Program, which serves nine countries in southern Africa. Pharmacy refill adherence was calculated as the number of months of cART claims submitted divided by the number of complete months between cART initiation and the last refill prior to the endpoint of interest, expressed as a percentage. The main outcome measure was virologic failure defined as a viral load > 1,000 copies/ml (1 at an initial assessment either 6 or 12 mo after cART initiation and (2 after a previous undetectable (i.e., 0.5. In addition, adherence levels assessed 3 mo prior to viral load assessments were as accurate for virologic failure occurring approximately 3 mo later as were CD4 count changes calculated from cART initiation to the actual time of the viral load assessments, indicating the potential utility of adherence assessments for predicting future, rather than simply detecting current, virologic failure. Moreover

  4. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡ (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen


    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

  5. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella


    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  6. Role of the functional MNS16A VNTR-243 variant of the human telomerase reverse transcriptase gene in progression and response to therapy of patients with non-Hodgkin's B-cell lymphomas. (United States)

    Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K


    MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.

  7. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction. (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre


    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  8. Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues (United States)

    Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang


    To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

  9. A single dose of a MIV-150/Zinc acetate gel provides 24 h of protection against vaginal simian human immunodeficiency virus reverse transcriptase infection, with more limited protection rectally 8-24 h after gel use. (United States)

    Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa


    Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.

  10. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis. (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin


    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  11. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST). (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max


    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  12. Detection of human telomerase reverse transcriptase messenger ...

    African Journals Online (AJOL)

    Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...

  13. [Study of human immunodeficiency virus transmission chains in Andalusia: analysis from baseline antiretroviral resistance sequences]. (United States)

    Pérez-Parra, Santiago; Chueca-Porcuna, Natalia; Álvarez-Estevez, Marta; Pasquau, Juan; Omar, Mohamed; Collado, Antonio; Vinuesa, David; Lozano, Ana Belen; García-García, Federico


    Protease and reverse transcriptase HIV-1 sequences provide useful information for patient clinical management, as well as information on resistance to antiretrovirals. The aim of this study is to evaluate transmission events, transmitted drug resistance, and to georeference subtypes among newly diagnosed patients referred to our center. A study was conducted on 693 patients diagnosed between 2005 and 2012 in Southern Spain. Protease and reverse transcriptase sequences were obtained for resistance to cART analysis with Trugene(®) HIV Genotyping Kit (Siemens, NAD). MEGA 5.2, Neighbor-Joining, ArcGIS and REGA were used for subsequent analysis. The results showed 298 patients clustered into 77 different transmission events. Most of the clusters were formed by pairs (n=49), of men having sex with men (n=26), Spanish (n=37), and below 45 years of age (73.5%). Urban areas from Granada, and the coastal areas of Almeria and Granada showed the greatest subtype heterogeneity. Five clusters were formed by more than 10 patients, and 15 clusters had transmitted drug resistance. The study data demonstrate how the phylogenetic characterization of transmission clusters is a powerful tool to monitor the spread of HIV, and may contribute to design correct preventive measures to minimize it. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  14. Vitamin E concentrations in adults with HIV/AIDS on highly active antiretroviral therapy. (United States)

    Itinoseki Kaio, Daniella J Itinoseki; Rondó, Patricia Helen C; Luzia, Liania Alves; Souza, José Maria P; Firmino, Aline Vale; Santos, Sigrid Sousa


    HIV/AIDS patients are probably more predisposed to vitamin E deficiency, considering that they are more exposed to oxidative stress. Additionally, there are an extensive number of drugs in the highly active antiretroviral therapy (HAART) regimens that may interfere with vitamin E concentrations. The objective of this study was to compare serum concentrations of alpha-tocopherol in 182 HIV/AIDS patients receiving different HAART regimens. The patients were divided into three groups according to regimen: nucleoside analog reverse-transcriptase inhibitors (NRTIs) + non-nucleoside analog reverse-transcriptase inhibitors (NNRTIs); NRTIs + protease inhibitors + ritonavir; NRTIs + other classes. Alpha-tocopherol was assessed by high-performance liquid chromatography. Multiple linear regression analysis was used to evaluate the effects of HAART regimen, time of use, and compliance with the regimen on alpha-tocopherol concentrations. Alpha-tocopherol concentrations were on average 4.12 μmol/L lower for the NRTIs + other classes regimen when compared to the NRTIs + NNRTIs regimen (p = 0.037). A positive association (p < 0.001) was observed between alpha-tocopherol and cholesterol concentrations, a finding due, in part, to the relationship between liposoluble vitamins and lipid profile. This study demonstrated differences in alpha-tocopherol concentrations between patients using different HAART regimens, especially regimens involving the use of new drugs. Long-term prospective cohort studies are needed to monitor vitamin E status in HIV/AIDS patients since the beginning of treatment.

  15. Lipid profile of HIV-infected patients in relation to antiretroviral therapy: a review. (United States)

    Souza, Suelen Jorge; Luzia, Liania Alves; Santos, Sigrid Sousa; Rondó, Patrícia Helen Carvalho


    This study reviewed the lipid profile of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in relation to use of antiretroviral therapy (ART), and its different classes of drugs. A total of 190 articles published in peer-reviewed journals were retrieved from PubMed and LILACS databases; 88 of them met the selection criteria and were included in the review. Patients with HIV/AIDS without ART presented an increase of triglycerides and decreases of total cholesterol, low density lipoprotein (LDL-c), and high density lipoprotein (HDL-c) levels. Distinct ART regimens appear to promote different alterations in lipid metabolism. Protease inhibitors, particularly indinavir and lopinavir, were commonly associated with hypercholesterolemia, high LDL-c, low HDL-c, and hypertriglyceridemia. The protease inhibitor atazanavir is apparently associated with a more advantageous lipid profile. Some nucleoside reverse-transcriptase inhibitors (didanosine, stavudine, and zidovudine) induced lipoatrophy and hypertriglyceridemia, whereas abacavir increased the risk of cardiovascular diseases even in the absence of apparent lipid disorders, and tenofovir resulted in lower levels of cholesterol and triglycerides. Although non-nucleoside reverse-transcriptase inhibitors predisposed to hypertriglyceridemia and hypercholesterolemia, nevirapine was particularly associated with high HDL-c levels, a protective factor against cardiovascular diseases. Therefore, the infection itself, different classes of drugs, and some drugs from the same class of ART appear to exert distinct alterations in lipid metabolism. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.

  16. Protecting the fetus against HIV infection: a systematic review of placental transfer of antiretrovirals. (United States)

    McCormack, Shelley A; Best, Brookie M


    Maternal-to-fetal transfer of antiretroviral drugs contributes to prevention of vertical transmission of HIV. This systematic review discusses published studies containing data pertaining to the pharmacokinetics of placental transfer of antiretrovirals in humans, including paired cord and maternal plasma samples collected at the time of delivery as well as ex vivo placental perfusion models. Articles pertaining to placental transfer of antiretrovirals were identified from PubMed, from references of included articles, and from US Department of Health and Human Services Panel on Treatment of HIV-infected Pregnant Women and Prevention of Perinatal Transmission guidelines. Articles from non-human animal models or that had no original maternal-to-fetal transfer data were excluded. PRISMA guidelines were followed. A total of 103 published studies were identified. Data across studies appeared relatively consistent for the nucleoside reverse transcriptase inhibitors (NRTIs) and the non-nucleotide reverse transcriptase inhibitors (NNRTIs), with cord to maternal ratios approaching 1 for many of these agents. The protease inhibitors atazanavir and lopinavir exhibited consistent maternal-to-fetal transfer across studies, although the transfer may be influenced by variations in drug-binding proteins. The protease inhibitors indinavir, nelfinavir, and saquinavir exhibited unreliable placental transport, with cord blood concentrations that were frequently undetectable. Limited data, primarily from case reports, indicate that darunavir and raltegravir provide detectable placental transfer. These findings appear consistent with current guidelines of using two NRTIs plus an NNRTI, atazanavir/ritonavir, or lopinavir/ritonavir to maximize placental transfer as well as to optimally suppress maternal viral load. Darunavir/ritonavir and raltegravir may reasonably serve as second-line agents.

  17. Cardiovascular disease risk factors in HIV patients--association with antiretroviral therapy. Results from the DAD study

    DEFF Research Database (Denmark)

    Friis-Møller, Nina; Weber, Rainer; Reiss, Peter


    , a prospective multinational cohort study initiated in 1999. METHODS: Cross-sectional analyses of CVD risk factors at baseline. The data collected includes data on demographic variables, cigarette smoking, diabetes mellitus, hypertension, dyslipidaemia, body mass index, stage of HIV infection, antiretroviral......OBJECTIVE: To determine the prevalence of risk factors for cardiovascular disease (CVD) among HIV-infected persons, and to investigate any association between such risk factors, stage of HIV disease, and use of antiretroviral therapies. DESIGN: Baseline data from 17,852 subjects enrolled in DAD...... therapy. RESULTS: Almost 25% of the study population were at an age where there is an appreciable risk of CVD, with those receiving a protease inhibitor (PI) and/or non-nucleoside reverse transcriptase inhibitor (NNRTI) tending to be older. 1.4% had a previous history of CVD and 51.5% were cigarette...

  18. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia. (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí


    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  19. Immortalization of Human Fetal Hepatocyte by Ectopic Expression of Human Telomerase Reverse Transcriptase, Human Papilloma Virus (E7) and Simian Virus 40 Large T (SV40 T) Antigen Towards Bioartificial Liver Support. (United States)

    Giri, Shibashish; Bader, Augustinus


    Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a

  20. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis. (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin


    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  1. Sequential emergence and clinical implications of viral mutants with K70E and K65R mutation in reverse transcriptase during prolonged tenofovir monotherapy in rhesus macaques with chronic RT-SHIV infection

    Directory of Open Access Journals (Sweden)

    Pedersen Niels C


    Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be

  2. Systematic review of antiretroviral-associated lipodystrophy: lipoatrophy, but not central fat gain, is an antiretroviral adverse drug reaction.

    Directory of Open Access Journals (Sweden)

    Reneé de Waal

    Full Text Available BACKGROUND: Lipoatrophy and/or central fat gain are observed frequently in patients on antiretroviral therapy (ART. Both are assumed to be antiretroviral adverse drug reactions. METHODS: We conducted a systematic review to determine whether fat loss or gain was more common in HIV-infected patients on ART than in uninfected controls; was associated with specific antiretrovirals; and would reverse after switching antiretrovirals. RESULTS: Twenty-seven studies met our inclusion criteria. One cohort study reported more lipoatrophy, less subcutaneous fat gain, but no difference in central fat gain in HIV-infected patients on ART than in controls. Randomised controlled trials (RCTs showed more limb fat loss (or less fat gain with the following regimens: stavudine (versus other nucleoside reverse transcriptase inhibitors (NRTIs; efavirenz (versus protease inhibitors (PIs; and NRTI-containing (versus NRTI-sparing. RCTs showed increased subcutaneous fat after switching to NRTI-sparing regimens or from stavudine/zidovudine to abacavir/tenofovir. There were no significant between-group differences in trunk and/or visceral fat gain in RCTs of various regimens, but results from efavirenz versus PI regimens were inconsistent. There was no significant between-group differences in central fat gain in RCTs switched to NRTI-sparing regimens, or from PI-containing regimens. CONCLUSIONS: There is clear evidence of a causal relationship between NRTIs (especially thymidine analogues and lipoatrophy, with concomitant PIs possibly having an ameliorating effect or efavirenz causing additive toxicity. By contrast, central fat gain appears to be a consequence of treating HIV infection, because it is not different from controls, is not linked to any antiretroviral class, and doesn't improve on switching.

  3. HIV-1 drug resistance in recently HIV-infected pregnant mother's naïve to antiretroviral therapy in Dodoma urban, Tanzania. (United States)

    Vairo, Francesco; Nicastri, Emanuele; Liuzzi, Giuseppina; Chaula, Zainab; Nguhuni, Boniface; Bevilacqua, Nazario; Forbici, Federica; Amendola, Alessandra; Fabeni, Lavinia; De Nardo, Pasquale; Perno, Carlo Federico; Cannas, Angela; Sakhoo, Calistus; Capobianchi, Maria Rosaria; Ippolito, Giuseppe


    HIV resistance affects virological response to therapy and efficacy of prophylaxis in mother-to-child-transmission. The study aims to assess the prevalence of HIV primary resistance in pregnant women naïve to antiretrovirals. Cross sectional baseline analysis of a cohort of HIV + pregnant women (HPW) enrolled in the study entitled Antiretroviral Management of Antenatal and Natal HIV Infection (AMANI, peace in Kiswahili language). The AMANI study began in May 2010 in Dodoma, Tanzania. In this observational cohort, antiretroviral treatment was provided to all women from the 28th week of gestation until the end of the breastfeeding period. Baseline CD4 cell count, viral load and HIV drug-resistance genotype were collected. Drug-resistance analysis was performed on 97 naïve infected-mothers. The prevalence of all primary drug resistance and primary non-nucleoside reverse-transcriptase inhibitors resistance was 11.9% and 7.5%, respectively. K103S was found in two women with no M184V detection. HIV-1 subtype A was the most commonly identified, with a high prevalence of subtype A1, followed by C, D, C/D recombinant, A/C recombinant and A/D recombinant. HIV drug- resistance mutations were detected in A1 and C subtypes. Our study reports an 11.9% prevalence rate of primary drug resistance in naïve HIV-infected pregnant women from a remote area of Tanzania. Considering that the non-nucleoside reverse-transcriptase inhibitors are part of the first-line antiretroviral regimen in Tanzania and all of Africa, resistance surveys should be prioritized in settings where antiretroviral therapy programs are scaled up.

  4. The effect of individual antiretroviral drugs on body composition in HIV-infected persons initiating highly active antiretroviral therapy. (United States)

    Shlay, Judith C; Sharma, Shweta; Peng, Grace; Gibert, Cynthia L; Grunfeld, Carl


    To examine the long-term effects of individual antiretroviral drugs on body composition among 416 persons initiating antiretroviral therapy (ART). In a substudy of a clinical trial of persons initiating ART, changes in body composition attributable to individual ART were examined. ARTs assessed were as follows: indinavir, ritonavir, nelfinavir, efavirenz, nevirapine, stavudine (d4T), zidovudine (ZDV), lamivudine (3TC), didanosine, and abacavir. Skinfolds and circumferences were measured at baseline and every 4 months. Mid arm, mid thigh, and waist subcutaneous tissue areas and nonsubcutaneous tissue areas were calculated. Rates of change per year of exposure to each individual ART drug were determined using multivariate longitudinal regression. d4T and ZDV use was associated with losses in subcutaneous tissue area and skinfold thickness. 3TC use was associated with gains in all subcutaneous tissue areas and skinfold thickness, whereas abacavir use was associated with an increase in waist subcutaneous tissue area. Indinavir was associated with gains in waist subcutaneous tissue area, whereas indinavir, efavirenz, and nevirapine were associated with increases in upper back skinfolds. d4T use was also associated with increases in all nonsubcutaneous tissue areas; 3TC use was associated with the greatest increase in waist nonsubcutaneous tissue area. In this prospective nonrandomized evaluation, the nucleoside reverse transcriptase inhibitors d4T and ZDV were associated with decreases in subcutaneous tissue areas, whereas 3TC use was associated with increased subcutaneous tissue areas and waist nonsubcutaneous tissue area.

  5. HIV Drug Resistance-Associated Mutations in Antiretroviral Naïve HIV-1-Infected Latin American Children

    Directory of Open Access Journals (Sweden)

    Luis E. Soto-Ramirez


    Full Text Available Our goal was to describe the presence of HIV drug resistance among HIV-1-infected, antiretroviral (ARV naïve children and adolescents in Latin America and to examine resistance in these children in relation to drug exposure in the mother. Genotyping was performed on plasma samples obtained at baseline from HIV-1-infected participants in a prospective cohort study in Brazil, Argentina, and Mexico (NISDI Pediatric Study. Of 713 HIV-infected children enrolled, 69 were ARV naïve and eligible for the analysis. At enrollment, mean age was 7.3 years; 81.2% were infected with HIV perinatally. Drug resistance mutations (DRMs were detected in 6 (8.7%; 95% confidence interval 3.1–18.2% ARV-naïve subjects; none of the mothers of these 6 received ARVs during their pregnancies and none of the children received ARV prophylaxis. Reverse transcriptase mutations K70R and K70E were detected in 3 and 2 subjects, respectively; protease mutation I50 V was detected in 1 subject. Three of the 6 children with DRMs initiated ARV therapy during followup, with a good response in 2. The overall rate of primary drug resistance in this pediatric HIV-infected population was low, and no subjects had more than 1 DRM. Mutations associated with resistance to nucleoside reverse transcriptase inhibitors were the most prevalent.

  6. Prevalence of drug resistance and importance of viral load measurements in Honduran HIV-infected patients failing antiretroviral treatment. (United States)

    Murillo, Wendy; de Rivera, I L; Parham, L; Jovel, E; Palou, E; Karlsson, A C; Albert, J


    The Honduran HIV/AIDS Program began to scale up access to HIV therapy in 2002. Up to May 2008, more than 6000 patients received combination antiretroviral therapy (cART). As HIV drug resistance is the major obstacle for effective treatment, the purpose of this study was to assess the prevalence of antiretroviral drug resistance in Honduran HIV-1-infected individuals. We collected samples from 138 individuals (97 adults and 41 children) on cART with virological, immunological or clinical signs of treatment failure. HIV-1 pol sequences were obtained using an in-house method. Resistance mutations were identified according to the 2007 International AIDS Society (IAS)-USA list and predicted susceptibility to cART was scored using the ANRS algorithm. Resistance mutations were detected in 112 patients (81%), 74% in adults and 98% in children. Triple-, dual- and single-class drug resistance was documented in 27%, 43% and 11% of the study subjects, respectively. Multiple logistic regression showed that resistance was independently associated with type of treatment failure [virological failure (odds ratio (OR) = 1) vs. immunological failure (OR = 0.11; 95% confidence interval (CI) 0.030-0.43) vs. clinical failure (OR = 0.037; 95% CI 0.0063-0.22)], route of transmission (OR = 42.8; 95% CI 3.73-491), and years on therapy (OR = 1.81; 95% CI 1.11-2.93). The prevalence of antiretroviral resistance was high in Honduran HIV-infected patients with signs of treatment failure. A majority of study subjects showed dual- or triple-class resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors and protease inhibitors. Virologically defined treatment failure was a strong predictor of resistance, indicating that viral load testing is needed to correctly identify patients with treatment failure attributable to resistance.

  7. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.


    Patick, A K; Boritzki, T J; Bloom, L A


    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...

  8. High level of APOBEC3F/3G editing in HIV-2 DNA vif and pol sequences from antiretroviral-naive patients. (United States)

    Bertine, Mélanie; Charpentier, Charlotte; Visseaux, Benoit; Storto, Alexandre; Collin, Gilles; Larrouy, Lucile; Damond, Florence; Matheron, Sophie; Brun-Vézinet, Françoise; Descamps, Diane


    In HIV-1, hypermutation introduced by APOBEC3F/3G cytidine deaminase activity leads to defective viruses. In-vivo impact of APOBEC3F/3G editing on HIV-2 sequences remains unknown. The objective of this study was to assess the level of APOBEC3F/3G editing in HIV-2-infected antiretroviral-naive patients. Direct sequencing of vif and pol regions was performed on HIV-2 proviral DNA from antiretroviral-naive patients included in the French Agence Nationale de Recherches sur le SIDA et les hépatites virales CO5 HIV-2 cohort. Hypermutated sequences were identified using Hypermut2.0 program. HIV-1 proviral sequences from Genbank were also assessed. Among 82 antiretroviral-naive HIV-2-infected patients assessed, 15 (28.8%) and five (16.7%) displayed Vif proviral defective sequences in HIV-2 groups A and B, respectively. A lower proportion of defective sequences was observed in protease-reverse transcriptase region. A higher median number of G-to-A mutations was observed in HIV-2 group B than in group A, both in Vif and protease-reverse transcriptase regions (P = 0.02 and P = 0.006, respectively). Compared with HIV-1 Vif sequences, a higher number of Vif defective sequences was observed in HIV-2 group A (P = 0.00001) and group B sequences (P = 0.013). We showed for the first time a high level of APOBEC3F/3G editing in HIV-2 sequences from antiretroviral-naive patients. Our study reported a group effect with a significantly higher level of APOBEC3F/3G editing in HIV-2 group B than in group A sequences.

  9. Mutations Related to Antiretroviral Resistance Identified by Ultra-Deep Sequencing in HIV-1 Infected Children under Structured Interruptions of HAART.

    Directory of Open Access Journals (Sweden)

    Jose Manuel Vazquez-Guillen

    Full Text Available Although Structured Treatment Interruptions (STI are currently not considered an alternative strategy for antiretroviral treatment, their true benefits and limitations have not been fully established. Some studies suggest the possibility of improving the quality of life of patients with this strategy; however, the information that has been obtained corresponds mostly to studies conducted in adults, with a lack of knowledge about its impact on children. Furthermore, mutations associated with antiretroviral resistance could be selected due to sub-therapeutic levels of HAART at each interruption period. Genotyping methods to determine the resistance profiles of the infecting viruses have become increasingly important for the management of patients under STI, thus low-abundance antiretroviral drug-resistant mutations (DRM's at levels under limit of detection of conventional genotyping (<20% of quasispecies could increase the risk of virologic failure. In this work, we analyzed the protease and reverse transcriptase regions of the pol gene by ultra-deep sequencing in pediatric patients under STI with the aim of determining the presence of high- and low-abundance DRM's in the viral rebounds generated by the STI. High-abundance mutations in protease and high- and low-abundance mutations in reverse transcriptase were detected but no one of these are directly associated with resistance to antiretroviral drugs. The results could suggest that the evaluated STI program is virologically safe, but strict and carefully planned studies, with greater numbers of patients and interruption/restart cycles, are still needed to evaluate the selection of DRM's during STI.

  10. Antiretroviral Drug Use in a Cohort of HIV-Uninfected Women in the United States: HIV Prevention Trials Network 064.

    Directory of Open Access Journals (Sweden)

    Iris Chen

    Full Text Available Antiretroviral (ARV drug use was analyzed in HIV-uninfected women in an observational cohort study conducted in 10 urban and periurban communities in the United States with high rates of poverty and HIV infection. Plasma samples collected in 2009-2010 were tested for the presence of 16 ARV drugs. ARV drugs were detected in samples from 39 (2% of 1,806 participants: 27/181 (15% in Baltimore, MD and 12/179 (7% in Bronx, NY. The ARV drugs detected included different combinations of non-nucleoside reverse transcriptase inhibitors and protease inhibitors (1-4 drugs/sample. These data were analyzed in the context of self-reported data on ARV drug use. None of the 39 women who had ARV drugs detected reported ARV drug use at any study visit. Further research is needed to evaluate ARV drug use by HIV-uninfected individuals.

