Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

DEFF Research Database (Denmark)

Fox, Zoe; Phillips, Andrew; Cohen, Cal

2008-01-01

the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

NARCIS (Netherlands)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

2011-01-01

The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

Science.gov (United States)

Tarasova, O A; Filimonov, D A; Poroikov, V V

2017-10-01

Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

Science.gov (United States)

Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

2011-01-01

In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-07-01

HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

Science.gov (United States)

Sluis-Cremer, Nicolas

2014-07-31

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

Directory of Open Access Journals (Sweden)

Anna Figueiredo

2006-11-01

Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

Immune pressure analysis of protease and reverse transcriptase ...

African Journals Online (AJOL)

/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Nicolas Sluis-Cremer

2014-07-01

Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

Diagnosis, antiretroviral therapy, and emergence of resistance to antiretroviral agents in HIV-2 infection: a review

Directory of Open Access Journals (Sweden)

Maia Hightower

Full Text Available Human immunodeficiency virus type 1 (HIV-1 and type 2 (HIV-2 are the causative agents of AIDS. HIV-2 is prevalent at moderate to high rates in West African countries, such as Senegal, Guinea, Gambia, and Cape Verde. Diagnosis of HIV-2 is made with a positive HIV-1/HIV-2 ELISA or simple/rapid assay, followed by one or two confirmatory tests specific for HIV-2. Following CD4+ T cell counts, HIV-2 viral burden and clinical signs and symptoms of immunodeficiency are beneficial in monitoring HIV-2 disease progression. Although non-nucleoside reverse transcriptase inhibitors are ineffective in treating HIV-2, nucleoside reverse transcriptase inhibitors and protease inhibitors can be effective in dual and triple antiretroviral regimens. Their use can decrease HIV-2 viral load, increase CD4+ T cell counts and improve AIDS-related symptoms. HIV-2 resistance to various nucleoside reverse transcriptase inhibitors and protease inhibitors, including zidovudine, lamivudine, ritonavir and indinavir, has been identified in some HIV-2 infected patients on antiretroviral therapy. The knowledge of HIV-2 peculiarities, when compared to HIV-1, is crucial to helping diagnose and guide the clinician in the choice of the initial antiretroviral regimen and for monitoring therapy success.

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics.

Science.gov (United States)

Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S

2014-06-01

The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

Science.gov (United States)

Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

2014-01-01

The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

DEFF Research Database (Denmark)

Lundgren, Jens

2008-01-01

BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

OpenAIRE

Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

2014-01-01

The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

Science.gov (United States)

Markowitz, Martin; Sarafianos, Stefan G

2018-07-01

4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

Challenges in Initiating Antiretroviral Therapy in 2010

Directory of Open Access Journals (Sweden)

Cécile L Tremblay

2010-01-01

Full Text Available Many clinical trials have shown that initiating antiretroviral therapy (ART at higher rather than lower CD4 T cell-positive counts results in survival benefit. Early treatment can help prevent end-organ damage associated with HIV replication and can decrease infectivity. The mainstay of treatment is either a non-nucleoside reverse transcriptase inhibitor or a ritonavir-boosted protease inhibitor in combination with two nucleoside reverse transcriptase inhibitors. While effective at combating HIV, ART can produce adverse alterations of lipid parameters, with some studies suggesting a relationship between some anti-retroviral agents and cardiovascular disease. As the HIV-positive population ages, issues such as hypertension and diabetes must be taken into account when initiating ART. Adhering to ART can be difficult; however, nonoptimal adherence to ART can result in the development of resistance; thus, drug characteristics and the patient’s preparedness to begin therapy must be considered. Reducing the pill burden through the use of fixed-dose antiretroviral drug combinations can facilitate adherence.

Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

DEFF Research Database (Denmark)

Sabin, Caroline A; Worm, Signe W; Weber, Rainer

2008-01-01

cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

DEFF Research Database (Denmark)

Kirk, Ole; Lundgren, Jens D; Pedersen, Court

2003-01-01

BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

OpenAIRE

Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

Science.gov (United States)

Sivan, Sree Kanth; Manga, Vijjulatha

2010-06-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

Science.gov (United States)

Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

2017-12-01

Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

Science.gov (United States)

Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

2017-01-17

Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens.

Science.gov (United States)

Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat

2011-01-01

We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

Science.gov (United States)

Patick, A K; Boritzki, T J; Bloom, L A

1997-10-01

Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

Nelfinavir and Non-Nucleoside Reverse Transcriptase Inhibitor-Based Salvage Regimes in Heavily Hiv Pretreated Patients

Directory of Open Access Journals (Sweden)

Jean-Guy Baril

2003-01-01

Full Text Available OBJECTIVE: To assess the efficacy of nelfinavir mesylate (NFV in combination with delavirdine mesylate(DLV or efavirenz (EFV and other antiretroviral agents following virological failure on other protease inhibitor (PI-based regimens.

Reverse transcriptase inhibitors as potential colorectal microbicides.

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

2009-05-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

Science.gov (United States)

Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

2017-11-08

The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

Science.gov (United States)

Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

2008-10-01

Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

Adipocytes Impair Efficacy of Antiretroviral Therapy

Science.gov (United States)

Couturier, Jacob; Winchester, Lee C.; Suliburk, James W.; Wilkerson, Gregory K.; Podany, Anthony T.; Agarwal, Neeti; Chua, Corrine Ying Xuan; Nehete, Pramod N.; Nehete, Bharti P.; Grattoni, Alessandro; Sastry, K. Jagannadha; Fletcher, Courtney V.; Lake, Jordan E.; Balasubramanyan, Ashok; Lewis, Dorothy E.

2018-01-01

Adequate distribution of antiretroviral drugs to infected cells in HIV patients is critical for viral suppression. In humans and primates, HIV- and SIV-infected CD4 T cells in adipose tissues have recently been identified as reservoirs for infectious virus. To better characterize adipose tissue as a pharmacological sanctuary for HIV-infected cells, in vitro experiments were conducted to assess antiretroviral drug efficacy in the presence of adipocytes, and drug penetration in adipose tissue cells (stromal-vascular-fraction cells and mature adipocytes) was examined in treated humans and monkeys. Co-culture experiments between HIV-1-infected CD4 T cells and primary human adipocytes showed that adipocytes consistently reduced the antiviral efficacy of the nucleotide reverse transcriptase inhibitor tenofovir and its prodrug forms tenofovir disoproxil fumarate (TDF) and tenofovir alafenamide (TAF). In HIV-infected persons, LC-MS/MS analysis of intracellular lysates derived from adipose tissue stromal-vascular-fraction cells or mature adipocytes suggested that integrase inhibitors penetrate adipose tissue, whereas penetration of nucleoside/nucleotide reverse transcriptase inhibitors such as TDF, emtricitabine, abacavir, and lamivudine is restricted. The limited distribution and functions of key antiretroviral drugs within fat depots may contribute to viral persistence in adipose tissue. PMID:29630975

Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

Science.gov (United States)

Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

2009-11-01

Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

Directory of Open Access Journals (Sweden)

Rami Kantor

2005-04-01

Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

Science.gov (United States)

Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

2002-12-01

Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

NARCIS (Netherlands)

Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

2004-01-01

Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

Antiretroviral drug susceptibility among drug-naive adults with recent HIV infection in Rakai, Uganda.

Science.gov (United States)

Eshleman, Susan H; Laeyendecker, Oliver; Parkin, Neil; Huang, Wei; Chappey, Colombe; Paquet, Agnes C; Serwadda, David; Reynolds, Steven J; Kiwanuka, Noah; Quinn, Thomas C; Gray, Ronald; Wawer, Maria

2009-04-27

To analyze antiretroviral drug susceptibility in HIV from recently infected adults in Rakai, Uganda, prior to the availability of antiretroviral drug treatment. Samples obtained at the time of HIV seroconversion (1998-2003) were analyzed using the GeneSeq HIV and PhenoSense HIV assays (Monogram Biosciences, Inc., South San Francisco, California, USA). Test results were obtained for 104 samples (subtypes: 26A, 1C, 66D, 9A/D, 1C/D, 1 intersubtype recombinant). Mutations used for genotypic surveillance of transmitted antiretroviral drug resistance were identified in six samples: three had nucleoside reverse transcriptase inhibitor (NRTI) surveillance mutations (two had M41L, one had K219R), and three had protease inhibitor surveillance mutations (I47V, F53L, N88D); none had nonnucleoside reverse transcriptase inhibitor (NNRTI) surveillance mutations. Other resistance-associated mutations were identified in some samples. However, none of the samples had a sufficient number of mutations to predict reduced antiretroviral drug susceptibility. Ten (9.6%) of the samples had reduced phenotypic susceptibility to at least one drug (one had partial susceptibility to didanosine, one had nevirapine resistance, and eight had resistance or partial susceptibility to at least one protease inhibitor). Fifty-three (51%) of the samples had hypersusceptibility to at least one drug (seven had zidovudine hypersusceptibility, 28 had NNRTI hypersusceptibility, 34 had protease inhibitor hypersusceptibility). Delavirdine hypersusceptibility was more frequent in subtype A than D. In subtype D, efavirenz hypersusceptibility was associated with substitutions at codon 11 in HIV-reverse transcriptase. Phenotyping detected reduced antiretroviral drug susceptibility and hypersusceptibility in HIV from some antiretroviral-naive Ugandan adults that was not predicted by genotyping. Phenotyping may complement genotyping for analysis of antiretroviral drug susceptibility in populations with nonsubtype B

HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

Science.gov (United States)

Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

2015-12-15

Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains.

Science.gov (United States)

Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania

2018-02-01

Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

Science.gov (United States)

Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

2009-01-01

We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

Science.gov (United States)

Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

2017-06-01

We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

Pharmacokinetics of antiretroviral drugs in anatomical sanctuary sites: the male and female genital tract.

Science.gov (United States)

Else, Laura J; Taylor, Stephen; Back, David J; Khoo, Saye H

2011-01-01

HIV resides within anatomical 'sanctuary sites', where local drug exposure and viral dynamics may differ significantly from the systemic compartment. Suboptimal antiretroviral concentrations in the genital tract may result in compartmentalized viral replication, selection of resistant mutations and possible re-entry of wild-type/resistant virus into the systemic circulation. Therefore, achieving adequate antiretroviral exposure in the genital tract has implications for the prevention of sexual and vertical transmission of HIV. Penetration of antiretrovirals in the genital tract is expressed by accumulation ratios derived from the measurement of drug concentrations in time-matched seminal plasma/cervicovaginal fluid and plasma samples. Penetration varies by gender and may be drug (as opposed to class) specific with high interindividual variability. Concentrations in seminal plasma are highest for nucleoside analogues and lowest for protease inhibitors and efavirenz. Seminal accumulation of newer agents, raltegravir and maraviroc, is moderate (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitors [lamivudine/zidovudine/tenofovir/didanosine > stavudine/abacavir] > raltegravir > indinavir/maraviroc/nevirapine > efavirenz/protease inhibitors [amprenavir/atazanavir/darunavir > lopinavir/ritonavir > saquinavir] > enfuvirtide). In the female genital tract, the nucleoside analogues exhibit high accumulation ratios, whereas protease inhibitors have limited penetration; however, substantial variability exists between individuals and study centres. Second generation non-nucleoside reverse transcriptase inhibitor etravirine, and maraviroc and raltegravir, demonstrate effective accumulation in cervicovaginal secretions (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitor [zidovudine/lamivudine/didanosine > emtricitabine/tenofovir] > indinavir > maraviroc/raltegravir/darunavir/etravirine > nevirapine

Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals.

Science.gov (United States)

Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi

2016-12-10

The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

Science.gov (United States)

Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

2000-05-18

To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

Efficacy and durability of nevirapine in antiretroviral drug naive patients

NARCIS (Netherlands)

Lange, Joep M. A.

2003-01-01

Nevirapine is a non-nucleoside reverse transcriptase inhibitor (NNRTI) that was first reported in the scientific literature in 1990. Varying doses of nevirapine (NVP) and a number of regimens containing this NNRTI have been studied in antiretroviral (ARV) naive patients. Four key studies have

Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

OpenAIRE

DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

2012-01-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

2013-11-01

Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

Czech Academy of Sciences Publication Activity Database

Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

2016-01-01

Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

Science.gov (United States)

Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

2016-05-01

Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

2011-01-01

We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

Lower genetic variability of HIV-1 and antiretroviral drug resistance in pregnant women from the state of Pará, Brazil.

Science.gov (United States)

Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães

2017-04-12

The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.

Long-term effectiveness of highly active antiretroviral therapy (HAART) in perinatally HIV-infected children in Denmark

DEFF Research Database (Denmark)

Bracher, Linda; Valerius, Niels Henrik; Rosenfeldt, Vibeke

2007-01-01

children treated with HAART. Initial HAART included 2 nucleoside reverse-transcriptase inhibitors in combination with either a protease inhibitor (n =38) or a non-nucleoside reverse-transcriptase inhibitor (n =12). 19 (39%) patients were previously treated with mono- or dual therapy. Baseline......The long-term impact of highly active antiretroviral therapy (HAART) on HIV-1 infected children is not well known. The Danish Paediatric HIV Cohort Study includes all patients ... characteristics were median CD4 percentage 14% and HIV-RNA viral load 4.9 log(10). Within the first 12 weeks of therapy approximately 60% achieved HIV-RNA viral load children changed the components of HAART. The proportion of children with CD4...

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

DEFF Research Database (Denmark)

Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy

2011-01-01

Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

Directory of Open Access Journals (Sweden)

Mark A Winters

Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

Science.gov (United States)

Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

2004-01-01

The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

Science.gov (United States)

Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

2012-01-01

1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties.

Science.gov (United States)

Fang, Evandro Fei; Ng, Tzi Bun

2015-04-01

Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

Drug resistance mutations in HIV type 1 isolates from naive patients eligible for first line antiretroviral therapy in JJ Hospital, Mumbai, India.

Science.gov (United States)

Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J

2011-12-01

More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.

Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

Science.gov (United States)

Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

2014-04-01

A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

Differences in Lipid Measurements by Antiretroviral Regimen Exposure in Cohorts from Asia and Australia

Directory of Open Access Journals (Sweden)

Amit C. Achhra

2012-01-01

Full Text Available We explored the mean differences in routinely measured lipids (total cholesterol, triglycerides, and high-density lipoprotein cholesterol according to exposure to different combination antiretroviral regimens in Asian (n=2051 and Australian (predominantly Caucasian, n=794 cohorts. The regimen was defined as at least 3 antiretroviral drugs with at least 2 nucleoside-reverse transcriptases (NRTIs and either of at least one protease inhibitor (PI or non-nucleoside-reverse transcriptases (NNRTIs. We categorised cART regimens as: NRTIs as tenofovir based or not; NNRTIs as nevirapine or efavirenz (but not both; and PI as atazanavir based or not. We found that the impact of various antiretroviral regimens on lipids in Asian and Australian cohorts was only different by cohort for total cholesterol (P for interaction between regimen and cohort: 0.05. The differences in total cholesterol were however small and unlikely to be of clinical significance. Overall, tenofovir with nevirapine or atazanavir was associated with the most favorable lipids, while the PI regimens without tenofovir and atazanavir were associated with least favorable lipids. We conclude that the impact of various ART regimens on lipids is largely similar in Asian and Australian cohorts and that the newer drugs such as tenofovir and atazanavir are likely to provide similar benefit in terms of lipid profiles in both populations.

Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

Science.gov (United States)

Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

2000-05-04

Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

Protecting the fetus against HIV infection: a systematic review of placental transfer of antiretrovirals.

Science.gov (United States)

McCormack, Shelley A; Best, Brookie M

2014-11-01

Maternal-to-fetal transfer of antiretroviral drugs contributes to prevention of vertical transmission of HIV. This systematic review discusses published studies containing data pertaining to the pharmacokinetics of placental transfer of antiretrovirals in humans, including paired cord and maternal plasma samples collected at the time of delivery as well as ex vivo placental perfusion models. Articles pertaining to placental transfer of antiretrovirals were identified from PubMed, from references of included articles, and from US Department of Health and Human Services Panel on Treatment of HIV-infected Pregnant Women and Prevention of Perinatal Transmission guidelines. Articles from non-human animal models or that had no original maternal-to-fetal transfer data were excluded. PRISMA guidelines were followed. A total of 103 published studies were identified. Data across studies appeared relatively consistent for the nucleoside reverse transcriptase inhibitors (NRTIs) and the non-nucleotide reverse transcriptase inhibitors (NNRTIs), with cord to maternal ratios approaching 1 for many of these agents. The protease inhibitors atazanavir and lopinavir exhibited consistent maternal-to-fetal transfer across studies, although the transfer may be influenced by variations in drug-binding proteins. The protease inhibitors indinavir, nelfinavir, and saquinavir exhibited unreliable placental transport, with cord blood concentrations that were frequently undetectable. Limited data, primarily from case reports, indicate that darunavir and raltegravir provide detectable placental transfer. These findings appear consistent with current guidelines of using two NRTIs plus an NNRTI, atazanavir/ritonavir, or lopinavir/ritonavir to maximize placental transfer as well as to optimally suppress maternal viral load. Darunavir/ritonavir and raltegravir may reasonably serve as second-line agents.

HIV-1 drug resistance before initiation or re-initiation of first-line antiretroviral therapy in low-income and middle-income countries: a systematic review and meta-regression analysis

NARCIS (Netherlands)

Gupta, Ravindra K.; Gregson, John; Parkin, Neil; Haile-Selassie, Hiwot; Tanuri, Amilcar; Andrade Forero, Liliana; Kaleebu, Pontiano; Watera, Christine; Aghokeng, Avelin; Mutenda, Nicholus; Dzangare, Janet; Hone, San; Hang, Zaw Zaw; Garcia, Judith; Garcia, Zully; Marchorro, Paola; Beteta, Enrique; Giron, Amalia; Hamers, Raph; Inzaule, Seth; Frenkel, Lisa M.; Chung, Michael H.; de Oliveira, Tulio; Pillay, Deenan; Naidoo, Kogie; Kharsany, Ayesha; Kugathasan, Ruthiran; Cutino, Teresa; Hunt, Gillian; Avila Rios, Santiago; Doherty, Meg; Jordan, Michael R.; Bertagnolio, Silvia

2018-01-01

Pretreatment drug resistance in people initiating or re-initiating antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTIs) might compromise HIV control in low-income and middle-income countries (LMICs). We aimed to assess the scale of this problem and whether

Antiretroviral Drug Use in a Cross-Sectional Population Survey in Africa: NIMH Project Accept (HPTN 043).

Science.gov (United States)

Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H

2017-02-01

Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.

Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study.

Science.gov (United States)

Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A

2017-01-01

Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

Evaluation of inadequate anti-retroviral treatment in patients with HIV/AIDS

Directory of Open Access Journals (Sweden)

Leonardo Carvalho da Fonseca

2012-04-01

Full Text Available INTRODUCTION: Since the emergence of antiretroviral therapy, the survival of patients infected with human immunodeficiency virus has increased. Non-adherence to this therapy is directly related to treatment failure, which allows the emergence of resistant viral strains. METHODS: A retrospective descriptive study of the antiretroviral dispensing records of 229 patients from the Center for Health Care, University Hospital, Federal University of Juiz de Fora, Brazil, was conducted between January and December 2009. RESULTS: The study aimed to evaluate patient compliance and determine if there was an association between non-adherence and the therapy. Among these patients, 63.8% were men with an average age of 44.0 ± 9.9 years. The most used treatment was a combination of 2 nucleoside reverse transcriptase inhibitors with 1 non-nucleoside reverse transcriptase inhibitor (55.5% or with 2 protease inhibitors (28.8%. It was found that patients taking lopinavir/ritonavir with zidovudine and lamivudine had a greater frequency of inadequate treatment than those taking atazanavir with zidovudine and lamivudine (85% and 83.3%, respectively. Moreover, when the combination of zidovudine/ lamivudine was used, the patients were less compliant (χ2 = 4.468, 1 degree of freedom, p = 0.035. CONCLUSIONS: The majority of patients failed to correctly adhere to their treatment; therefore, it is necessary to implement strategies that lead to improved compliance, thus ensuring therapeutic efficacy and increased patient survival.

Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1: 96 week results from the NEAT001/ANRS143 randomised non-inferiority trial

NARCIS (Netherlands)

Raffi, François; Babiker, Abdel G.; Richert, Laura; Molina, Jean-Michel; George, Elizabeth C.; Antinori, Andrea; Arribas, Jose R.; Grarup, Jesper; Hudson, Fleur; Schwimmer, Christine; Saillard, Juliette; Wallet, Cédrick; Jansson, Per O.; Allavena, Clotilde; van Leeuwen, Remko; Delfraissy, Jean-François; Vella, Stefano; Chêne, Geneviève; Pozniak, Anton; Dedes, Nikos; Autran, Brigitte; Bucciardini, Raffaella; Horban, Andrzej; Arribas, José; Boffito, Marta; Pillay, Deenan; Franquet, Xavier; Schwarze, Siegfried; Fischer, Aurélie; Diallo, Alpha; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; Gatell, José; Sandström, Eric; Flepp, Markus; Ewings, Fiona; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Soussi, Malika; Taieb, Audrey; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, André; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Raffi, Francois; Ragnaud, Jean Marie; Weiss, Laurence; Yazdanpanah, Yazdan; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; Eeden, Van; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Gonzalez Garcia, Juan; López Aldeguer, José; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Pilar Miralles, Martin; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Boucher, Charles; Calvez, Vincent; Collins, Simon; Dunn, David; Fox, Zoe; Perno, Carlo Federico; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; Arribas, Jose; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria

2014-01-01

Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. Between August, 2010, and September, 2011, we

Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

Directory of Open Access Journals (Sweden)

Ana Luiza Chaves Valadão

2015-06-01

Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

Directory of Open Access Journals (Sweden)

Oluwafeyisetan O. Adebiyi

2015-12-01

Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia

OpenAIRE

Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

2014-01-01

Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...

High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

Science.gov (United States)

Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

2005-01-01

Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

Characterizing Class‐Specific Exposure‐Viral Load Suppression Response of HIV Antiretrovirals Using A Model‐Based Meta‐Analysis

Science.gov (United States)

Xu, Y; Li, YF; Zhang, D; Dockendorf, M; Tetteh, E; Rizk, ML; Grobler, JA; Lai, M‐T; Gobburu, J

2016-01-01

We applied model‐based meta‐analysis of viral suppression as a function of drug exposure and in vitro potency for short‐term monotherapy in human immunodeficiency virus type 1 (HIV‐1)‐infected treatment‐naïve patients to set pharmacokinetic targets for development of nonnucleoside reverse transcriptase inhibitors (NNRTIs) and integrase strand transfer inhibitors (InSTIs). We developed class‐specific models relating viral load kinetics from monotherapy studies to potency normalized steady‐state trough plasma concentrations. These models were integrated with a literature assessment of doses which demonstrated to have long‐term efficacy in combination therapy, in order to set steady‐state trough concentration targets of 6.17‐ and 2.15‐fold above potency for NNRTIs and InSTIs, respectively. Both the models developed and the pharmacokinetic targets derived can be used to guide compound selection during preclinical development and to predict the dose–response of new antiretrovirals to inform early clinical trial design. PMID:27171172

Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

International Nuclear Information System (INIS)

Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

2004-01-01

Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

Directory of Open Access Journals (Sweden)

Ajay Kumar

2010-01-01

Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

Bone mineral density and inflammatory and bone biomarkers after darunavir-ritonavir combined with either raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults with HIV-1: a substudy of the NEAT001/ANRS143 randomised trial

NARCIS (Netherlands)

Bernardino, Jose I.; Mocroft, Amanda; Mallon, Patrick W.; Wallet, Cedrick; Gerstoft, Jan; Russell, Charlotte; Reiss, Peter; Katlama, Christine; de Wit, Stephane; Richert, Laura; Babiker, Abdel; Buño, Antonio; Castagna, Antonella; Girard, Pierre-Marie; Chene, Genevieve; Raffi, Francois; Arribas, Jose R.; Dedes, Nikos; Allavena, Clotilde; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raffaella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurelie; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jurgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Prins, Jan; Wit, Ferdinand W. N. M.; Nieuwkerk, Pythia

2015-01-01

Osteopenia, osteoporosis, and low bone mineral density are frequent in patients with HIV. We assessed the 96 week loss of bone mineral density associated with a nucleoside or nucleotide reverse transcriptase inhibitor (NtRTI)-sparing regimen. Antiretroviral-naive adults with HIV were enrolled in 78

Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

Science.gov (United States)

Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

2018-01-01

Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

Impact of switching antiretroviral therapy on lipodystrophy and other metabolic complications: a review

DEFF Research Database (Denmark)

Hansen, Birgitte Rønde; Haugaard, Steen B; Iversen, Johan

2004-01-01

Following the introduction of highly active antiretroviral therapy (HAART), metabolic and morphological complications known as HIV associated lipodystrophy syndrome (HALS) have been increasingly common. The approaches to target these complications span from resistance exercise, diet and use...... with the disfiguring body-alterations known as HALS. More recently, however, regimens containing nucleoside reverse-transcriptase inhibitors (NRTI) have attracted attention. Reviewing switch studies regarding metabolic parameters and body shape changes, certain trends emerge. Switching from PI, the metabolic...

A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

Directory of Open Access Journals (Sweden)

Marcin Kierczak

2009-10-01

Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

Directory of Open Access Journals (Sweden)

Meytal Galilee

2018-01-01

Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

Systematic review of antiretroviral-associated lipodystrophy: lipoatrophy, but not central fat gain, is an antiretroviral adverse drug reaction.

Directory of Open Access Journals (Sweden)

Reneé de Waal

Full Text Available BACKGROUND: Lipoatrophy and/or central fat gain are observed frequently in patients on antiretroviral therapy (ART. Both are assumed to be antiretroviral adverse drug reactions. METHODS: We conducted a systematic review to determine whether fat loss or gain was more common in HIV-infected patients on ART than in uninfected controls; was associated with specific antiretrovirals; and would reverse after switching antiretrovirals. RESULTS: Twenty-seven studies met our inclusion criteria. One cohort study reported more lipoatrophy, less subcutaneous fat gain, but no difference in central fat gain in HIV-infected patients on ART than in controls. Randomised controlled trials (RCTs showed more limb fat loss (or less fat gain with the following regimens: stavudine (versus other nucleoside reverse transcriptase inhibitors (NRTIs; efavirenz (versus protease inhibitors (PIs; and NRTI-containing (versus NRTI-sparing. RCTs showed increased subcutaneous fat after switching to NRTI-sparing regimens or from stavudine/zidovudine to abacavir/tenofovir. There were no significant between-group differences in trunk and/or visceral fat gain in RCTs of various regimens, but results from efavirenz versus PI regimens were inconsistent. There was no significant between-group differences in central fat gain in RCTs switched to NRTI-sparing regimens, or from PI-containing regimens. CONCLUSIONS: There is clear evidence of a causal relationship between NRTIs (especially thymidine analogues and lipoatrophy, with concomitant PIs possibly having an ameliorating effect or efavirenz causing additive toxicity. By contrast, central fat gain appears to be a consequence of treating HIV infection, because it is not different from controls, is not linked to any antiretroviral class, and doesn't improve on switching.

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

Science.gov (United States)

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

International Nuclear Information System (INIS)

Bavand, M.R.; Laub, O.

1988-01-01

Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

Science.gov (United States)

Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

2013-11-01

BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

Cardiovascular disease risk factors in HIV patients--association with antiretroviral therapy. Results from the DAD study

DEFF Research Database (Denmark)

Friis-Møller, Nina; Weber, Rainer; Reiss, Peter

2003-01-01

, a prospective multinational cohort study initiated in 1999. METHODS: Cross-sectional analyses of CVD risk factors at baseline. The data collected includes data on demographic variables, cigarette smoking, diabetes mellitus, hypertension, dyslipidaemia, body mass index, stage of HIV infection, antiretroviral...... to the prevalence among antiretroviral therapy (ART)-naive subjects. Subjects who have discontinued ART as well as subjects receiving nucleoside reverse transcriptase inhibitors had similar cholesterol levels to treatment-naive subjects. Higher CD4 cell count, lower plasma HIV RNA levels, clinical signs......OBJECTIVE: To determine the prevalence of risk factors for cardiovascular disease (CVD) among HIV-infected persons, and to investigate any association between such risk factors, stage of HIV disease, and use of antiretroviral therapies. DESIGN: Baseline data from 17,852 subjects enrolled in DAD...

HIV-1 drug resistance in recently HIV-infected pregnant mother's naïve to antiretroviral therapy in Dodoma urban, Tanzania.

Science.gov (United States)

Vairo, Francesco; Nicastri, Emanuele; Liuzzi, Giuseppina; Chaula, Zainab; Nguhuni, Boniface; Bevilacqua, Nazario; Forbici, Federica; Amendola, Alessandra; Fabeni, Lavinia; De Nardo, Pasquale; Perno, Carlo Federico; Cannas, Angela; Sakhoo, Calistus; Capobianchi, Maria Rosaria; Ippolito, Giuseppe

2013-09-21

HIV resistance affects virological response to therapy and efficacy of prophylaxis in mother-to-child-transmission. The study aims to assess the prevalence of HIV primary resistance in pregnant women naïve to antiretrovirals. Cross sectional baseline analysis of a cohort of HIV + pregnant women (HPW) enrolled in the study entitled Antiretroviral Management of Antenatal and Natal HIV Infection (AMANI, peace in Kiswahili language). The AMANI study began in May 2010 in Dodoma, Tanzania. In this observational cohort, antiretroviral treatment was provided to all women from the 28th week of gestation until the end of the breastfeeding period. Baseline CD4 cell count, viral load and HIV drug-resistance genotype were collected. Drug-resistance analysis was performed on 97 naïve infected-mothers. The prevalence of all primary drug resistance and primary non-nucleoside reverse-transcriptase inhibitors resistance was 11.9% and 7.5%, respectively. K103S was found in two women with no M184V detection. HIV-1 subtype A was the most commonly identified, with a high prevalence of subtype A1, followed by C, D, C/D recombinant, A/C recombinant and A/D recombinant. HIV drug- resistance mutations were detected in A1 and C subtypes. Our study reports an 11.9% prevalence rate of primary drug resistance in naïve HIV-infected pregnant women from a remote area of Tanzania. Considering that the non-nucleoside reverse-transcriptase inhibitors are part of the first-line antiretroviral regimen in Tanzania and all of Africa, resistance surveys should be prioritized in settings where antiretroviral therapy programs are scaled up.

Tenofovir-based regimens associated with less drug resistance in HIV-1-infected Nigerians failing first-line antiretroviral therapy.

Science.gov (United States)

Etiebet, Mary-Ann A; Shepherd, James; Nowak, Rebecca G; Charurat, Man; Chang, Harry; Ajayi, Samuel; Elegba, Olufunmilayo; Ndembi, Nicaise; Abimiku, Alashle; Carr, Jean K; Eyzaguirre, Lindsay M; Blattner, William A

2013-02-20

In resource-limited settings, HIV-1 drug resistance testing to guide antiretroviral therapy (ART) selection is unavailable. We retrospectively conducted genotypic analysis on archived samples from Nigerian patients who received targeted viral load testing to confirm treatment failure and report their drug resistance mutation patterns. Stored plasma from 349 adult patients on non-nucleoside reverse transcriptase inhibitor (NNRTI) regimens was assayed for HIV-1 RNA viral load, and samples with more than 1000 copies/ml were sequenced in the pol gene. Analysis for resistance mutations utilized the IAS-US 2011 Drug Resistance Mutation list. One hundred and seventy-five samples were genotyped; the majority of the subtypes were G (42.9%) and CRF02_AG (33.7%). Patients were on ART for a median of 27 months. 90% had the M184V/I mutation, 62% had at least one thymidine analog mutation, and 14% had the K65R mutation. 97% had an NNRTI resistance mutation and 47% had at least two etravirine-associated mutations. In multivariate analysis tenofovir-based regimens were less likely to have at least three nucleoside reverse transcriptase inhibitor (NRTI) mutations after adjusting for subtype, previous ART, CD4, and HIV viral load [P < 0.001, odds ratio (OR) 0.04]. 70% of patients on tenofovir-based regimens had at least two susceptible NRTIs to include in a second-line regimen compared with 40% on zidovudine-based regimens (P = 0.04, OR = 3.4). At recognition of treatment failure, patients on tenofovir-based first-line regimens had fewer NRTI drug-resistant mutations and more active NRTI drugs available for second-line regimens. These findings can inform strategies for ART regimen sequencing to optimize long-term HIV treatment outcomes in low-resource settings.

Update on HIV-1 acquired and transmitted drug resistance in Africa.