  11. Follow-up on long-term antiretroviral therapy for cats infected with feline immunodeficiency virus. (United States)

    Medeiros, Sheila de Oliveira; Abreu, Celina Monteiro; Delvecchio, Rodrigo; Ribeiro, Anísia Praxedes; Vasconcelos, Zilton; Brindeiro, Rodrigo de Moraes; Tanuri, Amilcar


    Feline immunodeficiency virus (FIV) is a lentivirus that induces AIDS-like disease in cats. Some of the antiretroviral drugs available to treat patients with HIV type 1 are used to treat FIV-infected cats; however, antiretroviral therapy (ART) is not used in cats as a long-term treatment. In this study, the effects of long-term ART were evaluated in domestic cats treated initially with the nucleoside transcriptase reverse inhibitor (NTRI) zidovudine (AZT) over a period ranging from 5-6 years, followed by a regimen of the NTRI lamivudine (3TC) plus AZT over 3 years. Viral load, sequencing of pol (reverse transcriptase [RT]) region and CD4:CD8 lymphocyte ratio were evaluated during and after treatment. Untreated cats were evaluated as a control group. CD4:CD8 ratios were lower, and uncharacterized resistance mutations were found in the RT region in the group of treated cats. A slight increase in viral load was observed in some cats after discontinuing treatment. The data strongly suggest that treated cats were resistant to therapy, and uncharacterized resistance mutations in the RT gene of FIV were selected for by AZT. Few studies have been conducted to evaluate the effect of long-term antiretroviral therapy in cats. To date, resistance mutations have not been described in vivo. © ISFM and AAFP 2015.

  12. Prevalence of HIV Antiretroviral Drug Resistance and Its Impacts on HIV-1 Virological Failures in Jiangsu, China: A Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Ying Zhou


    Full Text Available Antiretroviral therapy (ART has been shown to improve survival of patients with Human Immunodeficiency Virus (HIV infection and to reduce HIV-1 transmission. Therefore, the Chinese central government initiated a national program to provide ART free of charge to HIV-1 patients. We conducted a cross-sectional survey in Jiangsu province to determine the level of drug resistance (DR in HIV-1 infected patients and the correlates of DR in virological failures in 2012. Approximately 10.4% of the HIV-1 patients in the study experienced virological failure after one year of ART and were divided into drug sensitive and drug resistant groups based on genotype determination. The viral loads (VLs in the drug resistant group were significantly lower than the drug sensitive group. There were two independent predictors of virological failure: male gender and increasing duration of treatment. The primary mutations observed in the study were against nucleoside reverse transcriptase inhibitors (NRTIs which were M184V (79.45% and K103N (33.70% in nonnucleoside reverse transcriptase inhibitors (NNRTIs. The overall rate of DR in Jiangsu province is still relatively low among treated patients. However, close monitoring of drug resistance in male patients in the early stages of treatment is vital to maintaining and increasing the benefits of HIV ART achieved to date.

  13. Targeted transgenic overexpression of mitochondrial thymidine kinase (TK2) alters mitochondrial DNA (mtDNA) and mitochondrial polypeptide abundance: transgenic TK2, mtDNA, and antiretrovirals. (United States)

    Hosseini, Seyed H; Kohler, James J; Haase, Chad P; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William


    Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-gamma. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity.

  14. Executive summary of the GESIDA/National AIDS Plan Consensus Document on Antiretroviral Therapy in Adults Infected by the Human Immunodeficiency Virus (Updated January 2016). (United States)


    In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise 3 drugs, namely, 2 nucleoside reverse transcriptase inhibitors (NRTI), and 1 drug from another family. Four of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further 6 regimens, which are based on an INSTI, a non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with cobicistat or ritonavir (PI/COBI, PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include 3 (or at least 2) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  15. Executive summary of the GESIDA/National AIDS Plan Consensus Document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2015). (United States)

    Berenguer, Juan; Polo, Rosa; Aldeguer, José López; Lozano, Fernando; Aguirrebengoa, Koldo; Arribas, José Ramón; Blanco, José Ramón; Boix, Vicente; Casado, José Luis; Clotet, Bonaventura; Crespo, Manuel; Domingo, Pere; Estrada, Vicente; García, Federico; Gatell, José María; González-García, Juan; Gutiérrez, Félix; Iribarren, José Antonio; Knobel, Hernando; Llibre, Josep María; Locutura, Jaime; López, Juan Carlos; Miró, José M; Moreno, Santiago; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz-Moreno, José; Sanz, Jesús; Téllez, María Jesús; Tuset, Montserrat; Rivero, Antonio


    In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation vary depending on the CD4+ T-lymphocyte count, the presence of opportunistic infections or comorbid conditions, age, and the efforts to prevent the transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise three drugs, namely, two nucleoside reverse transcriptase inhibitors (NRTI) and one drug from another family. Three of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further seven regimens, which are based on an INSTI, an non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with ritonavir (PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include three (or at least two) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  16. Executive summary of the GeSIDA/National AIDS Plan consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2014). (United States)

    Berenguer, Juan; Polo, Rosa; Lozano, Fernando; López Aldeguer, José; Antela, Antonio; Arribas, José Ramón; Asensi, Víctor; Blanco, José Ramón; Clotet, Bonaventura; Domingo, Pere; Galindo, María José; Gatell, José María; González-García, Juan; Iribarren, José Antonio; Locutura, Jaime; López, Juan Carlos; Mallolas, Josep; Martínez, Esteban; Miralles, Celia; Miró, José M; Moreno, Santiago; Palacios, Rosario; Pérez Elías, María Jesús; Pineda, Juan Antonio; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz, Jesús; Tuset, Montserrat; Vidal, Francesc; Rivero, Antonio


    In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with clinical circumstances, number of CD4 cells, comorbid conditions and prevention of transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  17. Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults (United States)

    Günthard, Huldrych F.; Saag, Michael S.; Benson, Constance A.; del Rio, Carlos; Eron, Joseph J.; Gallant, Joel E.; Hoy, Jennifer F.; Mugavero, Michael J.; Sax, Paul E.; Thompson, Melanie A.; Gandhi, Rajesh T.; Landovitz, Raphael J.; Smith, Davey M.; Jacobsen, Donna M.; Volberding, Paul A.


    IMPORTANCE New data and therapeutic options warrant updated recommendations for the use of antiretroviral drugs (ARVs) to treat or to prevent HIV infection in adults. OBJECTIVE To provide updated recommendations for the use of antiretroviral therapy in adults (aged ≥18 years) with established HIV infection, including when to start treatment, initial regimens, and changing regimens, along with recommendations for using ARVs for preventing HIV among those at risk, including preexposure and postexposure prophylaxis. EVIDENCE REVIEW A panel of experts in HIV research and patient care convened by the International Antiviral Society-USA reviewed data published in peer-reviewed journals, presented by regulatory agencies, or presented as conference abstracts at peer-reviewed scientific conferences since the 2014 report, for new data or evidence that would change previous recommendations or their ratings. Comprehensive literature searches were conducted in the PubMed and EMBASE databases through April 2016. Recommendations were by consensus, and each recommendation was rated by strength and quality of the evidence. FINDINGS Newer data support the widely accepted recommendation that antiretroviral therapy should be started in all individuals with HIV infection with detectable viremia regardless of CD4 cell count. Recommended optimal initial regimens for most patients are 2 nucleoside reverse transcriptase inhibitors (NRTIs) plus an integrase strand transfer inhibitor (InSTI). Other effective regimens include nonnucleoside reverse transcriptase inhibitors or boosted protease inhibitors with 2 NRTIs. Recommendations for special populations and in the settings of opportunistic infections and concomitant conditions are provided. Reasons for switching therapy include convenience, tolerability, simplification, anticipation of potential new drug interactions, pregnancy or plans for pregnancy, elimination of food restrictions, virologic failure, or drug toxicities. Laboratory

  18. First-line antiretroviral drug discontinuations in children.

    Directory of Open Access Journals (Sweden)

    Melony Fortuin-de Smidt

    Full Text Available There are a limited number of paediatric antiretroviral drug options. Characterising the long term safety and durability of different antiretrovirals in children is important to optimise management of HIV infected children and to determine the estimated need for alternative drugs in paediatric regimens. We describe first-line antiretroviral therapy (ART durability and reasons for discontinuations in children at two South African ART programmes, where lopinavir/ritonavir has been recommended for children <3 years old since 2004, and abacavir replaced stavudine as the preferred nucleoside reverse transcriptase inhibitor in 2010.We included children (<16 years at ART initiation who initiated ≥3 antiretrovirals between 2004-2014 with ≥1 follow-up visit on ART. We estimated the incidence of first antiretroviral discontinuation using Kaplan-Meier analysis. We determined the reasons for antiretroviral discontinuations using competing risks analysis. We used Cox regression to identify factors associated with treatment-limiting toxicity.We included 3579 children with median follow-up duration of 41 months (IQR 14-72. At ART initiation, median age was 44 months (IQR 13-89 and median CD4 percent was 15% (IQR 9-21%. At three and five years on ART, 72% and 26% of children respectively remained on their initial regimen. By five years on ART, the most common reasons for discontinuations were toxicity (32%, treatment failure (18%, treatment simplification (5%, drug interactions (3%, and other or unspecified reasons (18%. The incidences of treatment limiting toxicity were 50.6 (95% CI 46.2-55.4, 1.6 (0.5-4.8, 2.0 (1.2-3.3, and 1.3 (0.6-2.8 per 1000 patient years for stavudine, abacavir, efavirenz and lopinavir/ritonavir respectively.While stavudine was associated with a high risk of treatment-limiting toxicity, abacavir, lopinavir/ritonavir and efavirenz were well-tolerated. This supports the World Health Organization recommendation to replace stavudine with

  19. Thymidine analogue-sparing highly active antiretroviral therapy (HAART). (United States)

    Nolan, David; Mallal, Simon


    The use of alternative nucleoside reverse transcriptase inhibitors (NRTIs) to the thymidine analogues stavudine (d4T) and zidovudine(ZDV) has been advocated as a means of limiting long-term NRTI-associated toxicity, particularly the development of lipoatrophy or fat wasting. This approach reflects an increasing knowledge of the distinct toxicity profiles of NRTI drugs. However, recent clinical trials have demonstrated that the use of thymidine analogue NRTIs and newer alternative backbone NRTIs, such as tenofovir (TNF) and abacavir (ABC), is associated with comparable short-term efficacy and tolerability. Given the importance of toxicity profile differences in determining clinical management, it is important to recognise that d4T and ZDV cary significantly different risks for long-term NRTI toxicity. Recognising that all NRTIs, including thymidine analogues, have individual toxicity profiles provides a more appropriate basis for selecting optimal antiretroviral therapy. The safety and efficacy of TNF and ABC are also reviewed here, although the available data provide only limited knowledge of the long-term effects of these drugs in terms of toxicity and antiviral durability.

  20. Antiretroviral medication prescribing errors are common with hospitalization of HIV-infected patients. (United States)

    Commers, Tessa; Swindells, Susan; Sayles, Harlan; Gross, Alan E; Devetten, Marcel; Sandkovsky, Uriel


    Errors in prescribing antiretroviral therapy (ART) often occur with the hospitalization of HIV-infected patients. The rapid identification and prevention of errors may reduce patient harm and healthcare-associated costs. A retrospective review of hospitalized HIV-infected patients was carried out between 1 January 2009 and 31 December 2011. Errors were documented as omission, underdose, overdose, duplicate therapy, incorrect scheduling and/or incorrect therapy. The time to error correction was recorded. Relative risks (RRs) were computed to evaluate patient characteristics and error rates. A total of 289 medication errors were identified in 146/416 admissions (35%). The most common was drug omission (69%). At an error rate of 31%, nucleoside reverse transcriptase inhibitors were associated with an increased risk of error when compared with protease inhibitors (RR 1.32; 95% CI 1.04-1.69) and co-formulated drugs (RR 1.59; 95% CI 1.19-2.09). Of the errors, 31% were corrected within the first 24 h, but over half (55%) were never remedied. Admissions with an omission error were 7.4 times more likely to have all errors corrected within 24 h than were admissions without an omission. Drug interactions with ART were detected on 51 occasions. For the study population (n = 177), an increased risk of admission error was observed for black (43%) compared with white (28%) individuals (RR 1.53; 95% CI 1.16-2.03) but no significant differences were observed between white patients and other minorities or between men and women. Errors in inpatient ART were common, and the majority were never detected. The most common errors involved omission of medication, and nucleoside reverse transcriptase inhibitors had the highest rate of prescribing error. Interventions to prevent and correct errors are urgently needed.

  1. Interactions between recreational drugs and antiretroviral agents. (United States)

    Antoniou, Tony; Tseng, Alice Lin-In


    To summarize existing data regarding potential interactions between recreational drugs and drugs commonly used in the management of HIV-positive patients. Information was obtained via a MEDLINE search (1966-August 2002) using the MeSH headings human immunodeficiency virus, drug interactions, cytochrome P450, medication names commonly prescribed for the management of HIV and related opportunistic infections, and names of commonly used recreational drugs. Abstracts of national and international conferences, review articles, textbooks, and references of all articles were also reviewed. Literature on pharmacokinetic interactions was considered for inclusion. Pertinent information was selected and summarized for discussion. In the absence of specific data, prediction of potential clinically significant interactions was based on pharmacokinetic and pharmacodynamic properties. All protease inhibitors (PIs) and nonnucleoside reverse transcriptase inhibitors are substrates and potent inhibitors or inducers of the cytochrome P450 system. Many classes of recreational drugs, including benzodiazepines, amphetamines, and opioids, are also metabolized by the liver and can potentially interact with antiretrovirals. Controlled interaction studies are often not available, but clinically significant interactions have been observed in a number of case reports. Overdoses secondary to interactions between the "rave" drugs methylenedioxymethamphetamine (MDMA) or gamma-hydroxybutyrate (GHB) and PIs have been reported. PIs, particularly ritonavir, may also inhibit metabolism of amphetamines, ketamine, lysergic acid diethylmide (LSD), and phencyclidine (PCP). Case series and pharmacokinetic studies suggest that nevirapine and efavirenz induce methadone metabolism, which may lead to symptoms of opiate withdrawal. A similar interaction may exist between methadone and the PIs ritonavir and nelfinavir, although the data are less consistent. Opiate metabolism can be inhibited or induced by

  2. Immunological responses during a virologically failing antiretroviral regimen are associated with in vivo synonymous mutation rates of HIV type-1 env

    DEFF Research Database (Denmark)

    Mens, Helene; Jørgensen, Louise Bruun; Kronborg, Gitte


    BACKGROUND: Little is known about the underlying causes of differences in immunological response to antiretroviral therapy during multidrug-resistant (MDR) HIV type-1 (HIV-1) infection. This study aimed to identify virological factors associated with immunological response during therapy failure...... for analysis. In a longitudinal mixed-effects model, plasma HIV-1 RNA only tended to predict immunological response (P=0.06), whereas minor protease inhibitor (PI) and nucleoside reverse transcriptase (NRTI) mutations at baseline correlated significantly with CD4+ T-cell count slopes (r= -0.56, P=0.04 and r......= -0.64, P=0.008, respectively). Interestingly, synonymous mutations of env correlated inversely with CD4+ T-cell count slopes (r=-0.60; P=0.01) and individuals with codons under positive selection had significantly better CD4+ T-cell responses than individuals without (0.42 versus -5.34; P=0...

  3. Resistance profiles and adherence at primary virological failure in three different highly active antiretroviral therapy regimens: analysis of failure rates in a randomized study

    DEFF Research Database (Denmark)

    Røge, B T; Barfod, T S; Kirk, O


    OBJECTIVES: To investigate the interplay between resistance and adherence in the virological failure of three fundamentally different highly active antiretroviral therapy (HAART) regimens. METHODS: We retrospectively identified 56 verified primary virological failures (viral load >400 HIV-1 RNA...... copies/mL) among 293 patients randomized to two nucleoside reverse transcriptase inhibitors (NRTIs)+ritonavir+saquinavir (RS-arm) (n=115), two NRTIs+nevirapine+nelfinavir (NN-arm) (n=118), or abacavir+stavudine+didanosine (ASD-arm) (n=60) followed up for a median of 90 weeks. Data on adherence were...... collected from patient files, and genotyping was performed on plasma samples collected at time of failure. RESULTS: Treatment interruption or poor adherence was mainly caused by side effects and accounted for 74% of failures, and was associated with absence of resistance mutations. In the 30 failing...

  4. No Evidence for Decay of the Latent Reservoir in HIV-1–Infected Patients Receiving Intensive Enfuvirtide-Containing Antiretroviral Therapy (United States)

    Gandhi, Rajesh T.; Bosch, Ronald J.; Aga, Evgenia; Albrecht, Mary; Demeter, Lisa M.; Dykes, Carrie; Bastow, Barbara; Para, Michael; Lai, Jun; Siliciano, Robert F.; Siliciano, Janet D.; Eron, Joseph J.


    Human immunodeficiency virus type 1 (HIV-1) persists in a latent reservoir of infected resting memory CD4 cells in patients receiving antiretroviral therapy. We assessed whether multitarget therapy with enfuvirtide, 2 reverse-transcriptase inhibitors, and a ritonavir-boosted protease inhibitor leads to decay of this reservoir. Nineteen treatment-naive patients initiated this regimen; 9 experienced virologic suppression and continued enfuvirtide-containing therapy for at least 48 weeks. In enfuvirtide-treated patients with virological suppression, there was no decay of the latent reservoir (95% confidence interval for half-life, 11 months to infinity). The stability of the latent reservoir despite intensive therapy suggests that new strategies are needed to eradicate HIV-1 from this reservoir. PMID:20001856

  5. Small-molecule inhibition of HIV pre-mRNA splicing as a novel antiretroviral therapy to overcome drug resistance.

    Directory of Open Access Journals (Sweden)

    Nadia Bakkour


    Full Text Available The development of multidrug-resistant viruses compromises antiretroviral therapy efficacy and limits therapeutic options. Therefore, it is an ongoing task to identify new targets for antiretroviral therapy and to develop new drugs. Here, we show that an indole derivative (IDC16 that interferes with exonic splicing enhancer activity of the SR protein splicing factor SF2/ASF suppresses the production of key viral proteins, thereby compromising subsequent synthesis of full-length HIV-1 pre-mRNA and assembly of infectious particles. IDC16 inhibits replication of macrophage- and T cell-tropic laboratory strains, clinical isolates, and strains with high-level resistance to inhibitors of viral protease and reverse transcriptase. Importantly, drug treatment of primary blood cells did not alter splicing profiles of endogenous genes involved in cell cycle transition and apoptosis. Thus, human splicing factors represent novel and promising drug targets for the development of antiretroviral therapies, particularly for the inhibition of multidrug-resistant viruses.

  6. HIV-1 drug resistance genotyping from antiretroviral therapy (ART naïve and first-line treatment failures in Djiboutian patients

    Directory of Open Access Journals (Sweden)

    Elmi Abar Aden


    Full Text Available Abstract In this study we report the prevalence of antiretroviral drug resistant HIV-1 genotypes of virus isolated from Djiboutian patients who failed first-line antiretroviral therapy (ART and from ART naïve patients. Patients and methods A total of 35 blood samples from 16 patients who showed first-line ART failure (>1000 viral genome copies/ml and 19 ART-naïve patients were collected in Djibouti from October 2009 to December 2009. Both the protease (PR and reverse transcriptase (RT genes were amplified and sequenced using National Agency for AIDS Research (ANRS protocols. The Stanford HIV database algorithm was used for interpretation of resistance data and genotyping. Results Among the 16 patients with first-line ART failure, nine (56.2% showed reverse transcriptase inhibitor-resistant HIV-1 strains: two (12.5% were resistant to nucleoside (NRTI, one (6.25% to non-nucleoside (NNRTI reverse transcriptase inhibitors, and six (37.5% to both. Analysis of the DNA sequencing data indicated that the most common mutations conferring drug resistance were M184V (38% for NRTI and K103N (25% for NNRTI. Only NRTI primary mutations K101Q, K103N and the PI minor mutation L10V were found in ART naïve individuals. No protease inhibitor resistant strains were detected. In our study, we found no detectable resistance in ∼ 44% of all patients who experienced therapeutic failure which was explained by low compliance, co-infection with tuberculosis and malnutrition. Genotyping revealed that 65.7% of samples were infected with subtype C, 20% with CRF02_AG, 8.5% with B, 2.9% with CRF02_AG/C and 2.9% with K/C. Conclusion The results of this first study about drug resistance mutations in first-line ART failures show the importance of performing drug resistance mutation test which guides the choice of a second-line regimen. This will improve the management of HIV-infected Djiboutian patients. Virtual slides The virtual slide(s for this article can be found

  7. Tenofovir-based regimens associated with less drug resistance in HIV-1-infected Nigerians failing first-line antiretroviral therapy. (United States)

    Etiebet, Mary-Ann A; Shepherd, James; Nowak, Rebecca G; Charurat, Man; Chang, Harry; Ajayi, Samuel; Elegba, Olufunmilayo; Ndembi, Nicaise; Abimiku, Alashle; Carr, Jean K; Eyzaguirre, Lindsay M; Blattner, William A


    In resource-limited settings, HIV-1 drug resistance testing to guide antiretroviral therapy (ART) selection is unavailable. We retrospectively conducted genotypic analysis on archived samples from Nigerian patients who received targeted viral load testing to confirm treatment failure and report their drug resistance mutation patterns. Stored plasma from 349 adult patients on non-nucleoside reverse transcriptase inhibitor (NNRTI) regimens was assayed for HIV-1 RNA viral load, and samples with more than 1000 copies/ml were sequenced in the pol gene. Analysis for resistance mutations utilized the IAS-US 2011 Drug Resistance Mutation list. One hundred and seventy-five samples were genotyped; the majority of the subtypes were G (42.9%) and CRF02_AG (33.7%). Patients were on ART for a median of 27 months. 90% had the M184V/I mutation, 62% had at least one thymidine analog mutation, and 14% had the K65R mutation. 97% had an NNRTI resistance mutation and 47% had at least two etravirine-associated mutations. In multivariate analysis tenofovir-based regimens were less likely to have at least three nucleoside reverse transcriptase inhibitor (NRTI) mutations after adjusting for subtype, previous ART, CD4, and HIV viral load [P < 0.001, odds ratio (OR) 0.04]. 70% of patients on tenofovir-based regimens had at least two susceptible NRTIs to include in a second-line regimen compared with 40% on zidovudine-based regimens (P = 0.04, OR = 3.4). At recognition of treatment failure, patients on tenofovir-based first-line regimens had fewer NRTI drug-resistant mutations and more active NRTI drugs available for second-line regimens. These findings can inform strategies for ART regimen sequencing to optimize long-term HIV treatment outcomes in low-resource settings.