Science.gov (United States)

Ssemwanga, Deogratius; Lihana, Raphael W; Ugoji, Chinenye; Abimiku, Alash'le; Nkengasong, John; Dakum, Patrick; Ndembi, Nicaise

2015-01-01

The last ten years have witnessed a significant scale-up and access to antiretroviral therapy in Africa, which has improved patient quality of life and survival. One major challenge associated with increased access to antiretroviral therapy is the development of antiretroviral resistance due to inconsistent drug supply and/or poor patient adherence. We review the current state of both acquired and transmitted drug resistance in Africa over the past ten years (2001-2011) to identify drug resistance associated with the different drug regimens used on the continent and to help guide affordable strategies for drug resistance surveillance. A total of 161 references (153 articles, six reports and two conference abstracts) were reviewed. Antiretroviral resistance data was available for 40 of 53 African countries. A total of 5,541 adult patients from 99 studies in Africa were included in this analysis. The pooled prevalence of drug resistance mutations in Africa was 10.6%, and Central Africa had the highest prevalence of 54.9%. The highest prevalence of nucleoside reverse transcriptase inhibitor mutations was in the west (55.3%) and central (54.8%) areas; nonnucleoside reverse transcriptase inhibitor mutations were highest in East Africa (57.0%) and protease inhibitors mutations highest in Southern Africa (16.3%). The major nucleoside reverse transcriptase inhibitor mutation in all four African regions was M184V. Major nonnucleoside reverse transcriptase inhibitor as well as protease inhibitor mutations varied by region. The prevalence of drug resistance has remained low in several African countries although the emergence of drug resistance mutations varied across countries. Continued surveillance of antiretroviral therapy resistance remains crucial in gauging the effectiveness of country antiretroviral therapy programs and strategizing on effective and affordable strategies for successful treatment.

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

International Nuclear Information System (INIS)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

2015-01-01

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

2015-10-23

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

Characterizing Class-Specific Exposure-Viral Load Suppression Response of HIV Antiretrovirals Using A Model-Based Meta-Analysis.

Science.gov (United States)

Xu, Y; Li, Y F; Zhang, D; Dockendorf, M; Tetteh, E; Rizk, M L; Grobler, J A; Lai, M-T; Gobburu, J; Ankrom, W

2016-08-01

We applied model-based meta-analysis of viral suppression as a function of drug exposure and in vitro potency for short-term monotherapy in human immunodeficiency virus type 1 (HIV-1)-infected treatment-naïve patients to set pharmacokinetic targets for development of nonnucleoside reverse transcriptase inhibitors (NNRTIs) and integrase strand transfer inhibitors (InSTIs). We developed class-specific models relating viral load kinetics from monotherapy studies to potency normalized steady-state trough plasma concentrations. These models were integrated with a literature assessment of doses which demonstrated to have long-term efficacy in combination therapy, in order to set steady-state trough concentration targets of 6.17- and 2.15-fold above potency for NNRTIs and InSTIs, respectively. Both the models developed and the pharmacokinetic targets derived can be used to guide compound selection during preclinical development and to predict the dose-response of new antiretrovirals to inform early clinical trial design. © 2016 The Authors. Clinical and Translational Science published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.

Does short-term virologic failure translate to clinical events in antiretroviral-naïve patients initiating antiretroviral therapy in clinical practice?

DEFF Research Database (Denmark)

NN, NN; Mugavero, Michael J; May, Margaret

2008-01-01

, nevirapine, lopinavir/ritonavir, nelfinavir, or abacavir as third drugs in combination with a zidovudine and lamivudine nucleoside reverse transcriptase inhibitor backbone. MAIN OUTCOME MEASURES: Short-term (24-week) virologic failure (>500 copies/ml) and clinical events within 2 years of ART initiation.......58-2.22), lopinavir/ritonavir (1.32, 95% CI = 1.12-1.57), nelfinavir (3.20, 95% CI = 2.74-3.74), and abacavir (2.13, 95% CI = 1.82-2.50). However, the rate of clinical events within 2 years of ART initiation appeared higher only with nevirapine (adjusted hazard ratio for composite outcome measure 1.27, 95% CI = 1......OBJECTIVE: To determine whether differences in short-term virologic failure among commonly used antiretroviral therapy (ART) regimens translate to differences in clinical events in antiretroviral-naïve patients initiating ART. DESIGN: Observational cohort study of patients initiating ART between...

Follow-up on long-term antiretroviral therapy for cats infected with feline immunodeficiency virus.

Science.gov (United States)

Medeiros, Sheila de Oliveira; Abreu, Celina Monteiro; Delvecchio, Rodrigo; Ribeiro, Anísia Praxedes; Vasconcelos, Zilton; Brindeiro, Rodrigo de Moraes; Tanuri, Amilcar

2016-04-01

Feline immunodeficiency virus (FIV) is a lentivirus that induces AIDS-like disease in cats. Some of the antiretroviral drugs available to treat patients with HIV type 1 are used to treat FIV-infected cats; however, antiretroviral therapy (ART) is not used in cats as a long-term treatment. In this study, the effects of long-term ART were evaluated in domestic cats treated initially with the nucleoside transcriptase reverse inhibitor (NTRI) zidovudine (AZT) over a period ranging from 5-6 years, followed by a regimen of the NTRI lamivudine (3TC) plus AZT over 3 years. Viral load, sequencing of pol (reverse transcriptase [RT]) region and CD4:CD8 lymphocyte ratio were evaluated during and after treatment. Untreated cats were evaluated as a control group. CD4:CD8 ratios were lower, and uncharacterized resistance mutations were found in the RT region in the group of treated cats. A slight increase in viral load was observed in some cats after discontinuing treatment. The data strongly suggest that treated cats were resistant to therapy, and uncharacterized resistance mutations in the RT gene of FIV were selected for by AZT. Few studies have been conducted to evaluate the effect of long-term antiretroviral therapy in cats. To date, resistance mutations have not been described in vivo. © ISFM and AAFP 2015.

Executive summary of the GESIDA/National AIDS Plan Consensus Document on Antiretroviral Therapy in Adults Infected by the Human Immunodeficiency Virus (Updated January 2016).

Science.gov (United States)

2016-01-01

In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise 3 drugs, namely, 2 nucleoside reverse transcriptase inhibitors (NRTI), and 1 drug from another family. Four of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further 6 regimens, which are based on an INSTI, a non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with cobicistat or ritonavir (PI/COBI, PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include 3 (or at least 2) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

S. Ganguly

2008-01-01

Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

DEFF Research Database (Denmark)

Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

2013-01-01

Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

NARCIS (Netherlands)

I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

2015-01-01

textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

Executive summary of the GeSIDA/National AIDS Plan consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2014).

Science.gov (United States)

Berenguer, Juan; Polo, Rosa; Lozano, Fernando; López Aldeguer, José; Antela, Antonio; Arribas, José Ramón; Asensi, Víctor; Blanco, José Ramón; Clotet, Bonaventura; Domingo, Pere; Galindo, María José; Gatell, José María; González-García, Juan; Iribarren, José Antonio; Locutura, Jaime; López, Juan Carlos; Mallolas, Josep; Martínez, Esteban; Miralles, Celia; Miró, José M; Moreno, Santiago; Palacios, Rosario; Pérez Elías, María Jesús; Pineda, Juan Antonio; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz, Jesús; Tuset, Montserrat; Vidal, Francesc; Rivero, Antonio

2014-01-01

In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with clinical circumstances, number of CD4 cells, comorbid conditions and prevention of transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Triple Active Antiretroviral Regimen Including Enfuvirtide Via the Biojector is Effective and Safe

Directory of Open Access Journals (Sweden)

Mona Loutfy

2007-01-01

Full Text Available For full HIV virological suppression, three fully active antiretroviral agents are required. New drug classes should be included to ensure that agents are fully active. The addition of enfuvirtide and efavirenz to the present patient’s new antiretroviral regimen ensured that two fully active agents were in use in the setting of a moderate degree of nucleoside resistance and a high level of protease resistance, and where non-nucleoside reverse transcriptase inhibitors were still fully active. Both viral load and CD4 count responded favourably to this regimen. The patient received support from physicians and clinic staff in the introduction and use of enfuvirtide. To reduce injection site reactions, a needle-free injection system (Biojector proved effective.

Cardiovascular disease risk factors in HIV patients--association with antiretroviral therapy. Results from the DAD study

DEFF Research Database (Denmark)

Friis-Møller, Nina; Weber, Rainer; Reiss, Peter

2003-01-01

, a prospective multinational cohort study initiated in 1999. METHODS: Cross-sectional analyses of CVD risk factors at baseline. The data collected includes data on demographic variables, cigarette smoking, diabetes mellitus, hypertension, dyslipidaemia, body mass index, stage of HIV infection, antiretroviral......OBJECTIVE: To determine the prevalence of risk factors for cardiovascular disease (CVD) among HIV-infected persons, and to investigate any association between such risk factors, stage of HIV disease, and use of antiretroviral therapies. DESIGN: Baseline data from 17,852 subjects enrolled in DAD...... therapy. RESULTS: Almost 25% of the study population were at an age where there is an appreciable risk of CVD, with those receiving a protease inhibitor (PI) and/or non-nucleoside reverse transcriptase inhibitor (NNRTI) tending to be older. 1.4% had a previous history of CVD and 51.5% were cigarette...

Lipid profile of HIV-infected patients in relation to antiretroviral therapy: a review.

Science.gov (United States)

Souza, Suelen Jorge; Luzia, Liania Alves; Santos, Sigrid Sousa; Rondó, Patrícia Helen Carvalho

2013-01-01

This study reviewed the lipid profile of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in relation to use of antiretroviral therapy (ART), and its different classes of drugs. A total of 190 articles published in peer-reviewed journals were retrieved from PubMed and LILACS databases; 88 of them met the selection criteria and were included in the review. Patients with HIV/AIDS without ART presented an increase of triglycerides and decreases of total cholesterol, low density lipoprotein (LDL-c), and high density lipoprotein (HDL-c) levels. Distinct ART regimens appear to promote different alterations in lipid metabolism. Protease inhibitors, particularly indinavir and lopinavir, were commonly associated with hypercholesterolemia, high LDL-c, low HDL-c, and hypertriglyceridemia. The protease inhibitor atazanavir is apparently associated with a more advantageous lipid profile. Some nucleoside reverse-transcriptase inhibitors (didanosine, stavudine, and zidovudine) induced lipoatrophy and hypertriglyceridemia, whereas abacavir increased the risk of cardiovascular diseases even in the absence of apparent lipid disorders, and tenofovir resulted in lower levels of cholesterol and triglycerides. Although non-nucleoside reverse-transcriptase inhibitors predisposed to hypertriglyceridemia and hypercholesterolemia, nevirapine was particularly associated with high HDL-c levels, a protective factor against cardiovascular diseases. Therefore, the infection itself, different classes of drugs, and some drugs from the same class of ART appear to exert distinct alterations in lipid metabolism. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.

Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1

DEFF Research Database (Denmark)

Raffi, François; Babiker, Abdel G; Richert, Laura

2014-01-01

BACKGROUND: Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. METHODS: Between August, 2010......-inferior to standard treatment and represents a treatment option for patients with CD4 cell counts higher than 200 cells per μL. FUNDING: European Union Sixth Framework Programme, Inserm-ANRS, Gilead Sciences, Janssen Pharmaceuticals, Merck Laboratories....

Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

Science.gov (United States)

Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

2006-11-15

TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

Calibrated user-friendly reverse transcriptase-PCR assay

DEFF Research Database (Denmark)

Bor, M V; Sørensen, B S; Rammer, P

1998-01-01

We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

The history of antiretrovirals: key discoveries over the past 25 years.

Science.gov (United States)

De Clercq, Erik

2009-09-01

Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.

5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.

Science.gov (United States)

Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong

2018-06-18

We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

PRACTICE OF USING VIRAL PROTEASE INHIBITORS IN CHILDREN WITH HIV INFECTION

Directory of Open Access Journals (Sweden)

V.B. Denisenko

2010-01-01

Full Text Available Selection of the most effective and safest high-active antiretroviral therapies is a critical issue faced by modern HIV medicine. Authors studied 28 children with HIV infection aged from 3 to 7 divided into two groups administered a combination of two HIV reverse transcriptase nucleoside inhibitors with viral protease nelfinavir inhibitors (n = 13 and lopinavir/ritonavir (n = 15. The subjects in both groups demonstrated a decreased frequency of HIV-associated symptoms and opportunistic infections, positive dynamics of immunological indicators, suppression of HIV replication. When lopinavir/ritonavir was administered, there was more even better dynamics in clinical, immunological and virologic parameters, which allows this medication to be recommended as a antiretroviral therapy for children. Key words: HIV infection, lopinavir/ritonavir, nelfinavir, children. (Pediatric Pharmacology. – 2010; 7(1:62-67

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

Science.gov (United States)

Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

2016-05-01

Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

Science.gov (United States)

House, M.L.; Kim, C.H.; Reno, P.W.

1998-01-01

Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

Prevalence of drug resistance and importance of viral load measurements in Honduran HIV-infected patients failing antiretroviral treatment.

Science.gov (United States)

Murillo, Wendy; de Rivera, I L; Parham, L; Jovel, E; Palou, E; Karlsson, A C; Albert, J

2010-02-01

The Honduran HIV/AIDS Program began to scale up access to HIV therapy in 2002. Up to May 2008, more than 6000 patients received combination antiretroviral therapy (cART). As HIV drug resistance is the major obstacle for effective treatment, the purpose of this study was to assess the prevalence of antiretroviral drug resistance in Honduran HIV-1-infected individuals. We collected samples from 138 individuals (97 adults and 41 children) on cART with virological, immunological or clinical signs of treatment failure. HIV-1 pol sequences were obtained using an in-house method. Resistance mutations were identified according to the 2007 International AIDS Society (IAS)-USA list and predicted susceptibility to cART was scored using the ANRS algorithm. Resistance mutations were detected in 112 patients (81%), 74% in adults and 98% in children. Triple-, dual- and single-class drug resistance was documented in 27%, 43% and 11% of the study subjects, respectively. Multiple logistic regression showed that resistance was independently associated with type of treatment failure [virological failure (odds ratio (OR) = 1) vs. immunological failure (OR = 0.11; 95% confidence interval (CI) 0.030-0.43) vs. clinical failure (OR = 0.037; 95% CI 0.0063-0.22)], route of transmission (OR = 42.8; 95% CI 3.73-491), and years on therapy (OR = 1.81; 95% CI 1.11-2.93). The prevalence of antiretroviral resistance was high in Honduran HIV-infected patients with signs of treatment failure. A majority of study subjects showed dual- or triple-class resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors and protease inhibitors. Virologically defined treatment failure was a strong predictor of resistance, indicating that viral load testing is needed to correctly identify patients with treatment failure attributable to resistance.

Dyslipidemia in HIV Infected Children Receiving Highly Active Antiretroviral Therapy.

Science.gov (United States)

Mandal, Anirban; Mukherjee, Aparna; Lakshmy, R; Kabra, Sushil K; Lodha, Rakesh

2016-03-01

To assess the prevalence of dyslipidemia and lipodystrophy in Indian children receiving non-nucleoside reverse transcriptase inhibitor (NNRTI) based highly active antiretroviral therapy (HAART) and to determine the associated risk factors for the same. The present cross-sectional study was conducted at a Pediatric Clinic of a tertiary care teaching center in India, from May 2011 through December 2012. HIV infected children aged 5-15 y were enrolled if they did not have any severe disease or hospital admission within last 3 mo or receive any medications known to affect the lipid profile. Eighty-one children were on highly active antiretroviral therapy (HAART) for at least 6 mo and 16 were receiving no antiretroviral therapy (ART). Participants' sociodemographic, nutritional, clinical, and laboratory data were recorded in addition to anthropometry and evidence of lipodystrophy. Fasting lipid profile, apolipoprotein A1 and B levels were done for all the children. Among the children on highly active antiretroviral therapy (HAART), 38.3 % had dyslipidemia and 80.2 % had lipodystrophy, while 25 % antiretroviral therapy (ART) naïve HIV infected children had dyslipidemia. No clinically significant risk factors could be identified that increased the risk of dyslipidemia or lipodystrophy in children on highly active antiretroviral therapy (HAART). There is a high prevalence of dyslipidemia and lipodystrophy in Indian children with HIV infection with an imminent need to establish facilities for testing and treatment of these children for metabolic abnormalities.

Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

Science.gov (United States)

Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

2013-06-18

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Diabetes mellitus in HIV-infected patients receiving antiretroviral ...

African Journals Online (AJOL)

Primary analysis using conditional logistic regression was employed to estimate univariate .... Refers to first-line regimen in Botswana – either non-nucleoside reverse transcriptase inhibitor-based regimen (NVP or. EFV) or .... Public Health.

Management of HIV During Pregnancy

OpenAIRE

Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M

2016-01-01

According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...

HIV drug resistance following a decade of the free antiretroviral therapy programme in India: A review.

Science.gov (United States)

Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R

2018-01-01

The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

[Predictive factors of clinically significant drug-drug interactions among regimens based on protease inhibitors, non-nucleoside reverse transcriptase inhibitors and raltegravir].

Science.gov (United States)

Cervero, Miguel; Torres, Rafael; Jusdado, Juan José; Pastor, Susana; Agud, Jose Luis

2016-04-15

To determine the prevalence and types of clinically significant drug-drug interactions (CSDI) in the drug regimens of HIV-infected patients receiving antiretroviral treatment. retrospective review of database. Centre: Hospital Universitario Severo Ochoa, Infectious Unit. one hundred and forty-two participants followed by one of the authors were selected from January 1985 to December 2014. from their outpatient medical records we reviewed information from the last available visit of the participants, in relation to HIV infection, comorbidities, demographics and the drugs that they were receiving; both antiretroviral drugs and drugs not related to HIV infection. We defined CSDI from the information sheet and/or database on antiretroviral drug interactions of the University of Liverpool (http://www.hiv-druginteractions.org) and we developed a diagnostic tool to predict the possibility of CSDI. By multivariate logistic regression analysis and by estimating the diagnostic performance curve obtained, we identified a quick tool to predict the existence of drug interactions. Of 142 patients, 39 (29.11%) had some type of CSDI and in 11.2% 2 or more interactions were detected. In only one patient the combination of drugs was contraindicated (this patient was receiving darunavir/r and quetiapine). In multivariate analyses, predictors of CSDI were regimen type (PI or NNRTI) and the use of 3 or more non-antiretroviral drugs (AUC 0.886, 95% CI 0.828 to 0.944; P=.0001). The risk was 18.55 times in those receiving NNRTI and 27,95 times in those receiving IP compared to those taking raltegravir. Drug interactions, including those defined as clinically significant, are common in HIV-infected patients treated with antiretroviral drugs, and the risk is greater in IP-based regimens. Raltegravir-based prescribing, especially in patients who receive at least 3 non-HIV drugs could avoid interactions. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

Directory of Open Access Journals (Sweden)

Cha YJ

2014-09-01

Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

Vitamin E concentrations in adults with HIV/AIDS on highly active antiretroviral therapy.

Science.gov (United States)

Itinoseki Kaio, Daniella J Itinoseki; Rondó, Patricia Helen C; Luzia, Liania Alves; Souza, José Maria P; Firmino, Aline Vale; Santos, Sigrid Sousa

2014-09-15

HIV/AIDS patients are probably more predisposed to vitamin E deficiency, considering that they are more exposed to oxidative stress. Additionally, there are an extensive number of drugs in the highly active antiretroviral therapy (HAART) regimens that may interfere with vitamin E concentrations. The objective of this study was to compare serum concentrations of alpha-tocopherol in 182 HIV/AIDS patients receiving different HAART regimens. The patients were divided into three groups according to regimen: nucleoside analog reverse-transcriptase inhibitors (NRTIs) + non-nucleoside analog reverse-transcriptase inhibitors (NNRTIs); NRTIs + protease inhibitors + ritonavir; NRTIs + other classes. Alpha-tocopherol was assessed by high-performance liquid chromatography. Multiple linear regression analysis was used to evaluate the effects of HAART regimen, time of use, and compliance with the regimen on alpha-tocopherol concentrations. Alpha-tocopherol concentrations were on average 4.12 μmol/L lower for the NRTIs + other classes regimen when compared to the NRTIs + NNRTIs regimen (p = 0.037). A positive association (p < 0.001) was observed between alpha-tocopherol and cholesterol concentrations, a finding due, in part, to the relationship between liposoluble vitamins and lipid profile. This study demonstrated differences in alpha-tocopherol concentrations between patients using different HAART regimens, especially regimens involving the use of new drugs. Long-term prospective cohort studies are needed to monitor vitamin E status in HIV/AIDS patients since the beginning of treatment.

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

OpenAIRE

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2008-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection.

Science.gov (United States)

Giacobbi, Nicholas S; Sluis-Cremer, Nicolas

2017-07-01

Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

Science.gov (United States)

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults

Science.gov (United States)

Günthard, Huldrych F.; Saag, Michael S.; Benson, Constance A.; del Rio, Carlos; Eron, Joseph J.; Gallant, Joel E.; Hoy, Jennifer F.; Mugavero, Michael J.; Sax, Paul E.; Thompson, Melanie A.; Gandhi, Rajesh T.; Landovitz, Raphael J.; Smith, Davey M.; Jacobsen, Donna M.; Volberding, Paul A.

2016-01-01

IMPORTANCE New data and therapeutic options warrant updated recommendations for the use of antiretroviral drugs (ARVs) to treat or to prevent HIV infection in adults. OBJECTIVE To provide updated recommendations for the use of antiretroviral therapy in adults (aged ≥18 years) with established HIV infection, including when to start treatment, initial regimens, and changing regimens, along with recommendations for using ARVs for preventing HIV among those at risk, including preexposure and postexposure prophylaxis. EVIDENCE REVIEW A panel of experts in HIV research and patient care convened by the International Antiviral Society-USA reviewed data published in peer-reviewed journals, presented by regulatory agencies, or presented as conference abstracts at peer-reviewed scientific conferences since the 2014 report, for new data or evidence that would change previous recommendations or their ratings. Comprehensive literature searches were conducted in the PubMed and EMBASE databases through April 2016. Recommendations were by consensus, and each recommendation was rated by strength and quality of the evidence. FINDINGS Newer data support the widely accepted recommendation that antiretroviral therapy should be started in all individuals with HIV infection with detectable viremia regardless of CD4 cell count. Recommended optimal initial regimens for most patients are 2 nucleoside reverse transcriptase inhibitors (NRTIs) plus an integrase strand transfer inhibitor (InSTI). Other effective regimens include nonnucleoside reverse transcriptase inhibitors or boosted protease inhibitors with 2 NRTIs. Recommendations for special populations and in the settings of opportunistic infections and concomitant conditions are provided. Reasons for switching therapy include convenience, tolerability, simplification, anticipation of potential new drug interactions, pregnancy or plans for pregnancy, elimination of food restrictions, virologic failure, or drug toxicities. Laboratory

Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

Energy Technology Data Exchange (ETDEWEB)

Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.

2017-02-06

The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

Executive summary of the GESIDA/National AIDS Plan Consensus Document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2015).

Science.gov (United States)

Berenguer, Juan; Polo, Rosa; Aldeguer, José López; Lozano, Fernando; Aguirrebengoa, Koldo; Arribas, José Ramón; Blanco, José Ramón; Boix, Vicente; Casado, José Luis; Clotet, Bonaventura; Crespo, Manuel; Domingo, Pere; Estrada, Vicente; García, Federico; Gatell, José María; González-García, Juan; Gutiérrez, Félix; Iribarren, José Antonio; Knobel, Hernando; Llibre, Josep María; Locutura, Jaime; López, Juan Carlos; Miró, José M; Moreno, Santiago; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz-Moreno, José; Sanz, Jesús; Téllez, María Jesús; Tuset, Montserrat; Rivero, Antonio

2015-10-01

In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation vary depending on the CD4+ T-lymphocyte count, the presence of opportunistic infections or comorbid conditions, age, and the efforts to prevent the transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise three drugs, namely, two nucleoside reverse transcriptase inhibitors (NRTI) and one drug from another family. Three of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further seven regimens, which are based on an INSTI, an non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with ritonavir (PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include three (or at least two) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Effects of treatment with suppressive combination antiretroviral drug therapy and the histone deacetylase inhibitor suberoylanilide hydroxamic acid; (SAHA on SIV-infected Chinese rhesus macaques.

Directory of Open Access Journals (Sweden)

Binhua Ling

Full Text Available Viral reservoirs-persistent residual virus despite combination antiretroviral therapy (cART-remain an obstacle to cure of HIV-1 infection. Difficulty studying reservoirs in patients underscores the need for animal models that mimics HIV infected humans on cART. We studied SIV-infected Chinese-origin rhesus macaques (Ch-RM treated with intensive combination antiretroviral therapy (cART and 3 weeks of treatment with the histone deacetyalse inhibitor, suberoylanilide hydroxamic acid (SAHA.SIVmac251 infected Ch-RM received reverse transcriptase inhibitors PMPA and FTC and integrase inhibitor L-870812 beginning 7 weeks post infection. Integrase inhibitor L-900564 and boosted protease inhibitor treatment with Darunavir and Ritonavir were added later. cART was continued for 45 weeks, with daily SAHA administered for the last 3 weeks, followed by euthanasia/necropsy. Plasma viral RNA and cell/tissue-associated SIV gag RNA and DNA were quantified by qRT-PCR/qPCR, with flow cytometry monitoring changes in immune cell populations.Upon cART initiation, plasma viremia declined, remaining <30 SIV RNA copy Eq/ml during cART, with occasional blips. Decreased viral replication was associated with decreased immune activation and partial restoration of intestinal CD4+ T cells. SAHA was well tolerated but did not result in demonstrable treatment-associated changes in plasma or cell associated viral parameters.The ability to achieve and sustain virological suppression makes cART-suppressed, SIV-infected Ch-RM a potentially useful model to evaluate interventions targeting residual virus. However, despite intensive cART over one year, persistent viral DNA and RNA remained in tissues of all three animals. While well tolerated, three weeks of SAHA treatment did not demonstrably impact viral RNA levels in plasma or tissues; perhaps reflecting dosing, sampling and assay limitations.

Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

Science.gov (United States)

Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

2006-05-01

To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor.

Science.gov (United States)

Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R

2009-02-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

International Nuclear Information System (INIS)

Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

1986-01-01

The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

HIV Protease Inhibitor Use During Pregnancy Is Associated With Decreased Progesterone Levels, Suggesting a Potential Mechanism Contributing to Fetal Growth Restriction

Science.gov (United States)

Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R.; Yudin, Mark H.; Murphy, Kellie E.; Walmsley, Sharon L.; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

2015-01-01

Background. Protease inhibitor (PI)–based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. Methods. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. Results. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Conclusions. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. PMID:25030058

HIV protease inhibitor use during pregnancy is associated with decreased progesterone levels, suggesting a potential mechanism contributing to fetal growth restriction.

Science.gov (United States)

Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R; Yudin, Mark H; Murphy, Kellie E; Walmsley, Sharon L; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

2015-01-01

Protease inhibitor (PI)-based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Prevalence of HIV Antiretroviral Drug Resistance and Its Impacts on HIV-1 Virological Failures in Jiangsu, China: A Cross-Sectional Study

Directory of Open Access Journals (Sweden)

Ying Zhou

2016-01-01

Full Text Available Antiretroviral therapy (ART has been shown to improve survival of patients with Human Immunodeficiency Virus (HIV infection and to reduce HIV-1 transmission. Therefore, the Chinese central government initiated a national program to provide ART free of charge to HIV-1 patients. We conducted a cross-sectional survey in Jiangsu province to determine the level of drug resistance (DR in HIV-1 infected patients and the correlates of DR in virological failures in 2012. Approximately 10.4% of the HIV-1 patients in the study experienced virological failure after one year of ART and were divided into drug sensitive and drug resistant groups based on genotype determination. The viral loads (VLs in the drug resistant group were significantly lower than the drug sensitive group. There were two independent predictors of virological failure: male gender and increasing duration of treatment. The primary mutations observed in the study were against nucleoside reverse transcriptase inhibitors (NRTIs which were M184V (79.45% and K103N (33.70% in nonnucleoside reverse transcriptase inhibitors (NNRTIs. The overall rate of DR in Jiangsu province is still relatively low among treated patients. However, close monitoring of drug resistance in male patients in the early stages of treatment is vital to maintaining and increasing the benefits of HIV ART achieved to date.

No Evidence for Decay of the Latent Reservoir in HIV-1–Infected Patients Receiving Intensive Enfuvirtide-Containing Antiretroviral Therapy

Science.gov (United States)

Gandhi, Rajesh T.; Bosch, Ronald J.; Aga, Evgenia; Albrecht, Mary; Demeter, Lisa M.; Dykes, Carrie; Bastow, Barbara; Para, Michael; Lai, Jun; Siliciano, Robert F.; Siliciano, Janet D.; Eron, Joseph J.

2010-01-01

Human immunodeficiency virus type 1 (HIV-1) persists in a latent reservoir of infected resting memory CD4 cells in patients receiving antiretroviral therapy. We assessed whether multitarget therapy with enfuvirtide, 2 reverse-transcriptase inhibitors, and a ritonavir-boosted protease inhibitor leads to decay of this reservoir. Nineteen treatment-naive patients initiated this regimen; 9 experienced virologic suppression and continued enfuvirtide-containing therapy for at least 48 weeks. In enfuvirtide-treated patients with virological suppression, there was no decay of the latent reservoir (95% confidence interval for half-life, 11 months to infinity). The stability of the latent reservoir despite intensive therapy suggests that new strategies are needed to eradicate HIV-1 from this reservoir. PMID:20001856

HIV-1 drug resistance genotyping from antiretroviral therapy (ART naïve and first-line treatment failures in Djiboutian patients

Directory of Open Access Journals (Sweden)

Elmi Abar Aden

2012-10-01

Full Text Available Abstract In this study we report the prevalence of antiretroviral drug resistant HIV-1 genotypes of virus isolated from Djiboutian patients who failed first-line antiretroviral therapy (ART and from ART naïve patients. Patients and methods A total of 35 blood samples from 16 patients who showed first-line ART failure (>1000 viral genome copies/ml and 19 ART-naïve patients were collected in Djibouti from October 2009 to December 2009. Both the protease (PR and reverse transcriptase (RT genes were amplified and sequenced using National Agency for AIDS Research (ANRS protocols. The Stanford HIV database algorithm was used for interpretation of resistance data and genotyping. Results Among the 16 patients with first-line ART failure, nine (56.2% showed reverse transcriptase inhibitor-resistant HIV-1 strains: two (12.5% were resistant to nucleoside (NRTI, one (6.25% to non-nucleoside (NNRTI reverse transcriptase inhibitors, and six (37.5% to both. Analysis of the DNA sequencing data indicated that the most common mutations conferring drug resistance were M184V (38% for NRTI and K103N (25% for NNRTI. Only NRTI primary mutations K101Q, K103N and the PI minor mutation L10V were found in ART naïve individuals. No protease inhibitor resistant strains were detected. In our study, we found no detectable resistance in ∼ 44% of all patients who experienced therapeutic failure which was explained by low compliance, co-infection with tuberculosis and malnutrition. Genotyping revealed that 65.7% of samples were infected with subtype C, 20% with CRF02_AG, 8.5% with B, 2.9% with CRF02_AG/C and 2.9% with K/C. Conclusion The results of this first study about drug resistance mutations in first-line ART failures show the importance of performing drug resistance mutation test which guides the choice of a second-line regimen. This will improve the management of HIV-infected Djiboutian patients. Virtual slides The virtual slide(s for this article can be found

Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

Science.gov (United States)

Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

2017-06-16

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Population-based surveillance of HIV drug resistance emerging on treatment and associated factors at sentinel antiretroviral therapy sites in Namibia.

Science.gov (United States)

Hong, Steven Y; Jonas, Anna; DeKlerk, Michael; Shiningavamwe, Andreas; Desta, Tiruneh; Badi, Alfons; Morris, Lynn; Hunt, Gillian M; Ledwaba, Johanna; Sheehan, Heidi B; Lau, Kiger; Trotter, Andrew; Tang, Alice M; Wanke, Christine; Jordan, Michael R

2015-04-01

The World Health Organization (WHO) prospective surveys of acquired HIV drug resistance (HIVDR) evaluate HIVDR emerging after the first year of antiretroviral therapy (ART) and associated factors. Consecutive ART starters in 2009 were enrolled at 3 sentinel sites in Namibia. Genotyping was performed at start and after 12 months in patients with HIV viral load (VL) >1000 copies per mL. HIVDR outcomes were: HIVDR prevention (VL ≤1000 copies/mL), possible HIVDR (VL >1000 copies/mL without detectable HIVDR or loss to follow-up or ART stop), and HIVDR (VL >1000 copies/mL with detectable HIVDR). Adherence was assessed using medication possession ratio (MPR). Of 394 starters, at 12 months, 80% were on first-line ART, 1% died, 4% transferred out, 1% stopped ART, <1% switched to second-line, and 15% were lost to follow-up. Among patients on first-line, 77% had VL testing, and 94% achieved VL ≤1000 copies per mL. At baseline, 7% had HIVDR. After 12 months, among patients with VL testing, 5% had HIVDR. A majority of patients failing therapy had high-level resistance to nonnucleoside reverse transcriptase inhibitors but none to protease inhibitors. All sites achieved the WHO target of ≥70% HIVDR prevention. Factors associated with not achieving HIVDR prevention were: baseline resistance to nonnucleoside reverse transcriptase inhibitors [odds ratio (OR) 3.0, P = 0.023], WHO stage 3 or 4 at baseline (OR 2.0, P = 0.012), and MPR <75% (OR 4.9, P = 0.021). Earlier ART initiation and removal of barriers to on-time drug pickups may help to prevent HIVDR. These data inform decisions at national and global levels on the effectiveness of first- and second-line regimens.

Small-molecule inhibition of HIV pre-mRNA splicing as a novel antiretroviral therapy to overcome drug resistance.

Directory of Open Access Journals (Sweden)

Nadia Bakkour

2007-10-01

Full Text Available The development of multidrug-resistant viruses compromises antiretroviral therapy efficacy and limits therapeutic options. Therefore, it is an ongoing task to identify new targets for antiretroviral therapy and to develop new drugs. Here, we show that an indole derivative (IDC16 that interferes with exonic splicing enhancer activity of the SR protein splicing factor SF2/ASF suppresses the production of key viral proteins, thereby compromising subsequent synthesis of full-length HIV-1 pre-mRNA and assembly of infectious particles. IDC16 inhibits replication of macrophage- and T cell-tropic laboratory strains, clinical isolates, and strains with high-level resistance to inhibitors of viral protease and reverse transcriptase. Importantly, drug treatment of primary blood cells did not alter splicing profiles of endogenous genes involved in cell cycle transition and apoptosis. Thus, human splicing factors represent novel and promising drug targets for the development of antiretroviral therapies, particularly for the inhibition of multidrug-resistant viruses.

Population-based monitoring of emerging HIV-1 drug resistance on antiretroviral therapy and associated factors in a sentinel site in Cameroon: low levels of resistance but poor programmatic performance.

Directory of Open Access Journals (Sweden)

Serge C Billong

Full Text Available BACKGROUND: Scale-up of antiretroviral therapy (ART in resource-limited settings has drastically reduced HIV-related morbidity and mortality. However, challenges in long-term ART, adherence and HIV drug resistance (HIVDR itself, require monitoring to limit HIVDR emergence among ART-experienced populations, in order to ensure regimen efficacy. METHODS: A longitudinal study was conducted from 2009-2011 in a cohort of 141 HIV-infected adult patients (aged >21 at the national social insurance centre hospital in Yaounde, Cameroon. As per-WHO HIVDR protocol, HIV-1 protease-reverse transcriptase genotyping was performed at baseline and at endpoint (12 months on first-line ART using ViroSeq™ Genotyping kit. RESULTS: At baseline, a prevalence of 3.6% (5/139 HIVDR was observed [protease inhibitors M46I (1/5, G73A (1/5, L90LM (1/5; nucleoside reverse transcriptase inhibitors: M184V (1/5, T215F (1/5; non-nucleoside reverse transcriptase inhibitors: K103N (1/5, Y181Y/C (2/5, M230ML (1/5]. At endpoint, 54.0% (76 patients were followed-up, 9.2% (13 died, and 3.5% (5 transferred, 38.5% (47 lost to follow-up (LTFU. 69.7% (53/76 of those followed-up had viremia <40 copies/ml and 90.8% (69/76 <1000 copies/ml. 4/7 patients with viremia ≥1000 copies/ml harbored HIVDR (prevalence: 5.3%; 4/76, with M184V/I (4/4 and K103K/N (3/4 being the most prevalent mutations. LTFU was favored by costs for consultation/laboratory tests, drug shortages, workload (physician/patient ratio: 1/180 and community disengagement. CONCLUSIONS: Low levels of HIVDR at baseline and at endpoint suggest a probable effectiveness of ART regimens used in Cameroon. However the possible high rate of HIVDR among LTFUs limited the strengths of our findings. Evaluating HIVDR among LTFU, improving adherence, task shifting, subsidizing/harmonizing costs for routine follow-up, are urgent measures to ensure an improved success of the country ART performance.

Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

Science.gov (United States)

Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

2013-09-01

Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

Neutralizing antibody and anti-retroviral drug sensitivities of HIV-1 isolates resistant to small molecule CCR5 inhibitors

International Nuclear Information System (INIS)

Pugach, Pavel; Ketas, Thomas J.; Michael, Elizabeth; Moore, John P.

2008-01-01

The small molecule CCR5 inhibitors are a new class of drugs for treating infection by human immunodeficiency virus type 1 (HIV-1). They act by binding to the CCR5 co-receptor and preventing its use during HIV-1-cell fusion. Escape mutants can be raised against CCR5 inhibitors in vitro and will arise when these drugs are used clinically. Here, we have assessed the responses of CCR5 inhibitor-resistant viruses to other anti-retroviral drugs that act by different mechanisms, and their sensitivities to neutralizing antibodies (NAbs). The rationale for the latter study is that the resistance pathway for CCR5 inhibitors involves changes in the HIV-1 envelope glycoproteins (Env), which are also targets for NAbs. The escape mutants CC101.19 and D1/85.16 were selected for resistance to AD101 and vicriviroc (VVC), respectively, from the primary R5 HIV-1 isolate CC1/85. Each escape mutant was cross-resistant to other small molecule CCR5 inhibitors (aplaviroc, maraviroc, VVC, AD101 and CMPD 167), but sensitive to protein ligands of CCR5: the modified chemokine PSC-RANTES and the humanized MAb PRO-140. The resistant viruses also retained wild-type sensitivity to the nucleoside reverse transcriptase inhibitor (RTI) zidovudine, the non-nucleoside RTI nevirapine, the protease inhibitor atazanavir and other attachment and fusion inhibitors that act independently of CCR5 (BMS-806, PRO-542 and enfuvirtide). Of note is that the escape mutants were more sensitive than the parental CC1/85 isolate to a subset of neutralizing monoclonal antibodies and to some sera from HIV-1-infected people, implying that sequence changes in Env that confer resistance to CCR5 inhibitors can increase the accessibility of some NAb epitopes. The need to preserve NAb resistance may therefore be a constraint upon how escape from CCR5 inhibitors occurs in vivo

Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions.

Science.gov (United States)

Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo

2017-08-31

In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

Science.gov (United States)

Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

2010-12-12

Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

OpenAIRE

Patick, A K; Boritzki, T J; Bloom, L A

1997-01-01

Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...

Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

International Nuclear Information System (INIS)

Spadafora, C.; Sciamanna, I.; Misteli, T.

2009-01-01

Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration.

Science.gov (United States)

Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M

2007-01-01

Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

Science.gov (United States)

Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

2009-01-01

Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

Science.gov (United States)

Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

2017-12-01

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

12-month mortality and loss-to-program in antiretroviral-treated children: The IeDEA pediatric West African Database to evaluate AIDS (pWADA, 2000-2008

Directory of Open Access Journals (Sweden)

Peterson Kevin

2011-06-01

Full Text Available Abstract Background The IeDEA West Africa Pediatric Working Group (pWADA was established in January 2007 to study the care and treatment of HIV-infected children in this region. We describe here the characteristics at antiretroviral treatment (ART initiation and study the 12-month mortality and loss-to-program of HIV-infected children followed in ART programs in West Africa. Methods Standardized data from HIV-infected children followed-up in ART programs were included. Nine clinical centers from six countries contributed to the dataset (Benin, Côte d'Ivoire, Gambia, Ghana, Mali and Senegal. Inclusion criteria were the followings: age 0-15 years and initiated triple antiretroviral drug regimens. Baseline time was the date of ART initiation. WHO criteria was used to define severe immunosuppression based on CD4 count by age or CD4 percent 6 months after ART initiation and factors associated with these two outcomes. Results Between June 2000 and December 2007, 2170 children were included. Characteristics at ART initiation were the following: median age of 5 years (Interquartile range (IQR: 2-9 and median CD4 percentage of 13% (IQR: 7-19. The most frequent drug regimen consisted of two nucleoside reverse transcriptase inhibitors and one non-nucleoside reverse transcriptase inhibitors (62%. During the first 12 months, 169 (7.8% children died and 461(21.2% were lost-to-program. Overall, in HIV-infected children on ART, the 12-month probability of death was 8.3% (95% Confidence Interval (CI: 7.2-9.6%, and of loss-to-program was 23.1% (95% CI: 21.3-25.0%. Both mortality and loss-to program were associated with advanced clinical stage, CD4 percentage 2005 of ART initiation. Conclusion Innovative and sustainable approaches are needed to better document causes of death and increase retention in HIV pediatric clinics in West Africa.

HIV genotype resistance testing in antiretroviral (ART) exposed Indian children--a need of the hour.

Science.gov (United States)

Shah, Ira; Parikh, Shefali

2013-04-01

Development of drug resistance in HIV infected children with treatment failure is a major impediment to selection of appropriate therapy. HIV genotype resistance assays predict drug resistance on the basis of mutations in the viral genome. However, their clinical utility, especially in a resource limited setting is still a subject of debate. The authors report two cases in which both the children suffered from treatment failure of various antiretroviral therapy regimes. In both the cases, Genotype Resistance Testing (GRT) prompted a radical change from proposed failure therapy as per existing guidelines. GRT was specifically important for the selection of a new dual Nucleoside reverse transcriptase inhibitors (NRTI) component of failure regimen by identifying TAMS and M184V mutations in the HIV genome. These case reports highlight the importance of GRT in children failing multiple antiretroviral regimes; and emphasizes the need to recognize situations where GRT is absolutely essential to guide appropriate therapy, even in a resource limited setting.

ORIGINAL ARTICLES Symptomatic hyperlactataemia in adults on ...

African Journals Online (AJOL)

2008-09-29

Sep 29, 2008 ... in combination with other antiretroviral drugs in a schedule .... males developed gynaecomastia without other symptoms of ..... nucleoside reverse transcriptase inhibitor (NRTI)-induced lactic acidosis in HIV-infected patients in ...

Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

Science.gov (United States)

Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

2016-06-01

Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

Artemether-Lumefantrine Combination Therapy for Treatment of Uncomplicated Malaria: The Potential for Complex Interactions with Antiretroviral Drugs in HIV-Infected Individuals

Directory of Open Access Journals (Sweden)

Pauline Byakika-Kibwika

2011-01-01

Full Text Available Treatment of malaria in HIV-infected individuals receiving antiretroviral therapy (ART poses significant challenges. Artemether-lumefantrine (AL is one of the artemisisnin-based combination therapies recommended for treatment of malaria. The drug combination is highly efficacious against sensitive and multidrug resistant falciparum malaria. Both artemether and lumefantrine are metabolized by hepatic cytochrome P450 (CYP450 enzymes which metabolize the protease inhibitors (PIs and nonnucleoside reverse transcriptase inhibitors (NNRTIs used for HIV treatment. Coadministration of NNRTIs and PIs with AL could potentially cause complex pharmacokinetic drug interactions. NNRTI by inducing CYP450 3A4 enzyme and PIs by inhibiting CYP450 3A4 enzymes could influence both artemether and lumefantrine concentrations and their active metabolites dihydroartemisinin and desbutyl-lumefantrine, predisposing patients to poor treatment response, toxicity, and risk for development of resistance. There are scanty data on these interactions and their consequences. Pharmacokinetic studies to evaluate these interactions in the target populations are urgently needed.

Cervical Shedding of HIV-1 RNA Among Women With Low Levels of Viremia While Receiving Highly Active Antiretroviral Therapy

Science.gov (United States)

Neely, Michael N.; Benning, Lorie; Xu, Jiaao; Strickler, Howard D.; Greenblatt, Ruth M.; Minkoff, Howard; Young, Mary; Bremer, James; Levine, Alexandra M.; Kovacs, Andrea

2011-01-01

Background Among women with low o r undetectable quantities of HIV-1 RNA in plasma, factors associated with genital HIV-1 RNA shedding, including choice of treatment regimen, are poorly characterized. Methods We measured HIV-1 RNA in cervical swab specimens obtained from participants in the Women’s Interagency HIV Study who had concurrent plasma viral RNA levels <500 copies/mL, and we assessed factors associated with genital HIV shedding. The study was powered to determine the relative effects of antiretroviral protease inhibitors (PIs) versus nonnucleoside reverse transcriptase inhibitors (NNRTIs) on viral RNA shedding. Results Overall, 44 (15%) of 290 women had detectable HIV-1 RNA in cervical specimens. In the final multivariate model, shedding was independently associated with NNRTI (vs. PI) use (odds ratio [OR], 95% confidence interval [CI]: 2.24, 1.13 to 4.45) and illicit drug use (OR, 95% CI: 2.41, 0.96 to 5.69). Conclusions This is the largest study to define risks for genital HIV-1 RNA shedding in women with low/undetectable plasma virus. Shedding in this population was common, and NNRTI-based highly active antiretroviral therapy (HAART) (vs. PI-based HAART) was associated with genital HIV shedding. Further study is required to determine the impact of these findings on transmission of HIV from mother to child or to sexual partners. PMID:17106279

Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration

Science.gov (United States)

Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M

2007-01-01

Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

Risk of triple-class virological failure in children with HIV: a retrospective cohort study

DEFF Research Database (Denmark)

Castro, Hannah; Judd, Ali; Gibb, Diana M

2011-01-01

In adults with HIV treated with antiretroviral drug regimens from within the three original drug classes (nucleoside or nucleotide reverse transcriptase inhibitors [NRTIs], non-NRTIs [NNRTIs], and protease inhibitors), virological failure occurs slowly, suggesting that long-term virological...... failure to the three original drugs classes in children....

Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

Directory of Open Access Journals (Sweden)

Edward J. Steele

2017-11-01

Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses.

Science.gov (United States)

Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun

2017-09-01

The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

Directory of Open Access Journals (Sweden)

Ilaria eSciamanna

2016-02-01

Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

Science.gov (United States)

Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

2016-02-01

In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

Directory of Open Access Journals (Sweden)

Francesca Carlini

Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

Clinical outcome of HIV-infected patients with sustained virologic response to antiretroviral therapy: long-term follow-up of a multicenter cohort.

Directory of Open Access Journals (Sweden)

Félix Gutierrez

Full Text Available BACKGROUND: Limited information exists on long-term prognosis of patients with sustained virologic response to antiretroviral therapy. We aimed to assess predictors of unfavorable clinical outcome in patients who maintain viral suppression with HAART. METHODS: Using data collected from ten clinic-based cohorts in Spain, we selected all antiretroviral-naive adults who initiated HAART and maintained plasma HIV-1 RNA levels <500 copies/mL throughout follow-up. Factors associated with disease progression were determined by Cox proportional-hazards models. RESULTS: Of 2,613 patients who started HAART, 757 fulfilled the inclusion criteria. 61% of them initiated a protease inhibitor-based HAART regimen, 29.7% a nonnucleoside reverse-transcriptase inhibitor-based regimen, and 7.8% a triple-nucleoside regimen. During 2,556 person-years of follow-up, 22 (2.9% patients died (mortality rate 0.86 per 100 person-years, and 40 (5.3% died or developed a new AIDS-defining event. The most common causes of death were neoplasias and liver failure. Mortality was independently associated with a CD4-T cell response <50 cells/L after 12 months of HAART (adjusted hazard ratio [AHR], 4.26 [95% confidence interval {CI}, 1.68-10.83]; P = .002, and age at initiation of HAART (AHR, 1.06 per year; 95% CI, 1.02-1.09; P = .001. Initial antiretroviral regimen chosen was not associated with different risk of clinical progression. CONCLUSIONS: Patients with sustained virologic response on HAART have a low mortality rate over time. Long-term outcome of these patients is driven by immunologic response at the end of the first year of therapy and age at the time of HAART initiation, but not by the initial antiretroviral regimen selected.

Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults: 2016 Recommendations of the International Antiviral Society-USA Panel.

Science.gov (United States)

Günthard, Huldrych F; Saag, Michael S; Benson, Constance A; del Rio, Carlos; Eron, Joseph J; Gallant, Joel E; Hoy, Jennifer F; Mugavero, Michael J; Sax, Paul E; Thompson, Melanie A; Gandhi, Rajesh T; Landovitz, Raphael J; Smith, Davey M; Jacobsen, Donna M; Volberding, Paul A

2016-07-12

New data and therapeutic options warrant updated recommendations for the use of antiretroviral drugs (ARVs) to treat or to prevent HIV infection in adults. To provide updated recommendations for the use of antiretroviral therapy in adults (aged ≥18 years) with established HIV infection, including when to start treatment, initial regimens, and changing regimens, along with recommendations for using ARVs for preventing HIV among those at risk, including preexposure and postexposure prophylaxis. A panel of experts in HIV research and patient care convened by the International Antiviral Society-USA reviewed data published in peer-reviewed journals, presented by regulatory agencies, or presented as conference abstracts at peer-reviewed scientific conferences since the 2014 report, for new data or evidence that would change previous recommendations or their ratings. Comprehensive literature searches were conducted in the PubMed and EMBASE databases through April 2016. Recommendations were by consensus, and each recommendation was rated by strength and quality of the evidence. Newer data support the widely accepted recommendation that antiretroviral therapy should be started in all individuals with HIV infection with detectable viremia regardless of CD4 cell count. Recommended optimal initial regimens for most patients are 2 nucleoside reverse transcriptase inhibitors (NRTIs) plus an integrase strand transfer inhibitor (InSTI). Other effective regimens include nonnucleoside reverse transcriptase inhibitors or boosted protease inhibitors with 2 NRTIs. Recommendations for special populations and in the settings of opportunistic infections and concomitant conditions are provided. Reasons for switching therapy include convenience, tolerability, simplification, anticipation of potential new drug interactions, pregnancy or plans for pregnancy, elimination of food restrictions, virologic failure, or drug toxicities. Laboratory assessments are recommended before treatment, and

Antiretroviral medication prescribing errors are common with hospitalization of HIV-infected patients.

Science.gov (United States)

Commers, Tessa; Swindells, Susan; Sayles, Harlan; Gross, Alan E; Devetten, Marcel; Sandkovsky, Uriel

2014-01-01

Errors in prescribing antiretroviral therapy (ART) often occur with the hospitalization of HIV-infected patients. The rapid identification and prevention of errors may reduce patient harm and healthcare-associated costs. A retrospective review of hospitalized HIV-infected patients was carried out between 1 January 2009 and 31 December 2011. Errors were documented as omission, underdose, overdose, duplicate therapy, incorrect scheduling and/or incorrect therapy. The time to error correction was recorded. Relative risks (RRs) were computed to evaluate patient characteristics and error rates. A total of 289 medication errors were identified in 146/416 admissions (35%). The most common was drug omission (69%). At an error rate of 31%, nucleoside reverse transcriptase inhibitors were associated with an increased risk of error when compared with protease inhibitors (RR 1.32; 95% CI 1.04-1.69) and co-formulated drugs (RR 1.59; 95% CI 1.19-2.09). Of the errors, 31% were corrected within the first 24 h, but over half (55%) were never remedied. Admissions with an omission error were 7.4 times more likely to have all errors corrected within 24 h than were admissions without an omission. Drug interactions with ART were detected on 51 occasions. For the study population (n = 177), an increased risk of admission error was observed for black (43%) compared with white (28%) individuals (RR 1.53; 95% CI 1.16-2.03) but no significant differences were observed between white patients and other minorities or between men and women. Errors in inpatient ART were common, and the majority were never detected. The most common errors involved omission of medication, and nucleoside reverse transcriptase inhibitors had the highest rate of prescribing error. Interventions to prevent and correct errors are urgently needed.

Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

Science.gov (United States)

Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

2012-05-01

Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

Cost-effectiveness of public-health policy options in the presence of pretreatment NNRTI drug resistance in sub-Saharan Africa: A modelling study

NARCIS (Netherlands)

A. Phillips (Andrew); V. Cambiano (Valentina); F. Nakagawa (Fumiyo); P. Revill (Paul); M.R. Jordan (Michael); T.B. Hallett (Timothy); M.C. Doherty (Meg); A. de Luca (Andrea); Lundgren, J.D. (Jens D.); Mhangara, M. (Mutsa); Apollo, T. (Tsitsi); J.W. Mellors (John W.); B.E. Nichols (Brooke); Parikh, U. (Urvi); D. Pillay (Deenan); T.F. Rinke de Wit (Tobias); K.C. Sigaloff (Kim); Havlir, D. (Diane); D.R. Kuritzkes (Daniel); A. Pozniak (Anton); D.A.M.C. van de Vijver (David); M. Vitoria (Marco); Wainberg, M.A. (Mark A.); E. Raizes (Elliot); S. Bertagnolio (Silvia)

2017-01-01

textabstractBackground: There is concern over increasing prevalence of non-nucleoside reverse-transcriptase inhibitor (NNRTI) resistance in people initiating antiretroviral therapy (ART) in low-income and middle-income countries. We assessed the effectiveness and cost-effectiveness of alternative

The effect of efavirenz versus nevirapine-containing regimens on immunologic, virologic and clinical outcomes in a prospective observational study

NARCIS (Netherlands)

Collaboration, H.-C.; Koopmans †, P.P.; Brouwer, A.M.; Dofferhoff, A.S.M.; Flier, M. van der; Groot, R. de; Hofstede, H.J.M. ter; Keuter, M.; Ven, A.J.A.M. van der; et al.,

2012-01-01

OBJECTIVE: To compare regimens consisting of either efavirenz or nevirapine and two or more nucleoside reverse transcriptase inhibitors (NRTIs) among HIV-infected, antiretroviral-naive, and AIDS-free individuals with respect to clinical, immunologic, and virologic outcomes. DESIGN: Prospective

A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

International Nuclear Information System (INIS)

Ferkous, F.; Saihi, Y.

2018-01-01

Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

Science.gov (United States)

Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

2015-10-01

Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy

DEFF Research Database (Denmark)

Bruyand, Mathias; Ryom, Lene; Shepherd, Leah

2015-01-01

-AIDS-defining cancers (NADC), AIDS-defining cancers (ADC), and the most frequently occurring ADC (Kaposi sarcoma, non-Hodgkin lymphoma) and NADC (lung, invasive anal, head/neck cancers, and Hodgkin lymphoma). RESULTS: A total of 41,762 persons contributed 241,556 person-years (PY). A total of 1832 cancers were...

Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

International Nuclear Information System (INIS)

Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

2011-01-01

LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

Science.gov (United States)

Zhao, Chen; Pyle, Anna Marie

2017-12-01

The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

Interactions between recreational drugs and antiretroviral agents.

Science.gov (United States)

Antoniou, Tony; Tseng, Alice Lin-In

2002-10-01

To summarize existing data regarding potential interactions between recreational drugs and drugs commonly used in the management of HIV-positive patients. Information was obtained via a MEDLINE search (1966-August 2002) using the MeSH headings human immunodeficiency virus, drug interactions, cytochrome P450, medication names commonly prescribed for the management of HIV and related opportunistic infections, and names of commonly used recreational drugs. Abstracts of national and international conferences, review articles, textbooks, and references of all articles were also reviewed. Literature on pharmacokinetic interactions was considered for inclusion. Pertinent information was selected and summarized for discussion. In the absence of specific data, prediction of potential clinically significant interactions was based on pharmacokinetic and pharmacodynamic properties. All protease inhibitors (PIs) and nonnucleoside reverse transcriptase inhibitors are substrates and potent inhibitors or inducers of the cytochrome P450 system. Many classes of recreational drugs, including benzodiazepines, amphetamines, and opioids, are also metabolized by the liver and can potentially interact with antiretrovirals. Controlled interaction studies are often not available, but clinically significant interactions have been observed in a number of case reports. Overdoses secondary to interactions between the "rave" drugs methylenedioxymethamphetamine (MDMA) or gamma-hydroxybutyrate (GHB) and PIs have been reported. PIs, particularly ritonavir, may also inhibit metabolism of amphetamines, ketamine, lysergic acid diethylmide (LSD), and phencyclidine (PCP). Case series and pharmacokinetic studies suggest that nevirapine and efavirenz induce methadone metabolism, which may lead to symptoms of opiate withdrawal. A similar interaction may exist between methadone and the PIs ritonavir and nelfinavir, although the data are less consistent. Opiate metabolism can be inhibited or induced by

Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

Science.gov (United States)

Collins, Kathleen; Nilsen, Timothy W

2013-08-01

Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

Science.gov (United States)

Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

1972-01-01

Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

Class of Antiretroviral Drugs and the Risk of Myocardial Infarction

DEFF Research Database (Denmark)

Friis-Møller, Nina; Reiss, P.; Sabin, C.A.

2007-01-01

of myocardial infarction, which is partly explained by dyslipidemia. We found no evidence of such an association for nonnucleoside reverse-transcriptase inhibitors; however, the number of person-years of observation for exposure to this class of drug was less than that for exposure to protease inhibitors...

Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

Directory of Open Access Journals (Sweden)

Marius Lazea

2011-12-01

Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

Selection of HIV resistance associated with antiretroviral therapy initiated due to pregnancy and suspended postpartum.

Science.gov (United States)

Ellis, Giovanina M; Huang, Sharon; Hitti, Jane; Frenkel, Lisa M

2011-11-01

Compare the risk of HIV drug resistance in women stopping suppressive nelfinavir (NFV)-based or Nevirapine (NVP)-based antiretroviral therapy (ART) after pregnancy. Specimens collected after stopping ART were tested for drug resistance by an oligonucleotide ligation assay and consensus sequencing. When postpartum drug resistance was detected, specimens obtained at study entry and during ART were evaluated. Sixteen of 38 women with ART-induced suppression of viral replication suspended ART postpartum. Resistance mutations were detected in 75% who stopped NFV-ART and in 50% who stopped NVP-ART. M184V, associated with Lamivudine resistance, was more frequent among those randomized to NFV-ART compared with NVP-ART (6 of 8 versus 1 of 8; P = 0.04), and nonnucleoside reverse transcriptase inhibitor resistance was detected in 4 of 8 stopping NVP-ART. HIV drug resistance was frequently observed among women who stopped suppressive NVP-ART or NFV-ART postpartum. This suggests that NFV-ART may have suboptimal potency, that staggering discontinuation of NVP-ART may be warranted, and/or ART adherence may be lax in women who choose to stop ART postpartum.

3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors.

Science.gov (United States)

de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão

2008-08-01

A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

Designing robust control-based HIV-treatment

Directory of Open Access Journals (Sweden)

Fredy Andrés Olarte Dussán

2008-05-01

Full Text Available Designing a robust control-based treatment for human immunodeficiency virus (HIV-infected patients was studied. The dynamics of the immune system’s response to infection was modelled using a 5th order nonlinear model with separate efficacy coefficients for protease inhibitor (PIs and reverse transcriptase inhibitors (RTIs. The immune res-ponse has been represented as an uncertain system due to errors in parameter estimation and the existence of un-modelled dynamics. A polytopic system was constructed incorporating all possible system parameter values. A con-trol system was designed using robust pole location techniques stabilising the polytopic system around an equilibrium point having a low viral load. Numerical simulation results (including the organism’s pharmacokinetical response to anti-retroviral drugs showed that the control law could lead to long-term stable conditions, even in extreme cases.

Antiretroviral Drug Use in a Cohort of HIV-Uninfected Women in the United States: HIV Prevention Trials Network 064.

Directory of Open Access Journals (Sweden)

Iris Chen

Full Text Available Antiretroviral (ARV drug use was analyzed in HIV-uninfected women in an observational cohort study conducted in 10 urban and periurban communities in the United States with high rates of poverty and HIV infection. Plasma samples collected in 2009-2010 were tested for the presence of 16 ARV drugs. ARV drugs were detected in samples from 39 (2% of 1,806 participants: 27/181 (15% in Baltimore, MD and 12/179 (7% in Bronx, NY. The ARV drugs detected included different combinations of non-nucleoside reverse transcriptase inhibitors and protease inhibitors (1-4 drugs/sample. These data were analyzed in the context of self-reported data on ARV drug use. None of the 39 women who had ARV drugs detected reported ARV drug use at any study visit. Further research is needed to evaluate ARV drug use by HIV-uninfected individuals.

[GeSIDA/National AIDS Plan: Consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (Updated January 2014)].

Science.gov (United States)

2014-01-01

This consensus document is an update of combined antiretroviral therapy (cART) guidelines for HIV-1 infected adult patients. To formulate these recommendations a panel composed of members of the Grupo de Estudio de Sida and the Plan Nacional sobre el Sida reviewed the efficacy and safety advances in clinical trials, cohort and pharmacokinetic studies published in medical journals (PubMed and Embase) or presented in medical scientific meetings. Recommendations strength and the evidence in which they are supported are based on modified criteria of the Infectious Diseases Society of America. In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with the clinical circumstances: CDC stage B or C disease (A-I), asymptomatic patients (depending on the CD4+ T-lymphocyte count: 500 cells/μL, B-III), comorbid conditions (HIV nephropathy, chronic hepatitis caused by HBV or HCV, age >55years, high cardiovascular risk, neurocognitive disorders, and cancer, A-II), and prevention of transmission of HIV (mother-to-child or heterosexual, A-I; men who have sex with men, A-III). The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). Some of the possible initial regimens have been considered alternatives. This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure where rescue ART should comprise 2 or 3 drugs that are fully active against the virus. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

Science.gov (United States)

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

First-line antiretroviral drug discontinuations in children.

Directory of Open Access Journals (Sweden)

Melony Fortuin-de Smidt

Full Text Available There are a limited number of paediatric antiretroviral drug options. Characterising the long term safety and durability of different antiretrovirals in children is important to optimise management of HIV infected children and to determine the estimated need for alternative drugs in paediatric regimens. We describe first-line antiretroviral therapy (ART durability and reasons for discontinuations in children at two South African ART programmes, where lopinavir/ritonavir has been recommended for children <3 years old since 2004, and abacavir replaced stavudine as the preferred nucleoside reverse transcriptase inhibitor in 2010.We included children (<16 years at ART initiation who initiated ≥3 antiretrovirals between 2004-2014 with ≥1 follow-up visit on ART. We estimated the incidence of first antiretroviral discontinuation using Kaplan-Meier analysis. We determined the reasons for antiretroviral discontinuations using competing risks analysis. We used Cox regression to identify factors associated with treatment-limiting toxicity.We included 3579 children with median follow-up duration of 41 months (IQR 14-72. At ART initiation, median age was 44 months (IQR 13-89 and median CD4 percent was 15% (IQR 9-21%. At three and five years on ART, 72% and 26% of children respectively remained on their initial regimen. By five years on ART, the most common reasons for discontinuations were toxicity (32%, treatment failure (18%, treatment simplification (5%, drug interactions (3%, and other or unspecified reasons (18%. The incidences of treatment limiting toxicity were 50.6 (95% CI 46.2-55.4, 1.6 (0.5-4.8, 2.0 (1.2-3.3, and 1.3 (0.6-2.8 per 1000 patient years for stavudine, abacavir, efavirenz and lopinavir/ritonavir respectively.While stavudine was associated with a high risk of treatment-limiting toxicity, abacavir, lopinavir/ritonavir and efavirenz were well-tolerated. This supports the World Health Organization recommendation to replace stavudine with

Calculation of direct antiretroviral treatment costs and potential cost savings by using generics in the German HIV ClinSurv cohort.

Directory of Open Access Journals (Sweden)

Matthias Stoll

Full Text Available UNLABELLED: BACKGROUND/AIM OF THE STUDY: The study aimed to determine the cost impacts of antiretroviral drugs by analysing a long-term follow-up of direct costs for combined antiretroviral therapy, cART, -regimens in the nationwide long-term observational multi-centre German HIV ClinSurv Cohort. The second aim was to develop potential cost saving strategies by modelling different treatment scenarios. METHODS: Antiretroviral regimens (ART from 10,190 HIV-infected patients from 11 participating ClinSurv study centres have been investigated since 1996. Biannual data cART-initiation, cART-changes, surrogate markers, clinical events and the Centre of Disease Control- (CDC-stage of HIV disease are reported. Treatment duration was calculated on a daily basis via the documented dates for the beginning and end of each antiretroviral drug treatment. Prices were calculated for each individual regimen based on actual office sales prices of the branded pharmaceuticals distributed by the license holder including German taxes. RESULTS: During the 13-year follow-up period, 21,387,427 treatment days were covered. Cumulative direct costs for antiretroviral drugs of €812,877,356 were determined according to an average of €42.08 per day (€7.52 to € 217.70. Since cART is widely used in Germany, the costs for an entire regimen increased by 13.5%. Regimens are more expensive in the advanced stages of HIV disease. The potential for cost savings was calculated using non-nucleotide-reverse-transcriptase-inhibitor, NNRTI, more frequently instead of ritonavir-boosted protease inhibitor, PI/r, in first line therapy. This calculation revealed cumulative savings of 10.9% to 19.8% of daily treatment costs (50% and 90% substitution of PI/r, respectively. Substituting certain branded drugs by generic drugs showed potential cost savings of between 1.6% and 31.8%. CONCLUSIONS: Analysis of the data of this nationwide study reflects disease-specific health services research

Calculation of direct antiretroviral treatment costs and potential cost savings by using generics in the German HIV ClinSurv cohort.