  8. Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives. (United States)

    Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano


    Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

  9. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A. (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong


    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  10. Long-term effectiveness of recommended boosted protease inhibitor-based antiretroviral therapy in Europe

    DEFF Research Database (Denmark)

    Santos, J R; Cozzi-Lepri, A; Phillips, A


    models were used to compare risks of failure by PI/r-based regimen. The main analysis was performed with intention-to-treat (ITT) ignoring treatment switches. RESULTS: The time to VF favoured DRV/r over ATZ/r, and both were superior to LPV/r (log-rank test; P

  11. Mortality and loss to follow-up among HIV-infected persons on long-term antiretroviral therapy in Latin America and the Caribbean (United States)

    Carriquiry, Gabriela; Fink, Valeria; Koethe, John Robert; Giganti, Mark Joseph; Jayathilake, Karu; Blevins, Meridith; Cahn, Pedro; Grinsztejn, Beatriz; Wolff, Marcelo; Pape, Jean William; Padgett, Denis; Madero, Juan Sierra; Gotuzzo, Eduardo; McGowan, Catherine Carey; Shepherd, Bryan Earl


    Introduction Long-term survival of HIV patients after initiating highly active antiretroviral therapy (ART) has not been sufficiently described in Latin America and the Caribbean, as compared to other regions. The aim of this study was to describe the incidence of mortality, loss to follow-up (LTFU) and associated risk factors for patients enrolled in the Caribbean, Central and South America Network (CCASAnet). Methods We assessed time from ART initiation (baseline) to death or LTFU between 2000 and 2014 among ART-naïve adults (≥18 years) from sites in seven countries included in CCASAnet: Argentina, Brazil, Chile, Haiti, Honduras, Mexico and Peru. Kaplan-Meier techniques were used to estimate the probability of mortality over time. Risk factors for death were assessed using Cox regression models stratified by site and adjusted for sex, baseline age, nadir pre-ART CD4 count, calendar year of ART initiation, clinical AIDS at baseline and type of ART regimen. Results A total of 16,996 ART initiators were followed for a median of 3.5 years (interquartile range (IQR): 1.6–6.2). The median age at ART initiation was 36 years (IQR: 30–44), subjects were predominantly male (63%), median CD4 count was 156 cells/µL (IQR: 60–251) and 26% of subjects had clinical AIDS prior to starting ART. Initial ART regimens were predominantly non-nucleoside reverse transcriptase inhibitor based (86%). The cumulative incidence of LTFU five years after ART initiation was 18.2% (95% confidence interval (CI) 17.5–18.8%). A total of 1582 (9.3%) subjects died; the estimated probability of death one, three and five years after ART initiation was 5.4, 8.3 and 10.3%, respectively. The estimated five-year mortality probability varied substantially across sites, from 3.5 to 14.0%. Risk factors for death were clinical AIDS at baseline (adjusted hazard ratio (HR)=1.65 (95% CI 1.47–1.87); p<0.001), lower baseline CD4 (HR=1.95 (95% CI 1.63–2.32) for 50 vs. 350 cells/µL; p<0.001) and

  12. Antiretroviral treatment is associated with increased attentional load-dependent brain activation in HIV patients. (United States)

    Chang, L; Yakupov, R; Nakama, H; Stokes, B; Ernst, T


    The purpose of this paper was to determine whether antiretroviral medications, especially the nucleoside analogue reverse transcriptase inhibitors, lead to altered brain activation due to their potential neurotoxic effects in patients with human immunodeficiency virus (HIV) infection. Forty-two right-handed men were enrolled in three groups: seronegative controls (SN, n = 18), HIV subjects treated with antiretroviral medications (HIV+ARV, n = 12), or not treated with antiretroviral medications (HIV+NARV, n = 12). Each subject performed a set of visual attention tasks with increasing difficulty or load (tracking two, three or four balls) during functional magnetic resonance imaging. HIV subjects, both groups combined, showed greater load-dependent increases in brain activation in the right frontal regions compared to SN (p-corrected = 0.006). HIV+ARV additionally showed greater load-dependent increases in activation compared to SN in bilateral superior frontal regions (p-corrected = 0.032) and a lower percent accuracy on the performance of the most difficult task (tracking four balls). Region of interest analyses further demonstrated that SN showed load-dependent decreases (with repeated trials despite increasing difficulty), while HIV subjects showed load-dependent increases in activation with the more difficult tasks, especially those on ARVs. These findings suggest that chronic ARV treatments may lead to greater requirement of the attentional network reserve and hence less efficient usage of the network and less practice effects in these HIV patients. As the brain has a limited reserve capacity, exhausting the reserve capacity in HIV+ARV would lead to declined performance with more difficult tasks that require more attention.

  13. Synergy against drug-resistant HIV-1 with the microbicide antiretrovirals, dapivirine and tenofovir, in combination. (United States)

    Schader, Susan M; Colby-Germinario, Susan P; Schachter, Jordana R; Xu, Hongtao; Wainberg, Mark A


    To evaluate the candidate antiretroviral microbicide compounds, dapivirine (DAP) and tenofovir (TFV), alone and in combination against the transmission of wild-type and nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV-1 from different subtypes. We determined single-drug efficacy of the RTIs, DAP and TFV, against subtype B and non-B wild-type and NNRTI-resistant HIV-1 in vitro. To assess breadth of activity, compounds were tested alone and in combination against wild-type and NNRTI-resistant subtype C primary HIV-1 isolates and complimentary clonal HIV-1 from subtypes B, C and CRF02_AG to control for viral variation. Early infection was quantified by counting light units emitted from TZM-bl cells less than 48-h postinfection. Combination ratios were based on drug inhibitory concentrations (IC(50)s) and combined effects were determined by calculating combination indices. Both candidate microbicide antiretrovirals demonstrated potent anti-NNRTI-resistant HIV-1 activity in vitro, albeit the combination protected better than the single-drug treatments. Of particular interest, the DAP with TFV combination exhibited synergy (50% combination index, CI(50) = 0.567) against subtype C NNRTI-resistant HIV-1, whereas additivity (CI(50) = 0.987) was observed against the wild-type counterpart from the same patient. The effect was not compounded by the presence of subdominant viral fractions, as experiments using complimentary clonal subtype C wild-type (CI(50) = 0.968) and NNRTI-resistant (CI(50) = 0.672) HIV-1, in lieu of the patient quasispecies, gave similar results. This study supports the notion that antiretroviral drug combinations may retain antiviral activity against some drug-resistant HIV-1 despite subtype classification and quasispecies diversity.

  14. Cervical Shedding of HIV-1 RNA Among Women With Low Levels of Viremia While Receiving Highly Active Antiretroviral Therapy (United States)

    Neely, Michael N.; Benning, Lorie; Xu, Jiaao; Strickler, Howard D.; Greenblatt, Ruth M.; Minkoff, Howard; Young, Mary; Bremer, James; Levine, Alexandra M.; Kovacs, Andrea


    Background Among women with low o r undetectable quantities of HIV-1 RNA in plasma, factors associated with genital HIV-1 RNA shedding, including choice of treatment regimen, are poorly characterized. Methods We measured HIV-1 RNA in cervical swab specimens obtained from participants in the Women’s Interagency HIV Study who had concurrent plasma viral RNA levels <500 copies/mL, and we assessed factors associated with genital HIV shedding. The study was powered to determine the relative effects of antiretroviral protease inhibitors (PIs) versus nonnucleoside reverse transcriptase inhibitors (NNRTIs) on viral RNA shedding. Results Overall, 44 (15%) of 290 women had detectable HIV-1 RNA in cervical specimens. In the final multivariate model, shedding was independently associated with NNRTI (vs. PI) use (odds ratio [OR], 95% confidence interval [CI]: 2.24, 1.13 to 4.45) and illicit drug use (OR, 95% CI: 2.41, 0.96 to 5.69). Conclusions This is the largest study to define risks for genital HIV-1 RNA shedding in women with low/undetectable plasma virus. Shedding in this population was common, and NNRTI-based highly active antiretroviral therapy (HAART) (vs. PI-based HAART) was associated with genital HIV shedding. Further study is required to determine the impact of these findings on transmission of HIV from mother to child or to sexual partners. PMID:17106279

  15. Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults: 2016 Recommendations of the International Antiviral Society-USA Panel. (United States)

    Günthard, Huldrych F; Saag, Michael S; Benson, Constance A; del Rio, Carlos; Eron, Joseph J; Gallant, Joel E; Hoy, Jennifer F; Mugavero, Michael J; Sax, Paul E; Thompson, Melanie A; Gandhi, Rajesh T; Landovitz, Raphael J; Smith, Davey M; Jacobsen, Donna M; Volberding, Paul A


    New data and therapeutic options warrant updated recommendations for the use of antiretroviral drugs (ARVs) to treat or to prevent HIV infection in adults. To provide updated recommendations for the use of antiretroviral therapy in adults (aged ≥18 years) with established HIV infection, including when to start treatment, initial regimens, and changing regimens, along with recommendations for using ARVs for preventing HIV among those at risk, including preexposure and postexposure prophylaxis. A panel of experts in HIV research and patient care convened by the International Antiviral Society-USA reviewed data published in peer-reviewed journals, presented by regulatory agencies, or presented as conference abstracts at peer-reviewed scientific conferences since the 2014 report, for new data or evidence that would change previous recommendations or their ratings. Comprehensive literature searches were conducted in the PubMed and EMBASE databases through April 2016. Recommendations were by consensus, and each recommendation was rated by strength and quality of the evidence. Newer data support the widely accepted recommendation that antiretroviral therapy should be started in all individuals with HIV infection with detectable viremia regardless of CD4 cell count. Recommended optimal initial regimens for most patients are 2 nucleoside reverse transcriptase inhibitors (NRTIs) plus an integrase strand transfer inhibitor (InSTI). Other effective regimens include nonnucleoside reverse transcriptase inhibitors or boosted protease inhibitors with 2 NRTIs. Recommendations for special populations and in the settings of opportunistic infections and concomitant conditions are provided. Reasons for switching therapy include convenience, tolerability, simplification, anticipation of potential new drug interactions, pregnancy or plans for pregnancy, elimination of food restrictions, virologic failure, or drug toxicities. Laboratory assessments are recommended before treatment, and

  16. 12-month mortality and loss-to-program in antiretroviral-treated children: The IeDEA pediatric West African Database to evaluate AIDS (pWADA, 2000-2008

    Directory of Open Access Journals (Sweden)

    Peterson Kevin


    Full Text Available Abstract Background The IeDEA West Africa Pediatric Working Group (pWADA was established in January 2007 to study the care and treatment of HIV-infected children in this region. We describe here the characteristics at antiretroviral treatment (ART initiation and study the 12-month mortality and loss-to-program of HIV-infected children followed in ART programs in West Africa. Methods Standardized data from HIV-infected children followed-up in ART programs were included. Nine clinical centers from six countries contributed to the dataset (Benin, Côte d'Ivoire, Gambia, Ghana, Mali and Senegal. Inclusion criteria were the followings: age 0-15 years and initiated triple antiretroviral drug regimens. Baseline time was the date of ART initiation. WHO criteria was used to define severe immunosuppression based on CD4 count by age or CD4 percent 6 months after ART initiation and factors associated with these two outcomes. Results Between June 2000 and December 2007, 2170 children were included. Characteristics at ART initiation were the following: median age of 5 years (Interquartile range (IQR: 2-9 and median CD4 percentage of 13% (IQR: 7-19. The most frequent drug regimen consisted of two nucleoside reverse transcriptase inhibitors and one non-nucleoside reverse transcriptase inhibitors (62%. During the first 12 months, 169 (7.8% children died and 461(21.2% were lost-to-program. Overall, in HIV-infected children on ART, the 12-month probability of death was 8.3% (95% Confidence Interval (CI: 7.2-9.6%, and of loss-to-program was 23.1% (95% CI: 21.3-25.0%. Both mortality and loss-to program were associated with advanced clinical stage, CD4 percentage 2005 of ART initiation. Conclusion Innovative and sustainable approaches are needed to better document causes of death and increase retention in HIV pediatric clinics in West Africa.

  17. High prevalence of antiretroviral drug resistance among HIV-1-untreated patients in Guinea-Conakry and in Niger. (United States)

    Charpentier, Charlotte; Bellecave, Pantxika; Cisse, Mohamed; Mamadou, Saidou; Diakite, Mandiou; Peytavin, Gilles; Tchiombiano, Stéphanie; Teisseire, Pierre; Pizarro, Louis; Storto, Alexandre; Brun-Vézinet, Françoise; Katlama, Christine; Calvez, Vincent; Marcelin, Anne-Geneviève; Masquelier, Bernard; Descamps, Diane


    The aim of the study was to assess the prevalence of antiretroviral drug resistance mutations in HIV-1 from recently diagnosed and untreated patients living in Conakry, Guinea-Conakry and in Niamey, Niger. The study was performed in two countries of Western Africa - Guinea-Conakry and Niger - using the same survey method in both sites. All newly HIV-1 diagnosed patients, naive of antiretroviral drugs, were consecutively included during September 2009 in each of the two sites. Protease and reverse transcriptase sequencing was performed using the ANRS procedures. Drug resistance mutations were identified according to the 2009 update surveillance drug resistance mutations. In Conakry, 99 patients were included, most of whom (89%) were infected with CRF02_AG recombinant virus. Resistance analysis among the 93 samples showed that ≥1 drug resistance mutation was observed in 8 samples, leading to a prevalence of primary resistance of 8.6% (95% CI 2.91-14.29%). In Niamey, 96 patients were included; a high diversity in HIV-1 subtypes was observed with 47 (51%) patients infected with CRF02_AG. Resistance analysis performed among the 92 samples with successful genotypic resistance test showed that ≥1 drug resistance mutation was observed in 6 samples, leading to a prevalence of primary resistance of 6.5% (95% CI 1.50-11.50%). We reported the first antiretroviral drug resistance survey studies in antiretroviral-naive patients living in Guinea-Conakry and in Niger. The prevalence of resistance was between 6% and 9% in both sites, which is higher than most of the other countries from Western Africa region.

  18. New and investigational antiretroviral drugs for HIV infection: mechanisms of action and early research findings. (United States)

    Saag, Michael S


    Numerous investigational antiretroviral agents are in clinical development. Among them are festinavir (BMS986001), a thymidine analogue similar to stavudine with reduced potential for toxicity; GS-7340, a prodrug of tenofovir that achieves greater intracellular concentrations; MK-1439, a nonnucleoside analogue reverse transcriptase inhibitor (NNRTI) that retains activity against common NNRTI-associated resistance mutations; and albuvirtide, a long-acting parenteral fusion inhibitor. Investigational integrase strand transfer inhibitors (InSTIs) include elvitegravir, recently approved by the US Food and Drug Administration (FDA) as part of a once-daily, single-tablet formulation with cobicistat/tenofovir/emtricitabine; dolutegravir, which maintains some activity against raltegravir- and elvitegravir-resistant mutants; and S/GSK1265744, which also maintains some activity against resistance mutations in the integrase gene and is being developed as a long-lasting parenteral agent. Novel 2-(quinolin-3-yl)acetic acid derivatives (LEDGINs), agents that were originally thought to inhibit the interaction of integrase with its cofactor lens epithelium-derived growth factor p75 (LEDGF/p75), be active against InSTI-resistant mutants and to have additive activity when combined with InSTIs. This article summarizes a presentation by Michael S. Saag, MD, at the IAS-USA live Improving the Management of HCV Disease continuing medical education program held in New York in October 2012.

  19. Increased Persistence of Initial Treatment for HIV Infection With Modern Antiretroviral Therapy. (United States)

    Davy-Mendez, Thibaut; Eron, Joseph J; Zakharova, Oksana; Wohl, David A; Napravnik, Sonia


    Initiating antiretroviral therapy (ART) early improves clinical outcomes and prevents transmission. Guidelines for first-line therapy have changed with the availability of newer ART agents. In this study, we compared persistence and virologic responses with initial ART according to the class of anchor agent used. An observational clinical cohort study in the Southeastern United States. All HIV-infected patients participating in the UNC Center for AIDS Research Clinical Cohort (UCHCC) and initiating ART between 1996 and 2014 were included. Separate time-to-event analyses with regimen discontinuation and virologic failure as outcomes were used, including Kaplan-Meier survival curves and adjusted Cox proportional hazards models. One thousand six hundred twenty-four patients were included (median age of 37 years at baseline, 28% women, 60% African American, and 28% white). Eleven percent initiated integrase strand transfer inhibitor (INSTI), 33% non-nucleoside reverse transcriptase inhibitor (NNRTI), 20% boosted protease inhibitor, 27% other, and 9% NRTI only regimens. Compared with NNRTI-containing regimens, INSTI-containing regimens had an adjusted hazard ratio of 0.49 (95% confidence interval, 0.35 to 0.69) for discontinuation and 0.70 (95% confidence interval, 0.46 to 1.06) for virologic failure. All other regimen types were associated with increased rates of discontinuation and failure compared with NNRTI. Initiating ART with an INSTI-containing regimen was associated with lower rates of regimen discontinuation and virologic failure.

  20. Selection of HIV resistance associated with antiretroviral therapy initiated due to pregnancy and suspended postpartum. (United States)

    Ellis, Giovanina M; Huang, Sharon; Hitti, Jane; Frenkel, Lisa M


    Compare the risk of HIV drug resistance in women stopping suppressive nelfinavir (NFV)-based or Nevirapine (NVP)-based antiretroviral therapy (ART) after pregnancy. Specimens collected after stopping ART were tested for drug resistance by an oligonucleotide ligation assay and consensus sequencing. When postpartum drug resistance was detected, specimens obtained at study entry and during ART were evaluated. Sixteen of 38 women with ART-induced suppression of viral replication suspended ART postpartum. Resistance mutations were detected in 75% who stopped NFV-ART and in 50% who stopped NVP-ART. M184V, associated with Lamivudine resistance, was more frequent among those randomized to NFV-ART compared with NVP-ART (6 of 8 versus 1 of 8; P = 0.04), and nonnucleoside reverse transcriptase inhibitor resistance was detected in 4 of 8 stopping NVP-ART. HIV drug resistance was frequently observed among women who stopped suppressive NVP-ART or NFV-ART postpartum. This suggests that NFV-ART may have suboptimal potency, that staggering discontinuation of NVP-ART may be warranted, and/or ART adherence may be lax in women who choose to stop ART postpartum.

  1. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)



    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  2. Telomerase reverse transcriptase promoter mutations in bladder cancer

    DEFF Research Database (Denmark)

    Allory, Yves; Beukers, Willemien; Sagrera, Ana


    for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...

  3. New subtypes and genetic recombination in HIV type 1-infecting patients with highly active antiretroviral therapy in Peru (2008-2010). (United States)

    Yabar, Carlos Augusto; Acuña, Maribel; Gazzo, Cecilia; Salinas, Gabriela; Cárdenas, Fanny; Valverde, Ada; Romero, Soledad


    HIV-1 subtype B is the most frequent strain in Peru. However, there is no available data about the genetic diversity of HIV-infected patients receiving highly active antiretroviral therapy (HAART) here. A group of 267 patients in the Peruvian National Treatment Program with virologic failure were tested for genotypic evidence of HIV drug resistance at the Instituto Nacional de Salud (INS) of Peru between March 2008 and December 2010. Viral RNA was extracted from plasma and the segments of the protease (PR) and reverse transcriptase (RT) genes were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), purified, and fully sequenced. Consensus sequences were submitted to the HIVdb Genotypic Resistance Interpretation Algorithm Database from Stanford University, and then aligned using Clustal X v.2.0 to generate a phylogenetic tree using the maximum likelihood method. Intrasubtype and intersubtype recombination analyses were performed using the SCUEAL program (Subtype Classification by Evolutionary ALgo-rithms). A total of 245 samples (91%) were successfully genotyped. The analysis obtained from the HIVdb program showed 81.5% resistance cases (n=198). The phylogenetic analysis revealed that subtype B was predominant in the population (98.8%), except for new cases of A, C, and H subtypes (n=4). Of these cases, only subtype C was imported. Likewise, recombination analysis revealed nine intersubtype and 20 intrasubtype recombinant cases. This is the first report of the presence of HIV-1 subtypes C and H in Peru. The introduction of new subtypes and circulating recombinants forms can make it difficult to distinguish resistance profiles in patients and consequently affect future treatment strategies against HIV in this country.

  4. Frequent Cross-Resistance to Dapivirine in HIV-1 Subtype C-Infected Individuals after First-Line Antiretroviral Therapy Failure in South Africa. (United States)

    Penrose, Kerri J; Wallis, Carole L; Brumme, Chanson J; Hamanishi, Kristen A; Gordon, Kelley C; Viana, Raquel V; Harrigan, P Richard; Mellors, John W; Parikh, Urvi M


    A vaginal ring containing dapivirine (DPV) has shown moderate protective efficacy against HIV-1 acquisition, but the activity of DPV against efavirenz (EFV)- and nevirapine (NVP)-resistant viruses that could be transmitted is not well defined. We investigated DPV cross-resistance of subtype C HIV-1 from individuals on failing NVP- or EFV-containing antiretroviral therapy (ART) in South Africa. Plasma samples were obtained from individuals with >10,000 copies of HIV RNA/ml and with HIV-1 containing at least one non-nucleoside reverse transcriptase (NNRTI) mutation. Susceptibility to NVP, EFV, and DPV in TZM-bl cells was determined for recombinant HIV-1 LAI containing bulk-amplified, plasma-derived, full-length reverse transcriptase sequences. Fold change (FC) values were calculated compared with a composite 50% inhibitory concentration (IC 50 ) from 12 recombinant subtype C HIV-1 LAI plasma-derived viruses from treatment-naive individuals in South Africa. A total of 25/100 (25%) samples showed >500-FCs to DPV compared to treatment-naive samples with IC 50 s exceeding the maximum DPV concentration tested (132 ng/ml). A total of 66/100 (66%) samples displayed 3- to 306-FCs, with a median IC 50 of 17.6 ng/ml. Only 9/100 (9%) samples were susceptible to DPV (FC 500-fold resistance to DPV compared to samples with a ≤500-fold resistance. A total of 91% of samples with NNRTI-resistant HIV-1 from individuals on failing first-line ART in South Africa exhibited ≥3-fold cross-resistance to DPV. This level of resistance exceeds expected plasma concentrations, but very high genital tract DPV concentrations from DPV ring use could block viral replication. It is critically important to assess the frequency of transmitted and selected DPV resistance in individuals using the DPV ring. Copyright © 2017 American Society for Microbiology.