Science.gov (United States)

Stoll, Matthias; Kollan, Christian; Bergmann, Frank; Bogner, Johannes; Faetkenheuer, Gerd; Fritzsche, Carlos; Hoeper, Kirsten; Horst, Heinz-August; van Lunzen, Jan; Plettenberg, Andreas; Reuter, Stefan; Rockstroh, Jürgen; Stellbrink, Hans-Jürgen; Hamouda, Osamah; Bartmeyer, Barbara

2011-01-01

BACKGROUND/AIM OF THE STUDY: The study aimed to determine the cost impacts of antiretroviral drugs by analysing a long-term follow-up of direct costs for combined antiretroviral therapy, cART, -regimens in the nationwide long-term observational multi-centre German HIV ClinSurv Cohort. The second aim was to develop potential cost saving strategies by modelling different treatment scenarios. Antiretroviral regimens (ART) from 10,190 HIV-infected patients from 11 participating ClinSurv study centres have been investigated since 1996. Biannual data cART-initiation, cART-changes, surrogate markers, clinical events and the Centre of Disease Control- (CDC)-stage of HIV disease are reported. Treatment duration was calculated on a daily basis via the documented dates for the beginning and end of each antiretroviral drug treatment. Prices were calculated for each individual regimen based on actual office sales prices of the branded pharmaceuticals distributed by the license holder including German taxes. During the 13-year follow-up period, 21,387,427 treatment days were covered. Cumulative direct costs for antiretroviral drugs of €812,877,356 were determined according to an average of €42.08 per day (€7.52 to € 217.70). Since cART is widely used in Germany, the costs for an entire regimen increased by 13.5%. Regimens are more expensive in the advanced stages of HIV disease. The potential for cost savings was calculated using non-nucleotide-reverse-transcriptase-inhibitor, NNRTI, more frequently instead of ritonavir-boosted protease inhibitor, PI/r, in first line therapy. This calculation revealed cumulative savings of 10.9% to 19.8% of daily treatment costs (50% and 90% substitution of PI/r, respectively). Substituting certain branded drugs by generic drugs showed potential cost savings of between 1.6% and 31.8%. Analysis of the data of this nationwide study reflects disease-specific health services research and will give insights into the cost impacts of

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

Science.gov (United States)

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

HIV Drug Resistance-Associated Mutations in Antiretroviral Naïve HIV-1-Infected Latin American Children

Directory of Open Access Journals (Sweden)

Luis E. Soto-Ramirez

2010-01-01

Full Text Available Our goal was to describe the presence of HIV drug resistance among HIV-1-infected, antiretroviral (ARV naïve children and adolescents in Latin America and to examine resistance in these children in relation to drug exposure in the mother. Genotyping was performed on plasma samples obtained at baseline from HIV-1-infected participants in a prospective cohort study in Brazil, Argentina, and Mexico (NISDI Pediatric Study. Of 713 HIV-infected children enrolled, 69 were ARV naïve and eligible for the analysis. At enrollment, mean age was 7.3 years; 81.2% were infected with HIV perinatally. Drug resistance mutations (DRMs were detected in 6 (8.7%; 95% confidence interval 3.1–18.2% ARV-naïve subjects; none of the mothers of these 6 received ARVs during their pregnancies and none of the children received ARV prophylaxis. Reverse transcriptase mutations K70R and K70E were detected in 3 and 2 subjects, respectively; protease mutation I50 V was detected in 1 subject. Three of the 6 children with DRMs initiated ARV therapy during followup, with a good response in 2. The overall rate of primary drug resistance in this pediatric HIV-infected population was low, and no subjects had more than 1 DRM. Mutations associated with resistance to nucleoside reverse transcriptase inhibitors were the most prevalent.

Thymidine analogue-sparing highly active antiretroviral therapy (HAART).

Science.gov (United States)

Nolan, David; Mallal, Simon

2003-02-01

The use of alternative nucleoside reverse transcriptase inhibitors (NRTIs) to the thymidine analogues stavudine (d4T) and zidovudine(ZDV) has been advocated as a means of limiting long-term NRTI-associated toxicity, particularly the development of lipoatrophy or fat wasting. This approach reflects an increasing knowledge of the distinct toxicity profiles of NRTI drugs. However, recent clinical trials have demonstrated that the use of thymidine analogue NRTIs and newer alternative backbone NRTIs, such as tenofovir (TNF) and abacavir (ABC), is associated with comparable short-term efficacy and tolerability. Given the importance of toxicity profile differences in determining clinical management, it is important to recognise that d4T and ZDV cary significantly different risks for long-term NRTI toxicity. Recognising that all NRTIs, including thymidine analogues, have individual toxicity profiles provides a more appropriate basis for selecting optimal antiretroviral therapy. The safety and efficacy of TNF and ABC are also reviewed here, although the available data provide only limited knowledge of the long-term effects of these drugs in terms of toxicity and antiviral durability.

Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

International Nuclear Information System (INIS)

Lund, Kaleb C.; Wallace, Kendall B.

2008-01-01

Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002

Directory of Open Access Journals (Sweden)

Watitpun Chotip

2003-03-01

Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.

High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

Science.gov (United States)

Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

2016-01-01

Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

The effect of individual antiretroviral drugs on body composition in HIV-infected persons initiating highly active antiretroviral therapy.

Science.gov (United States)

Shlay, Judith C; Sharma, Shweta; Peng, Grace; Gibert, Cynthia L; Grunfeld, Carl

2009-07-01

To examine the long-term effects of individual antiretroviral drugs on body composition among 416 persons initiating antiretroviral therapy (ART). In a substudy of a clinical trial of persons initiating ART, changes in body composition attributable to individual ART were examined. ARTs assessed were as follows: indinavir, ritonavir, nelfinavir, efavirenz, nevirapine, stavudine (d4T), zidovudine (ZDV), lamivudine (3TC), didanosine, and abacavir. Skinfolds and circumferences were measured at baseline and every 4 months. Mid arm, mid thigh, and waist subcutaneous tissue areas and nonsubcutaneous tissue areas were calculated. Rates of change per year of exposure to each individual ART drug were determined using multivariate longitudinal regression. d4T and ZDV use was associated with losses in subcutaneous tissue area and skinfold thickness. 3TC use was associated with gains in all subcutaneous tissue areas and skinfold thickness, whereas abacavir use was associated with an increase in waist subcutaneous tissue area. Indinavir was associated with gains in waist subcutaneous tissue area, whereas indinavir, efavirenz, and nevirapine were associated with increases in upper back skinfolds. d4T use was also associated with increases in all nonsubcutaneous tissue areas; 3TC use was associated with the greatest increase in waist nonsubcutaneous tissue area. In this prospective nonrandomized evaluation, the nucleoside reverse transcriptase inhibitors d4T and ZDV were associated with decreases in subcutaneous tissue areas, whereas 3TC use was associated with increased subcutaneous tissue areas and waist nonsubcutaneous tissue area.

Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

Science.gov (United States)

Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

2018-01-02

The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H.

Science.gov (United States)

Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng

2018-06-27

The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

High Levels of Transmitted HIV Drug Resistance in a Study in Papua New Guinea.

Science.gov (United States)

Lavu, Evelyn; Kave, Ellan; Mosoro, Euodia; Markby, Jessica; Aleksic, Eman; Gare, Janet; Elsum, Imogen A; Nano, Gideon; Kaima, Petronia; Dala, Nick; Gurung, Anup; Bertagnolio, Silvia; Crowe, Suzanne M; Myatt, Mark; Hearps, Anna C; Jordan, Michael R

2017-01-01

Papua New Guinea is a Pacific Island nation of 7.3 million people with an estimated HIV prevalence of 0.8%. ART initiation and monitoring are guided by clinical staging and CD4 cell counts, when available. Little is known about levels of transmitted HIV drug resistance in recently infected individuals in Papua New Guinea. Surveillance of transmitted HIV drug resistance in a total of 123 individuals recently infected with HIV and aged less than 30 years was implemented in Port Moresby (n = 62) and Mount Hagen (n = 61) during the period May 2013-April 2014. HIV drug resistance testing was performed using dried blood spots. Transmitted HIV drug resistance was defined by the presence of one or more drug resistance mutations as defined by the World Health Organization surveillance drug resistance mutations list. The prevalence of non-nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 16.1% (95% CI 8.8%-27.4%) and 8.2% (95% CI 3.2%-18.2%) in Port Moresby and Mount Hagen, respectively. The prevalence of nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 3.2% (95% CI 0.2%-11.7%) and 3.3% (95% CI 0.2%-11.8%) in Port Moresby and Mount Hagen, respectively. No protease inhibitor transmitted HIV drug resistance was observed. The level of non-nucleoside reverse transcriptase inhibitor drug resistance in antiretroviral drug naïve individuals recently infected with HIV in Port Moresby is amongst the highest reported globally. This alarming level of transmitted HIV drug resistance in a young sexually active population threatens to limit the on-going effective use of NNRTIs as a component of first-line ART in Papua New Guinea. To support the choice of nationally recommended first-line antiretroviral therapy, representative surveillance of HIV drug resistance among antiretroviral therapy initiators in Papua New Guinea should be urgently implemented.

In vitro resistance profile of the candidate HIV-1 microbicide drug dapivirine.

Science.gov (United States)

Schader, Susan M; Oliveira, Maureen; Ibanescu, Ruxandra-Ilinca; Moisi, Daniela; Colby-Germinario, Susan P; Wainberg, Mark A

2012-02-01

Antiretroviral-based microbicides may offer a means to reduce the sexual transmission of HIV-1. Suboptimal use of a microbicide may, however, lead to the development of drug resistance in users that are already, or become, infected with HIV-1. In such cases, the efficacy of treatments may be compromised since the same (or similar) antiretrovirals used in treatments are being developed as microbicides. To help predict which drug resistance mutations may develop in the context of suboptimal use, HIV-1 primary isolates of different subtypes and different baseline resistance profiles were used to infect primary cells in vitro in the presence of increasing suboptimal concentrations of the two candidate microbicide antiretrovirals dapivirine (DAP) and tenofovir (TFV) alone or in combination. Infections were ongoing for 25 weeks, after which reverse transcriptase genotypes were determined and scrutinized for the presence of any clinically recognized reverse transcriptase drug resistance mutations. Results indicated that suboptimal concentrations of DAP alone facilitated the emergence of common nonnucleoside reverse transcriptase inhibitor resistance mutations, while suboptimal concentrations of DAP plus TFV gave rise to fewer mutations. Suboptimal concentrations of TFV alone did not frequently result in the development of resistance mutations. Sensitivity evaluations for stavudine (d4T), nevirapine (NVP), and lamivudine (3TC) revealed that the selection of resistance as a consequence of suboptimal concentrations of DAP may compromise the potential for NVP to be used in treatment, a finding of potential relevance in developing countries.

Executive summary of the GESIDA/National AIDS Plan Consensus Document on Antiretroviral Therapy in Adults Infected by the Human Immunodeficiency Virus (Updated January 2017).

Science.gov (United States)

2017-05-31

Antiretroviral therapy (ART) is recommended for all patients infected by HIV-1. The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should be based on a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors (tenofovir in either of its two formulations plus emtricitabine or abacavir plus lamivudine) and another drug from a different family. Four of the recommended regimens, all of which have an integrase inhibitor as the third drug (dolutegravir, elvitegravir boosted with cobicistat or raltegravir), are considered preferential, whereas a further 3 regimens (based on elvitegravir/cobicistat, rilpivirine, or darunavir boosted with cobicistat or ritonavir) are considered alternatives. We present the reasons and criteria for switching ART in patients with an undetectable PVL and in those who present virological failure, in which case salvage ART should include 3 (or at least 2) drugs that are fully active against HIV. We also update the criteria for ART in specific situations (acute infection, HIV-2 infection, pregnancy) and comorbidities (tuberculosis or other opportunistic infections, kidney disease, liver disease and cancer). Copyright © 2017. Publicado por Elsevier España, S.L.U.

Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

Science.gov (United States)

Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

2011-02-01

Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

Antiretroviral activity of protease inhibitors against Toxoplasma gondii

Directory of Open Access Journals (Sweden)

Lianet Monzote

2013-02-01

Full Text Available The introduction of highly active antiretroviral therapy (HAART has caused a marked reduction in the occurrence and severity of parasitic infections, including the toxoplasmic encephalitis (TE. These changes have been attributed to the restoration of cell-mediated immunity. This study was developed to examine the activity of six antiretroviral protease inhibitors (API on Toxoplasma gondii tachyzoites. The six API showed anti-Toxoplasma activity, with IC50 value between 1.4 and 6.6 µg/mL. Further studies at the molecular level should be performed to clarify if the use of API could be beneficial or not for AIDS patients with TE.

High Rates of Baseline Drug Resistance and Virologic Failure Among ART-naive HIV-infected Children in Mali.

Science.gov (United States)

Crowell, Claudia S; Maiga, Almoustapha I; Sylla, Mariam; Taiwo, Babafemi; Kone, Niaboula; Oron, Assaf P; Murphy, Robert L; Marcelin, Anne-Geneviève; Traore, Ban; Fofana, Djeneba B; Peytavin, Gilles; Chadwick, Ellen G

2017-11-01

Limited data exist on drug resistance and antiretroviral treatment (ART) outcomes in HIV-1-infected children in West Africa. We determined the prevalence of baseline resistance and correlates of virologic failure (VF) in a cohort of ART-naive HIV-1-infected children baseline (before ART) and at 6 months. Resistance was defined according to the Stanford HIV Genotypic Resistance database. VF was defined as viral load ≥1000 copies/mL after 6 months of ART. Logistic regression was used to evaluate factors associated with VF or death >1 month after enrollment. Post hoc, antiretroviral concentrations were assayed on baseline samples of participants with baseline resistance. One-hundred twenty children with a median age 2.6 years (interquartile range: 1.6-5.0) were included. Eighty-eight percent reported no prevention of mother-to-child transmission exposure. At baseline, 27 (23%), 4 (3%) and none had non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor or protease inhibitor resistance, respectively. Thirty-nine (33%) developed VF and 4 died >1 month post-ART initiation. In multivariable analyses, poor adherence [odds ratio (OR): 6.1, P = 0.001], baseline NNRTI resistance among children receiving NNRTI-based ART (OR: 22.9, P baseline NNRTI resistance (OR: 5.8, P = 0.018) were significantly associated with VF/death. Ten (38%) with baseline resistance had detectable levels of nevirapine or efavirenz at baseline; 7 were currently breastfeeding, but only 2 reported maternal antiretroviral use. Baseline NNRTI resistance was common in children without reported NNRTI exposure and was associated with increased risk of treatment failure. Detectable NNRTI concentrations were present despite few reports of maternal/infant antiretroviral use.

A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

Science.gov (United States)

Zanetti, Maurizio

2017-02-01

Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

NARCIS (Netherlands)

Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

2013-01-01

The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

High HIV-1 Diversity and Prevalence of Transmitted Drug Resistance Among Antiretroviral-Naive HIV-Infected Pregnant Women from Rio de Janeiro, Brazil.

Science.gov (United States)

Delatorre, Edson; Silva-de-Jesus, Carlos; Couto-Fernandez, José Carlos; Pilotto, Jose H; Morgado, Mariza G

2017-01-01

Antiretroviral (ARV) resistance mutations in human immunodeficiency virus type 1 (HIV-1) infection may reduce the efficacy of prophylactic therapy to prevent mother-to-child transmission (PMTCT) and future treatment options. This study evaluated the diversity and the prevalence of transmitted drug resistance (TDR) in protease (PR) and reverse transcriptase (RT) regions of HIV-1 pol gene among 87 ARV-naive HIV-1-infected pregnant women from Rio de Janeiro, Brazil, between 2012 and 2015. The viral diversity comprised HIV-1 subtypes B (67.8%), F1 (17.2%), and C (4.6%); the circulating recombinant forms 12_BF (2.3%), 28/29_BF, 39_BF, 02_AG (1.1% each) and unique recombinants forms (4.5%). The overall prevalence of any TDR was 17.2%, of which 5.7% for nucleoside RT inhibitors, 5.7% for non-nucleoside RT inhibitors, and 8% for PR inhibitors. The TDR prevalence found in this population may affect the virological outcome of the standard PMTCT ARV-regimens, reinforcing the importance of continuous monitoring.

Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

Directory of Open Access Journals (Sweden)

Alessandra M. T. de Souza

2013-10-01

Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

Efavirenz poisoning in a 12 year old HIV negative African boy ...

African Journals Online (AJOL)

Efavirenz is an oral antiretroviral drug in the class of non nucleoside reverse transcriptase inhibitors. Toxicity at therapeutic doses has been documented but there is scarcity of data on presentation and management of Efavirenz overdose. We describe a case of Efavirenz poisoning in a 12-year old HIV Negative African boy ...

[GESIDA/National AIDS Plan: Consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (Updated January 2015)].

Science.gov (United States)

2015-10-01

This consensus document is an update of combined antiretroviral therapy (cART) guidelines and recommendations for HIV-1 infected adult patients. To formulate these recommendations, a panel composed of members of the AIDS Study Group and the AIDS National Plan (GeSIDA/Plan Nacional sobre el Sida) reviewed the efficacy and safety advances in clinical trials, and cohort and pharmacokinetic studies published in medical journals (PubMed and Embase) or presented in medical scientific meetings. The strength of the recommendations, and the evidence that supports them, are based on modified criteria of the Infectious Diseases Society of America. In this update, cART is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and level of the recommendation depends on the CD4+T-lymphocyte count, the presence of opportunistic diseases or comorbid conditions, age, and prevention of transmission of HIV. The objective of cART is to achieve an undetectable plasma viral load. Initial cART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors, and a third drug from a different family. Three out of the ten recommended regimes are regarded as preferential (all of them with an integrase inhibitor as the third drug), and the other seven (based on a non-nucleoside reverse transcriptase inhibitor, a ritonavir-boosted protease inhibitor, or an integrase inhibitor) as alternatives. This update presents the causes and criteria for switching cART in patients with undetectable plasma viral load, and in cases of virological failure where rescue cART should comprise 3 (or at least 2) drugs that are fully active against the virus. An update is also provided for the specific criteria for cART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). These new guidelines

Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

Energy Technology Data Exchange (ETDEWEB)

Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

2011-12-08

RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

Molecular Phylogenetics of Transmitted Drug Resistance in Newly Diagnosed HIV Type 1 Individuals in Denmark, a Nation-Wide Study

DEFF Research Database (Denmark)

Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

2011-01-01

Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

Molecular phylogenetics of transmitted drug resistance in newly diagnosed HIV Type 1 individuals in Denmark: a nation-wide study

DEFF Research Database (Denmark)

Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

2011-01-01

Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

Directory of Open Access Journals (Sweden)

Ammad Ahmad Farooqi

2018-04-01

Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

Directory of Open Access Journals (Sweden)

Markus Hecht

Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

Highly active antiretroviral therapy including protease inhibitors does not confer a unique CD4 cell benefit. The AVANTI and INCAS Study Groups.

Science.gov (United States)

2000-07-07

To determine if triple combination therapy, particularly including HIV protease inhibitors (PI), confers an unique immunological benefit that is independent of reductions of plasma viral load (pVL). The correlation between changes from baseline in CD4 cell count and pVL was examined at all time points up to 52 weeks in three randomized clinical trials (AVANTI-2, AVANTI-3 and INCAS) that compared dual nucleoside therapy with triple combination therapy. Individual pVL and CD4 cell counts changes from baseline were entered into multivariate linear regression models for patients receiving double therapy and for those receiving triple therapy including a PI and/or a non-nucleoside reverse transcriptase inhibitor (NNRTI), and the null hypothesis was tested. After 52 weeks of therapy, the relationship between changes from baseline CD4 cell count and pVL was independent of whether patients were assigned double or triple therapy (P = 0.23 and 0.69 for intercept and slope, respectively), or whether patients were assigned triple therapy including a PI or triple therapy including an NNRTI (P = 0.92 and 0.95, respectively). Less than 5% of patients ever had 'discordant' increases in both CD4 cell count and pVL compared with baseline, and this proportion was unrelated to the class of therapy used. 'Discordant' decreases from baseline in both parameters were observed in up to 35% of individuals. The correlation between pVL and CD4 cell count changes from baseline improved over time on therapy, regardless of the therapeutic regimen involved. The data provide no evidence for a CD4 cell count benefit of highly active antiretroviral therapy (HAART) unique to triple therapy or PI-containing regimens.

Nevirapine and efavirenz elicit different changes in lipid profiles in antiretroviral-therapy-naive patients infected with HIV-1.

Directory of Open Access Journals (Sweden)

Frank van Leth

2004-10-01

Full Text Available BACKGROUND: Patients infected with HIV-1 initiating antiretroviral therapy (ART containing a non-nucleoside reverse transcriptase inhibitor (NNRTI show presumably fewer atherogenic lipid changes than those initiating most ARTs containing a protease inhibitor. We analysed whether lipid changes differed between the two most commonly used NNRTIs, nevirapine (NVP and efavirenz (EFV. METHODS AND FINDINGS: Prospective analysis of lipids and lipoproteins was performed in patients enrolled in the NVP and EFV treatment groups of the 2NN study who remained on allocated treatment during 48 wk of follow-up. Patients were allocated to NVP (n = 417, or EFV (n = 289 in combination with stavudine and lamivudine. The primary endpoint was percentage change over 48 wk in high-density lipoprotein cholesterol (HDL-c, total cholesterol (TC, TC:HDL-c ratio, non-HDL-c, low-density lipoprotein cholesterol, and triglycerides. The increase of HDL-c was significantly larger for patients receiving NVP (42.5% than for patients receiving EFV (33.7%; p = 0.036, while the increase in TC was lower (26.9% and 31.1%, respectively; p = 0.073, resulting in a decrease of the TC:HDL-c ratio for patients receiving NVP (-4.1% and an increase for patients receiving EFV (+5.9%; p < 0.001. The increase of non-HDL-c was smaller for patients receiving NVP (24.7% than for patients receiving EFV (33.6%; p = 0.007, as were the increases of triglycerides (20.1% and 49.0%, respectively; p < 0.001 and low-density lipoprotein cholesterol (35.0% and 40.0%, respectively; p = 0.378. These differences remained, or even increased, after adjusting for changes in HIV-1 RNA and CD4+ cell levels, indicating an effect of the drugs on lipids over and above that which may be explained by suppression of HIV-1 infection. The increases in HDL-c were of the same order of magnitude as those seen with the use of the investigational HDL-c-increasing drugs. CONCLUSION: NVP-containing ART shows larger increases in HDL

Targeted Transgenic Overexpression of Mitochondrial Thymidine Kinase (TK2) Alters Mitochondrial DNA (mtDNA) and Mitochondrial Polypeptide Abundance : Transgenic TK2, mtDNA, and Antiretrovirals

OpenAIRE

Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

2007-01-01

Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...

A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

OpenAIRE

Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

2015-01-01

Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission.

Science.gov (United States)

Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia

2011-06-01

Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors

Science.gov (United States)

Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.

2017-10-01

The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

Synergy against drug-resistant HIV-1 with the microbicide antiretrovirals, dapivirine and tenofovir, in combination.

Science.gov (United States)

Schader, Susan M; Colby-Germinario, Susan P; Schachter, Jordana R; Xu, Hongtao; Wainberg, Mark A

2011-08-24

To evaluate the candidate antiretroviral microbicide compounds, dapivirine (DAP) and tenofovir (TFV), alone and in combination against the transmission of wild-type and nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV-1 from different subtypes. We determined single-drug efficacy of the RTIs, DAP and TFV, against subtype B and non-B wild-type and NNRTI-resistant HIV-1 in vitro. To assess breadth of activity, compounds were tested alone and in combination against wild-type and NNRTI-resistant subtype C primary HIV-1 isolates and complimentary clonal HIV-1 from subtypes B, C and CRF02_AG to control for viral variation. Early infection was quantified by counting light units emitted from TZM-bl cells less than 48-h postinfection. Combination ratios were based on drug inhibitory concentrations (IC(50)s) and combined effects were determined by calculating combination indices. Both candidate microbicide antiretrovirals demonstrated potent anti-NNRTI-resistant HIV-1 activity in vitro, albeit the combination protected better than the single-drug treatments. Of particular interest, the DAP with TFV combination exhibited synergy (50% combination index, CI(50) = 0.567) against subtype C NNRTI-resistant HIV-1, whereas additivity (CI(50) = 0.987) was observed against the wild-type counterpart from the same patient. The effect was not compounded by the presence of subdominant viral fractions, as experiments using complimentary clonal subtype C wild-type (CI(50) = 0.968) and NNRTI-resistant (CI(50) = 0.672) HIV-1, in lieu of the patient quasispecies, gave similar results. This study supports the notion that antiretroviral drug combinations may retain antiviral activity against some drug-resistant HIV-1 despite subtype classification and quasispecies diversity.

New and investigational antiretroviral drugs for HIV infection: mechanisms of action and early research findings.

Science.gov (United States)

Saag, Michael S

2012-12-01

Numerous investigational antiretroviral agents are in clinical development. Among them are festinavir (BMS986001), a thymidine analogue similar to stavudine with reduced potential for toxicity; GS-7340, a prodrug of tenofovir that achieves greater intracellular concentrations; MK-1439, a nonnucleoside analogue reverse transcriptase inhibitor (NNRTI) that retains activity against common NNRTI-associated resistance mutations; and albuvirtide, a long-acting parenteral fusion inhibitor. Investigational integrase strand transfer inhibitors (InSTIs) include elvitegravir, recently approved by the US Food and Drug Administration (FDA) as part of a once-daily, single-tablet formulation with cobicistat/tenofovir/emtricitabine; dolutegravir, which maintains some activity against raltegravir- and elvitegravir-resistant mutants; and S/GSK1265744, which also maintains some activity against resistance mutations in the integrase gene and is being developed as a long-lasting parenteral agent. Novel 2-(quinolin-3-yl)acetic acid derivatives (LEDGINs), agents that were originally thought to inhibit the interaction of integrase with its cofactor lens epithelium-derived growth factor p75 (LEDGF/p75), be active against InSTI-resistant mutants and to have additive activity when combined with InSTIs. This article summarizes a presentation by Michael S. Saag, MD, at the IAS-USA live Improving the Management of HCV Disease continuing medical education program held in New York in October 2012.

Increased Persistence of Initial Treatment for HIV Infection With Modern Antiretroviral Therapy.

Science.gov (United States)

Davy-Mendez, Thibaut; Eron, Joseph J; Zakharova, Oksana; Wohl, David A; Napravnik, Sonia

2017-10-01

Initiating antiretroviral therapy (ART) early improves clinical outcomes and prevents transmission. Guidelines for first-line therapy have changed with the availability of newer ART agents. In this study, we compared persistence and virologic responses with initial ART according to the class of anchor agent used. An observational clinical cohort study in the Southeastern United States. All HIV-infected patients participating in the UNC Center for AIDS Research Clinical Cohort (UCHCC) and initiating ART between 1996 and 2014 were included. Separate time-to-event analyses with regimen discontinuation and virologic failure as outcomes were used, including Kaplan-Meier survival curves and adjusted Cox proportional hazards models. One thousand six hundred twenty-four patients were included (median age of 37 years at baseline, 28% women, 60% African American, and 28% white). Eleven percent initiated integrase strand transfer inhibitor (INSTI), 33% non-nucleoside reverse transcriptase inhibitor (NNRTI), 20% boosted protease inhibitor, 27% other, and 9% NRTI only regimens. Compared with NNRTI-containing regimens, INSTI-containing regimens had an adjusted hazard ratio of 0.49 (95% confidence interval, 0.35 to 0.69) for discontinuation and 0.70 (95% confidence interval, 0.46 to 1.06) for virologic failure. All other regimen types were associated with increased rates of discontinuation and failure compared with NNRTI. Initiating ART with an INSTI-containing regimen was associated with lower rates of regimen discontinuation and virologic failure.

Resistance profiles and adherence at primary virological failure in three different highly active antiretroviral therapy regimens: analysis of failure rates in a randomized study

DEFF Research Database (Denmark)

Røge, B T; Barfod, T S; Kirk, O

2004-01-01

OBJECTIVES: To investigate the interplay between resistance and adherence in the virological failure of three fundamentally different highly active antiretroviral therapy (HAART) regimens. METHODS: We retrospectively identified 56 verified primary virological failures (viral load >400 HIV-1 RNA...... copies/mL) among 293 patients randomized to two nucleoside reverse transcriptase inhibitors (NRTIs)+ritonavir+saquinavir (RS-arm) (n=115), two NRTIs+nevirapine+nelfinavir (NN-arm) (n=118), or abacavir+stavudine+didanosine (ASD-arm) (n=60) followed up for a median of 90 weeks. Data on adherence were...... collected from patient files, and genotyping was performed on plasma samples collected at time of failure. RESULTS: Treatment interruption or poor adherence was mainly caused by side effects and accounted for 74% of failures, and was associated with absence of resistance mutations. In the 30 failing...

Immunological responses during a virologically failing antiretroviral regimen are associated with in vivo synonymous mutation rates of HIV type-1 env

DEFF Research Database (Denmark)

Mens, Helene; Jørgensen, Louise Bruun; Kronborg, Gitte

2009-01-01

BACKGROUND: Little is known about the underlying causes of differences in immunological response to antiretroviral therapy during multidrug-resistant (MDR) HIV type-1 (HIV-1) infection. This study aimed to identify virological factors associated with immunological response during therapy failure...... for analysis. In a longitudinal mixed-effects model, plasma HIV-1 RNA only tended to predict immunological response (P=0.06), whereas minor protease inhibitor (PI) and nucleoside reverse transcriptase (NRTI) mutations at baseline correlated significantly with CD4+ T-cell count slopes (r= -0.56, P=0.04 and r......= -0.64, P=0.008, respectively). Interestingly, synonymous mutations of env correlated inversely with CD4+ T-cell count slopes (r=-0.60; P=0.01) and individuals with codons under positive selection had significantly better CD4+ T-cell responses than individuals without (0.42 versus -5.34; P=0...

Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme.

Science.gov (United States)

Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan

2012-01-01

The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

A STUDY OF ANTIRETROVIRAL THERAPY OUTCOMES IN A TERTIARY CARE CENTER IN THANJAVUR MEDICAL COLLEGE HOSPITAL, SOUTHERN INDIA

Directory of Open Access Journals (Sweden)

Kannan V. P

2017-05-01

Full Text Available BACKGROUND The number of people infected with the Human Immunodeficiency Virus (HIV worldwide was estimated to be 33.2 million at the end of 2007. The introduction of Anti-Retroviral Therapy (ART has significantly reduced morbidity and mortality in HIVinfected patients in various developed and developing countries. However, the outcome of ART in India’s National ART Programme has not been reported in detail. The aim of the study is to- 1. Evaluate the immunological response of HIV infected adults starting Highly Active Antiretroviral Therapy (HAART. 2. Evaluate the clinical response of highly active antiretroviral therapy in HIV infected adults. 3. Assess the functional status improvement following highly active antiretroviral therapy. MATERIALS AND METHODS To evaluate the effectiveness of the National ART Programme at Thanjavur Medical College Hospital, we undertook a prospective observational study involving ART naive patients who were started on ART between May 2015 and October 2016. ART was offered to these patients in accordance with NACO guidelines. The regimen consisted of two nucleoside reverse transcriptase inhibitors and one non-nucleoside reverse transcriptase inhibitor. The available drugs included efavirenz, lamivudine, nevirapine and zidovudine. The CD4+ lymphocyte (CD4 count (cells/µL was estimated at baseline and at six months intervals during follow-up. Prophylaxis and treatment of opportunistic infections were in accordance with NACO guidelines. Anti-tuberculosis treatment was administered according to the Revised National Tuberculosis Control Programme guidelines. RESULTS Among 203 patients started on ART in this study, 3 died after completing 6 months of therapy and 17 died within 6 months of therapy. Out of the remaining 183 patients, 104 were males and 79 were females. The predominant route of HIV transmission is through unsafe sexual practice, which accounts for 84% of cases. Incidence of HIV is less common in literate

Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

Science.gov (United States)

Li, Runqin; Zhang, Yinglin

2016-01-01

Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

Directory of Open Access Journals (Sweden)

Dieter Hoffmann

Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

Mutations Related to Antiretroviral Resistance Identified by Ultra-Deep Sequencing in HIV-1 Infected Children under Structured Interruptions of HAART.

Directory of Open Access Journals (Sweden)

Jose Manuel Vazquez-Guillen

Full Text Available Although Structured Treatment Interruptions (STI are currently not considered an alternative strategy for antiretroviral treatment, their true benefits and limitations have not been fully established. Some studies suggest the possibility of improving the quality of life of patients with this strategy; however, the information that has been obtained corresponds mostly to studies conducted in adults, with a lack of knowledge about its impact on children. Furthermore, mutations associated with antiretroviral resistance could be selected due to sub-therapeutic levels of HAART at each interruption period. Genotyping methods to determine the resistance profiles of the infecting viruses have become increasingly important for the management of patients under STI, thus low-abundance antiretroviral drug-resistant mutations (DRM's at levels under limit of detection of conventional genotyping (<20% of quasispecies could increase the risk of virologic failure. In this work, we analyzed the protease and reverse transcriptase regions of the pol gene by ultra-deep sequencing in pediatric patients under STI with the aim of determining the presence of high- and low-abundance DRM's in the viral rebounds generated by the STI. High-abundance mutations in protease and high- and low-abundance mutations in reverse transcriptase were detected but no one of these are directly associated with resistance to antiretroviral drugs. The results could suggest that the evaluated STI program is virologically safe, but strict and carefully planned studies, with greater numbers of patients and interruption/restart cycles, are still needed to evaluate the selection of DRM's during STI.

Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

NARCIS (Netherlands)

Oude Essink, B. B.; Das, A. T.; Berkhout, B.

1995-01-01

Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

Science.gov (United States)

Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

2011-12-20

Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

Directory of Open Access Journals (Sweden)

Elisabeth Humphris-Narayanan

Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

Rate of accumulation of thymidine analogue mutations in patients continuing to receive virologically failing regimens containing zidovudine or stavudine: implications for antiretroviral therapy programs in resource-limited settings

DEFF Research Database (Denmark)

Cozzi-Lepri, Alessandro; Phillips, Andrew N; Martinez-Picado, Javier

2009-01-01

BACKGROUND: Because changes in antiretroviral therapy in resource-limited settings (RLSs) are delayed until patients experience immunological or clinical failure, it is important to be able to estimate the consequences in terms of accumulation of thymidine analogue (TA) mutations (TAMs). METHODS...... until the second GRT. RESULTS: At the time of the first GRT in a pair (t0), 1 year after virological failure, a median of 3 TAMs were detected, mutations 41L and 215Y in 65% of pairs and 67N in 52%. Overall, 126 TAMs were accumulated during 548 person-years of follow-up (PYFUs) (1/4.3 years; 95......% confidence interval, 3.7-5.0 years). Greater predicted activity of the TA at t0, TAM profile 2 (TAM2; vs TAM profile 1 [TAM1]) profiles at t0, use of a nonnucleoside reverse-transcriptase inhibitor (NNRTI) at t0 (vs combined NNRTI and protease inhibitor), and acquisition of HIV infection through heterosexual...

An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

DEFF Research Database (Denmark)

Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

2004-01-01

Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors.

Science.gov (United States)

Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi

2018-05-11

Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

Maternal Nutritional Status Predicts Adverse Birth Outcomes among HIV-Infected Rural Ugandan Women Receiving Combination Antiretroviral Therapy

Science.gov (United States)

Young, Sera; Murray, Katherine; Mwesigwa, Julia; Natureeba, Paul; Osterbauer, Beth; Achan, Jane; Arinaitwe, Emmanuel; Clark, Tamara; Ades, Veronica; Plenty, Albert; Charlebois, Edwin; Ruel, Theodore; Kamya, Moses; Havlir, Diane; Cohan, Deborah

2012-01-01

Objective Maternal nutritional status is an important predictor of birth outcomes, yet little is known about the nutritional status of HIV-infected pregnant women treated with combination antiretroviral therapy (cART). We therefore examined the relationship between maternal BMI at study enrollment, gestational weight gain (GWG), and hemoglobin concentration (Hb) among 166 women initiating cART in rural Uganda. Design Prospective cohort. Methods HIV-infected, ART-naïve pregnant women were enrolled between 12 and 28 weeks gestation and treated with a protease inhibitor or non-nucleoside reverse transcriptase inhibitor-based combination regimen. Nutritional status was assessed monthly. Neonatal anthropometry was examined at birth. Outcomes were evaluated using multivariate analysis. Results Mean GWG was 0.17 kg/week, 14.6% of women experienced weight loss during pregnancy, and 44.9% were anemic. Adverse fetal outcomes included low birth weight (LBW) (19.6%), preterm delivery (17.7%), fetal death (3.9%), stunting (21.1%), small-for-gestational age (15.1%), and head-sparing growth restriction (26%). No infants were HIV-infected. Gaining pregnancy, grossly inadequate GWG was common. Infants whose mothers gained <0.1 kg/week were at increased risk for LBW, preterm delivery, and composite adverse birth outcomes. cART by itself may not be sufficient for decreasing the burden of adverse birth outcomes among HIV-infected women. Trial Registration Clinicaltrials.gov NCT00993031 PMID:22879899

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

Targeted transgenic overexpression of mitochondrial thymidine kinase (TK2) alters mitochondrial DNA (mtDNA) and mitochondrial polypeptide abundance: transgenic TK2, mtDNA, and antiretrovirals.

Science.gov (United States)

Hosseini, Seyed H; Kohler, James J; Haase, Chad P; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

2007-03-01

Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-gamma. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity.

NMR structure of the HIV-1 reverse transcriptase thumb subdomain

Energy Technology Data Exchange (ETDEWEB)

Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

2016-12-15

The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

Antiretroviral treatment is associated with increased attentional load-dependent brain activation in HIV patients.

Science.gov (United States)

Chang, L; Yakupov, R; Nakama, H; Stokes, B; Ernst, T

2008-06-01

The purpose of this paper was to determine whether antiretroviral medications, especially the nucleoside analogue reverse transcriptase inhibitors, lead to altered brain activation due to their potential neurotoxic effects in patients with human immunodeficiency virus (HIV) infection. Forty-two right-handed men were enrolled in three groups: seronegative controls (SN, n = 18), HIV subjects treated with antiretroviral medications (HIV+ARV, n = 12), or not treated with antiretroviral medications (HIV+NARV, n = 12). Each subject performed a set of visual attention tasks with increasing difficulty or load (tracking two, three or four balls) during functional magnetic resonance imaging. HIV subjects, both groups combined, showed greater load-dependent increases in brain activation in the right frontal regions compared to SN (p-corrected = 0.006). HIV+ARV additionally showed greater load-dependent increases in activation compared to SN in bilateral superior frontal regions (p-corrected = 0.032) and a lower percent accuracy on the performance of the most difficult task (tracking four balls). Region of interest analyses further demonstrated that SN showed load-dependent decreases (with repeated trials despite increasing difficulty), while HIV subjects showed load-dependent increases in activation with the more difficult tasks, especially those on ARVs. These findings suggest that chronic ARV treatments may lead to greater requirement of the attentional network reserve and hence less efficient usage of the network and less practice effects in these HIV patients. As the brain has a limited reserve capacity, exhausting the reserve capacity in HIV+ARV would lead to declined performance with more difficult tasks that require more attention.

Short communication: high prevalence of drug resistance in HIV type 1-infected children born in Honduras and Belize 2001 to 2004.

Science.gov (United States)

Parham, Leda; de Rivera, Ivette Lorenzana; Murillo, Wendy; Naver, Lars; Largaespada, Natalia; Albert, Jan; Karlsson, Annika C

2011-10-01

Antiretroviral therapy has had a great impact on the prevention of mother-to-child transmission (MTCT) of HIV-1. However, development of drug resistance, which could be subsequently transmitted to the child, is a major concern. In Honduras and Belize the prevalence of drug resistance among HIV-1-infected children remains unknown. A total of 95 dried blood spot samples was obtained from HIV-1-infected, untreated children in Honduras and Belize born during 2001 to 2004, when preventive antiretroviral therapy was often suboptimal and consisted of monotherapy with nevirapine or zidovudine. Partial HIV-1 pol gene sequences were successfully obtained from 66 children (Honduras n=55; Belize n=11). Mutations associated with drug resistance were detected in 13% of the Honduran and 27% of the Belizean children. Most of the mutations detected in Honduras (43%) and all mutations detected in Belize were associated with resistance to nonnucleoside reverse transcriptase inhibitors, which was expected from the wide use of nevirapine to prevent MTCT during the study period. In addition, although several mothers reported that they had not received antiretroviral therapy, mutations associated with resistance to nucleoside reverse transcriptase inhibitors and protease inhibitors were found in Honduras. This suggests prior and unreported use of these drugs, or that these women had been infected with resistant virus. The present study demonstrates, for the first time, the presence of drug resistance-associated mutations in HIV-1-infected Honduran and Belizean children.

HIV-1 drug resistance surveillance in antiretroviral treatment-naive individuals from a reference hospital in Guatemala, 2010-2013.

Science.gov (United States)

Avila-Ríos, Santiago; García-Morales, Claudia; Garrido-Rodríguez, Daniela; Tapia-Trejo, Daniela; Girón-Callejas, Amalia Carolina; Mendizábal-Burastero, Ricardo; Escobar-Urias, Ingrid Yessenia; García-González, Blanca Leticia; Navas-Castillo, Sabrina; Pinzón-Meza, Rodolfo; Mejía-Villatoro, Carlos Rodolfo; Reyes-Terán, Gustavo

2015-04-01

The recent expansion of antiretroviral treatment (ART) coverage in middle/low-income countries has been associated with increasing prevalence of HIV pre-ART drug resistance (PDR). We assessed PDR prevalence, patterns, and trends in Guatemala. Blood samples from 1,084 ART-naive individuals, enrolled from October 2010 to December 2013 at the Roosevelt Hospital in Guatemala City, were obtained. PDR was evaluated using the WHO mutation list for transmitted drug resistance (TDR) surveillance. An overall PDR prevalence of 7.3% (95% CI 5.8-9.0%) was observed for the whole study period. TDR to nonnucleoside reverse transcriptase inhibitors (NNRTI) was the highest (4.9%, p500 and 350-500 CD4(+) T cells/μl (7.4% and 8.7%, respectively) compared to individuals with Guatemala remains at an intermediate level. Nevertheless, we have shown evidence suggesting increasing trends in NNRTI PDR, which need to be taken into account in national HIV management policies.

The future of pre-exposure prophylaxis (PrEP) for human immunodeficiency virus (HIV) infection.

Science.gov (United States)

Özdener, Ayşe Elif; Park, Tae Eun; Kalabalik, Julie; Gupta, Rachna

2017-05-01

People at high risk for HIV acquisition should be offered pre-exposure prophylaxis (PrEP). Tenofovir disoproxil fumarate (TDF)/emtricitabine (FTC) is currently the only medication recommended for pre-exposure prophylaxis (PrEP) by the Centers for Disease Control and Prevention (CDC) in people at high risk for HIV acquisition. This article will review medications currently under investigation and the future landscape of PrEP therapy. Areas covered: This article will review clinical trials that have investigated nontraditional regimens of TDF/FTC, antiretroviral agents from different drug classes such as integrase strand transfer inhibitors (INSTI), nucleoside reverse transcriptase inhibitors (NRTI), and non-nucleoside reverse transcriptase inhibitors (NNRTI) as potential PrEP therapies. Expert commentary: Currently, there are several investigational drugs in the pipeline for PrEP against HIV infection. Increased utilization of PrEP therapy depends on provider identification of people at high risk for HIV transmission. Advances in PrEP development will expand options and access for people and reduce the risk of HIV acquisition.

The development and validation of an UHPLC-MS/MS method for the rapid quantification of the antiretroviral agent dapivirine in human plasma.

Science.gov (United States)

Seserko, Lauren A; Emory, Joshua F; Hendrix, Craig W; Marzinke, Mark A

2013-11-01

Dapivirine is a non-nucleoside reverse transcriptase inhibitor designed to prevent HIV-1 viral replication and subsequent propagation. A sensitive method is required to quantify plasma concentrations to assess drug efficacy. Dapivirine-spiked plasma was combined with acetonitrile containing deuterated IS and was processed for analysis. The method has an analytical measuring range from 20 to 10,000 pg/ml. For the LLOQ, low, mid and high QCs, intra- and inter-assay precision (%CV) ranged from 5.58 to 13.89% and 5.23 to 13.36%, respectively, and intra- and inter-day accuracy (% deviation) ranged from -5.61 to 0.75% and -4.30 to 6.24%, respectively. A robust and sensitive LC-MS/MS assay for the high-throughput quantification of the antiretroviral drug dapivirine in human plasma was developed and validated following bioanalytical validation guidelines. The assay meets criteria for the analysis of samples from large research trials.

Pharmacological and clinical evidence of nevirapine immediate- and extended-release formulations

Directory of Open Access Journals (Sweden)

Ena J

2012-11-01

Full Text Available Javier Ena, Concepción Amador, Conxa Benito, Francisco PasquauHIV Unit, Hospital Marina Baixa, Villajoyosa, SpainAbstract: We reviewed the current information available on nevirapine immediate- and extended-release formulations and its role in single-dose and combination antiretroviral therapy. Nevirapine was approved in 1996 and was the first non-nucleoside reverse-transcriptase inhibitor available for the treatment of HIV-1 infection. Nevirapine has demonstrated good efficacy and a well-characterized safety profile. A major drawback is the low genetic barrier, allowing the emergence of resistance in the presence of single mutations in the reverse-transcriptase gene. This shortcoming is particularly relevant when nevirapine is administered in a single dose to prevent mother-to-child transmission of HIV-1 infection, compromising the efficacy of future non-nucleoside reverse transcriptase–inhibitor regimens. Studies published recently have probed the noninferiority of nevirapine compared to ritonavir-boosted atazanavir with both tenofovir disoproxil fumarate and emtricitabine in antiretroviral treatment–naïve patients. In 2011, a new formulation of nevirapine (nevirapine extended release that allowed once-daily dosing was approved by the Food and Drug Administration and by the European Medicines Agency. VERxVe, a study comparing nevirapine extended release with nevirapine immediate release in antiretroviral treatment–naïve patients, and TRANxITION, a study carried out in antiretroviral treatment–experienced patients who switched therapy from nevirapine immediate release to nevirapine extended release, provided data on the noninferiority of the new formulation of nevirapine compared with nevirapine immediate release in terms of efficacy and safety. Nevirapine extended release will further increase the durability and persistence of nevirapine-containing antiretroviral therapy, allowing once-daily dosing regimens.Keywords: nevirapine

Resistance Analyses of Integrase Strand Transfer Inhibitors within Phase 3 Clinical Trials of Treatment-Naive Patients

Directory of Open Access Journals (Sweden)

Kirsten L. White

2014-07-01

Full Text Available The integrase (IN strand transfer inhibitors (INSTIs, raltegravir (RAL, elvitegravir (EVG and dolutegravir (DTG, comprise the newest drug class approved for the treatment of HIV-1 infection, which joins the existing classes of reverse transcriptase, protease and binding/entry inhibitors. The efficacy of first-line regimens has attained remarkably high levels, reaching undetectable viral loads in 90% of patients by Week 48; however, there remain patients who require a change in regimen due to adverse events, virologic failure with emergent resistance or other issues of patient management. Large, randomized clinical trials conducted in antiretroviral treatment-naive individuals are required for drug approval in this population in the US, EU and other countries, with the primary endpoint for virologic success at Week 48. However, there are differences in the definition of virologic failure and the evaluation of drug resistance among the trials. This review focuses on the methodology and tabulation of resistance to INSTIs in phase 3 clinical trials of first-line regimens and discusses case studies of resistance.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali

2015-11-27

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

2015-01-01

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

TMC125 exerts similar initial antiviral potency as a five-drug, triple class antiretroviral regimen

NARCIS (Netherlands)

Sankatsing, Sanjay U. C.; Weverling, Gerrit J.; Peeters, Monika; van't Klooster, Gerben; Gruzdev, Boris; Rakhmanova, Aza; Danner, Sven A.; Jurriaans, Suzanne; Prins, Jan M.; Lange, Joep M. A.

2003-01-01

Objective: TMC125, a next generation, non-nucleoside reverse transcriptase inhibitor (NNRTI), demonstrated a remarkable decline of plasma HIV-1 RNA during a phase IIa study. We compared the initial rate of decline of plasma HIV-1 RNA achieved by TMC125 monotherapy with that of a triple class,

2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

International Nuclear Information System (INIS)

Starnes, M.C.

1988-01-01

2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

Perinatal acquisition of drug-resistant HIV-1 infection: mechanisms and long-term outcome

Directory of Open Access Journals (Sweden)

Dollfus Catherine

2009-09-01

Full Text Available Abstract Background Primary-HIV-1-infection in newborns that occurs under antiretroviral prophylaxis that is a high risk of drug-resistance acquisition. We examine the frequency and the mechanisms of resistance acquisition at the time of infection in newborns. Patients and Methods We studied HIV-1-infected infants born between 01 January 1997 and 31 December 2004 and enrolled in the ANRS-EPF cohort. HIV-1-RNA and HIV-1-DNA samples obtained perinatally from the newborn and mother were subjected to population-based and clonal analyses of drug resistance. If positive, serial samples were obtained from the child for resistance testing. Results Ninety-two HIV-1-infected infants were born during the study period. Samples were obtained from 32 mother-child pairs and from another 28 newborns. Drug resistance was detected in 12 newborns (20%: drug resistance to nucleoside reverse transcriptase inhibitors was seen in 10 cases, non-nucleoside reverse transcriptase inhibitors in two cases, and protease inhibitors in one case. For 9 children, the detection of the same resistance mutations in mothers' samples (6 among 10 available and in newborn lymphocytes (6/8 suggests that the newborn was initially infected by a drug-resistant strain. Resistance variants were either transmitted from mother-to-child or selected during subsequent temporal exposure under suboptimal perinatal prophylaxis. Follow-up studies of the infants showed that the resistance pattern remained stable over time, regardless of antiretroviral therapy, suggesting the early cellular archiving of resistant viruses. The absence of resistance in the mother of the other three children (3/10 and neonatal lymphocytes (2/8 suggests that the newborns were infected by a wild-type strain without long-term persistence of resistance when suboptimal prophylaxis was stopped. Conclusion This study confirms the importance of early resistance genotyping of HIV-1-infected newborns. In most cases (75%, drug

The development and validation of an UHPLC–MS/MS method for the rapid quantification of the antiretroviral agent dapivirine in human plasma

Science.gov (United States)

Seserko, Lauren A; Emory, Joshua F; Hendrix, Craig W; Marzinke, Mark A

2014-01-01

Background Dapivirine is a non-nucleoside reverse transcriptase inhibitor designed to prevent HIV-1 viral replication and subsequent propagation. A sensitive method is required to quantify plasma concentrations to assess drug efficacy. Results Dapivirine-spiked plasma was combined with acetonitrile containing deuterated IS and was processed for analysis. The method has an analytical measuring range from 20 to 10,000 pg/ml. For the LLOQ, low, mid and high QCs, intra- and inter-assay precision (%CV) ranged from 5.58 to 13.89% and 5.23 to 13.36%, respectively, and intra- and inter-day accuracy (% deviation) ranged from -5.61 to 0.75% and -4.30 to 6.24%, respectively. Conclusion A robust and sensitive LC–MS/MS assay for the high-throughput quantification of the antiretroviral drug dapivirine in human plasma was developed and validated following bioanalytical validation guidelines. The assay meets criteria for the analysis of samples from large research trials. PMID:24256358

Performance of 3 Rapid Tests for Discrimination Between HIV-1 and HIV-2 in Guinea-Bissau, West Africa

DEFF Research Database (Denmark)

Hønge, Bo Langhoff; Bjarnason Obinah, Magnús Pétur; Jespersen, Sanne

2014-01-01

As HIV-2 is intrinsically resistant to nonnucleoside reverse transcriptase inhibitors, it is mandatory to discriminate between HIV types before initiating antiretroviral treatment. Guinea-Bissau has the world's highest prevalence of HIV-2 and HIV-1/HIV-2 dually infected individuals. We evaluated ...... (agreement 90.9%) and SD Bioline HIV-1/2 3.0 (agreement 84.5%). Our results underscore the need for evaluation of tests in relevant populations before implementation....

Prevalence of Drug-Resistance Mutations and Non–Subtype B Strains Among HIV-Infected Infants From New York State

Science.gov (United States)

Karchava, Marine; Pulver, Wendy; Smith, Lou; Philpott, Sean; Sullivan, Timothy J.; Wethers, Judith; Parker, Monica M.

2010-01-01

Summary Prevalence studies indicate that transmission of drug-resistant HIV has been rising in the adult population, but data from the perinatally infected pediatric population are limited. In this retrospective study, we sequenced the pol region of HIV from perinatally infected infants diagnosed in New York State in 2001–2002. Analyses of drug resistance, subtype diversity, and perinatal antiretroviral exposure were conducted, and the results were compared with those from a previous study of HIV-infected infants identified in 1998–1999. Eight of 42 infants (19.1%) had provirus carrying at least 1 drug-resistance mutation, an increase of 58% over the 1998–1999 results. Mutations conferring resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors were detected in 7.1%, 11.9%, and 2.4% of specimens, respectively. Consistent with previous results, perinatal antiretroviral exposure was not associated with drug resistance (P = 0.70). Phylogenetic analysis indicated that 16.7% of infants were infected with a non–subtype B strain of HIV. It seems that drug-resistant and non–subtype B strains of HIV are becoming increasingly common in the perinatally infected population. Our results highlight the value of resistance testing for all HIV-infected infants upon diagnosis and the need to consider subtype diversity in diagnostic and treatment strategies. PMID:16868498

Low prevalence of primary HIV resistance in western Massachusetts.

Science.gov (United States)

Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J

2010-01-01

Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.

High level of APOBEC3F/3G editing in HIV-2 DNA vif and pol sequences from antiretroviral-naive patients.

Science.gov (United States)

Bertine, Mélanie; Charpentier, Charlotte; Visseaux, Benoit; Storto, Alexandre; Collin, Gilles; Larrouy, Lucile; Damond, Florence; Matheron, Sophie; Brun-Vézinet, Françoise; Descamps, Diane

2015-04-24

In HIV-1, hypermutation introduced by APOBEC3F/3G cytidine deaminase activity leads to defective viruses. In-vivo impact of APOBEC3F/3G editing on HIV-2 sequences remains unknown. The objective of this study was to assess the level of APOBEC3F/3G editing in HIV-2-infected antiretroviral-naive patients. Direct sequencing of vif and pol regions was performed on HIV-2 proviral DNA from antiretroviral-naive patients included in the French Agence Nationale de Recherches sur le SIDA et les hépatites virales CO5 HIV-2 cohort. Hypermutated sequences were identified using Hypermut2.0 program. HIV-1 proviral sequences from Genbank were also assessed. Among 82 antiretroviral-naive HIV-2-infected patients assessed, 15 (28.8%) and five (16.7%) displayed Vif proviral defective sequences in HIV-2 groups A and B, respectively. A lower proportion of defective sequences was observed in protease-reverse transcriptase region. A higher median number of G-to-A mutations was observed in HIV-2 group B than in group A, both in Vif and protease-reverse transcriptase regions (P = 0.02 and P = 0.006, respectively). Compared with HIV-1 Vif sequences, a higher number of Vif defective sequences was observed in HIV-2 group A (P = 0.00001) and group B sequences (P = 0.013). We showed for the first time a high level of APOBEC3F/3G editing in HIV-2 sequences from antiretroviral-naive patients. Our study reported a group effect with a significantly higher level of APOBEC3F/3G editing in HIV-2 group B than in group A sequences.

Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

Science.gov (United States)

Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

2018-05-03

Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

High-levels of acquired drug resistance in adult patients failing first-line antiretroviral therapy in a rural HIV treatment programme in KwaZulu-Natal, South Africa.

Directory of Open Access Journals (Sweden)

Justen Manasa

Full Text Available To determine the frequency and patterns of acquired antiretroviral drug resistance in a rural primary health care programme in South Africa.Cross-sectional study nested within HIV treatment programme.Adult (≥ 18 years HIV-infected individuals initially treated with a first-line stavudine- or zidovudine-based antiretroviral therapy (ART regimen and with evidence of virological failure (one viral load >1000 copies/ml were enrolled from 17 rural primary health care clinics. Genotypic resistance testing was performed using the in-house SATuRN/Life Technologies system. Sequences were analysed and genotypic susceptibility scores (GSS for standard second-line regimens were calculated using the Stanford HIVDB 6.0.5 algorithms.A total of 222 adults were successfully genotyped for HIV drug resistance between December 2010 and March 2012. The most common regimens at time of genotype were stavudine, lamivudine and efavirenz (51%; and stavudine, lamivudine and nevirapine (24%. Median duration of ART was 42 months (interquartile range (IQR 32-53 and median duration of antiretroviral failure was 27 months (IQR 17-40. One hundred and ninety one (86% had at least one drug resistance mutation. For 34 individuals (15%, the GSS for the standard second-line regimen was <2, suggesting a significantly compromised regimen. In univariate analysis, individuals with a prior nucleoside reverse-transcriptase inhibitor (NRTI substitution were more likely to have a GSS <2 than those on the same NRTIs throughout (odds ratio (OR 5.70, 95% confidence interval (CI 2.60-12.49.There are high levels of drug resistance in adults with failure of first-line antiretroviral therapy in this rural primary health care programme. Standard second-line regimens could potentially have had reduced efficacy in about one in seven adults involved.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Impact of switching antiretroviral therapy on lipodystrophy and other metabolic complications: a review

DEFF Research Database (Denmark)

Hansen, Birgitte R; Haugaard, Steen B; Iversen, Johan

2004-01-01

with the disfiguring body-alterations known as HALS. More recently, however, regimens containing nucleoside reverse-transcriptase inhibitors (NRTI) have attracted attention. Reviewing switch studies regarding metabolic parameters and body shape changes, certain trends emerge. Switching from PI, the metabolic...... complications such as dyslipidaemia and insulin resistance seem to be partly reversible, whereas the morphologic alterations appear to be unchanged. In studies in which NRTI's are switched, dyslipidaemia appears unaffected, but a modest improvement in peripheral lipoatrophy has been reported. However...

Postexposure protection of macaques from vaginal SHIV infection by topical integrase inhibitors.

Science.gov (United States)

Dobard, Charles; Sharma, Sunita; Parikh, Urvi M; West, Rolieria; Taylor, Andrew; Martin, Amy; Pau, Chou-Pong; Hanson, Debra L; Lipscomb, Jonathan; Smith, James; Novembre, Francis; Hazuda, Daria; Garcia-Lerma, J Gerardo; Heneine, Walid

2014-03-12

Coitally delivered microbicide gels containing antiretroviral drugs are important for HIV prevention. However, to date, microbicides have contained entry or reverse transcriptase inhibitors that block early steps in virus infection and thus need to be given as a preexposure dose that interferes with sexual practices and may limit compliance. Integrase inhibitors block late steps after virus infection and therefore are more suitable for post-coital dosing. We first determined the kinetics of strand transfer in vitro and confirmed that integration begins about 6 hours after infection. We then used a repeat-challenge macaque model to assess efficacy of vaginal gels containing integrase strand transfer inhibitors when applied before or after simian/human immunodeficiency virus (SHIV) challenge. We showed that gel containing the strand transfer inhibitor L-870812 protected two of three macaques when applied 30 min before SHIV challenge. We next evaluated the efficacy of 1% raltegravir gel and demonstrated its ability to protect macaques when applied 3 hours after SHIV exposure (five of six protected; P infections showed no evidence of drug resistance in plasma or vaginal secretions despite continued gel dosing after infection. We documented rapid vaginal absorption reflecting a short pharmacological lag time and noted that vaginal, but not plasma, virus load was substantially reduced in the breakthrough infection after raltegravir gel treatment. We provide a proof of concept that topically applied integrase inhibitors protect against vaginal SHIV infection when administered shortly before or 3 hours after virus exposure.

N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

Directory of Open Access Journals (Sweden)

Soo-Huey Yap

2007-12-01

Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

Different origin of adipogenic stem cells influences the response to antiretroviral drugs

Energy Technology Data Exchange (ETDEWEB)

Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina [Department of Surgery, Medicine, Dentistry and Morphological Sciences, University of Modena and Reggio Emilia School of Medicine, Via Campi 287, 41125 Modena (Italy); Polo, Miriam [Department of Pharmacology, University of Valencia, Av.da Blasco Ibáñez 15, Valencia (Spain); FISABIO–Hospital Universitario Dr. Peset, Av.da Gaspar Aguilar 90, Valencia (Spain); De Pol, Anto [Department of Surgery, Medicine, Dentistry and Morphological Sciences, University of Modena and Reggio Emilia School of Medicine, Via Campi 287, 41125 Modena (Italy); Dipartimento Sperimentale Interaziendale, Campus San Lazzaro, University of Modena and Reggio Emilia, 42122 Reggio Emilia (Italy); Pinti, Marcello [Department of Life Sciences, University of Modena and Reggio Emilia, Via Campi 287, 41125 Modena (Italy); Cossarizza, Andrea, E-mail: andrea.cossarizza@unimore.it [Department of Surgery, Medicine, Dentistry and Morphological Sciences, University of Modena and Reggio Emilia School of Medicine, Via Campi 287, 41125 Modena (Italy); Dipartimento Sperimentale Interaziendale, Campus San Lazzaro, University of Modena and Reggio Emilia, 42122 Reggio Emilia (Italy)

2015-10-01

Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

Different origin of adipogenic stem cells influences the response to antiretroviral drugs

International Nuclear Information System (INIS)

Gibellini, Lara; De Biasi, Sara; Nasi, Milena; Carnevale, Gianluca; Pisciotta, Alessandra; Bianchini, Elena; Bartolomeo, Regina; Polo, Miriam; De Pol, Anto; Pinti, Marcello; Cossarizza, Andrea

2015-01-01

Lipodystrophy (LD) is a main side effect of antiretroviral therapy for HIV infection, and can be provoked by nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PIs). LD exists in different forms, characterized by fat loss, accumulation, or both, but its pathogenesis is still unclear. In particular, few data exist concerning the effects of antiretroviral drugs on adipocyte differentiation. Adipose tissue can arise either from mesenchymal stem cells (MSCs), that include bone marrow-derived MSCs (hBM-MSCs), or from ectodermal stem cells, that include dental pulp stem cells (hDPSCs). To analyze whether the embryonal origin of adipocytes might impact the occurrence of different phenotypes in LD, we quantified the effects of several antiretroviral drugs on the adipogenic differentiation of hBM-MSCs and hDPSCs. hBM-MSCs and hDPSCs were isolated from healthy donors. Cells were treated with 10 and 50 μM stavudine (d4T), efavirenz (EFV), atazanavir (ATV), ritonavir (RTV), and ATV-boosted RTV. Viability and adipogenesis were evaluated by staining with propidium iodide, oil red, and adipoRed; mRNA levels of genes involved in adipocyte differentiation, i.e. CCAAT/enhancer-binding protein alpha (CEBPα) and peroxisome proliferator-activated receptor gamma (PPARγ), and in adipocyte functions, i.e. fatty acid synthase (FASN), fatty acid binding protein-4 (FABP4), perilipin-1 (PLIN1) and 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2), were quantified by real time PCR. We found that ATV, RTV, EFV, and ATV-boosted RTV, but not d4T, caused massive cell death in both cell types. EFV and d4T affected the accumulation of lipid droplets and induced changes in mRNA levels of genes involved in adipocyte functions in hBM-MSCs, while RTV and ATV had little effects. All drugs stimulated the accumulation of lipid droplets in hDPSCs. Thus, the adipogenic differentiation of human stem cells can be influenced by antiretroviral drugs, and depends, at least in

Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

NARCIS (Netherlands)

Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

2010-01-01

Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

Directory of Open Access Journals (Sweden)

Dolores Bautista-España

Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

Human immunodeficiency virus integrase inhibitors efficiently suppress feline immunodeficiency virus replication in vitro and provide a rationale to redesign antiretroviral treatment for feline AIDS

Directory of Open Access Journals (Sweden)

Ciervo Alessandra

2007-10-01

Full Text Available Abstract Background Treatment of feline immunodeficiency virus (FIV infection has been hampered by the absence of a specific combination antiretroviral treatment (ART. Integrase strand transfer inhibitors (INSTIs are emerging as a promising new drug class for HIV-1 treatment, and we evaluated the possibility of inhibiting FIV replication using INSTIs. Methods Phylogenetic analysis of lentiviral integrase (IN sequences was carried out using the PAUP* software. A theoretical three-dimensional structure of the FIV IN catalytic core domain (CCD was obtained by homology modeling based on a crystal structure of HIV-1 IN CCD. The interaction of the transferred strand of viral DNA with the catalytic cavity of FIV IN was deduced from a crystal structure of a structurally similar transposase complexed with transposable DNA. Molecular docking simulations were conducted using a genetic algorithm (GOLD. Antiviral activity was tested in feline lymphoblastoid MBM cells acutely infected with the FIV Petaluma strain. Circular and total proviral DNA was quantified by real-time PCR. Results The calculated INSTI-binding sites were found to be nearly identical in FIV and HIV-1 IN CCDs. The close similarity of primate and feline lentivirus IN CCDs was also supported by phylogenetic analysis. In line with these bioinformatic analyses, FIV replication was efficiently inhibited in acutely infected cell cultures by three investigational INSTIs, designed for HIV-1 and belonging to different classes. Of note, the naphthyridine carboxamide INSTI, L-870,810 displayed an EC50 in the low nanomolar range. Inhibition of FIV integration in situ was shown by real-time PCR experiments that revealed accumulation of circular forms of FIV DNA within cells treated with L-870,810. Conclusion We report a drug class (other than nucleosidic reverse transcriptase inhibitors that is capable of inhibiting FIV replication in vitro. The present study helped establish L-870,810, a compound

Human immunodeficiency virus integrase inhibitors efficiently suppress feline immunodeficiency virus replication in vitro and provide a rationale to redesign antiretroviral treatment for feline AIDS

Science.gov (United States)

Savarino, Andrea; Pistello, Mauro; D'Ostilio, Daniela; Zabogli, Elisa; Taglia, Fabiana; Mancini, Fabiola; Ferro, Stefania; Matteucci, Donatella; De Luca, Laura; Barreca, Maria Letizia; Ciervo, Alessandra; Chimirri, Alba; Ciccozzi, Massimo; Bendinelli, Mauro

2007-01-01

Background Treatment of feline immunodeficiency virus (FIV) infection has been hampered by the absence of a specific combination antiretroviral treatment (ART). Integrase strand transfer inhibitors (INSTIs) are emerging as a promising new drug class for HIV-1 treatment, and we evaluated the possibility of inhibiting FIV replication using INSTIs. Methods Phylogenetic analysis of lentiviral integrase (IN) sequences was carried out using the PAUP* software. A theoretical three-dimensional structure of the FIV IN catalytic core domain (CCD) was obtained by homology modeling based on a crystal structure of HIV-1 IN CCD. The interaction of the transferred strand of viral DNA with the catalytic cavity of FIV IN was deduced from a crystal structure of a structurally similar transposase complexed with transposable DNA. Molecular docking simulations were conducted using a genetic algorithm (GOLD). Antiviral activity was tested in feline lymphoblastoid MBM cells acutely infected with the FIV Petaluma strain. Circular and total proviral DNA was quantified by real-time PCR. Results The calculated INSTI-binding sites were found to be nearly identical in FIV and HIV-1 IN CCDs. The close similarity of primate and feline lentivirus IN CCDs was also supported by phylogenetic analysis. In line with these bioinformatic analyses, FIV replication was efficiently inhibited in acutely infected cell cultures by three investigational INSTIs, designed for HIV-1 and belonging to different classes. Of note, the naphthyridine carboxamide INSTI, L-870,810 displayed an EC50 in the low nanomolar range. Inhibition of FIV integration in situ was shown by real-time PCR experiments that revealed accumulation of circular forms of FIV DNA within cells treated with L-870,810. Conclusion We report a drug class (other than nucleosidic reverse transcriptase inhibitors) that is capable of inhibiting FIV replication in vitro. The present study helped establish L-870,810, a compound successfully tested in

A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

Science.gov (United States)

Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

2007-01-01

Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

Clinical implications of antiretroviral drug interactions with warfarin: a case-control study.