  5. Population-based surveillance of HIV drug resistance emerging on treatment and associated factors at sentinel antiretroviral therapy sites in Namibia. (United States)

    Hong, Steven Y; Jonas, Anna; DeKlerk, Michael; Shiningavamwe, Andreas; Desta, Tiruneh; Badi, Alfons; Morris, Lynn; Hunt, Gillian M; Ledwaba, Johanna; Sheehan, Heidi B; Lau, Kiger; Trotter, Andrew; Tang, Alice M; Wanke, Christine; Jordan, Michael R


    The World Health Organization (WHO) prospective surveys of acquired HIV drug resistance (HIVDR) evaluate HIVDR emerging after the first year of antiretroviral therapy (ART) and associated factors. Consecutive ART starters in 2009 were enrolled at 3 sentinel sites in Namibia. Genotyping was performed at start and after 12 months in patients with HIV viral load (VL) >1000 copies per mL. HIVDR outcomes were: HIVDR prevention (VL ≤1000 copies/mL), possible HIVDR (VL >1000 copies/mL without detectable HIVDR or loss to follow-up or ART stop), and HIVDR (VL >1000 copies/mL with detectable HIVDR). Adherence was assessed using medication possession ratio (MPR). Of 394 starters, at 12 months, 80% were on first-line ART, 1% died, 4% transferred out, 1% stopped ART, <1% switched to second-line, and 15% were lost to follow-up. Among patients on first-line, 77% had VL testing, and 94% achieved VL ≤1000 copies per mL. At baseline, 7% had HIVDR. After 12 months, among patients with VL testing, 5% had HIVDR. A majority of patients failing therapy had high-level resistance to nonnucleoside reverse transcriptase inhibitors but none to protease inhibitors. All sites achieved the WHO target of ≥70% HIVDR prevention. Factors associated with not achieving HIVDR prevention were: baseline resistance to nonnucleoside reverse transcriptase inhibitors [odds ratio (OR) 3.0, P = 0.023], WHO stage 3 or 4 at baseline (OR 2.0, P = 0.012), and MPR <75% (OR 4.9, P = 0.021). Earlier ART initiation and removal of barriers to on-time drug pickups may help to prevent HIVDR. These data inform decisions at national and global levels on the effectiveness of first- and second-line regimens.

  6. Antiretroviral therapy: current drugs. (United States)

    Pau, Alice K; George, Jomy M


    The rapid advances in drug discovery and the development of antiretroviral therapy is unprecedented in the history of modern medicine. The administration of chronic combination antiretroviral therapy targeting different stages of the human immunodeficiency virus' replicative life cycle allows for durable and maximal suppression of plasma viremia. This suppression has resulted in dramatic improvement of patient survival. This article reviews the history of antiretroviral drug development and discusses the clinical pharmacology, efficacy, and toxicities of the antiretroviral agents most commonly used in clinical practice to date. Published by Elsevier Inc.

  7. CD41 T cell recovery during suppression of HIV replication: an international comparison of the immunological efficacy of antiretroviral therapy in North America, Asia and Africa. (United States)

    Geng, Elvin H; Neilands, Torsten B; Thièbaut, Rodolphe; Bwana, Mwebesa Bosco; Nash, Denis; Moore, Richard D; Wood, Robin; Zannou, Djimon Marcel; Althoff, Keri N; Lim, Poh Lian; Nachega, Jean B; Easterbrook, Philippa J; Kambugu, Andrew; Little, Francesca; Nakigozi, Gertrude; Nakanjako, Damalie; Kiggundu, Valerian; Ki Li, Patrick Chung; Bangsberg, David R; Fox, Matthew P; Prozesky, HansW; Hunt, Peter W; Davies, Mary-Ann; Reynolds, Steven J; Egger, Matthias; Yiannoutsos, Constantin T; Vittinghoff, Eric V; Deeks, Steven G; Martin, Jeffrey N


    Even among HIV-infected patients who fully suppress plasma HIV RNA replication on antiretroviral therapy, genetic (e.g. CCL3L1 copy number), viral (e.g. tropism) and environmental (e.g. chronic exposure to microbial antigens) factors influence CD4 recovery. These factors differ markedly around the world and therefore the expected CD4 recovery during HIV RNA suppression may differ globally. We evaluated HIV-infected adults from North America, West Africa, East Africa, Southern Africa and Asia starting non-nucleoside reverse transcriptase inhibitorbased regimens containing efavirenz or nevirapine, who achieved at least one HIV RNA level Africa showed diminished CD4 recovery as compared with other regions. Three years after antiretroviral therapy initiation, the mean CD4 count for a prototypical patient with a pre-therapy CD4 count of 150/ml was 529/ml [95% confidence interval (CI): 517–541] in North America, 494/ml (95% CI: 429–559) in West Africa, 515/ml (95% CI: 508–522) in Southern Africa, 503/ml (95% CI: 478–528) in Asia and 437/ml (95% CI: 425–449) in East Africa. CD4 recovery during HIV RNA suppression is diminished in East Africa as compared with other regions of the world, and observed differences are large enough to potentially influence clinical outcomes. Epidemiological analyses on a global scale can identify macroscopic effects unobservable at the clinical, national or individual regional level.

  8. Population-based monitoring of emerging HIV-1 drug resistance on antiretroviral therapy and associated factors in a sentinel site in Cameroon: low levels of resistance but poor programmatic performance.

    Directory of Open Access Journals (Sweden)

    Serge C Billong

    Full Text Available BACKGROUND: Scale-up of antiretroviral therapy (ART in resource-limited settings has drastically reduced HIV-related morbidity and mortality. However, challenges in long-term ART, adherence and HIV drug resistance (HIVDR itself, require monitoring to limit HIVDR emergence among ART-experienced populations, in order to ensure regimen efficacy. METHODS: A longitudinal study was conducted from 2009-2011 in a cohort of 141 HIV-infected adult patients (aged >21 at the national social insurance centre hospital in Yaounde, Cameroon. As per-WHO HIVDR protocol, HIV-1 protease-reverse transcriptase genotyping was performed at baseline and at endpoint (12 months on first-line ART using ViroSeq™ Genotyping kit. RESULTS: At baseline, a prevalence of 3.6% (5/139 HIVDR was observed [protease inhibitors M46I (1/5, G73A (1/5, L90LM (1/5; nucleoside reverse transcriptase inhibitors: M184V (1/5, T215F (1/5; non-nucleoside reverse transcriptase inhibitors: K103N (1/5, Y181Y/C (2/5, M230ML (1/5]. At endpoint, 54.0% (76 patients were followed-up, 9.2% (13 died, and 3.5% (5 transferred, 38.5% (47 lost to follow-up (LTFU. 69.7% (53/76 of those followed-up had viremia <40 copies/ml and 90.8% (69/76 <1000 copies/ml. 4/7 patients with viremia ≥1000 copies/ml harbored HIVDR (prevalence: 5.3%; 4/76, with M184V/I (4/4 and K103K/N (3/4 being the most prevalent mutations. LTFU was favored by costs for consultation/laboratory tests, drug shortages, workload (physician/patient ratio: 1/180 and community disengagement. CONCLUSIONS: Low levels of HIVDR at baseline and at endpoint suggest a probable effectiveness of ART regimens used in Cameroon. However the possible high rate of HIVDR among LTFUs limited the strengths of our findings. Evaluating HIVDR among LTFU, improving adherence, task shifting, subsidizing/harmonizing costs for routine follow-up, are urgent measures to ensure an improved success of the country ART performance.

  9. Targeted Transgenic Overexpression of Mitochondrial Thymidine Kinase (TK2) Alters Mitochondrial DNA (mtDNA) and Mitochondrial Polypeptide Abundance : Transgenic TK2, mtDNA, and Antiretrovirals


    Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William


    Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...

  10. Different origin of adipogenic stem cells influences the response to antiretroviral drugs

    Energy Technology Data Exchange (ETDEWEB)

    Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina [Department of Surgery, Medicine, Dentistry and Morphological Sciences, University of Modena and Reggio Emilia School of Medicine, Via Campi 287, 41125 Modena (Italy); Polo, Miriam [Department of Pharmacology, University of Valencia, Av.da Blasco Ibáñez 15, Valencia (Spain); FISABIO–Hospital Universitario Dr. Peset, Av.da Gaspar Aguilar 90, Valencia (Spain); De Pol, Anto [Department of Surgery, Medicine, Dentistry and Morphological Sciences, University of Modena and Reggio Emilia School of Medicine, Via Campi 287, 41125 Modena (Italy); Dipartimento Sperimentale Interaziendale, Campus San Lazzaro, University of Modena and Reggio Emilia, 42122 Reggio Emilia (Italy); Pinti, Marcello [Department of Life Sciences, University of Modena and Reggio Emilia, Via Campi 287, 41125 Modena (Italy); Cossarizza, Andrea, E-mail: [Department of Surgery, Medicine, Dentistry and Morphological Sciences, University of Modena and Reggio Emilia School of Medicine, Via Campi 287, 41125 Modena (Italy); Dipartimento Sperimentale Interaziendale, Campus San Lazzaro, University of Modena and Reggio Emilia, 42122 Reggio Emilia (Italy)


    Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

  11. Different origin of adipogenic stem cells influences the response to antiretroviral drugs

    International Nuclear Information System (INIS)

    Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina; Polo, Miriam; De Pol, Anto; Pinti, Marcello; Cossarizza, Andrea


    Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

  12. HIV-1 drug resistance surveillance in antiretroviral treatment-naive individuals from a reference hospital in Guatemala, 2010-2013. (United States)

    Avila-Ríos, Santiago; García-Morales, Claudia; Garrido-Rodríguez, Daniela; Tapia-Trejo, Daniela; Girón-Callejas, Amalia Carolina; Mendizábal-Burastero, Ricardo; Escobar-Urias, Ingrid Yessenia; García-González, Blanca Leticia; Navas-Castillo, Sabrina; Pinzón-Meza, Rodolfo; Mejía-Villatoro, Carlos Rodolfo; Reyes-Terán, Gustavo


    The recent expansion of antiretroviral treatment (ART) coverage in middle/low-income countries has been associated with increasing prevalence of HIV pre-ART drug resistance (PDR). We assessed PDR prevalence, patterns, and trends in Guatemala. Blood samples from 1,084 ART-naive individuals, enrolled from October 2010 to December 2013 at the Roosevelt Hospital in Guatemala City, were obtained. PDR was evaluated using the WHO mutation list for transmitted drug resistance (TDR) surveillance. An overall PDR prevalence of 7.3% (95% CI 5.8-9.0%) was observed for the whole study period. TDR to nonnucleoside reverse transcriptase inhibitors (NNRTI) was the highest (4.9%, p500 and 350-500 CD4(+) T cells/μl (7.4% and 8.7%, respectively) compared to individuals with Guatemala remains at an intermediate level. Nevertheless, we have shown evidence suggesting increasing trends in NNRTI PDR, which need to be taken into account in national HIV management policies.

  13. Prevalence of oral soft tissue lesions in HIV-infected minority children treated with highly active antiretroviral therapies. (United States)

    Flanagan, M A; Barasch, A; Koenigsberg, S R; Fine, D; Houpt, M


    This project studied the prevalence of oral soft tissue disease in HIV-infected children treated with highly active antiretroviral therapy (HAART). Thirty-eight HIV-infected children participated in the study. Twenty-three of these patients were treated with HAART while 14 received exclusively reverse transcriptase inhibitors (RTI) and served as controls. The children were examined three times at approximately one-month intervals while their health history and laboratory data were abstracted from medical charts. Analyses were performed to determine differences in lesion prevalence between treatment groups as well as between lesion and no lesion groups with regard to immune differences. Thirty patients (79%) had oral lesions detected in at least one visit. There were no differences in specific lesion prevalence between HAART compared with RTI-treated children. However, a trend for more oral candidiasis in the latter group was observed. Subjects with oral soft tissue lesions had lower CD4 counts (P = 0.04) and percentage (P = 0.01) but similar viral loads when compared to patients without oral soft tissue disease. HAART does not appear to significantly affect oral soft tissue disease prevalence in HIV-infected children. Presence of lesions was associated with decreased immunity and may signal advancing disease.

  14. Does first line antiretroviral therapy increase the prevalence of cardiovascular risk factors in Indian patients?: A cross sectional study. (United States)

    Carey, R A B; Rupali, P; Abraham, O C; Kattula, D


    Antiretroviral therapy (ART) is associated with a myriad of metabolic complications which are potential cardiovascular risk factors. Early detection of these risk factors could help in alleviating morbidity and mortality in human immunodeficiency virus (HIV) infected patients on ART. To study the prevalence of cardiovascular risk factors in patients on a combination of nucleoside reverse transcriptase inhibitors (NRTIs) and non-NRTIs (NNRTIs) - the standard combination first line ART regimen used in tertiary referral center. The prevalence of cardiovascular risk factors in HIV infected subjects with stage 1t disease on standard first line ART for at least 1 year, HIV infected subjects with stage 1 disease and not on ART and HIV negative subjects was assessed. The study was a cross-sectional study design. Basic demographic data was collected and patients were examined for anthropometric data and blood was collected for analysis of blood glucose, serum lipids, and fasting insulin levels. Chi-square test was used to calculate significance. Statistical Package for Social Sciences (SPSS) software version 16.0 was used for data analysis. The prevalence of hypercholesterolemia and hypertriglyceridemia was higher in the patients on ART when compared to patients not on ART (PART and those not on ART. First line ART is associated with increased prevalence of dyslipidemia. Early detection and treatment of dyslipidemia should help in reducing the cardiovascular morbidity in patients on ART.

  15. Vitamin A and beta-carotene concentrations in adults with HIV/AIDS on highly active antiretroviral therapy. (United States)

    Kaio, Daniella Junko; Rondó, Patricia Helen Carvalho; Souza, José Maria Pacheco; Firmino, Aline Vale; Luzia, Liania Alves; Segurado, Aluisio Augusto


    Micronutrient deficiency is a common condition in HIV-infected individuals and may occur in all stages of the disease. The objective of this cross-sectional study was to compare the concentrations of vitamin A and beta-carotene, micronutrients related to immunity and oxidative stress, in 182 adults with HIV/AIDS, under different highly active antiretroviral therapy (HAART) regimens. Patients were divided into 3 groups according to their HAART regimen: combination of nucleoside analog reverse transcriptase inhibitors (NRTIs) and non-NRTIs; combination of NRTIs, protease inhibitors, and ritonavir; combination of NRTIs and other classes. Multiple linear regression analysis determined the effect of the treatment regimen, time of use, and compliance with the regimen, on vitamin A and beta-carotene concentrations, controlling for the following variables: gender, age, educational level, smoking, physical activity, body mass index, time of infection with HIV, presence of comorbidities, CD4(+) T lymphocyte count, total cholesterol and fractions, and triglyceride levels. There was no significant difference in vitamin A or beta-carotene concentrations in patients under the different HAART regimens. However, approximately 4% of the patients had deficient/low concentrations of vitamin A (<0.70 μmol/L), and 98% showed concentrations of beta-carotene <1.0 μmol/L. In conclusion, HIV/AIDS patients in this region will not benefit from vitamin A supplementation, independently of the HAART regimen utilized, but beta-carotene may be of importance, considering its antioxidant effect.

  16. Class of Antiretroviral Drugs and the Risk of Myocardial Infarction

    DEFF Research Database (Denmark)

    Friis-Møller, Nina; Reiss, P.; Sabin, C.A.


    of myocardial infarction, which is partly explained by dyslipidemia. We found no evidence of such an association for nonnucleoside reverse-transcriptase inhibitors; however, the number of person-years of observation for exposure to this class of drug was less than that for exposure to protease inhibitors...

  17. A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus

    Directory of Open Access Journals (Sweden)

    Crumpacker Clyde S


    Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus

  18. Emergence of Lamivudine-Resistant HBV during Antiretroviral Therapy Including Lamivudine for Patients Coinfected with HIV and HBV in China (United States)

    Li, Yijia; Zhu, Ting; Song, Xiaojing; Huang, Ying; Yang, Feifei; Guan, Shuo; Xie, Jing; Gohda, Jin; Hosoya, Noriaki; Kawana-Tachikawa, Ai; Liu, Wenjun; Gao, George Fu; Iwamoto, Aikichi; Li, Taisheng; Ishida, Takaomi


    In China, HIV-1-infected patients typically receive antiretroviral therapy (ART) that includes lamivudine (3TC) as a reverse-transcriptase inhibitor (RTI) (ART-3TC). Previous studies from certain developed countries have shown that, in ART-3TC, 3TC-resistant HBV progressively emerges at an annual rate of 15–20% in patients coinfected with HIV-1 and HBV. This scenario in China warrants investigation because >10% of all HIV-infected patients in China are HBV carriers. We measured the occurrence of 3TC-resistant HBV during ART-3TC for HIV-HBV coinfection and also tested the effect of tenofovir disoproxil fumarate (TDF) used as an additional RTI (ART-3TC/TDF) in a cohort study in China. We obtained 200 plasma samples collected from 50 Chinese patients coinfected with HIV-1 and HBV (positive for hepatitis B surface antigen) and examined them for the prevalence of 3TC-resistant HBV by directly sequencing PCR products that covered the HBV reverse-transcriptase gene. We divided the patients into ART-3TC and ART-3TC/TDF groups and compared the efficacy of treatment and incidence of drug-resistance mutation between the groups. HIV RNA and HBV DNA loads drastically decreased in both ART-3TC and ART-3TC/TDF groups. In the ART-3TC group, HBV breakthrough or insufficient suppression of HBV DNA loads was observed in 20% (10/50) of the patients after 96-week treatment, and 8 of these patients harbored 3TC-resistant mutants. By contrast, neither HBV breakthrough nor treatment failure was recorded in the ART-3TC/TDF group. All of the 3TC-resistant HBV mutants emerged from the cases in which HBV DNA loads were high at baseline. Our results clearly demonstrated that ART-3TC is associated with the emergence of 3TC-resistant HBV in patients coinfected with HIV-1 and HBV and that ART-3TC/TDF reduces HBV DNA loads to an undetectable level. These findings support the use of TDF-based treatment regimens for patients coinfected with HIV-1 and HBV. PMID:26288093

  19. Nevirapine and efavirenz elicit different changes in lipid profiles in antiretroviral-therapy-naive patients infected with HIV-1.

    Directory of Open Access Journals (Sweden)

    Frank van Leth


    Full Text Available BACKGROUND: Patients infected with HIV-1 initiating antiretroviral therapy (ART containing a non-nucleoside reverse transcriptase inhibitor (NNRTI show presumably fewer atherogenic lipid changes than those initiating most ARTs containing a protease inhibitor. We analysed whether lipid changes differed between the two most commonly used NNRTIs, nevirapine (NVP and efavirenz (EFV. METHODS AND FINDINGS: Prospective analysis of lipids and lipoproteins was performed in patients enrolled in the NVP and EFV treatment groups of the 2NN study who remained on allocated treatment during 48 wk of follow-up. Patients were allocated to NVP (n = 417, or EFV (n = 289 in combination with stavudine and lamivudine. The primary endpoint was percentage change over 48 wk in high-density lipoprotein cholesterol (HDL-c, total cholesterol (TC, TC:HDL-c ratio, non-HDL-c, low-density lipoprotein cholesterol, and triglycerides. The increase of HDL-c was significantly larger for patients receiving NVP (42.5% than for patients receiving EFV (33.7%; p = 0.036, while the increase in TC was lower (26.9% and 31.1%, respectively; p = 0.073, resulting in a decrease of the TC:HDL-c ratio for patients receiving NVP (-4.1% and an increase for patients receiving EFV (+5.9%; p < 0.001. The increase of non-HDL-c was smaller for patients receiving NVP (24.7% than for patients receiving EFV (33.6%; p = 0.007, as were the increases of triglycerides (20.1% and 49.0%, respectively; p < 0.001 and low-density lipoprotein cholesterol (35.0% and 40.0%, respectively; p = 0.378. These differences remained, or even increased, after adjusting for changes in HIV-1 RNA and CD4+ cell levels, indicating an effect of the drugs on lipids over and above that which may be explained by suppression of HIV-1 infection. The increases in HDL-c were of the same order of magnitude as those seen with the use of the investigational HDL-c-increasing drugs. CONCLUSION: NVP-containing ART shows larger increases in HDL

  20. [GeSIDA/National AIDS Plan: Consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (Updated January 2014)]. (United States)


    This consensus document is an update of combined antiretroviral therapy (cART) guidelines for HIV-1 infected adult patients. To formulate these recommendations a panel composed of members of the Grupo de Estudio de Sida and the Plan Nacional sobre el Sida reviewed the efficacy and safety advances in clinical trials, cohort and pharmacokinetic studies published in medical journals (PubMed and Embase) or presented in medical scientific meetings. Recommendations strength and the evidence in which they are supported are based on modified criteria of the Infectious Diseases Society of America. In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with the clinical circumstances: CDC stage B or C disease (A-I), asymptomatic patients (depending on the CD4+ T-lymphocyte count: 500 cells/μL, B-III), comorbid conditions (HIV nephropathy, chronic hepatitis caused by HBV or HCV, age >55years, high cardiovascular risk, neurocognitive disorders, and cancer, A-II), and prevention of transmission of HIV (mother-to-child or heterosexual, A-I; men who have sex with men, A-III). The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). Some of the possible initial regimens have been considered alternatives. This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure where rescue ART should comprise 2 or 3 drugs that are fully active against the virus. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid


    Directory of Open Access Journals (Sweden)

    Kannan V. P


    Full Text Available BACKGROUND The number of people infected with the Human Immunodeficiency Virus (HIV worldwide was estimated to be 33.2 million at the end of 2007. The introduction of Anti-Retroviral Therapy (ART has significantly reduced morbidity and mortality in HIVinfected patients in various developed and developing countries. However, the outcome of ART in India’s National ART Programme has not been reported in detail. The aim of the study is to- 1. Evaluate the immunological response of HIV infected adults starting Highly Active Antiretroviral Therapy (HAART. 2. Evaluate the clinical response of highly active antiretroviral therapy in HIV infected adults. 3. Assess the functional status improvement following highly active antiretroviral therapy. MATERIALS AND METHODS To evaluate the effectiveness of the National ART Programme at Thanjavur Medical College Hospital, we undertook a prospective observational study involving ART naive patients who were started on ART between May 2015 and October 2016. ART was offered to these patients in accordance with NACO guidelines. The regimen consisted of two nucleoside reverse transcriptase inhibitors and one non-nucleoside reverse transcriptase inhibitor. The available drugs included efavirenz, lamivudine, nevirapine and zidovudine. The CD4+ lymphocyte (CD4 count (cells/µL was estimated at baseline and at six months intervals during follow-up. Prophylaxis and treatment of opportunistic infections were in accordance with NACO guidelines. Anti-tuberculosis treatment was administered according to the Revised National Tuberculosis Control Programme guidelines. RESULTS Among 203 patients started on ART in this study, 3 died after completing 6 months of therapy and 17 died within 6 months of therapy. Out of the remaining 183 patients, 104 were males and 79 were females. The predominant route of HIV transmission is through unsafe sexual practice, which accounts for 84% of cases. Incidence of HIV is less common in literate

  2. Surveillance of transmitted antiretroviral drug resistance among HIV-1 infected women attending antenatal clinics in Chitungwiza, Zimbabwe.