Science.gov (United States)

Esterly, John S; Darin, Kristin M; Gerzenshtein, Lana; Othman, Fidah; Postelnick, Michael J; Scarsi, Kimberly K

2013-06-01

Warfarin, a frequently prescribed anticoagulant with a narrow therapeutic index, is susceptible to drug-drug interactions with antiretroviral therapy (ART). This study compared the warfarin maintenance dose (WMD) between patients receiving and not receiving ART and evaluated predictors of warfarin dosage among those on ART. This was a case-control (1:2) study. Cases were HIV-infected patients receiving warfarin and protease inhibitor (PI)- and/or non-nucleoside reverse transcriptase inhibitor (NNRTI)-based ART. Controls were randomly selected HIV-uninfected patients receiving warfarin. The WMD was compared between cases and controls and between cases on varying ART regimens. Bivariate comparisons were performed and a linear regression model was developed to identify predictors of WMD. We identified 18 case and 36 control patients eligible for inclusion. Cases were younger than controls (mean age: 45.8 versus 63.1 years, P African American (50.0% versus 22.2%, P=0.04). ART was classified as PI-based (n=9), NNRTI-based (n=7) and PI + NNRTI-based (n=2). The WMD (mean ± SD) differed between cases and controls (8.6  ±  3.4 mg versus 5.1 ± 1.5 mg, P ART regimens (PI: 8.8  ±  4.5 mg; NNRTI: 8.6   ± 1.8 mg; PI + NNRTI: 7.3  ±  3.3 mg; P = 0.86). Race and ritonavir dose were independent predictors of WMD, predicting an increase of 3.9 mg (95% CI: 0.88-6.98, P = 0.02) if a patient was African American or 3.7 mg (95% CI: 0.53-6.89, P = 0.03) if the total daily ritonavir dose was 200 mg. The required WMD was significantly higher in patients receiving ART. Prompt dose titration to achieve a higher WMD with vigilant monitoring may be required due to these drug-drug interactions.

An overview of the molecular and epidemiological features of HIV-1 infection in two major cities of Bahia state, Brazil.

Science.gov (United States)

Amaral, Amanda Gm; Oliveira, Isabele B; Carneiro, Diego C; Alcantara, Luiz Cj; Monteiro-Cunha, Joana P

2017-06-01

The high mutation rate of the human immunodeficiency virus (HIV) has created a public health challenge because the use of antiretroviral drugs can generate selective pressure that drives resistance in these viruses. The aim of this work was to characterise the molecular and epidemiological profile of HIV in Bahia, Brazil. DNA sequences from regions of HIV gag, pol, and env genes were obtained from previous studies performed in this area between 2002 and 2012. Their genotype and drug-resistance mutations were identified using bioinformatics tools. Clinical and epidemiological data were analysed. Among 263 individuals (46.4% male), 97.5% were asymptomatic and 49.1% were receiving treatment. Most of the individuals were 31 to 40 years old (36.9%) and infected through heterosexual contact (40.7%). The predominant genotype was B (68.1%) followed by BF recombinants (18.6%). Among the individuals infected with either F or BF genotypes, 68.4% were women and 76.8% were infected through heterosexual transmission. The prevalence of associated mutations conferring antiretroviral resistance was 14.2%, with 3.8% of all mutations conferring resistance to protease inhibitors, 9.43% to nucleoside reverse transcriptase inhibitors, and 8.5% to non-nucleoside reverse transcriptase inhibitors. Drug resistance was higher in individuals receiving treatment (26.1%) than in the drug-naïve (4.3%) individuals. This study will contribute to the understanding and monitoring of HIV epidemic in this Brazilian region.

Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

Directory of Open Access Journals (Sweden)

Ma Bi

2017-10-01

Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

Science.gov (United States)

Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

2009-01-01

Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

Science.gov (United States)

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Reverse zymography alone does not confirm presence of a protease inhibitor.

Science.gov (United States)

Dutta, Sangita; Bhattacharyya, Debasish

2013-03-01

Reverse zymography is applied for identification and semi-quantification of protease inhibitors that are of protein in nature. However, a protein that shows band in reverse zymography against a protease used for digestion of the gel need not be an inhibitor; it might be resistant to degradation by the protease. We demonstrate that in reverse zymography, avidin, streptavidin and the leaf extract of Catharanthus roseus behave like inhibitors of proteases like papain, ficin, bromelain extracts from pineapple leaf, stem and fruit and trypsin. Still, they do not act as inhibitors of those proteases when enzyme assays were done in solution. In reverse zymography, the extract of pineapple crown leaf shows two major inhibitor bands against its own proteases. Identification of these proteins from sequences derived from MALDI TOF MS analysis indicated that they are fruit and stem bromelains. Avidin, streptavidin and bromelains are 'kinetically stable proteins' that are usually resistant to proteolysis. Thus, it is recommended that identification of an inhibitor of a protease by reverse zymography should be supported by independent assay methods for confirmation.

Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects.

Science.gov (United States)

Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R

2015-01-01

Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

Science.gov (United States)

Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

2009-06-01

Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

Directory of Open Access Journals (Sweden)

Weizi Liang

Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

High rate of virologic suppression with darunavir/ritonavir plus optimized background therapy among highly antiretroviral-experienced HIV-infected patients: results of a prospective cohort study in São Paulo, Brazil

Directory of Open Access Journals (Sweden)

José Ernesto Vidal

Full Text Available OBJECTIVES: To assess the virologic and immunological response of darunavir/ritonavir plus optimized background therapy in highly antiretroviral-experienced HIV-infected patients in Brazil. METHODS: Prospective cohort study carried out in a tertiary center in Sao Paulo, Brazil. Three-class antiretroviral-experienced patients with confirmed virologic failure began darunavir/ritonavir plus optimized background therapy (nucleoside/tide reverse transcriptase inhibitors ± raltegravir ± enfuvirtide ± maraviroc after performing a genotypic resistance assay. Clinical evaluation and laboratory tests were collected at baseline and at weeks 12, 24, and 48. Multivariate analysis was performed to identify predictors of virologic response at 48 weeks. RESULTS: Ninety-two patients were included. The median of darunavir resistant mutation was 1 (range 0-6. The median genotypic sensitivity score in the optimized background therapy was 2 (interquartile range 1-2. At week 48, 83% (95% CI: 75-90% had an HIV RNA level 100 000 copies/mL was inversely associated with virologic success at week 48 (HR: 0.22, 95% CI: 0.06-0.85, p = 0.028. CONCLUSIONS: Darunavir/ritonavir plus optimized background therapy was a highly effective salvage regimen under clinical routine conditions in a referral center in Brazil, which is similar to the reported in high-income countries.

High rate of virologic suppression with darunavir/ritonavir plus optimized background therapy among highly antiretroviral-experienced HIV-infected patients: results of a prospective cohort study in São Paulo, Brazil

Directory of Open Access Journals (Sweden)

José Ernesto Vidal

2013-02-01

Full Text Available OBJECTIVES: To assess the virologic and immunological response of darunavir/ritonavir plus optimized background therapy in highly antiretroviral-experienced HIV-infected patients in Brazil. METHODS: Prospective cohort study carried out in a tertiary center in Sao Paulo, Brazil. Three-class antiretroviral-experienced patients with confirmed virologic failure began darunavir/ritonavir plus optimized background therapy (nucleoside/tide reverse transcriptase inhibitors ± raltegravir ± enfuvirtide ± maraviroc after performing a genotypic resistance assay. Clinical evaluation and laboratory tests were collected at baseline and at weeks 12, 24, and 48. Multivariate analysis was performed to identify predictors of virologic response at 48 weeks. RESULTS: Ninety-two patients were included. The median of darunavir resistant mutation was 1 (range 0-6. The median genotypic sensitivity score in the optimized background therapy was 2 (interquartile range 1-2. At week 48, 83% (95% CI: 75-90% had an HIV RNA level 100 000 copies/mL was inversely associated with virologic success at week 48 (HR: 0.22, 95% CI: 0.06-0.85, p = 0.028. CONCLUSIONS: Darunavir/ritonavir plus optimized background therapy was a highly effective salvage regimen under clinical routine conditions in a referral center in Brazil, which is similar to the reported in high-income countries.

Treatment Failure in HIV-Infected Children on Second-line Protease Inhibitor-Based Antiretroviral Therapy.

Science.gov (United States)

Suaysod, Rapeepan; Ngo-Giang-Huong, Nicole; Salvadori, Nicolas; Cressey, Tim R; Kanjanavanit, Suparat; Techakunakorn, Pornchai; Krikajornkitti, Sawitree; Srirojana, Sakulrat; Laomanit, Laddawan; Chalermpantmetagul, Suwalai; Lallemant, Marc; Le Cœur, Sophie; McIntosh, Kenneth; Traisathit, Patrinee; Jourdain, Gonzague

2015-07-01

Human immunodeficiency virus (HIV)-infected children failing second-line antiretroviral therapy (ART) have no access to third-line antiretroviral drugs in many resource-limited settings. It is important to identify risk factors for second-line regimen failure. HIV-infected children initiating protease inhibitor (PI)-containing second-line ART within the Program for HIV Prevention and Treatment observational cohort study in Thailand between 2002 and 2010 were included. Treatment failure was defined as confirmed HIV type 1 RNA load >400 copies/mL after at least 6 months on second-line regimen or death. Adherence was assessed by drug plasma levels and patient self-report. Cox proportional hazards regression analyses were used to identify risk factors for failure. A total of 111 children started a PI-based second-line regimen, including 59 girls (53%). Median first-line ART duration was 1.9 years (interquartile range [IQR], 1.4-3.3 years), and median age at second-line initiation was 10.7 years (IQR, 6.3-13.4 years). Fifty-four children (49%) experienced virologic failure, and 2 (2%) died. The risk of treatment failure 24 months after second-line initiation was 41%. In multivariate analyses, failure was independently associated with exposure to first-line ART for >2 years (adjusted hazard ratio [aHR], 1.8; P = .03), age >13 years (aHR, 2.9; P < .001), body mass index-for-age z score < -2 standard deviations at second-line initiation (aHR, 2.8; P = .03), and undetectable drug levels within 6 months following second-line initiation (aHR, 4.5; P < .001). Children with longer exposure to first-line ART, entry to adolescence, underweight, and/or undetectable drug levels were at higher risk of failing second-line ART and thus should be closely monitored. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

Directory of Open Access Journals (Sweden)

Johnson Barry C

2012-12-01

Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

Vitamin A and beta-carotene concentrations in adults with HIV/AIDS on highly active antiretroviral therapy.

Science.gov (United States)

Kaio, Daniella Junko; Rondó, Patricia Helen Carvalho; Souza, José Maria Pacheco; Firmino, Aline Vale; Luzia, Liania Alves; Segurado, Aluisio Augusto

2013-01-01

Micronutrient deficiency is a common condition in HIV-infected individuals and may occur in all stages of the disease. The objective of this cross-sectional study was to compare the concentrations of vitamin A and beta-carotene, micronutrients related to immunity and oxidative stress, in 182 adults with HIV/AIDS, under different highly active antiretroviral therapy (HAART) regimens. Patients were divided into 3 groups according to their HAART regimen: combination of nucleoside analog reverse transcriptase inhibitors (NRTIs) and non-NRTIs; combination of NRTIs, protease inhibitors, and ritonavir; combination of NRTIs and other classes. Multiple linear regression analysis determined the effect of the treatment regimen, time of use, and compliance with the regimen, on vitamin A and beta-carotene concentrations, controlling for the following variables: gender, age, educational level, smoking, physical activity, body mass index, time of infection with HIV, presence of comorbidities, CD4(+) T lymphocyte count, total cholesterol and fractions, and triglyceride levels. There was no significant difference in vitamin A or beta-carotene concentrations in patients under the different HAART regimens. However, approximately 4% of the patients had deficient/low concentrations of vitamin A (<0.70 μmol/L), and 98% showed concentrations of beta-carotene <1.0 μmol/L. In conclusion, HIV/AIDS patients in this region will not benefit from vitamin A supplementation, independently of the HAART regimen utilized, but beta-carotene may be of importance, considering its antioxidant effect.

Maternal nutritional status predicts adverse birth outcomes among HIV-infected rural Ugandan women receiving combination antiretroviral therapy.

Directory of Open Access Journals (Sweden)

Sera Young

Full Text Available Maternal nutritional status is an important predictor of birth outcomes, yet little is known about the nutritional status of HIV-infected pregnant women treated with combination antiretroviral therapy (cART. We therefore examined the relationship between maternal BMI at study enrollment, gestational weight gain (GWG, and hemoglobin concentration (Hb among 166 women initiating cART in rural Uganda.Prospective cohort.HIV-infected, ART-naïve pregnant women were enrolled between 12 and 28 weeks gestation and treated with a protease inhibitor or non-nucleoside reverse transcriptase inhibitor-based combination regimen. Nutritional status was assessed monthly. Neonatal anthropometry was examined at birth. Outcomes were evaluated using multivariate analysis.Mean GWG was 0.17 kg/week, 14.6% of women experienced weight loss during pregnancy, and 44.9% were anemic. Adverse fetal outcomes included low birth weight (LBW (19.6%, preterm delivery (17.7%, fetal death (3.9%, stunting (21.1%, small-for-gestational age (15.1%, and head-sparing growth restriction (26%. No infants were HIV-infected. Gaining <0.1 kg/week was associated with LBW, preterm delivery, and a composite adverse obstetric/fetal outcome. Maternal weight at 7 months gestation predicted LBW. For each g/dL higher mean Hb, the odds of small-for-gestational age decreased by 52%.In our cohort of HIV-infected women initiating cART during pregnancy, grossly inadequate GWG was common. Infants whose mothers gained <0.1 kg/week were at increased risk for LBW, preterm delivery, and composite adverse birth outcomes. cART by itself may not be sufficient for decreasing the burden of adverse birth outcomes among HIV-infected women.Clinicaltrials.gov NCT00993031.

Resistance Mutations outside the Integrase Coding Region Have an Effect on Human Immunodeficiency Virus Replicative Fitness but Do Not Affect Its Susceptibility to Integrase Strand Transfer Inhibitors

Czech Academy of Sciences Publication Activity Database

Weber, Jan; Rose, J. D.; Vazquez, A. C.; Winner, D.; Margot, N.; McColl, D. J.; Miller, M. D.; Quinones-Mateu, M. E.

2013-01-01

Roč. 8, č. 6 (2013), e65631/1-e65631/14 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LK11207 Institutional support: RVO:61388963 Keywords : HIV -1 reverse-transcriptase * viral fitness * antiretroviral therapy * clinical-implications Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2013 http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0065631

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Increasing HIV-1 Drug Resistance Between 2010 and 2012 in Adults Participating in Population-Based HIV Surveillance in Rural KwaZulu-Natal, South Africa.

Science.gov (United States)

Manasa, Justen; Danaviah, Siva; Lessells, Richard; Elshareef, Muna; Tanser, Frank; Wilkinson, Eduan; Pillay, Sureshnee; Mthiyane, Hloniphile; Mwambi, Henry; Pillay, Deenan; de Oliveira, Tulio

2016-08-01

As more human immunodeficiency virus (HIV)-infected patients access combination antiretroviral therapy (cART), higher proportions of newly infected patients may be infected with drug-resistant viruses. Regular surveillance of transmitted drug resistance (TDR) is required in southern Africa where high rates of transmission persist despite rapid expansion of ART. Dried blood spot samples from cART-naive participants from two rounds of an annual population-based HIV surveillance program in rural KwaZulu-Natal were tested for HIV RNA, and samples with HIV RNA >10,000 copies/ml were genotyped for drug resistance. The 2009 surveillance of drug resistance mutation (SDRM) list was used for drug resistance interpretation. The data were added to previously published data from the same program, and the χ(2) test for trend was used to test for trend in estimated prevalence of any TDR. Seven hundred and one participants' data were analyzed: 67 (2010), 381 (2011), and 253 (2012). No TDR was detected in 2010. Years 2011 and 2012 had 18 participants with SDRMs 4.7% and 7.1%, respectively (p = .02, χ(2) test for trend). The nonnucleoside reverse transcriptase inhibitor mutation, K103N, was the most common mutation, occurring in 27 (3.8%) of the participants, while nucleoside reverse transcriptase inhibitor (NRTI) SDRMs were detected in 10 (1.4%) of the participants, of whom eight had only a single NRTI SDRM. The increase in levels of drug resistance observed in this population could be a signal of increasing transmission of drug-resistant HIV. Thus, continued surveillance is critical to inform public health policies around HIV treatment and prevention.

Identification of a methylated oligoribonucleotide as a potent inhibitor of HIV-1 reverse transcription complex.

Science.gov (United States)

Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc

2011-07-01

Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.

Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

LENUS (Irish Health Repository)

Bansode, Vijay B

2011-10-13

Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

[Comparative cost-effectiveness analysis between darunavir/ritonavir and other protease inhibitors in treatment-naive human immunodeficiency syndrome type 1-infected patients in Spain].

Science.gov (United States)

Smets, Erik; Brogan, Anita J; Hill, Andrew; Adriaenssen, Ines; Sawyer, Anthony W; Domingo-Pedrol, Pere; Gostkorzewicz, Joana; Ledesma, Francisco

2013-01-01

GESIDA (AIDS Study Group) has proposed preferred regimens of antiretroviral treatment as initial therapy in HIV infected patients. The objective of this analysis is to compare the costs and effectiveness of darunavir/r QD and other ritonavir-boosted (/r) protease inhibitors (PIs) currently recommended in GESIDA guidelines for treatment-naïve patients. A cost-efficacy model compared the boosted PIs recommended as preferred or alternative treatment choices, each used with a nucleoside reverse transcriptase inhibitor backbone. Efficacy was measured by 48-week virological response (viral load < 50 copies/mL) adjusted by baseline viral load and CD4 cell count. To generate efficiency frontiers and cost-efficacy ratios, one-year antiretroviral therapy costs in Spain, and 48-week efficacy values were used. The model estimated that starting treatment with darunavir/r QD was the most cost-effective choice compared with the other preferred PI/r based therapies. The average cost per patient with a virological response was lower for darunavir/r QD (13,420€) than for atazanavir/r QD (14,000€), or lopinavir/r BID (13,815€). Among the preferred PI/r-based therapies, darunavir/r QD also was estimated to be the most efficient option for treatment-naïve patients. Atazanavir/r QD and lopinavir/r BID were found to be «dominated» by darunavir/r) and, consequently, were outside the efficiency frontier of PI/r-based first-line treatment. Given a fixed budget of 10 million euros for PI/r-based first-line therapy, the model estimated that darunavir/r QD would yield more responders (745) than atazanavir/r QD (714), or lopinavir/r BID (724). At the same time, darunavir/r QD would reduce the number of individuals failing treatment (150) compared with atazanavir/r QD (172) and lopinavir/r BID (286). In this model, darunavir/r QD was found to be the most cost-effective choice, among the preferred PI/r-based therapies recommended in the Spanish guidelines for treatment-naïve patients

Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

Science.gov (United States)

Wang, Shuwen; Zhu, Jiyue

2003-05-23

The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

Directory of Open Access Journals (Sweden)

Yong Teng

2014-02-01

Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

Echocardiographic assessment of systolic pulmonary arterial pressure in HIV-positive patients.

Directory of Open Access Journals (Sweden)

Mehrnaz Rasoulinejad

2014-11-01

Full Text Available Pulmonary hypertension is rare but is one of the complications that occur due to HIV infection. Symptoms of HIV-associated pulmonary arterial hypertension are often non-specific but the main symptom of the disease is dyspnea. In this cross-sectional study, we measured systolic pulmonary arterial pressure (SPAP by echocardiographic methods among HIV-positive patients who received ART. This research is a descriptive, cross-sectional study of 170 HIV-positive patients that was conducted in Imam-Khomeini hospital, Tehran, Iran during 2011-2013. All patients regularly received antiretroviral therapy at least for recent 2 years. There were not any cardiopulmonary symptoms (cough, dyspnea, exertional fatigue and chest discomfort in these patients. All participants underwent echocardiography to estimate SPAP. The participants comprised 108 males (63.5% and 62 females (46.5%. The mean age of patients was 41 years old, and the mean duration of HIV infection was 5.5 years. The mean CD4 cell count was 401 cell/µl. The principal regimen of antiretroviral therapy included two nucleoside reverse transcriptase inhibitor (NRTI and one non-nucleoside reverse transcriptase inhibitor (NNRTI in the hospital. The mean of systolic pulmonary arterial pressure was 25 mmHg in the participants; 156 (93.4% of them had SPAP ≤ 30 mmHg (normal, six (3.6% had SPAP: 31-35 mmHg (borderline and five (3% had SPAP > 35 mmHg (pulmonary hypertension. Our results indicated a significant increase of pulmonary hypertension in asymptomatic HIV-positive patients that had no association with any other risk factor. Also, antiretroviral therapy was not a risk factor for pulmonary hypertension in this study.

Etravirine combined with antiretrovirals other than darunavir/ritonavir for HIV-1-infected, treatment-experienced adults: Week 48 results of a phase IV trial

Directory of Open Access Journals (Sweden)

Eduardo Arathoon

2017-01-01

Full Text Available Objective: VIOLIN (TMC125IFD3002; NCT01422330 evaluated the safety, tolerability, and pharmacokinetics of etravirine with antiretrovirals other than darunavir/ritonavir in HIV-1-infected patients. Methods: In a 48-week, phase IV, single-arm, multicenter study, patients on prior antiretroviral therapy (⩾8 weeks who needed to change regimen for virologic failure (viral load ⩾ 500 copies/mL or simplification/adverse events (viral load < 50 copies/mL received etravirine 200 mg bid with ⩾1 other active antiretroviral, excluding darunavir/ritonavir or only nucleoside/tide reverse transcriptase inhibitors. Results: Of 211 treated patients, 73% (n = 155 had baseline viral load ⩾ 50 copies/mL and 27% (n = 56 had baseline viral load < 50 copies/mL. Protease inhibitors were the most common background antiretrovirals (83%. Diarrhea was the most frequent adverse event (17%. Serious adverse events (no rash occurred in 5% of patients; none were etravirine related. Overall, median etravirine AUC12h was 5390 ng h/mL and C0h was 353 ng/mL (N = 199. Week 48 virologic response rates (viral load < 50 copies/mL; Food and Drug Administration Snapshot algorithm were 48% (74/155 (baseline viral load ⩾ 50 copies/mL and 75% (42/56 (baseline viral load < 50 copies/mL. Virologic failure rates were 42% and 13%, respectively. The most frequently emerging etravirine resistance-associated mutations in virologic failures were Y181C, E138A, and M230L. Virologic response rates for patients with baseline viral load ⩾ 50 copies/mL were 38% (30/79 (non-adherent versus 64% (44/69 (adherent subset. Conclusion: Etravirine 200 mg bid in combination with antiretrovirals other than darunavir/ritonavir was well tolerated in the studied treatment-experienced HIV-1-infected population. The overall etravirine safety and tolerability profile and pharmacokinetics (specifically in those patients who were adherent

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

Science.gov (United States)

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

Indanones as high-potency reversible inhibitors of monoamine oxidase.

Science.gov (United States)

Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P

2015-05-01

Recent reports document that α-tetralone (3,4-dihydro-2H-naphthalen-1-one) is an appropriate scaffold for the design of high-potency monoamine oxidase (MAO) inhibitors. Based on the structural similarity between α-tetralone and 1-indanone, the present study involved synthesis of 34 1-indanone and related indane derivatives as potential inhibitors of recombinant human MAO-A and MAO-B. The results show that C6-substituted indanones are particularly potent and selective MAO-B inhibitors, with IC50 values ranging from 0.001 to 0.030 μM. C5-Substituted indanone and indane derivatives are comparatively weaker MAO-B inhibitors. Although the 1-indanone and indane derivatives are selective inhibitors of the MAO-B isoform, a number of homologues are also potent MAO-A inhibitors, with three homologues possessing IC50 values 1-indanone as a reversible MAO inhibitor with a competitive mode of inhibition. It may be concluded that 1-indanones are promising leads for the design of therapies for neurodegenerative and neuropsychiatric disorders such as Parkinson's disease and depression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Modeling Outcomes of First-Line Antiretroviral Therapy and Rate of CD4 Counts Change among a Cohort of HIV/AIDS Patients in Ethiopia: A Retrospective Cohort Study.

Directory of Open Access Journals (Sweden)

Tadesse Awoke

Full Text Available Antiretroviral therapy has shown to be effective in reducing morbidity and mortality in patients infected with HIV for the past couples of decades. However, there remains a need to better understand the characteristics of long-term treatment outcomes in resource poor settings. The main aim of this study was to determine and compare the long-term response of patients on nevirapine and efavirenz based first line antiretroviral therapy regimen in Ethiopia.Hospital based retrospective cohort study was conducted from January 2009 to December 2013 at University hospital located in Northwest Ethiopia. Human subject research approval for this study was received from University of Gondar Research Ethics Committee and the medical director of the hospital. Cox-proportional hazards model was used to assess the effect of baseline covariates on composite outcome and a semi-parametric mixed effect model was used to investigate CD4 counts response to treatments.A total of 2386 HIV/AIDS naive patients were included in this study. Nearly one-in-four patients experienced the events, of which death, lost to follow up, treatment substitution and discontinuation of Non-Nucleoside Reverse Transcriptase Inhibitors(NNRTI accounted: 99 (26.8%, 122 (33.0%, 137 (37.0% and 12 (3.2%, respectively. The hazard of composite outcome on nevirapine compared with efavirenz was 1.02(95%CI: 0.52-1.99 with p-value = 0.96. Similarly, the hazard of composite outcome on tenofovir and stavudine compared with zidovudine were 1.87 (95%CI: 1.52-2.32, p-value < 0.0001 and 1.72(95% CI: 1.22-2.32, p-value = 0.002, respectively. The rate of CD4 increase in response to treatment was high during the first 10 months and stabilized later.This study revealed that treatment responses were comparable whether nevirapine or efavirenz was chosen to initiate antiretroviral therapy for HIV/AIDS patients in Ethiopia. There was significant difference on risk of composite outcome between patients who were

Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India.

Science.gov (United States)

Satyanarayana, Kanikaram; Srivastava, Sadhana

2010-01-19

The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable

Prevalence of oral soft tissue lesions in HIV-infected minority children treated with highly active antiretroviral therapies.

Science.gov (United States)

Flanagan, M A; Barasch, A; Koenigsberg, S R; Fine, D; Houpt, M

2000-01-01

This project studied the prevalence of oral soft tissue disease in HIV-infected children treated with highly active antiretroviral therapy (HAART). Thirty-eight HIV-infected children participated in the study. Twenty-three of these patients were treated with HAART while 14 received exclusively reverse transcriptase inhibitors (RTI) and served as controls. The children were examined three times at approximately one-month intervals while their health history and laboratory data were abstracted from medical charts. Analyses were performed to determine differences in lesion prevalence between treatment groups as well as between lesion and no lesion groups with regard to immune differences. Thirty patients (79%) had oral lesions detected in at least one visit. There were no differences in specific lesion prevalence between HAART compared with RTI-treated children. However, a trend for more oral candidiasis in the latter group was observed. Subjects with oral soft tissue lesions had lower CD4 counts (P = 0.04) and percentage (P = 0.01) but similar viral loads when compared to patients without oral soft tissue disease. HAART does not appear to significantly affect oral soft tissue disease prevalence in HIV-infected children. Presence of lesions was associated with decreased immunity and may signal advancing disease.

[Study of human immunodeficiency virus transmission chains in Andalusia: analysis from baseline antiretroviral resistance sequences].

Science.gov (United States)

Pérez-Parra, Santiago; Chueca-Porcuna, Natalia; Álvarez-Estevez, Marta; Pasquau, Juan; Omar, Mohamed; Collado, Antonio; Vinuesa, David; Lozano, Ana Belen; García-García, Federico

2015-11-01

Protease and reverse transcriptase HIV-1 sequences provide useful information for patient clinical management, as well as information on resistance to antiretrovirals. The aim of this study is to evaluate transmission events, transmitted drug resistance, and to georeference subtypes among newly diagnosed patients referred to our center. A study was conducted on 693 patients diagnosed between 2005 and 2012 in Southern Spain. Protease and reverse transcriptase sequences were obtained for resistance to cART analysis with Trugene(®) HIV Genotyping Kit (Siemens, NAD). MEGA 5.2, Neighbor-Joining, ArcGIS and REGA were used for subsequent analysis. The results showed 298 patients clustered into 77 different transmission events. Most of the clusters were formed by pairs (n=49), of men having sex with men (n=26), Spanish (n=37), and below 45 years of age (73.5%). Urban areas from Granada, and the coastal areas of Almeria and Granada showed the greatest subtype heterogeneity. Five clusters were formed by more than 10 patients, and 15 clusters had transmitted drug resistance. The study data demonstrate how the phylogenetic characterization of transmission clusters is a powerful tool to monitor the spread of HIV, and may contribute to design correct preventive measures to minimize it. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Emergence of Lamivudine-Resistant HBV during Antiretroviral Therapy Including Lamivudine for Patients Coinfected with HIV and HBV in China

Science.gov (United States)

Li, Yijia; Zhu, Ting; Song, Xiaojing; Huang, Ying; Yang, Feifei; Guan, Shuo; Xie, Jing; Gohda, Jin; Hosoya, Noriaki; Kawana-Tachikawa, Ai; Liu, Wenjun; Gao, George Fu; Iwamoto, Aikichi; Li, Taisheng; Ishida, Takaomi

2015-01-01

In China, HIV-1-infected patients typically receive antiretroviral therapy (ART) that includes lamivudine (3TC) as a reverse-transcriptase inhibitor (RTI) (ART-3TC). Previous studies from certain developed countries have shown that, in ART-3TC, 3TC-resistant HBV progressively emerges at an annual rate of 15–20% in patients coinfected with HIV-1 and HBV. This scenario in China warrants investigation because >10% of all HIV-infected patients in China are HBV carriers. We measured the occurrence of 3TC-resistant HBV during ART-3TC for HIV-HBV coinfection and also tested the effect of tenofovir disoproxil fumarate (TDF) used as an additional RTI (ART-3TC/TDF) in a cohort study in China. We obtained 200 plasma samples collected from 50 Chinese patients coinfected with HIV-1 and HBV (positive for hepatitis B surface antigen) and examined them for the prevalence of 3TC-resistant HBV by directly sequencing PCR products that covered the HBV reverse-transcriptase gene. We divided the patients into ART-3TC and ART-3TC/TDF groups and compared the efficacy of treatment and incidence of drug-resistance mutation between the groups. HIV RNA and HBV DNA loads drastically decreased in both ART-3TC and ART-3TC/TDF groups. In the ART-3TC group, HBV breakthrough or insufficient suppression of HBV DNA loads was observed in 20% (10/50) of the patients after 96-week treatment, and 8 of these patients harbored 3TC-resistant mutants. By contrast, neither HBV breakthrough nor treatment failure was recorded in the ART-3TC/TDF group. All of the 3TC-resistant HBV mutants emerged from the cases in which HBV DNA loads were high at baseline. Our results clearly demonstrated that ART-3TC is associated with the emergence of 3TC-resistant HBV in patients coinfected with HIV-1 and HBV and that ART-3TC/TDF reduces HBV DNA loads to an undetectable level. These findings support the use of TDF-based treatment regimens for patients coinfected with HIV-1 and HBV. PMID:26288093

Global trends in antiretroviral resistance in treatment-naive individuals with HIV after rollout of antiretroviral treatment in resource-limited settings: a global collaborative study and meta-regression analysis.