    Directory of Open Access Journals (Sweden)

    Mqondisi Tshabalala

    Full Text Available The rapid scale-up of highly active antiretroviral therapy (HAART and use of single dose Nevirapine (SD NVP for prevention of mother-to-child transmission (pMTCT have raised fears about the emergence of resistance to the first line antiretroviral drug regimens. A cross-sectional study was conducted to determine the prevalence of primary drug resistance (PDR in a cohort of young (<25 yrs HAART-naïve HIV pregnant women attending antenatal clinics in Chitungwiza, Zimbabwe. Whole blood was collected in EDTA for CD4 counts, viral load, serological estimation of duration of infection using the BED Calypte assay and genotyping for drug resistance. Four hundred and seventy-one women, mean age 21 years; SD: 2.1 were enrolled into the study between 2006 and 2007. Their median CD4 count was 371cells/µL; IQR: 255-511 cells/µL. Two hundred and thirty-six samples were genotyped for drug resistance. Based on the BED assay, 27% were recently infected (RI whilst 73% had long-term infection (LTI. Median CD4 count was higher (p<0.05 in RI than in women with LTI. Only 2 women had drug resistance mutations; protease I85V and reverse transcriptase Y181C. Prevalence of PDR in Chitungwiza, 4 years after commencement of the national ART program remained below WHO threshold limit (5%. Frequency of recent infection BED testing is consistent with high HIV acquisition during pregnancy. With the scale-up of long-term ART programs, maintenance of proper prescribing practices, continuous monitoring of patients and reinforcement of adherence may prevent the acquisition and transmission of PDR.

  3. Potential pharmacokinetic interactions between antiretrovirals and medicinal plants used as complementary and African traditional medicines. (United States)

    Müller, Adrienne C; Kanfer, Isadore


    The use of traditional/complementary/alternate medicines (TCAMs) in HIV/AIDS patients who reside in Southern Africa is quite common. Those who use TCAMs in addition to antiretroviral (ARV) treatment may be at risk of experiencing clinically significant pharmacokinetic (PK) interactions, particularly between the TCAMs and the protease inhibitors (PIs) and non-nucleoside reverse transcriptase inhibitors (NNRTIs). Mechanisms of PK interactions include alterations to the normal functioning of drug efflux transporters, such as P-gp and/or CYP isoenzymes, such a CYP3A4 that mediate the absorption and elimination of drugs in the small intestine and liver. Specific mechanisms include inhibition and activation of these proteins and induction via the pregnane X receptor (PXR). Several clinical studies and case reports involving ARV-herb PK interactions have been reported. St John's Wort, Garlic and Cat's Claw exhibited potentially significant interactions, each with a PI or NNRTI. The potential for these herbs to induce PK interactions with drugs was first identified in reports of in vitro studies. Other in vitro studies have shown that several African traditional medicinal (ATM) plants and extracts may also demonstrate PK interactions with ARVs, through effects on CYP3A4, P-gp and PXR. The most complex effects were exhibited by Hypoxis hemerocallidea, Sutherlandia frutescens, Cyphostemma hildebrandtii, Acacia nilotica, Agauria salicifolia and Elaeodendron buchananii. Despite a high incidence of HIV/AIDs in the African region, only one clinical study, between efavirenz and Hypoxis hemerocallidea has been conducted. However, several issues/concerns still remain to be addressed and thus more studies on ATMs are warranted in order for more meaningful data to be generated and the true potential for such interactions to be determined. Copyright © 2011 John Wiley & Sons, Ltd.

  4. High rate of virologic suppression with darunavir/ritonavir plus optimized background therapy among highly antiretroviral-experienced HIV-infected patients: results of a prospective cohort study in São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    José Ernesto Vidal

    Full Text Available OBJECTIVES: To assess the virologic and immunological response of darunavir/ritonavir plus optimized background therapy in highly antiretroviral-experienced HIV-infected patients in Brazil. METHODS: Prospective cohort study carried out in a tertiary center in Sao Paulo, Brazil. Three-class antiretroviral-experienced patients with confirmed virologic failure began darunavir/ritonavir plus optimized background therapy (nucleoside/tide reverse transcriptase inhibitors ± raltegravir ± enfuvirtide ± maraviroc after performing a genotypic resistance assay. Clinical evaluation and laboratory tests were collected at baseline and at weeks 12, 24, and 48. Multivariate analysis was performed to identify predictors of virologic response at 48 weeks. RESULTS: Ninety-two patients were included. The median of darunavir resistant mutation was 1 (range 0-6. The median genotypic sensitivity score in the optimized background therapy was 2 (interquartile range 1-2. At week 48, 83% (95% CI: 75-90% had an HIV RNA level 100 000 copies/mL was inversely associated with virologic success at week 48 (HR: 0.22, 95% CI: 0.06-0.85, p = 0.028. CONCLUSIONS: Darunavir/ritonavir plus optimized background therapy was a highly effective salvage regimen under clinical routine conditions in a referral center in Brazil, which is similar to the reported in high-income countries.

  5. High rate of virologic suppression with darunavir/ritonavir plus optimized background therapy among highly antiretroviral-experienced HIV-infected patients: results of a prospective cohort study in São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    José Ernesto Vidal


    Full Text Available OBJECTIVES: To assess the virologic and immunological response of darunavir/ritonavir plus optimized background therapy in highly antiretroviral-experienced HIV-infected patients in Brazil. METHODS: Prospective cohort study carried out in a tertiary center in Sao Paulo, Brazil. Three-class antiretroviral-experienced patients with confirmed virologic failure began darunavir/ritonavir plus optimized background therapy (nucleoside/tide reverse transcriptase inhibitors ± raltegravir ± enfuvirtide ± maraviroc after performing a genotypic resistance assay. Clinical evaluation and laboratory tests were collected at baseline and at weeks 12, 24, and 48. Multivariate analysis was performed to identify predictors of virologic response at 48 weeks. RESULTS: Ninety-two patients were included. The median of darunavir resistant mutation was 1 (range 0-6. The median genotypic sensitivity score in the optimized background therapy was 2 (interquartile range 1-2. At week 48, 83% (95% CI: 75-90% had an HIV RNA level 100 000 copies/mL was inversely associated with virologic success at week 48 (HR: 0.22, 95% CI: 0.06-0.85, p = 0.028. CONCLUSIONS: Darunavir/ritonavir plus optimized background therapy was a highly effective salvage regimen under clinical routine conditions in a referral center in Brazil, which is similar to the reported in high-income countries.

  6. Calculation of direct antiretroviral treatment costs and potential cost savings by using generics in the German HIV ClinSurv cohort.

    Directory of Open Access Journals (Sweden)

    Matthias Stoll

    Full Text Available UNLABELLED: BACKGROUND/AIM OF THE STUDY: The study aimed to determine the cost impacts of antiretroviral drugs by analysing a long-term follow-up of direct costs for combined antiretroviral therapy, cART, -regimens in the nationwide long-term observational multi-centre German HIV ClinSurv Cohort. The second aim was to develop potential cost saving strategies by modelling different treatment scenarios. METHODS: Antiretroviral regimens (ART from 10,190 HIV-infected patients from 11 participating ClinSurv study centres have been investigated since 1996. Biannual data cART-initiation, cART-changes, surrogate markers, clinical events and the Centre of Disease Control- (CDC-stage of HIV disease are reported. Treatment duration was calculated on a daily basis via the documented dates for the beginning and end of each antiretroviral drug treatment. Prices were calculated for each individual regimen based on actual office sales prices of the branded pharmaceuticals distributed by the license holder including German taxes. RESULTS: During the 13-year follow-up period, 21,387,427 treatment days were covered. Cumulative direct costs for antiretroviral drugs of €812,877,356 were determined according to an average of €42.08 per day (€7.52 to € 217.70. Since cART is widely used in Germany, the costs for an entire regimen increased by 13.5%. Regimens are more expensive in the advanced stages of HIV disease. The potential for cost savings was calculated using non-nucleotide-reverse-transcriptase-inhibitor, NNRTI, more frequently instead of ritonavir-boosted protease inhibitor, PI/r, in first line therapy. This calculation revealed cumulative savings of 10.9% to 19.8% of daily treatment costs (50% and 90% substitution of PI/r, respectively. Substituting certain branded drugs by generic drugs showed potential cost savings of between 1.6% and 31.8%. CONCLUSIONS: Analysis of the data of this nationwide study reflects disease-specific health services research

  7. Calculation of direct antiretroviral treatment costs and potential cost savings by using generics in the German HIV ClinSurv cohort. (United States)

    Stoll, Matthias; Kollan, Christian; Bergmann, Frank; Bogner, Johannes; Faetkenheuer, Gerd; Fritzsche, Carlos; Hoeper, Kirsten; Horst, Heinz-August; van Lunzen, Jan; Plettenberg, Andreas; Reuter, Stefan; Rockstroh, Jürgen; Stellbrink, Hans-Jürgen; Hamouda, Osamah; Bartmeyer, Barbara


    BACKGROUND/AIM OF THE STUDY: The study aimed to determine the cost impacts of antiretroviral drugs by analysing a long-term follow-up of direct costs for combined antiretroviral therapy, cART, -regimens in the nationwide long-term observational multi-centre German HIV ClinSurv Cohort. The second aim was to develop potential cost saving strategies by modelling different treatment scenarios. Antiretroviral regimens (ART) from 10,190 HIV-infected patients from 11 participating ClinSurv study centres have been investigated since 1996. Biannual data cART-initiation, cART-changes, surrogate markers, clinical events and the Centre of Disease Control- (CDC)-stage of HIV disease are reported. Treatment duration was calculated on a daily basis via the documented dates for the beginning and end of each antiretroviral drug treatment. Prices were calculated for each individual regimen based on actual office sales prices of the branded pharmaceuticals distributed by the license holder including German taxes. During the 13-year follow-up period, 21,387,427 treatment days were covered. Cumulative direct costs for antiretroviral drugs of €812,877,356 were determined according to an average of €42.08 per day (€7.52 to € 217.70). Since cART is widely used in Germany, the costs for an entire regimen increased by 13.5%. Regimens are more expensive in the advanced stages of HIV disease. The potential for cost savings was calculated using non-nucleotide-reverse-transcriptase-inhibitor, NNRTI, more frequently instead of ritonavir-boosted protease inhibitor, PI/r, in first line therapy. This calculation revealed cumulative savings of 10.9% to 19.8% of daily treatment costs (50% and 90% substitution of PI/r, respectively). Substituting certain branded drugs by generic drugs showed potential cost savings of between 1.6% and 31.8%. Analysis of the data of this nationwide study reflects disease-specific health services research and will give insights into the cost impacts of

  8. High-levels of acquired drug resistance in adult patients failing first-line antiretroviral therapy in a rural HIV treatment programme in KwaZulu-Natal, South Africa.

    Directory of Open Access Journals (Sweden)

    Justen Manasa

    Full Text Available To determine the frequency and patterns of acquired antiretroviral drug resistance in a rural primary health care programme in South Africa.Cross-sectional study nested within HIV treatment programme.Adult (≥ 18 years HIV-infected individuals initially treated with a first-line stavudine- or zidovudine-based antiretroviral therapy (ART regimen and with evidence of virological failure (one viral load >1000 copies/ml were enrolled from 17 rural primary health care clinics. Genotypic resistance testing was performed using the in-house SATuRN/Life Technologies system. Sequences were analysed and genotypic susceptibility scores (GSS for standard second-line regimens were calculated using the Stanford HIVDB 6.0.5 algorithms.A total of 222 adults were successfully genotyped for HIV drug resistance between December 2010 and March 2012. The most common regimens at time of genotype were stavudine, lamivudine and efavirenz (51%; and stavudine, lamivudine and nevirapine (24%. Median duration of ART was 42 months (interquartile range (IQR 32-53 and median duration of antiretroviral failure was 27 months (IQR 17-40. One hundred and ninety one (86% had at least one drug resistance mutation. For 34 individuals (15%, the GSS for the standard second-line regimen was <2, suggesting a significantly compromised regimen. In univariate analysis, individuals with a prior nucleoside reverse-transcriptase inhibitor (NRTI substitution were more likely to have a GSS <2 than those on the same NRTIs throughout (odds ratio (OR 5.70, 95% confidence interval (CI 2.60-12.49.There are high levels of drug resistance in adults with failure of first-line antiretroviral therapy in this rural primary health care programme. Standard second-line regimens could potentially have had reduced efficacy in about one in seven adults involved.

  9. Genotypic Characterization of Human Immunodeficiency Virus Type 1 Derived from Antiretroviral Drug-Treated Individuals Residing in Earthquake-Affected Areas in Nepal. (United States)

    Negi, Bharat Singh; Kotaki, Tomohiro; Joshi, Sunil Kumar; Bastola, Anup; Nakazawa, Minato; Kameoka, Masanori


    Molecular epidemiological data on human immunodeficiency virus type 1 (HIV-1) are limited in Nepal and have not been available in areas affected by the April 2015 earthquake. Therefore, we conducted a genotypic study on HIV-1 genes derived from individuals on antiretroviral therapy residing in 14 districts in Nepal highly affected by the earthquake. HIV-1 genomic fragments were amplified from 40 blood samples of HIV treatment-failure individuals, and a sequencing analysis was performed on these genes. In the 40 samples, 29 protease, 32 reverse transcriptase, 25 gag, and 21 env genes were sequenced. HIV-1 subtyping revealed that subtype C (84.2%, 32/38) was the major subtype prevalent in the region, while CRF01_AE (7.9%, 3/38) and other recombinant forms (7.9%, 3/38) were also detected. In addition, major drug resistance mutations were identified in 21.9% (7/32) of samples, indicating the possible emergence of HIV-1 drug resistance in earthquake-affected areas in Nepal.

  10. Executive summary of the GESIDA/National AIDS Plan Consensus Document on Antiretroviral Therapy in Adults Infected by the Human Immunodeficiency Virus (Updated January 2017). (United States)


    Antiretroviral therapy (ART) is recommended for all patients infected by HIV-1. The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should be based on a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors (tenofovir in either of its two formulations plus emtricitabine or abacavir plus lamivudine) and another drug from a different family. Four of the recommended regimens, all of which have an integrase inhibitor as the third drug (dolutegravir, elvitegravir boosted with cobicistat or raltegravir), are considered preferential, whereas a further 3 regimens (based on elvitegravir/cobicistat, rilpivirine, or darunavir boosted with cobicistat or ritonavir) are considered alternatives. We present the reasons and criteria for switching ART in patients with an undetectable PVL and in those who present virological failure, in which case salvage ART should include 3 (or at least 2) drugs that are fully active against HIV. We also update the criteria for ART in specific situations (acute infection, HIV-2 infection, pregnancy) and comorbidities (tuberculosis or other opportunistic infections, kidney disease, liver disease and cancer). Copyright © 2017. Publicado por Elsevier España, S.L.U.

  11. Artemether-Lumefantrine Combination Therapy for Treatment of Uncomplicated Malaria: The Potential for Complex Interactions with Antiretroviral Drugs in HIV-Infected Individuals

    Directory of Open Access Journals (Sweden)

    Pauline Byakika-Kibwika


    Full Text Available Treatment of malaria in HIV-infected individuals receiving antiretroviral therapy (ART poses significant challenges. Artemether-lumefantrine (AL is one of the artemisisnin-based combination therapies recommended for treatment of malaria. The drug combination is highly efficacious against sensitive and multidrug resistant falciparum malaria. Both artemether and lumefantrine are metabolized by hepatic cytochrome P450 (CYP450 enzymes which metabolize the protease inhibitors (PIs and nonnucleoside reverse transcriptase inhibitors (NNRTIs used for HIV treatment. Coadministration of NNRTIs and PIs with AL could potentially cause complex pharmacokinetic drug interactions. NNRTI by inducing CYP450 3A4 enzyme and PIs by inhibiting CYP450 3A4 enzymes could influence both artemether and lumefantrine concentrations and their active metabolites dihydroartemisinin and desbutyl-lumefantrine, predisposing patients to poor treatment response, toxicity, and risk for development of resistance. There are scanty data on these interactions and their consequences. Pharmacokinetic studies to evaluate these interactions in the target populations are urgently needed.

  12. The development and validation of an UHPLC-MS/MS method for the rapid quantification of the antiretroviral agent dapivirine in human plasma. (United States)

    Seserko, Lauren A; Emory, Joshua F; Hendrix, Craig W; Marzinke, Mark A


    Dapivirine is a non-nucleoside reverse transcriptase inhibitor designed to prevent HIV-1 viral replication and subsequent propagation. A sensitive method is required to quantify plasma concentrations to assess drug efficacy. Dapivirine-spiked plasma was combined with acetonitrile containing deuterated IS and was processed for analysis. The method has an analytical measuring range from 20 to 10,000 pg/ml. For the LLOQ, low, mid and high QCs, intra- and inter-assay precision (%CV) ranged from 5.58 to 13.89% and 5.23 to 13.36%, respectively, and intra- and inter-day accuracy (% deviation) ranged from -5.61 to 0.75% and -4.30 to 6.24%, respectively. A robust and sensitive LC-MS/MS assay for the high-throughput quantification of the antiretroviral drug dapivirine in human plasma was developed and validated following bioanalytical validation guidelines. The assay meets criteria for the analysis of samples from large research trials.

  13. The development and validation of an UHPLC–MS/MS method for the rapid quantification of the antiretroviral agent dapivirine in human plasma (United States)

    Seserko, Lauren A; Emory, Joshua F; Hendrix, Craig W; Marzinke, Mark A


    Background Dapivirine is a non-nucleoside reverse transcriptase inhibitor designed to prevent HIV-1 viral replication and subsequent propagation. A sensitive method is required to quantify plasma concentrations to assess drug efficacy. Results Dapivirine-spiked plasma was combined with acetonitrile containing deuterated IS and was processed for analysis. The method has an analytical measuring range from 20 to 10,000 pg/ml. For the LLOQ, low, mid and high QCs, intra- and inter-assay precision (%CV) ranged from 5.58 to 13.89% and 5.23 to 13.36%, respectively, and intra- and inter-day accuracy (% deviation) ranged from -5.61 to 0.75% and -4.30 to 6.24%, respectively. Conclusion A robust and sensitive LC–MS/MS assay for the high-throughput quantification of the antiretroviral drug dapivirine in human plasma was developed and validated following bioanalytical validation guidelines. The assay meets criteria for the analysis of samples from large research trials. PMID:24256358

  14. Characterizing Class-Specific Exposure-Viral Load Suppression Response of HIV Antiretrovirals Using A Model-Based Meta-Analysis. (United States)

    Xu, Y; Li, Y F; Zhang, D; Dockendorf, M; Tetteh, E; Rizk, M L; Grobler, J A; Lai, M-T; Gobburu, J; Ankrom, W


    We applied model-based meta-analysis of viral suppression as a function of drug exposure and in vitro potency for short-term monotherapy in human immunodeficiency virus type 1 (HIV-1)-infected treatment-naïve patients to set pharmacokinetic targets for development of nonnucleoside reverse transcriptase inhibitors (NNRTIs) and integrase strand transfer inhibitors (InSTIs). We developed class-specific models relating viral load kinetics from monotherapy studies to potency normalized steady-state trough plasma concentrations. These models were integrated with a literature assessment of doses which demonstrated to have long-term efficacy in combination therapy, in order to set steady-state trough concentration targets of 6.17- and 2.15-fold above potency for NNRTIs and InSTIs, respectively. Both the models developed and the pharmacokinetic targets derived can be used to guide compound selection during preclinical development and to predict the dose-response of new antiretrovirals to inform early clinical trial design. © 2016 The Authors. Clinical and Translational Science published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.

  15. Characterizing Class‐Specific Exposure‐Viral Load Suppression Response of HIV Antiretrovirals Using A Model‐Based Meta‐Analysis (United States)

    Xu, Y; Li, YF; Zhang, D; Dockendorf, M; Tetteh, E; Rizk, ML; Grobler, JA; Lai, M‐T; Gobburu, J


    We applied model‐based meta‐analysis of viral suppression as a function of drug exposure and in vitro potency for short‐term monotherapy in human immunodeficiency virus type 1 (HIV‐1)‐infected treatment‐naïve patients to set pharmacokinetic targets for development of nonnucleoside reverse transcriptase inhibitors (NNRTIs) and integrase strand transfer inhibitors (InSTIs). We developed class‐specific models relating viral load kinetics from monotherapy studies to potency normalized steady‐state trough plasma concentrations. These models were integrated with a literature assessment of doses which demonstrated to have long‐term efficacy in combination therapy, in order to set steady‐state trough concentration targets of 6.17‐ and 2.15‐fold above potency for NNRTIs and InSTIs, respectively. Both the models developed and the pharmacokinetic targets derived can be used to guide compound selection during preclinical development and to predict the dose–response of new antiretrovirals to inform early clinical trial design. PMID:27171172

  16. High HIV-1 Diversity and Prevalence of Transmitted Drug Resistance Among Antiretroviral-Naive HIV-Infected Pregnant Women from Rio de Janeiro, Brazil. (United States)

    Delatorre, Edson; Silva-de-Jesus, Carlos; Couto-Fernandez, José Carlos; Pilotto, Jose H; Morgado, Mariza G


    Antiretroviral (ARV) resistance mutations in human immunodeficiency virus type 1 (HIV-1) infection may reduce the efficacy of prophylactic therapy to prevent mother-to-child transmission (PMTCT) and future treatment options. This study evaluated the diversity and the prevalence of transmitted drug resistance (TDR) in protease (PR) and reverse transcriptase (RT) regions of HIV-1 pol gene among 87 ARV-naive HIV-1-infected pregnant women from Rio de Janeiro, Brazil, between 2012 and 2015. The viral diversity comprised HIV-1 subtypes B (67.8%), F1 (17.2%), and C (4.6%); the circulating recombinant forms 12_BF (2.3%), 28/29_BF, 39_BF, 02_AG (1.1% each) and unique recombinants forms (4.5%). The overall prevalence of any TDR was 17.2%, of which 5.7% for nucleoside RT inhibitors, 5.7% for non-nucleoside RT inhibitors, and 8% for PR inhibitors. The TDR prevalence found in this population may affect the virological outcome of the standard PMTCT ARV-regimens, reinforcing the importance of continuous monitoring.

  17. Cholelithiasis and Nephrolithiasis in HIV-Positive Patients in the Era of Combination Antiretroviral Therapy.

    Directory of Open Access Journals (Sweden)

    Kuan-Yin Lin

    Full Text Available This study aimed to describe the epidemiology and risk factors of cholelithiasis and nephrolithiasis among HIV-positive patients in the era of combination antiretroviral therapy.We retrospectively reviewed the medical records of HIV-positive patients who underwent routine abdominal sonography for chronic viral hepatitis, fatty liver, or elevated aminotransferases between January 2004 and January 2015. Therapeutic drug monitoring of plasma concentrations of atazanavir was performed and genetic polymorphisms, including UDP-glucuronosyltransferase (UGT 1A1*28 and multidrug resistance gene 1 (MDR1 G2677T/A, were determined in a subgroup of patients who received ritonavir-boosted or unboosted atazanavir-containing combination antiretroviral therapy. Information on demographics, clinical characteristics, and laboratory testing were collected and analyzed.During the 11-year study period, 910 patients who underwent routine abdominal sonography were included for analysis. The patients were mostly male (96.9% with a mean age of 42.2 years and mean body-mass index of 22.9 kg/m2 and 85.8% being on antiretroviral therapy. The anchor antiretroviral agents included non-nucleoside reverse-transcriptase inhibitors (49.3%, unboosted atazanavir (34.4%, ritonavir-boosted lopinavir (20.4%, and ritonavir-boosted atazanavir (5.5%. The overall prevalence of cholelithiasis and nephrolithiasis was 12.5% and 8.2%, respectively. Among 680 antiretroviral-experienced patients with both baseline and follow-up sonography, the crude incidence of cholelithiasis and nephrolithiasis was 4.3% and 3.7%, respectively. In multivariate analysis, the independent factors associated with incident cholelithiasis were exposure to ritonavir-boosted atazanavir for >2 years (adjusted odds ratio [AOR], 6.29; 95% confidence interval [CI], 1.12-35.16 and older age (AOR, 1.04; 95% CI, 1.00-1.09. The positive association between duration of exposure to ritonavir-boosted atazanavir and incident

  18. [GESIDA/National AIDS Plan: Consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (Updated January 2015)]. (United States)


    This consensus document is an update of combined antiretroviral therapy (cART) guidelines and recommendations for HIV-1 infected adult patients. To formulate these recommendations, a panel composed of members of the AIDS Study Group and the AIDS National Plan (GeSIDA/Plan Nacional sobre el Sida) reviewed the efficacy and safety advances in clinical trials, and cohort and pharmacokinetic studies published in medical journals (PubMed and Embase) or presented in medical scientific meetings. The strength of the recommendations, and the evidence that supports them, are based on modified criteria of the Infectious Diseases Society of America. In this update, cART is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and level of the recommendation depends on the CD4+T-lymphocyte count, the presence of opportunistic diseases or comorbid conditions, age, and prevention of transmission of HIV. The objective of cART is to achieve an undetectable plasma viral load. Initial cART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors, and a third drug from a different family. Three out of the ten recommended regimes are regarded as preferential (all of them with an integrase inhibitor as the third drug), and the other seven (based on a non-nucleoside reverse transcriptase inhibitor, a ritonavir-boosted protease inhibitor, or an integrase inhibitor) as alternatives. This update presents the causes and criteria for switching cART in patients with undetectable plasma viral load, and in cases of virological failure where rescue cART should comprise 3 (or at least 2) drugs that are fully active against the virus. An update is also provided for the specific criteria for cART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). These new guidelines

  19. The history of antiretrovirals: key discoveries over the past 25 years. (United States)

    De Clercq, Erik


    Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.

  20. Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India. (United States)

    Satyanarayana, Kanikaram; Srivastava, Sadhana


    The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable

  1. Etravirine combined with antiretrovirals other than darunavir/ritonavir for HIV-1-infected, treatment-experienced adults: Week 48 results of a phase IV trial

    Directory of Open Access Journals (Sweden)

    Eduardo Arathoon


    Full Text Available Objective: VIOLIN (TMC125IFD3002; NCT01422330 evaluated the safety, tolerability, and pharmacokinetics of etravirine with antiretrovirals other than darunavir/ritonavir in HIV-1-infected patients. Methods: In a 48-week, phase IV, single-arm, multicenter study, patients on prior antiretroviral therapy (⩾8 weeks who needed to change regimen for virologic failure (viral load ⩾ 500 copies/mL or simplification/adverse events (viral load < 50 copies/mL received etravirine 200 mg bid with ⩾1 other active antiretroviral, excluding darunavir/ritonavir or only nucleoside/tide reverse transcriptase inhibitors. Results: Of 211 treated patients, 73% (n = 155 had baseline viral load ⩾ 50 copies/mL and 27% (n = 56 had baseline viral load < 50 copies/mL. Protease inhibitors were the most common background antiretrovirals (83%. Diarrhea was the most frequent adverse event (17%. Serious adverse events (no rash occurred in 5% of patients; none were etravirine related. Overall, median etravirine AUC12h was 5390 ng h/mL and C0h was 353 ng/mL (N = 199. Week 48 virologic response rates (viral load < 50 copies/mL; Food and Drug Administration Snapshot algorithm were 48% (74/155 (baseline viral load ⩾ 50 copies/mL and 75% (42/56 (baseline viral load < 50 copies/mL. Virologic failure rates were 42% and 13%, respectively. The most frequently emerging etravirine resistance-associated mutations in virologic failures were Y181C, E138A, and M230L. Virologic response rates for patients with baseline viral load ⩾ 50 copies/mL were 38% (30/79 (non-adherent versus 64% (44/69 (adherent subset. Conclusion: Etravirine 200 mg bid in combination with antiretrovirals other than darunavir/ritonavir was well tolerated in the studied treatment-experienced HIV-1-infected population. The overall etravirine safety and tolerability profile and pharmacokinetics (specifically in those patients who were adherent

  2. Patterns of HIV-1 drug resistance after first-line antiretroviral therapy (ART) failure in 6 sub-Saharan African countries: implications for second-line ART strategies. (United States)

    Hamers, Raph L; Sigaloff, Kim C E; Wensing, Annemarie M; Wallis, Carole L; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S; Rinke de Wit, Tobias F; Schuurman, Rob


    Human immunodeficiency virus type 1 (HIV-1) drug resistance may limit the benefits of antiretroviral therapy (ART). This cohort study examined patterns of drug-resistance mutations (DRMs) in individuals with virological failure on first-line ART at 13 clinical sites in 6 African countries and predicted their impact on second-line drug susceptibility. A total of 2588 antiretroviral-naive individuals initiated ART consisting of different nucleoside reverse transcriptase inhibitor (NRTI) backbones (zidovudine, stavudine, tenofovir, or abacavir, plus lamivudine or emtricitabine) with either efavirenz or nevirapine. Population sequencing after 12 months of ART was retrospectively performed if HIV RNA was >1000 copies/mL. The 2010 International Antiviral Society-USA list was used to score major DRMs. The Stanford algorithm was used to predict drug susceptibility. HIV-1 sequences were generated for 142 participants who virologically failed ART, of whom 70% carried ≥1 DRM and 49% had dual-class resistance, with an average of 2.4 DRMs per sequence (range, 1-8). The most common DRMs were M184V (53.5%), K103N (28.9%), Y181C (15.5%), and G190A (14.1%). Thymidine analogue mutations were present in 8.5%. K65R was frequently selected by stavudine (15.0%) or tenofovir (27.7%). Among participants with ≥1 DRM, HIV-1 susceptibility was reduced in 93% for efavirenz/nevirapine, in 81% for lamivudine/emtricitabine, in 59% for etravirine/rilpivirine, in 27% for tenofovir, in 18% for stavudine, and in 10% for zidovudine. Early failure detection limited the accumulation of resistance. After stavudine failure in African populations, zidovudine rather than tenofovir may be preferred in second-line ART. Strategies to prevent HIV-1 resistance are a global priority.

  3. Effects of treatment with suppressive combination antiretroviral drug therapy and the histone deacetylase inhibitor suberoylanilide hydroxamic acid; (SAHA on SIV-infected Chinese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Binhua Ling

    Full Text Available Viral reservoirs-persistent residual virus despite combination antiretroviral therapy (cART-remain an obstacle to cure of HIV-1 infection. Difficulty studying reservoirs in patients underscores the need for animal models that mimics HIV infected humans on cART. We studied SIV-infected Chinese-origin rhesus macaques (Ch-RM treated with intensive combination antiretroviral therapy (cART and 3 weeks of treatment with the histone deacetyalse inhibitor, suberoylanilide hydroxamic acid (SAHA.SIVmac251 infected Ch-RM received reverse transcriptase inhibitors PMPA and FTC and integrase inhibitor L-870812 beginning 7 weeks post infection. Integrase inhibitor L-900564 and boosted protease inhibitor treatment with Darunavir and Ritonavir were added later. cART was continued for 45 weeks, with daily SAHA administered for the last 3 weeks, followed by euthanasia/necropsy. Plasma viral RNA and cell/tissue-associated SIV gag RNA and DNA were quantified by qRT-PCR/qPCR, with flow cytometry monitoring changes in immune cell populations.Upon cART initiation, plasma viremia declined, remaining <30 SIV RNA copy Eq/ml during cART, with occasional blips. Decreased viral replication was associated with decreased immune activation and partial restoration of intestinal CD4+ T cells. SAHA was well tolerated but did not result in demonstrable treatment-associated changes in plasma or cell associated viral parameters.The ability to achieve and sustain virological suppression makes cART-suppressed, SIV-infected Ch-RM a potentially useful model to evaluate interventions targeting residual virus. However, despite intensive cART over one year, persistent viral DNA and RNA remained in tissues of all three animals. While well tolerated, three weeks of SAHA treatment did not demonstrably impact viral RNA levels in plasma or tissues; perhaps reflecting dosing, sampling and assay limitations.

  4. Unnecessary antiretroviral treatment switches and accumulation of HIV resistance mutations; two arguments for viral load monitoring in Africa. (United States)

    Sigaloff, Kim C E; Hamers, Raph L; Wallis, Carole L; Kityo, Cissy; Siwale, Margaret; Ive, Prudence; Botes, Mariette E; Mandaliya, Kishor; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S; van Vugt, Michèle; de Wit, Tobias F Rinke


    This study aimed to investigate the consequences of using clinicoimmunological criteria to detect antiretroviral treatment (ART) failure and guide regimen switches in HIV-infected adults in sub-Saharan Africa. Frequencies of unnecessary switches, patterns of HIV drug resistance, and risk factors for the accumulation of nucleoside reverse transcriptase inhibitor (NRTI)-associated mutations were evaluated. Cross-sectional analysis of adults switching ART regimens at 13 clinical sites in 6 African countries was performed. Two types of failure identification were compared: diagnosis of clinicoimmunological failure without viral load testing (CIF only) or CIF with local targeted viral load testing (targeted VL). After study enrollment, reference HIV RNA and genotype were determined retrospectively. Logistic regression assessed factors associated with multiple thymidine analogue mutations (TAMs) and NRTI cross-resistance (≥2 TAMs or Q151M or K65R/K70E). Of 250 patients with CIF switching to second-line ART, targeted VL was performed in 186. Unnecessary switch at reference HIV RNA <1000 copies per milliliter occurred in 46.9% of CIF only patients versus 12.4% of patients with targeted VL (P < 0.001). NRTI cross-resistance was observed in 48.0% of 183 specimens available for genotypic analysis, comprising ≥2 TAMs (37.7%), K65R (7.1%), K70E (3.3%), or Q151M (3.3%). The presence of NRTI cross-resistance was associated with the duration of ART exposure and zidovudine use. Clinicoimmunological monitoring without viral load testing resulted in frequent unnecessary regimen switches. Prolonged treatment failure was indicated by extensive NRTI cross-resistance. Access to virological monitoring should be expanded to prevent inappropriate switches, enable early failure detection and preserve second-line treatment options in Africa.

  5. Neutralizing antibody and anti-retroviral drug sensitivities of HIV-1 isolates resistant to small molecule CCR5 inhibitors

    International Nuclear Information System (INIS)

    Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.


    The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo

  6. Clinical outcomes of first-line antiretroviral therapy in Latin America: analysis from the LATINA retrospective cohort study. (United States)

    Angriman, Federico; Belloso, Waldo H; Sierra-Madero, Juan; Sánchez, Jorge; Moreira, Ronaldo Ismerio; Kovalevski, Leandro O; Orellana, Liliana C; Cardoso, Sandra Wagner; Crabtree-Ramirez, Brenda; La Rosa, Alberto; Losso, Marcelo H


    Nearly 2 million people are infected with human immunodeficiency virus (HIV) in Latin America. However, information regarding population-scale outcomes from a regional perspective is scarce. We aimed to describe the baseline characteristics and therapeutic outcomes of newly-treated individuals with HIV infection in Latin America. A Retrospective cohort study was undertaken. The primary explanatory variable was combination antiretroviral therapy based on either a protease inhibitor (PI) or a non-nucleoside reverse transcriptase inhibitor (NNRTI). The main outcome was defined as the composite of all-cause mortality and the occurrence of an AIDS-defining clinical event or a serious non-AIDS-defining event during the first year of therapy. The secondary outcomes included the time to a change in treatment strategy. All analyses were performed according to the intention to treat principle. A total of 937 treatment-naive patients from four participating countries were included (228 patients with PI therapy and 709 with NNRTI-based treatment). At the time of treatment initiation, the patients had a mean age of 37 (SD: 10) years and a median CD4 + T-cell count of 133 cells/mm(3) (interquartile range: 47.5-216.0). Patients receiving PI-based regimens had a significantly lower CD4 + count, a higher AIDS prevalence at baseline and a shorter time from HIV diagnosis until the initiation of treatment. There was no difference in the hazard ratio for the primary outcome between groups. The only covariates associated with the latter were CD4 + cell count at baseline, study site and age. The estimated hazard ratio for the time to a change in treatment (NNRTI vs PI) was 0.61 (95% CI 0.47-0.80, p America present with similar clinical outcomes regardless of the choice of initial therapy. Patients treated with PIs are more likely to require a treatment change during the first year of follow up. © The Author(s) 2015.

  7. Characterization of HIV-1 antiretroviral drug resistance after second-line treatment failure in Mali, a limited-resources setting (United States)

    Maiga, Almoustapha Issiaka; Fofana, Djeneba Bocar; Cisse, Mamadou; Diallo, Fodié; Maiga, Moussa Youssoufa; Traore, Hamar Alassane; Maiga, Issouf Alassane; Sylla, Aliou; Fofana, Dionke; Taiwo, Babafemi; Murphy, Robert; Katlama, Christine; Tounkara, Anatole; Calvez, Vincent; Marcelin, Anne-Geneviève


    Objectives We describe the outcomes of second-line drug resistance profiles and predict the efficacy of drugs for third-line therapy in patients monitored without the benefit of plasma HIV-1 RNA viral load (VL) or resistance testing. Methods We recruited 106 HIV-1-infected patients after second-line treatment failure in Mali. VL was determined by the Abbott RealTime system and the resistance by the ViroSeq HIV-1 genotyping system. The resistance testing was interpreted using the latest version of the Stanford algorithm. Results Among the 106 patients, 93 had isolates successfully sequenced. The median age, VL and CD4 cells were respectively 35 years, 72 000 copies/mL and 146 cells/mm3. Patients were exposed to a median of 4 years of treatment and to six antiretrovirals. We found 20% of wild-type viruses. Resistance to etravirine was noted in 38%, to lopinavir in 25% and to darunavir in 12%. The duration of prior nucleos(t)ide reverse transcriptase inhibitor exposure was associated with resistance to abacavir (P < 0.0001) and tenofovir (P = 0.0001), and duration of prior protease inhibitor treatment with resistance to lopinavir (P < 0.0001) and darunavir (P = 0.06). Conclusion Long duration of therapy prior to failure was associated with high levels of resistance and is directly related to limited access to VL monitoring and delayed switches to second-line treatment, precluding efficacy of drugs for third-line therapy. This study underlines the need for governments and public health organizations to recommend the use of VL monitoring and also the availability of darunavir and raltegravir for third-line therapies in the context of limited-resource settings. PMID:22888273

  8. Antiretroviral therapy initiation before, during, or after pregnancy in HIV-1-infected women: maternal virologic, immunologic, and clinical response.

    Directory of Open Access Journals (Sweden)

    Vlada V Melekhin


    Full Text Available Pregnancy has been associated with a decreased risk of HIV disease progression in the highly active antiretroviral therapy (HAART era. The effect of timing of HAART initiation relative to pregnancy on maternal virologic, immunologic and clinical outcomes has not been assessed.We conducted a retrospective cohort study from 1997-2005 among 112 pregnant HIV-infected women who started HAART before (N = 12, during (N = 70 or after pregnancy (N = 30.Women initiating HAART before pregnancy had lower CD4+ nadir and higher baseline HIV-1 RNA. Women initiating HAART after pregnancy were more likely to receive triple-nucleoside reverse transcriptase inhibitors. Multivariable analyses adjusted for baseline CD4+ lymphocytes, baseline HIV-1 RNA, age, race, CD4+ lymphocyte count nadir, history of ADE, prior use of non-HAART ART, type of HAART regimen, prior pregnancies, and date of HAART start. In these models, women initiating HAART during pregnancy had better 6-month HIV-1 RNA and CD4+ changes than those initiating HAART after pregnancy (-0.35 vs. 0.10 log(10 copies/mL, P = 0.03 and 183.8 vs. -70.8 cells/mm(3, P = 0.03, respectively but similar to those initiating HAART before pregnancy (-0.32 log(10 copies/mL, P = 0.96 and 155.8 cells/mm(3, P = 0.81, respectively. There were 3 (25% AIDS-defining events or deaths in women initiating HAART before pregnancy, 3 (4% in those initiating HAART during pregnancy, and 5 (17% in those initiating after pregnancy (P = 0.01. There were no statistical differences in rates of HIV disease progression between groups.HAART initiation during pregnancy was associated with better immunologic and virologic responses than initiation after pregnancy.

  9. Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs. (United States)

    Hijazi, Karolin; Cuppone, Anna M; Smith, Kieron; Stincarelli, Maria A; Ekeruche-Makinde, Julia; De Falco, Giulia; Hold, Georgina L; Shattock, Robin; Kelly, Charles G; Pozzi, Gianni; Iannelli, Francesco


    Anti-retroviral (ARV) -based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on expression of drug

  10. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia. (United States)

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick C K; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher K C; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin


    First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance - Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥ 2 TAMs; or M184V+≥ 1 TAM. Virological suppression was defined as viral load (VL) failure and (2) factors associated with virological suppression after 12 months on second-line. A total of 105 patients from 10 sites in Thailand, Hong Kong, Indonesia, Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥ 1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥ 2 TAMs; and 32 with M184V+≥ 1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤ 200 cells/µL at genotyping (OR=4.43, 95% CI [1.59-12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39-16.36], pfailure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving virological response. This emphasizes the importance of continued adherence counselling well into second-line therapy.

  11. Individualization of antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Pavlos R


    Full Text Available Rebecca Pavlos, Elizabeth J PhillipsInstitute for Immunology and Infectious Diseases, Murdoch University, Murdoch, Western Australia, AustraliaAbstract: Antiretroviral therapy (ART has evolved considerably over the last three decades. From the early days of monotherapy with high toxicities and pill burdens, through to larger pill burdens and more potent combination therapies, and finally, from 2005 and beyond where we now have the choice of low pill burdens and once-daily therapies. More convenient and less toxic regimens are also becoming available, even in resource-poor settings. An understanding of the individual variation in response to ART, both efficacy and toxicity, has evolved over this time. The strong association of the major histocompatibility class I allele HLA-B*5701 and abacavir hypersensitivity, and its translation and use in routine HIV clinical practice as a predictive marker with 100% negative predictive value, has been a success story and a notable example of the challenges and triumphs in bringing pharmacogenetics to the clinic. In real clinical practice, however, it is going to be the exception rather than the rule that individual biomarkers will definitively guide patient therapy. The need for individualized approaches to ART has been further increased by the importance of non-AIDS comorbidities in HIV clinical practice. In the future, the ideal utilization of the individualized approach to ART will likely consist of a combined approach using a combination of knowledge of drug, virus, and host (pharmacogenetic and pharmacoecologic [factors in the individual's environment that may be dynamic over time] information to guide the truly personalized prescription. This review will focus on our knowledge of the pharmacogenetics of the efficacy and toxicity of currently available antiretroviral agents and the current and potential utility of such information and approaches in present and future HIV clinical care.Keywords: HIV

  12. Guidelines for using antiretroviral agents among HIV-infected adults and adolescents. (United States)

    Dybul, Mark; Fauci, Anthony S; Bartlett, John G; Kaplan, Jonathan E; Pau, Alice K


    , treatment should be offered to persons who have 55,000 copies/mL (by b-deoxyribonucleic acid [bDNA] or reverse transcriptase-polymerase chain reaction [RT-PCR] assays). The recommendation to treat asymptomatic patients should be based on the willingness and readiness of the person to begin therapy; the degree of existing immunodeficiency as determined by the CD4+ T cell count; the risk for disease progression as determined by the CD4+ T cell count and level of plasma HIV RNA; the potential benefits and risks of initiating therapy in an asymptomatic person; and the likelihood, after counseling and education, of adherence to the prescribed treatment regimen. Treatment goals should be maximal and durable suppression of viral load, restoration and preservation of immunologic function, improvement of quality of life, and reduction of HIV-related morbidity and mortality. Results of therapy are evaluated through plasma HIV RNA levels, which are expected to indicate a 1.0 log10 decrease at 2-8 weeks and no detectable virus (<50 copies/mL) at 4-6 months after treatment initiation. Failure of therapy at 4-6 months might be ascribed to nonadherence, inadequate potency of drugs or suboptimal levels of antiretroviral agents, viral resistance, and other factors that are poorly understood. Patients whose therapy fails in spite of a high level of adherence to the regimen should have their regimen changed; this change should be guided by a thorough drug treatment history and the results of drug-resistance testing. Because of limitations in the available alternative antiretroviral regimens that have documented efficacy, optimal changes in therapy might be difficult to achieve for patients in whom the preferred regimen has failed. These decisions are further confounded by problems with adherence, toxicity, and resistance. For certain patients, participating in a clinical trial with or without access to new drugs or using a regimen that might not achieve complete suppression of viral

  13. Rate of accumulation of thymidine analogue mutations in patients continuing to receive virologically failing regimens containing zidovudine or stavudine: implications for antiretroviral therapy programs in resource-limited settings

    DEFF Research Database (Denmark)

    Cozzi-Lepri, Alessandro; Phillips, Andrew N; Martinez-Picado, Javier


    BACKGROUND: Because changes in antiretroviral therapy in resource-limited settings (RLSs) are delayed until patients experience immunological or clinical failure, it is important to be able to estimate the consequences in terms of accumulation of thymidine analogue (TA) mutations (TAMs). METHODS...... until the second GRT. RESULTS: At the time of the first GRT in a pair (t0), 1 year after virological failure, a median of 3 TAMs were detected, mutations 41L and 215Y in 65% of pairs and 67N in 52%. Overall, 126 TAMs were accumulated during 548 person-years of follow-up (PYFUs) (1/4.3 years; 95......% confidence interval, 3.7-5.0 years). Greater predicted activity of the TA at t0, TAM profile 2 (TAM2; vs TAM profile 1 [TAM1]) profiles at t0, use of a nonnucleoside reverse-transcriptase inhibitor (NNRTI) at t0 (vs combined NNRTI and protease inhibitor), and acquisition of HIV infection through heterosexual...