Science.gov (United States)

Gupta, Ravindra K; Jordan, Michael R; Sultan, Binta J; Hill, Andrew; Davis, Daniel H J; Gregson, John; Sawyer, Anthony W; Hamers, Raph L; Ndembi, Nicaise; Pillay, Deenan; Bertagnolio, Silvia

2012-10-06

The emergence and spread of high levels of HIV-1 drug resistance in resource-limited settings where combination antiretroviral treatment has been scaled up could compromise the effectiveness of national HIV treatment programmes. We aimed to estimate changes in the prevalence of HIV-1 drug resistance in treatment-naive individuals with HIV since initiation of rollout in resource-limited settings. We did a systematic search for studies and conference abstracts published between January, 2001, and July, 2011, and included additional data from the WHO HIV drug resistance surveillance programme. We assessed the prevalence of drug-resistance mutations in untreated individuals with respect to time since rollout in a series of random-effects meta-regression models. Study-level data were available for 26,102 patients from sub-Saharan Africa, Asia, and Latin America. We recorded no difference between chronic and recent infection on the prevalence of one or more drug-resistance mutations for any region. East Africa had the highest estimated rate of increase at 29% per year (95% CI 15 to 45; p=0·0001) since rollout, with an estimated prevalence of HIV-1 drug resistance at 8 years after rollout of 7·4% (4·3 to 12·7). We recorded an annual increase of 14% (0% to 29%; p=0·054) in southern Africa and a non-significant increase of 3% (-0·9 to 16; p=0·618) in west and central Africa. There was no change in resistance over time in Latin America, and because of much country-level heterogeneity the meta-regression analysis was not appropriate for Asia. With respect to class of antiretroviral, there were substantial increases in resistance to non-nucleoside reverse transcriptase inhibitors (NNRTI) in east Africa (36% per year [21 to 52]; pAfrica (23% per year [7 to 42]; p=0·0049). No increase was noted for the other drug classes in any region. Our findings suggest a significant increase in prevalence of drug resistance over time since antiretroviral rollout in regions of sub

Cholelithiasis and Nephrolithiasis in HIV-Positive Patients in the Era of Combination Antiretroviral Therapy.

Directory of Open Access Journals (Sweden)

Kuan-Yin Lin

Full Text Available This study aimed to describe the epidemiology and risk factors of cholelithiasis and nephrolithiasis among HIV-positive patients in the era of combination antiretroviral therapy.We retrospectively reviewed the medical records of HIV-positive patients who underwent routine abdominal sonography for chronic viral hepatitis, fatty liver, or elevated aminotransferases between January 2004 and January 2015. Therapeutic drug monitoring of plasma concentrations of atazanavir was performed and genetic polymorphisms, including UDP-glucuronosyltransferase (UGT 1A1*28 and multidrug resistance gene 1 (MDR1 G2677T/A, were determined in a subgroup of patients who received ritonavir-boosted or unboosted atazanavir-containing combination antiretroviral therapy. Information on demographics, clinical characteristics, and laboratory testing were collected and analyzed.During the 11-year study period, 910 patients who underwent routine abdominal sonography were included for analysis. The patients were mostly male (96.9% with a mean age of 42.2 years and mean body-mass index of 22.9 kg/m2 and 85.8% being on antiretroviral therapy. The anchor antiretroviral agents included non-nucleoside reverse-transcriptase inhibitors (49.3%, unboosted atazanavir (34.4%, ritonavir-boosted lopinavir (20.4%, and ritonavir-boosted atazanavir (5.5%. The overall prevalence of cholelithiasis and nephrolithiasis was 12.5% and 8.2%, respectively. Among 680 antiretroviral-experienced patients with both baseline and follow-up sonography, the crude incidence of cholelithiasis and nephrolithiasis was 4.3% and 3.7%, respectively. In multivariate analysis, the independent factors associated with incident cholelithiasis were exposure to ritonavir-boosted atazanavir for >2 years (adjusted odds ratio [AOR], 6.29; 95% confidence interval [CI], 1.12-35.16 and older age (AOR, 1.04; 95% CI, 1.00-1.09. The positive association between duration of exposure to ritonavir-boosted atazanavir and incident

Prevalence and patterns of HIV transmitted drug resistance in Guatemala.

Science.gov (United States)

Avila-Ríos, Santiago; Mejía-Villatoro, Carlos R; García-Morales, Claudia; Soto-Nava, Maribel; Escobar, Ingrid; Mendizabal, Ricardo; Girón, Amalia; García, Leticia; Reyes-Terán, Gustavo

2011-12-01

To assess human immunodeficiency virus (HIV) diversity and the prevalence of transmitted drug resistance (TDR) in Guatemala. One hundred forty-five antiretroviral treatment-naïve patients referred to the Roosevelt Hospital in Guatemala City were enrolled from October 2010 to March 2011. Plasma HIV pol sequences were obtained and TDR was assessed with the Stanford algorithm and the World Health Organization (WHO) TDR surveillance mutation list. HIV subtype B was highly prevalent in Guatemala (96.6%, 140/145), and a 2.8% (4/145) prevalence of BF1 recombinants and 0.7% (1/145) prevalence of subtype C viruses were found. TDR prevalence for the study period was 8.3% (12/145) with the Stanford database algorithm (score > 15) and the WHO TDR surveillance mutation list. Most TDR cases were associated with non-nucleoside reverse transcriptase inhibitors (NNRTIs) (83.3%, 10/12); a low prevalence of nucleoside reverse transcriptase inhibitors and protease inhibitors was observed in the cohort (Guatemala. TDR prevalence in Guatemala was at the intermediate level. Most TDR cases were associated with NNRTIs. Further and continuous TDR surveillance is necessary to gain more indepth knowledge about TDR spread and trends in Guatemala and to optimize treatment outcomes in the country.

Factors associated with suboptimal adherence to antiretroviral therapy in Asia

Science.gov (United States)

Jiamsakul, Awachana; Kumarasamy, Nagalingeswaran; Ditangco, Rossana; Li, Patrick CK; Phanuphak, Praphan; Sirisanthana, Thira; Sungkanuparph, Somnuek; Kantipong, Pacharee; Lee, Christopher KC; Mustafa, Mahiran; Merati, Tuti; Kamarulzaman, Adeeba; Singtoroj, Thida; Law, Matthew

2014-01-01

Introduction Adherence to antiretroviral therapy (ART) plays an important role in treatment outcomes. It is crucial to identify factors influencing adherence in order to optimize treatment responses. The aim of this study was to assess the rates of, and factors associated with, suboptimal adherence (SubAdh) in the first 24 months of ART in an Asian HIV cohort. Methods As part of a prospective resistance monitoring study, the TREAT Asia Studies to Evaluate Resistance Monitoring Study (TASER-M) collected patients’ adherence based on the World Health Organization-validated Adherence Visual Analogue Scale. SubAdh was defined in two ways: (i) 14 days. Time was divided into four intervals: 0–6, 6–12, 12–18 and 18–24 months. Factors associated with SubAdh were analysed using generalized estimating equations. Results Out of 1316 patients, 32% ever reported 2 assessments per patient per year had an odds ratio (OR)=0.7 (95% confidence interval (CI) (0.55 to 0.90), p=0.006), compared to sites with ≤2 assessments per patient per year. Compared to heterosexual exposure, SubAdh was higher in injecting drug users (IDUs) (OR=1.92, 95% CI (1.23 to 3.00), p=0.004) and lower in homosexual exposure (OR=0.52, 95% CI (0.38 to 0.71), p<0.001). Patients taking a nucleoside transcriptase inhibitor and protease inhibitor (NRTI+PI) combination were less likely to report adherence <100% (OR=0.36, 95% CI (0.20 to 0.67), p=0.001) compared to patients taking an NRTI and non-nucleoside transcriptase inhibitor (NRTI+NNRTI) combination. SubAdh decreased with increasing time on ART (all p<0.001). Similar associations were found with adherence <95% as the outcome. Conclusions We found that SubAdh, defined as either <100% and <95%, was associated with mode of HIV exposure, ART regimen, time on ART and frequency of adherence measurement. The more frequently sites assessed patients, the lower the SubAdh, possibly reflecting site resourcing for patient counselling. Although social

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 2.

Science.gov (United States)

McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.

Clinical outcomes of first-line antiretroviral therapy in Latin America: analysis from the LATINA retrospective cohort study.

Science.gov (United States)

Angriman, Federico; Belloso, Waldo H; Sierra-Madero, Juan; Sánchez, Jorge; Moreira, Ronaldo Ismerio; Kovalevski, Leandro O; Orellana, Liliana C; Cardoso, Sandra Wagner; Crabtree-Ramirez, Brenda; La Rosa, Alberto; Losso, Marcelo H

2016-02-01

Nearly 2 million people are infected with human immunodeficiency virus (HIV) in Latin America. However, information regarding population-scale outcomes from a regional perspective is scarce. We aimed to describe the baseline characteristics and therapeutic outcomes of newly-treated individuals with HIV infection in Latin America. A Retrospective cohort study was undertaken. The primary explanatory variable was combination antiretroviral therapy based on either a protease inhibitor (PI) or a non-nucleoside reverse transcriptase inhibitor (NNRTI). The main outcome was defined as the composite of all-cause mortality and the occurrence of an AIDS-defining clinical event or a serious non-AIDS-defining event during the first year of therapy. The secondary outcomes included the time to a change in treatment strategy. All analyses were performed according to the intention to treat principle. A total of 937 treatment-naive patients from four participating countries were included (228 patients with PI therapy and 709 with NNRTI-based treatment). At the time of treatment initiation, the patients had a mean age of 37 (SD: 10) years and a median CD4 + T-cell count of 133 cells/mm(3) (interquartile range: 47.5-216.0). Patients receiving PI-based regimens had a significantly lower CD4 + count, a higher AIDS prevalence at baseline and a shorter time from HIV diagnosis until the initiation of treatment. There was no difference in the hazard ratio for the primary outcome between groups. The only covariates associated with the latter were CD4 + cell count at baseline, study site and age. The estimated hazard ratio for the time to a change in treatment (NNRTI vs PI) was 0.61 (95% CI 0.47-0.80, p America present with similar clinical outcomes regardless of the choice of initial therapy. Patients treated with PIs are more likely to require a treatment change during the first year of follow up. © The Author(s) 2015.

The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

Directory of Open Access Journals (Sweden)

Gronenborn Angela M

2010-05-01

Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

High frequency of Fredrickson's phenotypes IV and IIb in Brazilians infected by human immunodeficiency virus

Directory of Open Access Journals (Sweden)

Oliveira Helena CF

2005-06-01

Full Text Available Abstract Background Human immunodeficiency virus (HIV infection is very prevalent in Brazil. HIV therapy has been recently associated with coronary heart disease (CHD. Dyslipidemia is a major risk factor for CHD that is frequently described in HIV positive patients, but very few studies have been conducted in Brazilian patients evaluating their lipid profiles. Methods In the present work, we evaluated the frequency and severity of dyslipidemia in 257 Brazilian HIV positive patients. Two hundred and thirty-eight (93% were submitted to antiretroviral therapy (224 treated with protease inhibitors plus nucleoside reverse transcriptase inhibitors, 14 treated only with the latter, 12 naive and 7 had no records of treatment. The average time on drug treatment with antiretroviral therapy was 20 months. None of the patients was under lipid lowering drugs. Cholesterol, triglyceride, phospholipid and free fatty acids were determined by enzymatic colorimetric methods. Lipoprotein profile was estimated by the Friedewald formula and Fredrickson's phenotyping was obtained by serum electrophoresis on agarose. Apolipoprotein B and AI and lipoprotein "a" were measured by nephelometry. Results The Fredrickson phenotypes were: type IIb (51%, IV (41%, IIa (7%. In addition one patient was type III and another type V. Thirty-three percent of all HIV+ patients presented serum cholesterol levels ≥ 200 mg/dL, 61% LDL-cholesterol ≥ 100 mg/dL, 65% HDL-cholesterol below 40 mg/dL, 46% triglycerides ≥ 150 mg/dL and 10% have all these parameters above the limits. Eighty-six percent of patients had cholesterol/HDL-cholesterol ratio ≥ 3.5, 22% increased lipoprotein "a", 79% increased free fatty acids and 9% increased phospholipids. The treatment with protease inhibitors plus nucleoside reverse transcriptase inhibitors increased the levels of cholesterol and triglycerides in these patients when compared with naïve patients. The HDL-cholesterol (p = 0.01 and

Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

2010-03-26

The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs.

Directory of Open Access Journals (Sweden)

Karolin Hijazi

Full Text Available Anti-retroviral (ARV -based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on

Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs.

Science.gov (United States)

Hijazi, Karolin; Cuppone, Anna M; Smith, Kieron; Stincarelli, Maria A; Ekeruche-Makinde, Julia; De Falco, Giulia; Hold, Georgina L; Shattock, Robin; Kelly, Charles G; Pozzi, Gianni; Iannelli, Francesco

2015-01-01

Anti-retroviral (ARV) -based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on expression of drug

The safety and pharmacokinetics of a reverse transcriptase inhibitor, 3TC, in patients with HIV infection: a phase I study

NARCIS (Netherlands)

van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.

1992-01-01

To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient

Effectiveness of etravirine-based therapy for treatment-experienced HIV-infected patients.

Science.gov (United States)

Huerta García, Gloria; Mata-Marín, José Antonio; Domínguez-Hermosillo, Juan Carlos; Chavez-García, Marcelino; Banda-Lara, Marco Issac; Nuñez-Rodríguez, Nohemi; Cruz-Herrera, Javier Enrique; Sandoval-Ramírez, Jorge Luis; Villagómez-Ruiz, Alfredo; Manjarrez-Tellez, Bulmaro; Gaytan-Martínez, Jesús Enrique

2016-06-30

Treatment options are limited for HIV-1-infected individuals who have received extensive previous antiretroviral therapy. ETV has shown significant clinical benefits in treatment-experienced HIV-1+ patients with antiretroviral resistance. The aim of this study was to evaluate the effectiveness of ETV plus optimized background regimen in real-life conditions in a cohort of highly HIV-1 antiretroviral-experienced patients. Retrospective cohort of treatment-experienced HIV-1-infected adults with virological failure who started therapy with an ETV-containing regimen. The effectiveness was evaluated using HIV-1 RNA viral load and changes in CD4+ cell count after 48 weeks of treatment. Forty-two patients ≥ 16 years of age were included; 74% were men, and the median age was 45 years (IQR 41-53). All participants had prior non-nucleoside reverse transcriptase inhibitor use (55% nevirapine, 83%, efavirenz, and 28% both). Baseline median HIV-1 RNA viral load was 15,598 copies/mL (IQR 2651-84,175) and CD4+ cell count was 276 cells/mL (IQR 155-436). After 48 weeks of treatment, 90.5% (95% CI 78-96) of patients had HIV-1 RNA viral load treatment to a median of 407 cells/mL (IQR 242-579); p HIV-1 RNA viral load ≥ 100,000 copies/mL (OR 7.6; 95% CI 1.2-44.80; p = 0.025). Our study provides clinically important evidence of the effectiveness and safety of ETV in highly antiretroviral-experienced HIV-1-infected patients.

Surveillance of transmitted HIV drug resistance using matched plasma and dried blood spot specimens from voluntary counseling and testing sites in Ho Chi Minh City, Vietnam, 2007-2008.

Science.gov (United States)

Duc, Nguyen Bui; Hien, Bui Thu; Wagar, Nick; Tram, Tran Hong; Giang, Le Truong; Yang, Chunfu; Wolfe, Mitchell I; Hien, Nguyen Tran; Tuan, Nguyen Anh

2012-05-01

During 2007-2008, surveillance of transmitted human immunodeficiency virus (HIV) drug resistance (TDR) was performed following World Health Organization guidance among clients with newly diagnosed HIV infection attending voluntary counseling and testing (VCT) sites in Ho Chi Minh City (HCMC), Vietnam. Moderate (5%-15%) TDR to nonnucleoside reverse-transcriptase inhibitors (NNRTIs) was observed among VCT clients aged 18-21 years. Follow-up surveillance of TDR in HCMC and other geographic regions of Vietnam is warranted. Data generated will guide the national HIV drug resistance surveillance strategy and support selection of current and future first-line antiretroviral therapy and HIV prevention programs.

An assessment of the relationship between the World Health Organization HIV drug resistance early warning indicators and HIV drug resistance acquisition.

Science.gov (United States)

St-Jean, M; Harrigan, P R; Sereda, P; Montaner, Jsg; Lima, V D

2017-05-01

The World Health Organization (WHO)'s HIV drug resistance (HIVDR) early warning indicators (EWIs) measure antiretroviral therapy (ART)-site factors associated with HIVDR prevention, without HIVDR laboratory testing. We assessed the relationship between EWIs and HIVDR acquisition using data from British Columbia, Canada. Eligible patients were ART-naïve, were ≥ 19 years old, had initiated ART between 1 January 2000 and 31 December 2012, had ≥ 15 months of follow-up, and were without transmitted HIVDR. Patients were followed for acquired HIVDR until 31 March 2014, the last contact date, or death. We built logistic regression models to assess the associations and predictive ability of individual indicators and of the EWI Score (the number of indicators for which a patient did not meet the criteria) on HIVDR acquisition (to any class of HIVDR, lamivudine (3TC)/emtricitabine (FTC), nonnucleoside reverse transcriptase inhibitors (NNRTIs), nucleoside reverse transcriptase inhibitors (NRTIs) or protease inhibitors (PIs)]). All explored EWIs were associated with at least one class of HIVDR, with the exception of 'ART prescribing practices'. We observed a dose-response relationship between acquiring HIVDR to any antiretroviral class and an increasing EWI score in our predictive logistic regression model. The area under the curve was 0.848 (excellent discrimination). The adjusted odds ratios for acquiring any class of HIVDR for an EWI score of 1, 2 and ≥ 3 versus 0 were 2.30 [95% confidence Interval (CI) 1.21-4.38], 3.35 (95% CI: 1.86-6.03) and 7.26 (95% CI: 4.18-12.61), respectively. Several EWIs were associated with and predictive of HIVDR, supporting the WHO EWIs as a component of the HIVDR prevention method in settings where HIVDR testing is not routinely or widely available. © 2016 British HIV Association.

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

Science.gov (United States)

Schuster, W; Brennicke, A

1987-01-01

We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

Low Prolactin and High 20-α-Hydroxysteroid Dehydrogenase Levels Contribute to Lower Progesterone Levels in HIV-Infected Pregnant Women Exposed to Protease Inhibitor-Based Combination Antiretroviral Therapy.

Science.gov (United States)

Papp, Eszter; Balogun, Kayode; Banko, Nicole; Mohammadi, Hakimeh; Loutfy, Mona; Yudin, Mark H; Shah, Rajiv; MacGillivray, Jay; Murphy, Kellie E; Walmsley, Sharon L; Silverman, Michael; Serghides, Lena

2016-05-15

It has been reported that pregnant women receiving protease inhibitor (PI)-based combination antiretroviral therapy (cART) have lower levels of progesterone, which put them at risk of adverse birth outcomes, such as low birth weight. We sought to understand the mechanisms involved in this decline in progesterone level. We assessed plasma levels of progesterone, prolactin, and lipids and placental expression of genes involved in progesterone metabolism in 42 human immunodeficiency virus (HIV)-infected and 31 HIV-uninfected pregnant women. In vitro studies and a mouse pregnancy model were used to delineate the effect of HIV from that of PI-based cART on progesterone metabolism. HIV-infected pregnant women receiving PI-based cART showed a reduction in plasma progesterone levels (P= .026) and an elevation in placental expression of the progesterone inactivating enzyme 20-α-hydroxysteroid dehydrogenase (20α-HSD; median, 2.5 arbitrary units [AU]; interquartile range [IQR], 1.00-4.10 AU), compared with controls (median, 0.89 AU; IQR, 0.66-1.26 AU;P= .002). Prolactin, a key regulator of 20α-HSD, was lower (P= .012) in HIV-infected pregnant women. We observed similar data in pregnant mice exposed to PI-based cART. In vitro inhibition of 20α-HSD activity in trophoblast cells reversed PI-based cART-induced decreases in progesterone levels. Our data suggest that the decrease in progesterone levels observed in HIV-infected pregnant women exposed to PI-based cART is caused, at least in part, by an increase in placental expression of 20α-HSD, which may be due to lower prolactin levels observed in these women. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Humanized mice recapitulate key features of HIV-1 infection: a novel concept using long-acting anti-retroviral drugs for treating HIV-1.

Directory of Open Access Journals (Sweden)

Marc Nischang

Full Text Available BACKGROUND: Humanized mice generate a lymphoid system of human origin subsequent to transplantation of human CD34+ cells and thus are highly susceptible to HIV infection. Here we examined the efficacy of antiretroviral treatment (ART when added to food pellets, and of long-acting (LA antiretroviral compounds, either as monotherapy or in combination. These studies shall be inspiring for establishing a gold standard of ART, which is easy to administer and well supported by the mice, and for subsequent studies such as latency. Furthermore, they should disclose whether viral breakthrough and emergence of resistance occurs similar as in HIV-infected patients when ART is insufficient. METHODS/PRINCIPAL FINDINGS: NOD/shi-scid/γ(cnull (NOG mice were used in all experimentations. We first performed pharmacokinetic studies of the drugs used, either added to food pellets (AZT, TDF, 3TC, RTV or in a LA formulation that permitted once weekly subcutaneous administration (TMC278: non-nucleoside reverse transcriptase inhibitor, TMC181: protease inhibitor. A combination of 3TC, TDF and TMC278-LA or 3TC, TDF, TMC278-LA and TMC181-LA suppressed the viral load to undetectable levels in 15/19 (79% and 14/14 (100% mice, respectively. In successfully treated mice, subsequent monotherapy with TMC278-LA resulted in viral breakthrough; in contrast, the two LA compounds together prevented viral breakthrough. Resistance mutations matched the mutations most commonly observed in HIV patients failing therapy. Importantly, viral rebound after interruption of ART, presence of HIV DNA in successfully treated mice and in vitro reactivation of early HIV transcripts point to an existing latent HIV reservoir. CONCLUSIONS/SIGNIFICANCE: This report is a unique description of multiple aspects of HIV infection in humanized mice that comprised efficacy testing of various treatment regimens, including LA compounds, resistance mutation analysis as well as viral rebound after treatment

Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

OpenAIRE

Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

2014-01-01

Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

Directory of Open Access Journals (Sweden)

Atsuko Hachiya

2011-01-01

Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

Does first line antiretroviral therapy increase the prevalence of cardiovascular risk factors in Indian patients?: A cross sectional study.

Science.gov (United States)

Carey, R A B; Rupali, P; Abraham, O C; Kattula, D

2013-01-01

Antiretroviral therapy (ART) is associated with a myriad of metabolic complications which are potential cardiovascular risk factors. Early detection of these risk factors could help in alleviating morbidity and mortality in human immunodeficiency virus (HIV) infected patients on ART. To study the prevalence of cardiovascular risk factors in patients on a combination of nucleoside reverse transcriptase inhibitors (NRTIs) and non-NRTIs (NNRTIs) - the standard combination first line ART regimen used in tertiary referral center. The prevalence of cardiovascular risk factors in HIV infected subjects with stage 1t disease on standard first line ART for at least 1 year, HIV infected subjects with stage 1 disease and not on ART and HIV negative subjects was assessed. The study was a cross-sectional study design. Basic demographic data was collected and patients were examined for anthropometric data and blood was collected for analysis of blood glucose, serum lipids, and fasting insulin levels. Chi-square test was used to calculate significance. Statistical Package for Social Sciences (SPSS) software version 16.0 was used for data analysis. The prevalence of hypercholesterolemia and hypertriglyceridemia was higher in the patients on ART when compared to patients not on ART (PART and those not on ART. First line ART is associated with increased prevalence of dyslipidemia. Early detection and treatment of dyslipidemia should help in reducing the cardiovascular morbidity in patients on ART.

Understanding the Molecular Determinant of Reversible Human Monoamine Oxidase B Inhibitors Containing 2H-Chromen-2-One Core: Structure-Based and Ligand-Based Derived Three-Dimensional Quantitative Structure-Activity Relationships Predictive Models.

Science.gov (United States)

Mladenović, Milan; Patsilinakos, Alexandros; Pirolli, Adele; Sabatino, Manuela; Ragno, Rino

2017-04-24

Monoamine oxidase B (MAO B) catalyzes the oxidative deamination of aryalkylamines neurotransmitters with concomitant reduction of oxygen to hydrogen peroxide. Consequently, the enzyme's malfunction can induce oxidative damage to mitochondrial DNA and mediates development of Parkinson's disease. Thus, MAO B emerges as a promising target for developing pharmaceuticals potentially useful to treat this vicious neurodegenerative condition. Aiming to contribute to the development of drugs with the reversible mechanism of MAO B inhibition only, herein, an extended in silico-in vitro procedure for the selection of novel MAO B inhibitors is demonstrated, including the following: (1) definition of optimized and validated structure-based three-dimensional (3-D) quantitative structure-activity relationships (QSAR) models derived from available cocrystallized inhibitor-MAO B complexes; (2) elaboration of SAR features for either irreversible or reversible MAO B inhibitors to characterize and improve coumarin-based inhibitor activity (Protein Data Bank ID: 2V61 ) as the most potent reversible lead compound; (3) definition of structure-based (SB) and ligand-based (LB) alignment rule assessments by which virtually any untested potential MAO B inhibitor might be evaluated; (4) predictive ability validation of the best 3-D QSAR model through SB/LB modeling of four coumarin-based external test sets (267 compounds); (5) design and SB/LB alignment of novel coumarin-based scaffolds experimentally validated through synthesis and biological evaluation in vitro. Due to the wide range of molecular diversity within the 3-D QSAR training set and derived features, the selected N probe-derived 3-D QSAR model proves to be a valuable tool for virtual screening (VS) of novel MAO B inhibitors and a platform for design, synthesis and evaluation of novel active structures. Accordingly, six highly active and selective MAO B inhibitors (picomolar to low nanomolar range of activity) were disclosed as a

Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

International Nuclear Information System (INIS)

Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

2001-01-01

Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

Extended use of raltegravir in the treatment of HIV-1 infection: optimizing therapy

Directory of Open Access Journals (Sweden)

Charlotte Charpentier

2010-10-01

Full Text Available Charlotte Charpentier1, Laurence Weiss21Assistance Publique-Hôpitaux de Paris, Hôpital Bichat-Claude Bernard, Laboratoire de Virologie, Université Paris-Diderot, Paris, France; 2Assistance Publique-Hôpitaux de Paris, Hôpital Européen Georges Pompidou, Service d’Immunologie Clinique, Université Paris Descartes, Paris, FranceAbstract: Raltegravir is the first licensed compound in 2007 of the new integrase inhibitor drug class. At the dose of 400 mg twice daily, raltegravir showed a potent antiviral action in antiretroviral-naïve patients when associated with tenofovir and emtricitabine. Raltegravir was also found to be highly active in antiretroviral-experienced patients with virological failure and displaying multiresistant virus, as shown with the BENCHMRK and ANRS 139 TRIO trials. Finally, the use of raltegravir was assessed in the context of a switch strategy in antiretroviral-experienced patients with virological success [human immunodeficiency virus type 1 (HIV-1 RNA below detection limit], highlighting the following mandatory criteria in this strategy: the nucleoside reverse transcriptase inhibitors associated with raltegravir have to be fully active. In the different studies, raltegravir had a favorable safety and tolerability profile. In the clinical situation a switch in virologically suppressed patients receiving a protease inhibitor, an improvement of the lipid profile was observed. Overall, when analyzing the Phase II and III trials together, only a few patients on raltegravir discontinued for adverse events. The development of resistance to raltegravir mainly involved three resistance mutations in integrase gene: Q148H/K/R, N155H, and Y143C/H/R. In conclusion, raltegravir improved the clinical management of HIV-1 infection both in antiretroviral-naïve and in antiretroviral-experienced patients.Keywords: HIV-1, integrase inhibitors, raltegravir, antiretroviral therapy

Potential pharmacokinetic interactions between antiretrovirals and medicinal plants used as complementary and African traditional medicines.

Science.gov (United States)

Müller, Adrienne C; Kanfer, Isadore

2011-11-01

The use of traditional/complementary/alternate medicines (TCAMs) in HIV/AIDS patients who reside in Southern Africa is quite common. Those who use TCAMs in addition to antiretroviral (ARV) treatment may be at risk of experiencing clinically significant pharmacokinetic (PK) interactions, particularly between the TCAMs and the protease inhibitors (PIs) and non-nucleoside reverse transcriptase inhibitors (NNRTIs). Mechanisms of PK interactions include alterations to the normal functioning of drug efflux transporters, such as P-gp and/or CYP isoenzymes, such a CYP3A4 that mediate the absorption and elimination of drugs in the small intestine and liver. Specific mechanisms include inhibition and activation of these proteins and induction via the pregnane X receptor (PXR). Several clinical studies and case reports involving ARV-herb PK interactions have been reported. St John's Wort, Garlic and Cat's Claw exhibited potentially significant interactions, each with a PI or NNRTI. The potential for these herbs to induce PK interactions with drugs was first identified in reports of in vitro studies. Other in vitro studies have shown that several African traditional medicinal (ATM) plants and extracts may also demonstrate PK interactions with ARVs, through effects on CYP3A4, P-gp and PXR. The most complex effects were exhibited by Hypoxis hemerocallidea, Sutherlandia frutescens, Cyphostemma hildebrandtii, Acacia nilotica, Agauria salicifolia and Elaeodendron buchananii. Despite a high incidence of HIV/AIDs in the African region, only one clinical study, between efavirenz and Hypoxis hemerocallidea has been conducted. However, several issues/concerns still remain to be addressed and thus more studies on ATMs are warranted in order for more meaningful data to be generated and the true potential for such interactions to be determined. Copyright © 2011 John Wiley & Sons, Ltd.

Effectiveness and cost of treatment with maraviroc in HIV infection

Directory of Open Access Journals (Sweden)

Viola Sacchi

2009-12-01

Full Text Available Since 1995, life expectancy and quality of life of HIV patients improved significantly due to the use of Highly Active Anti-Retroviral Therapy (HAART, consisting of different combinations of three classes of antiretroviral agents, nucleoside and non-nucleoside reverse transcriptase inhibitors, and protease inhibitors. Recently, new treatment options for individuals developing resistance to these drugs have become available, with the appearance of new drug classes like integrase inhibitors, fusion inhibitors and CCR5 antagonists. Maraviroc is the first antiretroviral agent belonging to the latter drug class approved for clinical use. CCR5 receptor antagonists act by blocking the interaction of the HIV virus with the CCR5 chemokine receptor, a co-receptor essential to the entry process of R5-tropic viruses. The drug is indicated, in combination with other antiretroviral products, for treatment-experienced adult patients infected with only CCR5-tropic HIV-1 detectable virus strains. Results of main phase III clinical trials indicate that maraviroc, in combination with optimized background therapy (OBT, causes significantly greater reductions in viral load and increases in CD4+ cell count, as compared to OBT alone in this kind of patients. In Italy, the monthly cost of maraviroc therapy is about € 780. A number of economic evaluations, performed for different settings, demonstrate that the therapy including maraviroc is cost-effective if compared to OBT alone, determining an ICER generally below the threshold of three times the GDP per capita. In the Italian context, the ICER determined by OBT + maraviroc vs OBT alone is approximately 45,000 €/LYG.

High prevalence of antiretroviral drug resistance among HIV-1-untreated patients in Guinea-Conakry and in Niger.