  14. TMC125 exerts similar initial antiviral potency as a five-drug, triple class antiretroviral regimen

    NARCIS (Netherlands)

    Sankatsing, Sanjay U. C.; Weverling, Gerrit J.; Peeters, Monika; van't Klooster, Gerben; Gruzdev, Boris; Rakhmanova, Aza; Danner, Sven A.; Jurriaans, Suzanne; Prins, Jan M.; Lange, Joep M. A.


    Objective: TMC125, a next generation, non-nucleoside reverse transcriptase inhibitor (NNRTI), demonstrated a remarkable decline of plasma HIV-1 RNA during a phase IIa study. We compared the initial rate of decline of plasma HIV-1 RNA achieved by TMC125 monotherapy with that of a triple class,

  15. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  16. HIV antiretroviral drug combination induces endothelial mitochondrial dysfunction and reactive oxygen species production, but not apoptosis

    International Nuclear Information System (INIS)

    Jiang Bo; Hebert, Valeria Y.; Li, Yuchi; Mathis, J. Michael; Alexander, J. Steven; Dugas, Tammy R.


    Numerous reports now indicate that HIV patients administered long-term antiretroviral therapy (ART) are at a greater risk for developing cardiovascular diseases. Endothelial dysfunction is an initiating event in atherogenesis and may contribute to HIV-associated atherosclerosis. We previously reported that ART induces direct endothelial dysfunction in rodents. In vitro treatment of human umbilical vein endothelial cells (HUVEC) with ART indicated endothelial mitochondrial dysfunction and a significant increase in the production of reactive oxygen species (ROS). In this study, we determined whether ART-induced endothelial dysfunction is mediated via mitochondria-derived ROS and whether this mitochondrial injury culminates in endothelial cell apoptosis. Two major components of ART combination therapy, a nucleoside reverse transcriptase inhibitor and a protease inhibitor, were tested, using AZT and indinavir as representatives for each. Microscopy utilizing fluorescent indicators of ROS and mitochondria demonstrated the mitochondrial localization of ART-induced ROS. MnTBAP, a cell-permeable metalloporphyrin antioxidant, abolished ART-induced ROS production. As a final step in confirming the mitochondrial origin of the ART-induced ROS, HUVEC were transduced with a cytosolic- compared to a mitochondria-targeted catalase. Transduction with the mitochondria-targeted catalase was more effective than cytoplasmic catalase in inhibiting the ROS and 8-isoprostane (8-iso-PGF 2α ) produced after treatment with either AZT or indinavir. However, both mitochondrial and cytoplasmic catalase attenuated ROS and 8-iso-PGF 2α production induced by the combination treatment, suggesting that in this case, the formation of cytoplasmic ROS may also occur, and thus, that the mechanism of toxicity in the combination treatment group may be different compared to treatment with AZT or indinavir alone. Finally, to determine whether ART-induced mitochondrial dysfunction and ROS production

  17. Clinical implications of antiretroviral drug interactions with warfarin: a case-control study. (United States)

    Esterly, John S; Darin, Kristin M; Gerzenshtein, Lana; Othman, Fidah; Postelnick, Michael J; Scarsi, Kimberly K


    Warfarin, a frequently prescribed anticoagulant with a narrow therapeutic index, is susceptible to drug-drug interactions with antiretroviral therapy (ART). This study compared the warfarin maintenance dose (WMD) between patients receiving and not receiving ART and evaluated predictors of warfarin dosage among those on ART. This was a case-control (1:2) study. Cases were HIV-infected patients receiving warfarin and protease inhibitor (PI)- and/or non-nucleoside reverse transcriptase inhibitor (NNRTI)-based ART. Controls were randomly selected HIV-uninfected patients receiving warfarin. The WMD was compared between cases and controls and between cases on varying ART regimens. Bivariate comparisons were performed and a linear regression model was developed to identify predictors of WMD. We identified 18 case and 36 control patients eligible for inclusion. Cases were younger than controls (mean age: 45.8 versus 63.1 years, P African American (50.0% versus 22.2%, P=0.04). ART was classified as PI-based (n=9), NNRTI-based (n=7) and PI + NNRTI-based (n=2). The WMD (mean ± SD) differed between cases and controls (8.6  ±  3.4 mg versus 5.1 ± 1.5 mg, P ART regimens (PI: 8.8  ±  4.5 mg; NNRTI: 8.6   ± 1.8 mg; PI + NNRTI: 7.3  ±  3.3 mg; P = 0.86). Race and ritonavir dose were independent predictors of WMD, predicting an increase of 3.9 mg (95% CI: 0.88-6.98, P = 0.02) if a patient was African American or 3.7 mg (95% CI: 0.53-6.89, P = 0.03) if the total daily ritonavir dose was 200 mg. The required WMD was significantly higher in patients receiving ART. Prompt dose titration to achieve a higher WMD with vigilant monitoring may be required due to these drug-drug interactions.

  18. Global trends in antiretroviral resistance in treatment-naive individuals with HIV after rollout of antiretroviral treatment in resource-limited settings: a global collaborative study and meta-regression analysis. (United States)

    Gupta, Ravindra K; Jordan, Michael R; Sultan, Binta J; Hill, Andrew; Davis, Daniel H J; Gregson, John; Sawyer, Anthony W; Hamers, Raph L; Ndembi, Nicaise; Pillay, Deenan; Bertagnolio, Silvia


    The emergence and spread of high levels of HIV-1 drug resistance in resource-limited settings where combination antiretroviral treatment has been scaled up could compromise the effectiveness of national HIV treatment programmes. We aimed to estimate changes in the prevalence of HIV-1 drug resistance in treatment-naive individuals with HIV since initiation of rollout in resource-limited settings. We did a systematic search for studies and conference abstracts published between January, 2001, and July, 2011, and included additional data from the WHO HIV drug resistance surveillance programme. We assessed the prevalence of drug-resistance mutations in untreated individuals with respect to time since rollout in a series of random-effects meta-regression models. Study-level data were available for 26,102 patients from sub-Saharan Africa, Asia, and Latin America. We recorded no difference between chronic and recent infection on the prevalence of one or more drug-resistance mutations for any region. East Africa had the highest estimated rate of increase at 29% per year (95% CI 15 to 45; p=0·0001) since rollout, with an estimated prevalence of HIV-1 drug resistance at 8 years after rollout of 7·4% (4·3 to 12·7). We recorded an annual increase of 14% (0% to 29%; p=0·054) in southern Africa and a non-significant increase of 3% (-0·9 to 16; p=0·618) in west and central Africa. There was no change in resistance over time in Latin America, and because of much country-level heterogeneity the meta-regression analysis was not appropriate for Asia. With respect to class of antiretroviral, there were substantial increases in resistance to non-nucleoside reverse transcriptase inhibitors (NNRTI) in east Africa (36% per year [21 to 52]; pAfrica (23% per year [7 to 42]; p=0·0049). No increase was noted for the other drug classes in any region. Our findings suggest a significant increase in prevalence of drug resistance over time since antiretroviral rollout in regions of sub

  19. The development of antiretroviral therapy and its impact on the HIV-1/AIDS pandemic. (United States)

    Broder, Samuel


    In the last 25 years, HIV-1, the retrovirus responsible for the acquired immunodeficiency syndrome (AIDS), has gone from being an "inherently untreatable" infectious agent to one eminently susceptible to a range of approved therapies. During a five-year period, starting in the mid-1980s, my group at the National Cancer Institute played a role in the discovery and development of the first generation of antiretroviral agents, starting in 1985 with Retrovir (zidovudine, AZT) in a collaboration with scientists at the Burroughs-Wellcome Company (now GlaxoSmithKline). We focused on AZT and related congeners in the dideoxynucleoside family of nucleoside reverse transcriptase inhibitors (NRTIs), taking them from the laboratory to the clinic in response to the pandemic of AIDS, then a terrifying and lethal disease. These drugs proved, above all else, that HIV-1 infection is treatable, and such proof provided momentum for new therapies from many sources, directed at a range of viral targets, at a pace that has rarely if ever been matched in modern drug development. Antiretroviral therapy has brought about a substantial decrease in the death rate due to HIV-1 infection, changing it from a rapidly lethal disease into a chronic manageable condition, compatible with very long survival. This has special implications within the classic boundaries of public health around the world, but at the same time in certain regions may also affect a cycle of economic and civil instability in which HIV-1/AIDS is both cause and consequence. Many challenges remain, including (1) the life-long duration of therapy; (2) the ultimate role of pre-exposure prophylaxis (PrEP); (3) the cardiometabolic side-effects or other toxicities of long-term therapy; (4) the emergence of drug-resistance and viral genetic diversity (non-B subtypes); (5) the specter of new cross-species transmissions from established retroviral reservoirs in apes and Old World monkeys; and (6) the continued pace of new HIV-1

  20. HIV-1 transmission patterns in antiretroviral therapy-naive, HIV-infected North Americans based on phylogenetic analysis by population level and ultra-deep DNA sequencing.

    Directory of Open Access Journals (Sweden)

    Lisa L Ross

    Full Text Available Factors that contribute to the transmission of human immunodeficiency virus type 1 (HIV-1, especially drug-resistant HIV-1 variants remain a significant public health concern. In-depth phylogenetic analyses of viral sequences obtained in the screening phase from antiretroviral-naïve HIV-infected patients seeking enrollment in EPZ108859, a large open-label study in the USA, Canada and Puerto Rico ( NCT00440947 were examined for insights into the roles of drug resistance and epidemiological factors that could impact disease dissemination. Viral transmission clusters (VTCs were initially predicted from a phylogenetic analysis of population level HIV-1 pol sequences obtained from 690 antiretroviral-naïve subjects in 2007. Subsequently, the predicted VTCs were tested for robustness by ultra deep sequencing (UDS using pyrosequencing technology and further phylogenetic analyses. The demographic characteristics of clustered and non-clustered subjects were then compared. From 690 subjects, 69 were assigned to 1 of 30 VTCs, each containing 2 to 5 subjects. Race composition of VTCs were significantly more likely to be white (72% vs. 60%; p = 0.04. VTCs had fewer reverse transcriptase and major PI resistance mutations (9% vs. 24%; p = 0.002 than non-clustered sequences. Both men-who-have-sex-with-men (MSM (68% vs. 48%; p = 0.001 and Canadians (29% vs. 14%; p = 0.03 were significantly more frequent in VTCs than non-clustered sequences. Of the 515 subjects who initiated antiretroviral therapy, 33 experienced confirmed virologic failure through 144 weeks while only 3/33 were from VTCs. Fewer VTCs subjects (as compared to those with non-clustering virus had HIV-1 with resistance-associated mutations or experienced virologic failure during the course of the study. Our analysis shows specific geographical and drug resistance trends that correlate well with transmission clusters defined by HIV sequences of similarity

  1. Highly active antiretroviral therapy including protease inhibitors does not confer a unique CD4 cell benefit. The AVANTI and INCAS Study Groups. (United States)


    To determine if triple combination therapy, particularly including HIV protease inhibitors (PI), confers an unique immunological benefit that is independent of reductions of plasma viral load (pVL). The correlation between changes from baseline in CD4 cell count and pVL was examined at all time points up to 52 weeks in three randomized clinical trials (AVANTI-2, AVANTI-3 and INCAS) that compared dual nucleoside therapy with triple combination therapy. Individual pVL and CD4 cell counts changes from baseline were entered into multivariate linear regression models for patients receiving double therapy and for those receiving triple therapy including a PI and/or a non-nucleoside reverse transcriptase inhibitor (NNRTI), and the null hypothesis was tested. After 52 weeks of therapy, the relationship between changes from baseline CD4 cell count and pVL was independent of whether patients were assigned double or triple therapy (P = 0.23 and 0.69 for intercept and slope, respectively), or whether patients were assigned triple therapy including a PI or triple therapy including an NNRTI (P = 0.92 and 0.95, respectively). Less than 5% of patients ever had 'discordant' increases in both CD4 cell count and pVL compared with baseline, and this proportion was unrelated to the class of therapy used. 'Discordant' decreases from baseline in both parameters were observed in up to 35% of individuals. The correlation between pVL and CD4 cell count changes from baseline improved over time on therapy, regardless of the therapeutic regimen involved. The data provide no evidence for a CD4 cell count benefit of highly active antiretroviral therapy (HAART) unique to triple therapy or PI-containing regimens.

  2. High rates of regimen change due to drug toxicity among a cohort of South Indian adults with HIV infection initiated on generic, first-line antiretroviral treatment. (United States)

    Sivadasan, Ajith; Abraham, O C; Rupali, Priscilla; Pulimood, Susanne A; Rajan, Joyce; Rajkumar, S; Zachariah, Anand; Kannangai, Rajesh; Kandathil, Abraham Joseph; Sridharan, G; Mathai, Dilip


    To determine the rates, reasons and predictors of treatment change of the initial antiretroviral treatment (ART) regimen in HIV-infected south Indian adults. In this prospective cohort study, ART-naive adults initiated on generic, fixed dose combination ART as per the National AIDS Control Organization guidelines were followed up at an academic medical center. Treatment change was defined as any event which necessitated a change in or discontinuation of the initial ART regimen. Two hundred and thirty persons with HIV infection (males 74.8% and median age 37 years) were followed up for median duration of 48 weeks. The majority (98.7%) had acquired HIV infection through the heterosexual route. Most (70.4%) had advanced IV infection (WHO clinical stage 3 or 4) and 78% had CD4+ T-lymphocyte counts below 200 cells/microL. The initial ART regimens used were: Lamivudine (3TC) with Stavudine (d4T) (in 76%) or Azidothymidine (AZT) and Nevirapine (NVP) (in 86%) or Efavirenz (EFV). The cumulative incidence of treatment change was 39.6% (91 patients). Drug toxicity (WHO grade 3 or 4) was the reason for treatment change among 62 (27%) (incidence rate 35.9/100 person-years). The most common toxicities were attributable to the thymidine analogue nucleoside reverse transcriptase inhibitors (NRTIs), d4T and AZT [lactic acidosis (8.7%), anemia (7%) and peripheral neuropathy (5.2%)]. The other toxicities were rash (3.9%) and hepatitis (1.3%) due to NVP. The mortality (4.6/100 person-years) and disease progression rates (4.1/100 person-years) were low. The ART regimens used in this study were effective in decreasing disease progression and death. However, they were associated with high rates of drug toxicities, particularly those attributable to thymidine analogue NRTI. As efforts are made to improve access to ART, treatment regimens chosen should not only be potent, but also safe.

  3. Prevalence and evolution of low frequency HIV drug resistance mutations detected by ultra deep sequencing in patients experiencing first line antiretroviral therapy failure. (United States)

    Vandenhende, Marie-Anne; Bellecave, Pantxika; Recordon-Pinson, Patricia; Reigadas, Sandrine; Bidet, Yannick; Bruyand, Mathias; Bonnet, Fabrice; Lazaro, Estibaliz; Neau, Didier; Fleury, Hervé; Dabis, François; Morlat, Philippe; Masquelier, Bernard


    Clinical relevance of low-frequency HIV-1 variants carrying drug resistance associated mutations (DRMs) is still unclear. We aimed to study the prevalence of low-frequency DRMs, detected by Ultra-Deep Sequencing (UDS) before antiretroviral therapy (ART) and at virological failure (VF), in HIV-1 infected patients experiencing VF on first-line ART. Twenty-nine ART-naive patients followed up in the ANRS-CO3 Aquitaine Cohort, having initiated ART between 2000 and 2009 and experiencing VF (2 plasma viral loads (VL) >500 copies/ml or one VL >1000 copies/ml) were included. Reverse transcriptase and protease DRMs were identified using Sanger sequencing (SS) and UDS at baseline (before ART initiation) and VF. Additional low-frequency variants with PI-, NNRTI- and NRTI-DRMs were found by UDS at baseline and VF, significantly increasing the number of detected DRMs by 1.35 fold (plow-frequency DRMs modified ARV susceptibility predictions to the prescribed treatment for 1 patient at baseline, in whom low-frequency DRM was found at high frequency at VF, and 6 patients at VF. DRMs found at VF were rarely detected as low-frequency DRMs prior to treatment. The rare low-frequency NNRTI- and NRTI-DRMs detected at baseline that correlated with the prescribed treatment were most often found at high-frequency at VF. Low frequency DRMs detected before ART initiation and at VF in patients experiencing VF on first-line ART can increase the overall burden of resistance to PI, NRTI and NNRTI.

  4. Impact of Antiretroviral Regimens on CSF Viral Escape in a Prospective Multicohort Study of ART-Experienced HIV-1 Infected Adults in the United States. (United States)

    Mukerji, Shibani S; Misra, Vikas; Lorenz, David R; Uno, Hajime; Morgello, Susan; Franklin, Donald; Ellis, Ronald J; Letendre, Scott; Gabuzda, Dana


    Cerebrospinal fluid (CSF) viral escape occurs in 4-20% of HIV-infected adults, yet the impact of antiretroviral therapy (ART) on CSF escape is unclear. Prospective study of 1063 participants with baseline plasma viral load (VL) ≤400 copies/ml between 2005-2016. Odds ratio for ART regimens (PI with nucleoside reverse transcriptase inhibitor [PI+NRTI] versus other ART) and CSF escape was estimated using mixed-effects models. Drug resistance mutation frequencies were calculated. Baseline mean age was 46, median plasma VL, CD4 nadir, and CD4 count were 50 copies/mL, 88 cells/μL, and 424 cells/μL, respectively; 48% on PI+NRTI, 33% on non-NRTI, and 6% on integrase inhibitors. During median follow-up of 4.4 years, CSF escape occurred in 77 participants (7.2%). PI+NRTI use was an independent predictor of CSF escape (OR 3.1 [95% CI 1.8-5.0]) in adjusted analyses and models restricted to plasma VL ≤50 copies/ml (pCSF viral escape than non-ATV PI+NRTI regimens. Plasma and CSF M184V/I combined with thymidine-analog mutations were more frequent in CSF escape versus no escape (23% vs. 2.3%). Genotypic susceptibility score-adjusted CNS penetration-effectiveness (CPE) values were calculated for CSF escape with M184V/I mutations (n=34). Adjusted CPE values were low (CSF and plasma in 27 (79%) and 13 (38%), respectively, indicating suboptimal CNS drug availability. PI+NRTI regimens are independent predictors of CSF escape in HIV-infected adults. Reduced CNS ART bioavailability may predispose to CSF escape in patients with M184V/I mutations. Optimizing ART regimens may reduce risk of CSF escape.

  5. Identification of Immunogenic Cytotoxic T Lymphocyte Epitopes Containing Drug Resistance Mutations in Antiretroviral Treatment-Naïve HIV-Infected Individuals.

    Directory of Open Access Journals (Sweden)

    Juan Blanco-Heredia

    Full Text Available Therapeutic HIV vaccines may prove helpful to intensify antiretroviral treatment (ART efficacy and may be an integral part of future cure strategies.We examined IFN-gamma ELISpot responses to a panel of 218 HIV clade B consensus-based HIV protease-reverse transcriptase peptides, designed to mimic previously described and predicted cytotoxic T lymphocyte epitopes overlapping drug resistance (DR positions, that either included the consensus sequence or the DR variant sequence, in 49 ART-naïve HIV-infected individuals. Next generation sequencing was used to assess the presence of minority DR variants in circulating viral populations.Although a wide spectrum of differential magnitudes of response to DR vs. WT peptide pairs was observed, responses to DR peptides were frequent and strong in the study cohort. No difference between the median magnitudes of response to DR vs. WT peptides was observed. Interestingly, of the 22 peptides that were recognized by >15% of the participants, two-thirds (64% corresponded to DR peptides. When analysing responses per peptide pair per individual, responses to only WT (median 4 pairs/individual or DR (median 6 pairs/individual were more common than responses to both WT and DR (median 2 pairs/individual; p<0.001. While the presence of ELISpot responses to WT peptides was frequently associated with the presence of the corresponding peptide sequence in the patient's virus (mean 68% of cases, responses to DR peptides were generally not associated with the presence of DR mutations in the viral population, even at low frequencies (mean 1.4% of cases; p = 0.0002.Our data suggests that DR peptides are frequently immunogenic and raises the potential benefit of broadening the antigens included in a therapeutic vaccine approach to immunogenic epitopes containing common DR sequences. Further studies are needed to assess the quality of responses elicited by DR peptides.

  6. Full Viral Suppression, Low-Level Viremia, and Quantifiable Plasma HIV-RNA at the End of Pregnancy in HIV-Infected Women on Antiretroviral Treatment. (United States)

    Baroncelli, Silvia; Pirillo, Maria F; Tamburrini, Enrica; Guaraldi, Giovanni; Pinnetti, Carmela; Degli Antoni, Anna; Galluzzo, Clementina M; Stentarelli, Chiara; Amici, Roberta; Floridia, Marco


    There is limited information on full viral suppression and low-level HIV-RNA viremia in HIV-infected women at the end of pregnancy. We investigated HIV-RNA levels close to delivery in women on antiretroviral treatment in order to define rates of complete suppression, low-level viremia, and quantifiable HIV-RNA, exploring as potential determinants some clinical and viroimmunological variables. Plasma samples from a national study in Italy, collected between 2003 and 2012, were used. According to plasma HIV-RNA levels, three groups were defined: full suppression (target not detected), low-level viremia (target detected but HIV-RNA (≥37 copies/ml). Multivariable logistic regression was used to define determinants of full viral suppression and of quantifiable HIV-RNA. Among 107 women evaluated at a median gestational age of 35 weeks, 90 (84.1%) had HIV-RNA HIV-RNA was 109 copies/ml (IQR 46-251), with only one case showing resistance (mutation M184V; rate: 9.1%). In multivariable analyses, women with higher baseline HIV-RNA levels and with hepatitis C virus (HCV) coinfection were significantly more likely to have quantifiable HIV-RNA in late pregnancy. Full viral suppression was significantly more likely with nonnucleoside reverse transcriptase inhibitor (NNRTI)-based regimens and significantly less likely with higher HIV-RNA in early pregnancy. No cases of HIV transmission occurred. In conclusion, HIV-infected pregnant women showed a high rate of viral suppression and a low resistance rate before delivery. In most cases no target HIV-RNA was detected in plasma, suggesting a low risk of subsequent virological rebound and development of resistance. Women with high levels of HIV-RNA in early pregnancy and those who have concomitant HCV infection should be considered at higher risk of having quantifiable HIV-RNA at the end of pregnancy.

  7. Bioanalysis, metabolism & clinical pharmacology of antiretroviral drugs

    NARCIS (Netherlands)

    Heine, R. ter


    The aims of all studies described in this thesis were to develop new bioanalytical and more patient friendly methods for studying the clinical pharmacology of antiretroviral drugs and to ultimately improve antiretroviral treatment.

  8. When to start antiretroviral therapy

    DEFF Research Database (Denmark)

    Lundgren, Jens D; Babiker, Abdel G; Gordin, Fred M


    Strategies for use of antiretroviral therapy (ART) have traditionally focused on providing treatment to persons who stand to benefit immediately from initiating the therapy. There is global consensus that any HIV+ person with CD4 counts less than 350 cells/μl should initiate ART. However, it rema...

  9. Antiretroviral drug resistance in HIV-1 therapy-naive patients in Cuba. (United States)

    Pérez, Lissette; Kourí, Vivian; Alemán, Yoan; Abrahantes, Yeisel; Correa, Consuelo; Aragonés, Carlos; Martínez, Orlando; Pérez, Jorge; Fonseca, Carlos; Campos, Jorge; Álvarez, Delmis; Schrooten, Yoeri; Dekeersmaeker, Nathalie; Imbrechts, Stijn; Beheydt, Gertjan; Vinken, Lore; Soto, Yudira; Álvarez, Alina; Vandamme, Anne-Mieke; Van Laethem, Kristel


    In Cuba, antiretroviral therapy rollout started in 2001 and antiretroviral therapy coverage has reached almost 40% since then. The objectives of this study were therefore to analyze subtype distribution, and level and patterns of drug resistance in therapy-naive HIV-1 patients. Four hundred and one plasma samples were collected from HIV-1 therapy-naive patients in 2003 and in 2007-2011. HIV-1 drug resistance genotyping was performed in the pol gene and drug resistance was interpreted according to the WHO surveillance drug-resistance mutations list, version 2009. Potential impact on first-line therapy response was estimated using genotypic drug resistance interpretation systems HIVdb version 6.2.0 and Rega version 8.0.2. Phylogenetic analysis was performed using Neighbor-Joining. The majority of patients were male (84.5%), men who have sex with men (78.1%) and from Havana City (73.6%). Subtype B was the most prevalent subtype (39.3%), followed by CRF20-23-24_BG (19.5%), CRF19_cpx (18.0%) and CRF18_cpx (10.3%). Overall, 29 patients (7.2%) had evidence of drug resistance, with 4.0% (CI 1.6%-4.8%) in 2003 versus 12.5% (CI 7.2%-14.5%) in 2007-2011. A significant increase in drug resistance was observed in recently HIV-1 diagnosed patients, i.e. 14.8% (CI 8.0%-17.0%) in 2007-2011 versus 3.8% (CI 0.9%-4.7%) in 2003 (OR 3.9, CI 1.5-17.0, p=0.02). The majority of drug resistance was restricted to a single drug class (75.8%), with 55.2% patients displaying nucleoside reverse transcriptase inhibitor (NRTI), 10.3% non-NRTI (NNRTI) and 10.3% protease inhibitor (PI) resistance mutations. Respectively, 20.7% and 3.4% patients carried viruses containing drug resistance mutations against NRTI+NNRTI and NRTI+NNRTI+PI. The first cases of resistance towards other drug classes than NRTI were only detected from 2008 onwards. The most frequent resistance mutations were T215Y/rev (44.8%), M41L (31.0%), M184V (17.2%) and K103N (13.8%). The median genotypic susceptibility score for the

  10. Tubulin Inhibitor-Based Antibody-Drug Conjugates for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Hao Chen


    Full Text Available Antibody-drug conjugates (ADCs are a class of highly potent biopharmaceutical drugs generated by conjugating cytotoxic drugs with specific monoclonal antibodies through appropriate linkers. Specific antibodies used to guide potent warheads to tumor tissues can effectively reduce undesired side effects of the cytotoxic drugs. An in-depth understanding of antibodies, linkers, conjugation strategies, cytotoxic drugs, and their molecular targets has led to the successful development of several approved ADCs. These ADCs are powerful therapeutics for cancer treatment, enabling wider therapeutic windows, improved pharmacokinetic/pharmacodynamic properties, and enhanced efficacy. Since tubulin inhibitors are one of the most successful cytotoxic drugs in the ADC armamentarium, this review focuses on the progress in tubulin inhibitor-based ADCs, as well as lessons learned from the unsuccessful ADCs containing tubulin inhibitors. This review should be helpful to facilitate future development of new generations of tubulin inhibitor-based ADCs for cancer therapy.

  11. Immunohistochemical detection of human telomerase reverse transcriptase in oral cancer and pre-cancer

    Directory of Open Access Journals (Sweden)

    Jayanthi Palani


    Conclusion: There was increased expression of hTERT protein in OSCC and leukoplakia samples when compared to normal oral mucosa. The cellular localization, LI and LS in OSF were significantly different from OSCC and leukoplakia.

  12. Mechanism of polypurine tract primer generation by HIV-1 reverse transcriptase

    Czech Academy of Sciences Publication Activity Database

    Figiel, M.; Krepl, Miroslav; Park, S.; Poznanski, J.; Skowronek, K.; Golab, A.; Ha, T.; Šponer, Jiří; Nowotny, M.


    Roč. 293, č. 1 (2018), s. 191-202 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * strand dna -synthesis * retroviral rnases-h * rna/ dna hybrid Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.125, year: 2016

  13. Coordination between the polymerase and RNase H activity of HIV-1 reverse transcriptase

    Czech Academy of Sciences Publication Activity Database

    Figiel, M.; Krepl, Miroslav; Poznanski, J.; Gotab, A.; Šponer, Jiří; Nowotny, M.


    Roč. 45, č. 6 (2017), s. 3341-3352 ISSN 0305-1048 R&D Projects: GA ČR GAP208/12/1878 Grant - others:GA MŠk(CZ) LO1305 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * rna/dna hybrid * force-field Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016

  14. In vitro HIV-1 evolution in response to triple reverse transcriptase inhibitors & in silico phenotypic analysis.

    Directory of Open Access Journals (Sweden)

    Barbara A Rath

    Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.

  15. Pyrroloaryls and pyrroloheteroaryls: Inhibitors of the HIV fusion/attachment, reverse transcriptase and integrase

    Czech Academy of Sciences Publication Activity Database

    Patel, Rahul V.; Park, S.W.


    Roč. 23, č. 17 (2015), s. 5247-5263 ISSN 0968-0896 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Pyrrole * Arylthiopyrrole * Triciribine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.923, year: 2015

  16. Tissue-specific expression of telomerase reverse transcriptase gene variants in Nicotiana tabacum

    Czech Academy of Sciences Publication Activity Database

    Jurečková, J.; Sýkorová, Eva; Hafidh, Said; Honys, David; Fajkus, Jiří; Fojtová, M.


    Roč. 245, č. 3 (2017), s. 549-561 ISSN 0032-0935 R&D Projects: GA ČR GA13-06943S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 ; RVO:61389030 Keywords : male gametophyte development * tobacco male gametophyte * allotetraploid nicotiana Subject RIV: EF - Botanics; EF - Botanics (UEB-Q) OBOR OECD: Plant sciences, botany; Plant sciences, botany (UEB-Q) Impact factor: 3.361, year: 2016

  17. A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Sandra J Laney


    Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

  18. Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses (United States)


    are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney

  19. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia (United States)

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin


    Introduction First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance – Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥2 TAMs; or M184V+≥1 TAM. Virological suppression was defined as viral load (VL) Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥2 TAMs; and 32 with M184V+≥1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤200 cells/µL at genotyping (OR=4.43, 95% CI [1.59–12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39–16.36], p<0.001). Among 87/105 patients with available VL at 12 months after switch to second-line ART, virological suppression was achieved in 85%. The median genotypic susceptibility score (GSS) for the second-line regimen was 2.00. Patients with ART adherence ≥95% were more likely to be virologically suppressed (OR=9.33, 95% CI (2.43–35.81), p=0.001). Measures of patient resistance to second-line ART, including the GSS, were not significantly associated with virological outcome. Conclusions Multi-NRTI RAMs at first-line failure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving

  20. Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs.

    Directory of Open Access Journals (Sweden)

    Karolin Hijazi

    Full Text Available Anti-retroviral (ARV -based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on

  1. High prevalence of severe vitamin D deficiency in combined antiretroviral therapy-naive and successfully treated Swiss HIV patients. (United States)

    Mueller, Nicolas J; Fux, Christoph A; Ledergerber, Bruno; Elzi, Luigia; Schmid, Patrick; Dang, Thanh; Magenta, Lorenzo; Calmy, Alexandra; Vergopoulos, Athanasios; Bischoff-Ferrari, Heike A


    To evaluate the prevalence of 25-hydroxyvitamin D [25(OH)D] deficiency in HIV-positive patients, a population at risk for osteoporosis. Retrospective assessment of vitamin D levels by season and initiation of combined antiretroviral therapy (cART). 25(OH)D was measured in 211 HIV-positive patients: samples were taken before initiation of cART from February to April or from August to October as well as 12 (same season) and 18 months (alternate season) after starting cART. 1,25-Dihydroxyvitamin D [1,25(OH)2D] was measured in a subset of 74 patients. Multivariable analyses included season, sex, age, ethnicity, BMI, intravenous drug use (IDU), renal function, time since HIV diagnosis, previous AIDS, CD4 cell count and cART, in particular nonnucleoside reverse transcriptase inhibitor (NNRTI) and tenofovir (TDF) use. At baseline, median 25(OH)D levels were 37 (interquartile range 20-49) nmol/l in spring and 57 (39-74) nmol/l in the fall; 25(OH)D deficiency less than 30 nmol/l was more prevalent in spring (42%) than in fall (14%), but remained unchanged regardless of cART exposure. In multivariable analysis, 25(OH)D levels were higher in white patients and those with a longer time since HIV diagnosis and lower in springtime measurements and in those with active IDU and NNRTI use. 1-Hydroxylation rates were significantly higher in patients with low 25(OH)D. Hepatitis C seropositivity, previous AIDS and higher CD4 cell counts correlated with lower 1,25(OH)2D levels, whereas BMI and TDF use were associated with higher levels. In TDF-treated patients, higher 1,25(OH)2D correlated with increases in serum alkaline phosphatase. Based on the high rate of vitamin D deficiency in HIV-positive patients, systematic screening with consideration of seasonality is warranted. The impact of NNRTIs on 25(OH)D and TDF on 1,25(OH)2D needs further attention.

  2. A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries. (United States)

    Waning, Brenda; Diedrichsen, Ellen; Moon, Suerie


    Indian manufacturers of generic antiretroviral (ARV) medicines facilitated the rapid scale up of HIV/AIDS treatment in developing countries though provision of low-priced, quality-assured medicines. The legal framework in India that facilitated such production, however, is changing with implementation of the World Trade Organization Agreement on Trade-Related Aspects of Intellectual Property Rights, and intellectual property measures being discussed in regional and bilateral free trade agreement negotiations. Reliable quantitative estimates of the Indian role in generic global ARV supply are needed to understand potential impacts of such measures on HIV/AIDS treatment in developing countries. We utilized transactional data containing 17,646 donor-funded purchases of ARV tablets made by 115 low- and middle-income countries from 2003 to 2008 to measure market share, purchase trends and prices of Indian-produced generic ARVs compared with those of non-Indian generic and brand ARVs. Indian generic manufacturers dominate the ARV market, accounting for more than 80% of annual purchase volumes. Among paediatric ARV and adult nucleoside and non-nucleoside reverse transcriptase inhibitor markets, Indian-produced generics accounted for 91% and 89% of 2008 global purchase volumes, respectively. From 2003 to 2008, the number of Indian generic manufactures supplying ARVs increased from four to 10 while the number of Indian-manufactured generic products increased from 14 to 53. Ninety-six of 100 countries purchased Indian generic ARVs in 2008, including high HIV-burden sub-Saharan African countries. Indian-produced generic ARVs used in first-line regimens were consistently and considerably less expensive than non-Indian generic and innovator ARVs. Key ARVs newly recommended by the World Health Organization are three to four times more expensive than older regimens. Indian generic producers supply the majority of ARVs in developing countries. Future scale up using newly

  3. Impact of switching antiretroviral therapy on lipodystrophy and other metabolic complications: a review

    DEFF Research Database (Denmark)

    Hansen, Birgitte R; Haugaard, Steen B; Iversen, Johan


    with the disfiguring body-alterations known as HALS. More recently, however, regimens containing nucleoside reverse-transcriptase inhibitors (NRTI) have attracted attention. Reviewing switch studies regarding metabolic parameters and body shape changes, certain trends emerge. Switching from PI, the metabolic...... complications such as dyslipidaemia and insulin resistance seem to be partly reversible, whereas the morphologic alterations appear to be unchanged. In studies in which NRTI's are switched, dyslipidaemia appears unaffected, but a modest improvement in peripheral lipoatrophy has been reported. However...

  4. Humanized mice recapitulate key features of HIV-1 infection: a novel concept using long-acting anti-retroviral drugs for treating HIV-1.

    Directory of Open Access Journals (Sweden)

    Marc Nischang

    Full Text Available BACKGROUND: Humanized mice generate a lymphoid system of human origin subsequent to transplantation of human CD34+ cells and thus are highly susceptible to HIV infection. Here we examined the efficacy of antiretroviral treatment (ART when added to food pellets, and of long-acting (LA antiretroviral compounds, either as monotherapy or in combination. These studies shall be inspiring for establishing a gold standard of ART, which is easy to administer and well supported by the mice, and for subsequent studies such as latency. Furthermore, they should disclose whether viral breakthrough and emergence of resistance occurs similar as in HIV-infected patients when ART is insufficient. METHODS/PRINCIPAL FINDINGS: NOD/shi-scid/γ(cnull (NOG mice were used in all experimentations. We first performed pharmacokinetic studies of the drugs used, either added to food pellets (AZT, TDF, 3TC, RTV or in a LA formulation that permitted once weekly subcutaneous administration (TMC278: non-nucleoside reverse transcriptase inhibitor, TMC181: protease inhibitor. A combination of 3TC, TDF and TMC278-LA or 3TC, TDF, TMC278-LA and TMC181-LA suppressed the viral load to undetectable levels in 15/19 (79% and 14/14 (100% mice, respectively. In successfully treated mice, subsequent monotherapy with TMC278-LA resulted in viral breakthrough; in contrast, the two LA compounds together prevented viral breakthrough. Resistance mutations matched the mutations most commonly observed in HIV patients failing therapy. Importantly, viral rebound after interruption of ART, presence of HIV DNA in successfully treated mice and in vitro reactivation of early HIV transcripts point to an existing latent HIV reservoir. CONCLUSIONS/SIGNIFICANCE: This report is a unique description of multiple aspects of HIV infection in humanized mice that comprised efficacy testing of various treatment regimens, including LA compounds, resistance mutation analysis as well as viral rebound after treatment

  5. Incidence of virological failure and major regimen change of initial combination antiretroviral therapy in the Latin America and the Caribbean: an observational cohort study (United States)

    Cesar, Carina; Jenkins, Cathy A.; Shepherd, Bryan E.; Padgett, Denis; Mejía, Fernando; Ribeiro, Sayonara Rocha; Cortes, Claudia P.; Pape, Jean W.; Madero, Juan Sierra; Fink, Valeria; Sued, Omar; McGowan, Catherine; Cahn, Pedro


    Background Access to combination antiretroviral therapy (cART) is expanding in Latin America and the Caribbean (LAC). There is little information in this region regarding incidence of and factors associated with regimen failure and regimen change. Methods Antiretroviral-naïve adults starting cART from 2000-2014 at sites in seven countries throughout LAC were included. Cumulative incidence of virologic failure and major regimen change were estimated with death considered a competing event. Findings 14,027 cART initiators (60% male, median age 37 years, median CD4 156 cells/mm3, median HIV-RNA 5·0 log10 copies/mL, and 28% with clinical AIDS) were followed for a median of 3·9 years. 1,719 patients presented virologic failure and 1,955 had a major regimen change. Excluding GHESKIO-Haiti (which did not regularly measure HIV-RNA), cumulative incidence of virologic failure was 7·8%, 19·2%, and 25·8% at one, three, and five years after cART initiation, respectively; cumulative incidence of major regimen change was 5·9%, 12·7%, and 18·2%. Incidence of major regimen change at GHESKIO-Haiti at five years was 10·7%. Virologic failure was associated with younger age (adjusted hazard ratio[aHR]=2·03 for 20 vs. 40 years; 95% confidence interval[CI] 1·68-2·44), infection through injection-drug use (IDU) (aHR=1·60; 95%CI 1·02-2·52), initiation in earlier calendar years (aHR=1·28 for 2002 vs. 2006; 95%CI 1·13-1·46), and starting with a boosted protease inhibitor (aHR=1·17 vs. non-nucleoside reverse transcriptase inhibitor; 95%CI 1·00-1·64). Interpretation Incidence of virologic failure was generally lower than in North America/Europe. Our results suggest the need to design strategies to reduce failure and major regimen change among younger patients and those with a history of IDU. Funding US National Institutes of Health: U01 AI069923. PMID:26520929

  6. Affordable HIV drug-resistance testing for monitoring of antiretroviral therapy in sub-Saharan Africa. (United States)

    Inzaule, Seth C; Ondoa, Pascale; Peter, Trevor; Mugyenyi, Peter N; Stevens, Wendy S; de Wit, Tobias F Rinke; Hamers, Raph L


    Increased provision of antiretroviral therapy in sub-Saharan Africa has led to a growing number of patients with therapy failure and acquired drug-resistant HIV, driving the demand for more costly further lines of antiretroviral therapy. In conjunction with accelerated access to viral load monitoring, feasible and affordable technologies to detect drug-resistant HIV could help maximise the durability and rational use of available drug regimens. Potential low-cost technologies include in-house Sanger and next-generation sequencing in centralised laboratories, and point mutation assays and genotype-free systems that predict response to antiretroviral therapy at point-of-care. Strengthening of centralised high-throughput laboratories, including efficient systems for sample referral and results delivery, will increase economies-of-scale while reducing costs. Access barriers can be mitigated by standardisation of in-house assays into commercial kits, use of polyvalent instruments, and adopting price-reducing strategies. A stepwise rollout approach should improve feasibility, prioritising WHO-recommended population-based surveillance and management of complex patient categories, such as patients failing protease inhibitor-based antiretroviral therapy. Implementation research, adaptations of existing WHO guidance, and political commitment, will be key to support the appropriate investments and policy changes. In this Personal View, we discuss the potential role of HIV drug resistance testing for population-based surveillance and individual patient management in sub-Saharan Africa. We review the strengths and challenges of promising low-cost technologies and how they can be implemented. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Modeling Outcomes of First-Line Antiretroviral Therapy and Rate of CD4 Counts Change among a Cohort of HIV/AIDS Patients in Ethiopia: A Retrospective Cohort Study.

    Directory of Open Access Journals (Sweden)

    Tadesse Awoke

    Full Text Available Antiretroviral therapy has shown to be effective in reducing morbidity and mortality in patients infected with HIV for the past couples of decades. However, there remains a need to better understand the characteristics of long-term treatment outcomes in resource poor settings. The main aim of this study was to determine and compare the long-term response of patients on nevirapine and efavirenz based first line antiretroviral therapy regimen in Ethiopia.Hospital based retrospective cohort study was conducted from January 2009 to December 2013 at University hospital located in Northwest Ethiopia. Human subject research approval for this study was received from University of Gondar Research Ethics Committee and the medical director of the hospital. Cox-proportional hazards model was used to assess the effect of baseline covariates on composite outcome and a semi-parametric mixed effect model was used to investigate CD4 counts response to treatments.A total of 2386 HIV/AIDS naive patients were included in this study. Nearly one-in-four patients experienced the events, of which death, lost to follow up, treatment substitution and discontinuation of Non-Nucleoside Reverse Transcriptase Inhibitors(NNRTI accounted: 99 (26.8%, 122 (33.0%, 137 (37.0% and 12 (3.2%, respectively. The hazard of composite outcome on nevirapine compared with efavirenz was 1.02(95%CI: 0.52-1.99 with p-value = 0.96. Similarly, the hazard of composite outcome on tenofovir and stavudine compared with zidovudine were 1.87 (95%CI: 1.52-2.32, p-value <