Science.gov (United States)

Charpentier, Charlotte; Bellecave, Pantxika; Cisse, Mohamed; Mamadou, Saidou; Diakite, Mandiou; Peytavin, Gilles; Tchiombiano, Stéphanie; Teisseire, Pierre; Pizarro, Louis; Storto, Alexandre; Brun-Vézinet, Françoise; Katlama, Christine; Calvez, Vincent; Marcelin, Anne-Geneviève; Masquelier, Bernard; Descamps, Diane

2011-01-01

The aim of the study was to assess the prevalence of antiretroviral drug resistance mutations in HIV-1 from recently diagnosed and untreated patients living in Conakry, Guinea-Conakry and in Niamey, Niger. The study was performed in two countries of Western Africa - Guinea-Conakry and Niger - using the same survey method in both sites. All newly HIV-1 diagnosed patients, naive of antiretroviral drugs, were consecutively included during September 2009 in each of the two sites. Protease and reverse transcriptase sequencing was performed using the ANRS procedures. Drug resistance mutations were identified according to the 2009 update surveillance drug resistance mutations. In Conakry, 99 patients were included, most of whom (89%) were infected with CRF02_AG recombinant virus. Resistance analysis among the 93 samples showed that ≥1 drug resistance mutation was observed in 8 samples, leading to a prevalence of primary resistance of 8.6% (95% CI 2.91-14.29%). In Niamey, 96 patients were included; a high diversity in HIV-1 subtypes was observed with 47 (51%) patients infected with CRF02_AG. Resistance analysis performed among the 92 samples with successful genotypic resistance test showed that ≥1 drug resistance mutation was observed in 6 samples, leading to a prevalence of primary resistance of 6.5% (95% CI 1.50-11.50%). We reported the first antiretroviral drug resistance survey studies in antiretroviral-naive patients living in Guinea-Conakry and in Niger. The prevalence of resistance was between 6% and 9% in both sites, which is higher than most of the other countries from Western Africa region.

2-(Alkyl/aryl)amino-6-benzylpyrimidin-4(3H)-ones as inhibitors of wild-type and mutant HIV-1: enantioselectivity studies.

Science.gov (United States)

Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello

2012-04-12

The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society

The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

Directory of Open Access Journals (Sweden)

Niu Meijuan

2004-10-01

Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

Science.gov (United States)

Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

2013-01-01

In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

Reverse transcriptase directs viral evolution in a deep ocean methane seep

Science.gov (United States)

Paul, B. G.; Bagby, S. C.

2013-12-01

Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

Structural Basis for the Inhibition of RNase H Activity of HIV-1 Reverse Transcriptase by RNase H Active Site-Directed Inhibitors

Energy Technology Data Exchange (ETDEWEB)

Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev (Merck)

2010-09-02

HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are critical to the HIV life cycle. Although a number of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-containing inhibitors bound to the RNase H active site. This class of compounds binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addition, one of the naphthyridinone-based compounds was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compound can also bind the RNase H site and retains the metal-dependent binding mode of this class of molecules. These structures provide a means for structurally guided design of novel RNase H inhibitors.

[Consensus Statement by GeSIDA/National AIDS Plan Secretariat on antiretroviral treatment in adults infected by the human immunodeficiency virus (Updated January 2013)].

Science.gov (United States)

2013-11-01

This consensus document is an update of combined antiretroviral therapy (cART) guidelines for HIV-1 infected adult patients. To formulate these recommendations a panel composed of members of the GeSIDA/National AIDS Plan Secretariat (Grupo de Estudio de Sida and the Secretaría del Plan Nacional sobre el Sida) reviewed the efficacy and safety advances in clinical trials, cohort and pharmacokinetic studies published in medical journals (PubMed and Embase) or presented in medical scientific meetings. The strength of the recommendations and the evidence which support them are based on a modification of the criteria of Infectious Diseases Society of America. cART is recommended in patients with symptoms of HIV infection, in pregnant women, in serodiscordant couples with high risk of transmission, in hepatitisB co-infection requiring treatment, and in HIV nephropathy. cART is recommended in asymptomatic patients if CD4 is 500cells/μl cART should be considered in the case of chronic hepatitisC, cirrhosis, high cardiovascular risk, plasma viral load >100.000 copies/ml, proportion of CD4 cells 55years. The objective of cART is to achieve an undetectable viral load. The first cART should include 2 reverse transcriptase inhibitors (RTI) nucleoside analogs and a third drug (a non-analog RTI, a ritonavir boosted protease inhibitor, or an integrase inhibitor). The panel has consensually selected some drug combinations, for the first cART and specific criteria for cART in acute HIV infection, in tuberculosis and other HIV related opportunistic infections, for the women and in pregnancy, in hepatitisB or C co-infection, in HIV-2 infection, and in post-exposure prophylaxis. These new guidelines update previous recommendations related to first cART (when to begin and what drugs should be used), how to monitor, and what to do in case of viral failure or adverse drug reactions. cART specific criteria in comorbid patients and special situations are similarly updated. Copyright �

On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

Science.gov (United States)

Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

2017-07-11

Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

Science.gov (United States)

Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

2008-09-01

We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 1.

Science.gov (United States)

Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and characterization of the novel reversible and selective cathepsin X inhibitors.

Science.gov (United States)

Fonović, Urša Pečar; Mitrović, Ana; Knez, Damijan; Jakoš, Tanja; Pišlar, Anja; Brus, Boris; Doljak, Bojan; Stojan, Jure; Žakelj, Simon; Trontelj, Jurij; Gobec, Stanislav; Kos, Janko

2017-09-13

Cathepsin X is a cysteine peptidase involved in the progression of cancer and neurodegenerative diseases. Targeting this enzyme with selective inhibitors opens a new possibility for intervention in several therapeutic areas. In this study triazole-based reversible and selective inhibitors of cathepsin X have been identified. Their selectivity and binding is enhanced when the 2,3-dihydrobenzo[b][1,4]dioxine moiety is present as the R 1 substituent. Of a series of selected triazole-benzodioxine derivatives, compound 22 is the most potent inhibitor of cathepsin X carboxypeptidase activity (K i  = 2.45 ± 0.05 μM) with at least 100-fold greater selectivity in comparison to cathepsin B or other related cysteine peptidases. Compound 22 is not cytotoxic to prostate cancer cells PC-3 or pheochromocytoma PC-12 cells at concentrations up to 10 μM. It significantly inhibits the migration of tumor cells and increases the outgrowth of neurites, both processes being under the control of cathepsin X carboxypeptidase activity. Compound 22 and other characterized triazole-based inhibitors thus possess a great potential for further development resulting in several in vivo applications.

Antiretroviral therapy during pregnancy and the risk of an adverse outcome.

Science.gov (United States)

Tuomala, Ruth E; Shapiro, David E; Mofenson, Lynne M; Bryson, Yvonne; Culnane, Mary; Hughes, Michael D; O'Sullivan, M J; Scott, Gwendolyn; Stek, Alice M; Wara, Diane; Bulterys, Marc

2002-06-13

Some studies suggest that combination antiretroviral therapy in pregnant women with human immunodeficiency virus type 1 (HIV-1) infection increases the risk of premature birth and other adverse outcomes of pregnancy. We studied pregnant women with HIV-1 infection who were enrolled in seven clinical studies and delivered their infants from 1990 through 1998. The cohort comprised 2123 women who received antiretroviral therapy during pregnancy (monotherapy in 1590, combination therapy without protease inhibitors in 396, and combination therapy with protease inhibitors in 137) and 1143 women who did not receive antiretroviral therapy. After standardization for the CD4+ cell count and use or nonuse of tobacco, alcohol, and illicit drugs, the rate of premature delivery (women who received antiretroviral therapy and those who did not (16 percent and 17 percent, respectively); the rate of low birth weight (women who received combination therapy with protease inhibitors (5 percent) had infants with very low birth weight, as compared with nine women who received combination therapy without protease inhibitors (2 percent) (adjusted odds ratio, 3.56; 95 percent confidence interval, 1.04 to 12.19). As compared with no antiretroviral therapy or monotherapy, combination therapy for HIV-1 infection in pregnant women is not associated with increased rates of premature delivery or with low birth weight, low Apgar scores, or stillbirth in their infants. The association between combination therapy with protease inhibitors and an increased risk of very low birth weight requires confirmation.

Antiretroviral drug resistance in HIV-1 therapy-naive patients in Cuba.

Science.gov (United States)

Pérez, Lissette; Kourí, Vivian; Alemán, Yoan; Abrahantes, Yeisel; Correa, Consuelo; Aragonés, Carlos; Martínez, Orlando; Pérez, Jorge; Fonseca, Carlos; Campos, Jorge; Álvarez, Delmis; Schrooten, Yoeri; Dekeersmaeker, Nathalie; Imbrechts, Stijn; Beheydt, Gertjan; Vinken, Lore; Soto, Yudira; Álvarez, Alina; Vandamme, Anne-Mieke; Van Laethem, Kristel

2013-06-01

In Cuba, antiretroviral therapy rollout started in 2001 and antiretroviral therapy coverage has reached almost 40% since then. The objectives of this study were therefore to analyze subtype distribution, and level and patterns of drug resistance in therapy-naive HIV-1 patients. Four hundred and one plasma samples were collected from HIV-1 therapy-naive patients in 2003 and in 2007-2011. HIV-1 drug resistance genotyping was performed in the pol gene and drug resistance was interpreted according to the WHO surveillance drug-resistance mutations list, version 2009. Potential impact on first-line therapy response was estimated using genotypic drug resistance interpretation systems HIVdb version 6.2.0 and Rega version 8.0.2. Phylogenetic analysis was performed using Neighbor-Joining. The majority of patients were male (84.5%), men who have sex with men (78.1%) and from Havana City (73.6%). Subtype B was the most prevalent subtype (39.3%), followed by CRF20-23-24_BG (19.5%), CRF19_cpx (18.0%) and CRF18_cpx (10.3%). Overall, 29 patients (7.2%) had evidence of drug resistance, with 4.0% (CI 1.6%-4.8%) in 2003 versus 12.5% (CI 7.2%-14.5%) in 2007-2011. A significant increase in drug resistance was observed in recently HIV-1 diagnosed patients, i.e. 14.8% (CI 8.0%-17.0%) in 2007-2011 versus 3.8% (CI 0.9%-4.7%) in 2003 (OR 3.9, CI 1.5-17.0, p=0.02). The majority of drug resistance was restricted to a single drug class (75.8%), with 55.2% patients displaying nucleoside reverse transcriptase inhibitor (NRTI), 10.3% non-NRTI (NNRTI) and 10.3% protease inhibitor (PI) resistance mutations. Respectively, 20.7% and 3.4% patients carried viruses containing drug resistance mutations against NRTI+NNRTI and NRTI+NNRTI+PI. The first cases of resistance towards other drug classes than NRTI were only detected from 2008 onwards. The most frequent resistance mutations were T215Y/rev (44.8%), M41L (31.0%), M184V (17.2%) and K103N (13.8%). The median genotypic susceptibility score for the

Analytical Method Development and Validation for the Simultaneous Estimation of Abacavir and Lamivudine by Reversed-phase High-performance Liquid Chromatography in Bulk and Tablet Dosage Forms.

Science.gov (United States)

Raees Ahmad, Sufiyan Ahmad; Patil, Lalit; Mohammed Usman, Mohammed Rageeb; Imran, Mohammad; Akhtar, Rashid

2018-01-01

A simple rapid, accurate, precise, and reproducible validated reverse phase high performance liquid chromatography (HPLC) method was developed for the determination of Abacavir (ABAC) and Lamivudine (LAMI) in bulk and tablet dosage forms. The quantification was carried out using Symmetry Premsil C18 (250 mm × 4.6 mm, 5 μm) column run in isocratic way using mobile phase comprising methanol: water (0.05% orthophosphoric acid with pH 3) 83:17 v/v and a detection wavelength of 245 nm and injection volume of 20 μl, with a flow rate of 1 ml/min. In the developed method, the retention times of ABAC and LAMI were found to be 3.5 min and 7.4 min, respectively. The method was validated in terms of linearity, precision, accuracy, limits of detection, limits of quantitation, and robustness in accordance with the International Conference on Harmonization guidelines. The assay of the proposed method was found to be 99% - 101%. The recovery studies were also carried out and mean % recovery was found to be 99% - 101%. The % relative standard deviation from reproducibility was found to be performance liquid chromatography, UV: Ultraviolet, ICH: International Conference on Harmonization, ABAC: Abacavir, LAMI: Lamivudine, HIV: Human immunodeficiency virus, AIDS: Acquired immunodeficiency syndrome, NRTI: Nucleoside reverse transcriptase inhibitors, ARV: Antiretroviral, RSD: Relative standard deviation, RT: Retention time, SD: Standard deviation.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

Directory of Open Access Journals (Sweden)

Warrilow David

2008-12-01

Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

Dual antiretroviral therapy for HIV infection.

Science.gov (United States)

Soriano, Vicente; Fernandez-Montero, Jose Vicente; Benitez-Gutierrez, Laura; Mendoza, Carmen de; Arias, Ana; Barreiro, Pablo; Peña, José M; Labarga, Pablo

2017-08-01

For two decades, triple combinations of antiretrovirals have been the standard treatment for HIV infection. The challenges of such lifelong therapy include long-term side effects, high costs and reduced drug adherence. The recent advent of more potent and safer antiretrovirals has renewed the interest for simpler HIV regimens. Areas covered: We discuss the pros and cons of dual antiretroviral therapies in both drug-naïve and in treatment-experienced patients with viral suppression (switch strategy). Expert opinion: Some dual antiretroviral regimens are safe and efficacious, particularly as maintenance therapy. At this time, combinations of dolutegravir plus rilpivirine represent the best dual regimen. Longer follow-up and larger study populations are needed before supporting dolutegravir plus lamivudine. In contrast, dual therapy based on maraviroc is less effective. Although dual regimens with boosted protease inhibitors plus either lamivudine or raltegravir may be effective, they are penalized by metabolic side effects and risk for drug interactions. The newest dual regimens could save money, reduce toxicity and spare drug options for the future. For the first time in HIV therapeutics, less can be more. Dual therapy switching has set up a new paradigm in HIV treatment that uses induction-maintenance.

Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss.

Science.gov (United States)

Zhu, Tao; Niu, Deng-Ke

2013-03-05

Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

Occurrence of transmitted HIV-1 drug resistance among Drug-naïve pregnant women in selected HIV-care centres in Ghana.

Science.gov (United States)

Martin-Odoom, Alexander; Adiku, Theophilus; Delgado, Elena; Lartey, Margaret; Ampofo, William K

2017-03-01

Access to antiretroviral therapy in Ghana has been scaled up across the country over the last decade. This study sought to determine the occurrence of transmitted HIV-1 drug resistance in pregnant HIV-1 positive women yet to initiate antiretroviral therapy at selected HIV Care Centres in Ghana. Plasma specimens from twenty-six (26) HIV seropositive pregnant women who were less than 28weeks pregnant with their first pregnancy and ART naïve were collected from selected HIV care centres in three (3) regions in Ghana. Genotypic testing was done for the reverse transcriptase gene and the sequences generated were analyzed for HIV-1 drug resistance mutations using the Stanford University HIV Drug Resistance Database. Resistance mutations associated with the reverse transcriptase gene were detected in 4 (15.4%) of the participants. At least one major drug resistance mutation in the reverse transcriptase gene was found in 3 (11.5%) of the women. The detection of transmitted HIV-1 drug resistance in this drug-naïve group in two regional HIV care sites is an indication of the need for renewed action in monitoring the emergence of transmitted HIV-1 drug resistance in Ghana. None declared.

A silicone elastomer vaginal ring for HIV prevention containing two microbicides with different mechanisms of action.

Science.gov (United States)

Fetherston, Susan M; Boyd, Peter; McCoy, Clare F; McBride, Marcella C; Edwards, Karen-Leigh; Ampofo, Stephen; Malcolm, R Karl

2013-02-14

Vaginal rings are currently being developed for the long-term (at least 30 days) continuous delivery of microbicides against human immunodeficiency virus (HIV). Research to date has mostly focused on devices containing a single antiretroviral compound, exemplified by the 25mg dapivirine ring currently being evaluated in a Phase III clinical study. However, there is a strong clinical rationale for combining antiretrovirals with different mechanisms of action in a bid to increase breadth of protection and limit the emergence of resistant strains. Here we report the development of a combination antiretroviral silicone elastomer matrix-type vaginal ring for simultaneous controlled release of dapivirine, a non-nucleoside reverse transcriptase inhibitor, and maraviroc, a CCR5-targeted HIV-1 entry inhibitor. Vaginal rings loaded with 25mg dapivirine and various quantities of maraviroc (50-400mg) were manufactured and in vitro release assessed. The 25mg dapivirine and 100mg maraviroc formulation was selected for further study. A 24-month pharmaceutical stability evaluation was conducted, indicating good product stability in terms of in vitro release, content assay, mechanical properties and related substances. This combination ring product has now progressed to Phase I clinical testing. Copyright © 2012 Elsevier B.V. All rights reserved.

Guidelines for antiretroviral therapy in adults

Directory of Open Access Journals (Sweden)

G Meintjes

2012-08-01

Full Text Available These guidelines are intended as an update to those published in the Southern African Journal of HIV Medicine in January 2008. Since the release of the previous guidelines, the scale-up of antiretroviral therapy (ART in Southern Africa has continued to grow. Cohort studies from the region show excellent clinical outcomes; however, ART is still being started late (in advanced disease, resulting in relatively high early mortality rates. New data on antiretroviral (ARV tolerability in the region and several new ARV drugs have become available. Although currently few in number, some patients in the region are failing protease inhibitor (PI-based second-line regimens. To address this, guidelines on third-line (or ‘salvage’ therapy have been expanded.

Gibbs Free Energy of Hydrolytic Water Molecule in Acyl-Enzyme Intermediates of a Serine Protease: A Potential Application for Computer-Aided Discovery of Mechanism-Based Reversible Covalent Inhibitors.

Science.gov (United States)

Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi

2017-01-01

In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.

Bauhinia variegata var. variegata trypsin inhibitor: From isolation to potential medicinal applications

International Nuclear Information System (INIS)

Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun

2010-01-01

Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K i , 0.1 x 10 -9 M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.

Peripheral neuropathy in HIV: an analysis of evidence-based approaches.

Science.gov (United States)

Nicholas, Patrice K; Corless, Inge B; Evans, Linda A

2014-01-01

Peripheral neuropathy is a common and vexing symptom for people living with HIV infection (PLWH). Neuropathy occurs in several different syndromes and is identified in the literature as distal sensory polyneuropathy or distal sensory peripheral neuropathy. More recently, the HIV literature has focused on the syndrome as painful HIV-associated sensory neuropathy, addressing the symptom rather than the underlying pathophysiology. Assessment of neuropathy in PLWH is critical and must be incorporated into nursing practice for each visit. Neuropathy has been attributed to the direct effects of HIV, exposure to antiretroviral medications (particularly the nucleoside reverse transcriptase inhibitors), advanced immune suppression, and comorbid tuberculosis infection and exposure to antituberculosis medications. Evidence supports the importance of addressing neuropathy in PLWH with pharmacologic treatment regimens and complementary/alternative approaches. This paper examines the pathophysiology, evidence, and approaches to managing peripheral neuropathy. A case study has been included to illustrate a patient's experience with neuropathy symptoms. Copyright © 2014 Association of Nurses in AIDS Care. Published by Elsevier Inc. All rights reserved.

The association between HIV, antiretroviral therapy, and gestational diabetes mellitus

NARCIS (Netherlands)

Soepnel, Larske M; Norris, Shane A; Schrier, Verena J M M; Browne, Joyce L; Rijken, Marcus J; Gray, Glenda; Klipstein-Grobusch, Kerstin

2017-01-01

OBJECTIVES: The widespread, chronic use of antiretroviral therapy raises questions concerning the metabolic consequences of HIV infection and treatment. Antiretroviral therapy, and specifically protease inhibitors, has been associated with hyperglycemia. As pregnant women are vulnerable to

Characterization of HIV-1 antiretroviral drug resistance after second-line treatment failure in Mali, a limited-resources setting

Science.gov (United States)

Maiga, Almoustapha Issiaka; Fofana, Djeneba Bocar; Cisse, Mamadou; Diallo, Fodié; Maiga, Moussa Youssoufa; Traore, Hamar Alassane; Maiga, Issouf Alassane; Sylla, Aliou; Fofana, Dionke; Taiwo, Babafemi; Murphy, Robert; Katlama, Christine; Tounkara, Anatole; Calvez, Vincent; Marcelin, Anne-Geneviève

2012-01-01

Objectives We describe the outcomes of second-line drug resistance profiles and predict the efficacy of drugs for third-line therapy in patients monitored without the benefit of plasma HIV-1 RNA viral load (VL) or resistance testing. Methods We recruited 106 HIV-1-infected patients after second-line treatment failure in Mali. VL was determined by the Abbott RealTime system and the resistance by the ViroSeq HIV-1 genotyping system. The resistance testing was interpreted using the latest version of the Stanford algorithm. Results Among the 106 patients, 93 had isolates successfully sequenced. The median age, VL and CD4 cells were respectively 35 years, 72 000 copies/mL and 146 cells/mm3. Patients were exposed to a median of 4 years of treatment and to six antiretrovirals. We found 20% of wild-type viruses. Resistance to etravirine was noted in 38%, to lopinavir in 25% and to darunavir in 12%. The duration of prior nucleos(t)ide reverse transcriptase inhibitor exposure was associated with resistance to abacavir (P < 0.0001) and tenofovir (P = 0.0001), and duration of prior protease inhibitor treatment with resistance to lopinavir (P < 0.0001) and darunavir (P = 0.06). Conclusion Long duration of therapy prior to failure was associated with high levels of resistance and is directly related to limited access to VL monitoring and delayed switches to second-line treatment, precluding efficacy of drugs for third-line therapy. This study underlines the need for governments and public health organizations to recommend the use of VL monitoring and also the availability of darunavir and raltegravir for third-line therapies in the context of limited-resource settings. PMID:22888273

Design and synthesis of N₁-aryl-benzimidazoles 2-substituted as novel HIV-1 non-nucleoside reverse transcriptase inhibitors.

Science.gov (United States)

Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba

2014-02-15

A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase

OpenAIRE

Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael

2012-01-01

Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

Science.gov (United States)

Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

2014-01-01

Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

HIV-1 transmitted drug resistance and genetic diversity among patients from Piauí State, Northeast Brazil.

Science.gov (United States)

Moura, Maria Edileuza Soares; da Guarda Reis, Mônica Nogueira; Lima, Yanna Andressa Ramos; Eulálio, Kelsen Dantas; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo

2015-05-01

HIV-1 transmitted-drug-resistance and genetic diversity are dynamic and may differ in distinct locations/risk groups. In Brazil, increased AIDS incidence and related mortality have been detected in the Northeast region, differently from the epicenter in the Southeast. This cross-sectional study describes transmitted-dru- resistance and HIV-1 subtypes in protease/PR and reverse transcriptase/RT regions among antiretroviral naïve patients from Piauí State, Northeast Brazil. Among 96 patients recruited 89 (92.7%) had HIV-1 PR/RT regions sequenced: 44 females and 45 males, 22 self-declared as men who have sex with men. Transmitted-drug-resistance was investigated by CPR tool (Stanford HIV-1 Drug Resistance/SDRM). HIV-1 subtypes were assigned by REGA and phylogenetic inference. Overall, transmitted-drug-resistance rate was 11.2% (10/89; CI 95%: 5.8-19.1%); 22.7% among men who have sex with men (5/22; CI 95%: 8.8-43.4%), 10% in heterosexual men (2/20; CI 95%: 1.7-29.3%) and 6.8% in women (3/44; CI 95%: 1.8-17.4%). Singleton mutations to protease-inhibitor/PI, nucleoside-reverse-transcriptase-inhibitor/NRTI or non-nucleoside-reverse-transcriptase-inhibitor/NNRTI predominated (8/10): PI mutations (M46L, V82F, L90M); NRTI mutations (M41L, D67N) and NNRTI mutations (K103N/S). Dual class resistance mutations to NRTI and NNRTI were observed: T215L (NRTI), Y188L (NNRTI) and T215N (NRTI), F227L (NNRTI). Subtype B prevailed (86.6%; 77/89), followed by subtype F1 (1.1%, 1/89) and subtype C (1.1%, 1/89). B/F1 and B/C intersubtype recombinants represented 11.2% (10/89). In Piauí State extensive testing of incidence and transmitted-drug-resistance in all populations with risk behaviors may help control AIDS epidemic locally. © 2015 Wiley Periodicals, Inc.

(3,4-dihydroisoquinolin-2(1H)-yl)

Indian Academy of Sciences (India)

Administrator

HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.

High-throughput screening using pseudotyped lentiviral particles: a strategy for the identification of HIV-1 inhibitors in a cell-based assay.

Science.gov (United States)

Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping

2009-03-01

Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.

Emtricitabine/tenofovir disoproxil fumarate.

Science.gov (United States)

2004-01-01

Gilead Sciences is developing a fixed-dose co-formulation of two of its reverse transcriptase inhibitors, emtricitabine [Emtriva] and tenofovir disoproxil fumarate [Viread], for once-daily dosing in combination with other antiretrovirals for the treatment of HIV infection. Each co-formulated tablet will contain 300 mg of tenofovir disoproxil fumarate and 200 mg of emtricitabine. Emtricitabine [Emtriva] is a nucleoside reverse transcriptase inhibitor (NRTI) with demonstrated potent activity against HIV and hepatitis B virus (HBV). It was first approved in the US by the FDA in July 2003 and is indicated for adults aged > or =18 years. Safety and effectiveness in paediatric patients have not been established. In antiretroviral-treatment-experienced patients, the use of emtricitabine may be considered for adults with HIV strains that are expected to be susceptible to the drug as assessed by genotypic or phenotypic testing. The recommended dose of emtricitabine is one 200 mg capsule daily, with or without food. In the European Union, emtricitabine is indicated in combination with other antiretroviral agents for the treatment of HIV in adults and children, where it is also licensed as an oral 10 mg/mL solution. The oral solution is for use in infants older than 4 months, children and patients unable to swallow hard capsules, and patients with renal impairment who require dose reduction. Tenofovir disoproxil fumarate [Viread] is a nucleotide reverse transcriptase inhibitor that is indicated in combination with other antiretroviral agents for the treatment of HIV-1 infection in treatment-experienced patients. The drug was first approved in the US in October 2001, followed by further approvals in the European Union, Australia, Iceland, Brazil, Canada and Switzerland. The drug has been launched in all these countries. In February 2003, the EMEA's advisory committee adopted a positive opinion to extend the indication of tenofovir disoproxil fumarate in all 15 member states to

Structure-Activity Analysis of Vinylogous Urea Inhibitors of Human Immunodeficiency Virus-Encoded Ribonuclease H ▿

OpenAIRE

Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.

2010-01-01

Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...

Patterns of HIV-1 drug resistance after first-line antiretroviral therapy (ART) failure in 6 sub-Saharan African countries: implications for second-line ART strategies.

Science.gov (United States)

Hamers, Raph L; Sigaloff, Kim C E; Wensing, Annemarie M; Wallis, Carole L; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S; Rinke de Wit, Tobias F; Schuurman, Rob

2012-06-01

Human immunodeficiency virus type 1 (HIV-1) drug resistance may limit the benefits of antiretroviral therapy (ART). This cohort study examined patterns of drug-resistance mutations (DRMs) in individuals with virological failure on first-line ART at 13 clinical sites in 6 African countries and predicted their impact on second-line drug susceptibility. A total of 2588 antiretroviral-naive individuals initiated ART consisting of different nucleoside reverse transcriptase inhibitor (NRTI) backbones (zidovudine, stavudine, tenofovir, or abacavir, plus lamivudine or emtricitabine) with either efavirenz or nevirapine. Population sequencing after 12 months of ART was retrospectively performed if HIV RNA was >1000 copies/mL. The 2010 International Antiviral Society-USA list was used to score major DRMs. The Stanford algorithm was used to predict drug susceptibility. HIV-1 sequences were generated for 142 participants who virologically failed ART, of whom 70% carried ≥1 DRM and 49% had dual-class resistance, with an average of 2.4 DRMs per sequence (range, 1-8). The most common DRMs were M184V (53.5%), K103N (28.9%), Y181C (15.5%), and G190A (14.1%). Thymidine analogue mutations were present in 8.5%. K65R was frequently selected by stavudine (15.0%) or tenofovir (27.7%). Among participants with ≥1 DRM, HIV-1 susceptibility was reduced in 93% for efavirenz/nevirapine, in 81% for lamivudine/emtricitabine, in 59% for etravirine/rilpivirine, in 27% for tenofovir, in 18% for stavudine, and in 10% for zidovudine. Early failure detection limited the accumulation of resistance. After stavudine failure in African populations, zidovudine rather than tenofovir may be preferred in second-line ART. Strategies to prevent HIV-1 resistance are a global priority.

Bauhinia variegata var. variegata trypsin inhibitor: From isolation to potential medicinal applications

Energy Technology Data Exchange (ETDEWEB)

Fang, Evandro Fei; Wong, Jack Ho [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Bah, Clara Shui Fern [Department of Food Science, Division of Sciences, University of Otago (New Zealand); Lin, Peng [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China); Tsao, Sai Wah [Department of Anatomy, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Sassoon Road, Pokfulam, Hong Kong SAR (China); Ng, Tzi Bun, E-mail: b021770@mailserv.cuhk.edu.hk [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR (China)

2010-06-11

Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K{sub i}, 0.1 x 10{sup -9} M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI.

Bauhinia variegata var. variegata trypsin inhibitor: from isolation to potential medicinal applications.

Science.gov (United States)

Fang, Evandro Fei; Wong, Jack Ho; Bah, Clara Shui Fern; Lin, Peng; Tsao, Sai Wah; Ng, Tzi Bun

2010-06-11

Here we report for the first time of a new Kunitz-type trypsin inhibitor (termed BvvTI) from seeds of the Camel's foot tree, Bauhinia variegata var. variegata. BvvTI shares the same reactive site residues (Arg, Ser) and exhibits a homology of N-terminal amino acid sequence to other Bauhinia protease inhibitors. The trypsin inhibitory activity (K(i), 0.1 x 10(-9)M) of BvvTI ranks the highest among them. Besides anti-HIV-1 reverse transcriptase activity, BvvTI could significantly inhibit the proliferation of nasopharyngeal cancer CNE-1 cells in a selective way. This may partially be contributed by its induction of cytokines and apoptotic bodies. These results unveil potential medicinal applications of BvvTI. (c) 2010 Elsevier Inc. All rights reserved.

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

Science.gov (United States)

Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

2017-02-01

Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

Enhanced activity of carbosilane dendrimers against HIV when combined with reverse transcriptase inhibitor drugs: searching for more potent microbicides

Directory of Open Access Journals (Sweden)

Vacas-Córdoba E

2014-07-01

Full Text Available Enrique Vacas-Córdoba,1–3 Marta Galán,3,4 Francisco J de la Mata,3,4 Rafael Gómez,3,4 Marjorie Pion,1–3 M Ángeles Muñoz-Fernández1–3 1Laboratorio InmunoBiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain; 2Instituto de Investigación Sanitaria del Gregorio Marañón, Madrid, Spain; 3Networking Research Center on Bioengineering, Biomaterials and Nanomedicine, (CIBER-BBN, Madrid, Spain; 4Dendrimers for Biomedical Applications Group (BioInDen, University of Alcalá, Madrid, Spain Abstract: Self-administered topical microbicides or oral preexposure prophylaxis could be very helpful tools for all risk groups to decrease the human immunodeficiency virus (HIV-1 infection rates. Up until now, antiretrovirals (ARVs have been the most advanced microbicide candidates. Nevertheless, the majority of clinical trials has failed in HIV-1 patients. Nanotechnology offers suitable approaches to develop novel antiviral agents. Thereby, new nanosystems, such as carbosilane dendrimers, have been shown to be safe and effective compounds against HIV with great potential as topical microbicides. In addition, because most of the attempts to develop effective topical microbicides were unsuccessful, combinatorial strategies could be a valid approach when designing new microbicides. We evaluated various combinations of anionic carbosilane dendrimers with sulfated (G3-S16 and naphthyl sulfonated (G2-NF16 ended groups with different ARVs against HIV-1 infection. The G3-S16 and G2-NF16 dendrimers showed a synergistic or additive activity profile with zidovudine, efavirenz, and tenofovir in the majority of the combinations tested against the X4 and R5 tropic HIV-1 in cell lines, as well as in human primary cells. Therefore, the combination of ARVs and polyanionic carbosilane dendrimers enhances the antiviral potency of the individual compounds, and our findings support further clinical research on combinational approaches as

Otitis media in Brazilian human immunodeficiency virus infected children undergoing antiretroviral therapy.

Science.gov (United States)

Miziara, I D; Weber, R; Araújo Filho, B Cunha; Pinheiro Neto, C Diógenes

2007-11-01

To assess changes in the prevalence of otitis media, associated with the use of highly active antiretroviral therapy, in Brazilian human immunodeficiency virus (HIV) infected children. Division of otorhinolaryngology, Hospital das Clínicas, Sao Paulo University Medical School, Brazil. A cohort of 459 HIV-infected children aged below 13 years. The prevalence of otitis media and the serum cluster of differentiation four glycoprotein T lymphocyte count were compared for children receiving highly active antiretroviral therapy (with protease inhibitors) and those receiving standard antiretroviral therapy (without protease inhibitors). Otitis media was present in 33.1 per cent of the children. Children aged from zero years to five years 11 months receiving highly active antiretroviral therapy had a higher prevalence of acute otitis media (p=0.02) and a lower prevalence of chronic otitis media (p=0.02). Children who were receiving highly active antiretroviral therapy had a mean serum cluster of differentiation four glycoprotein T lymphocyte count greater than that of those who were receiving standard antiretroviral therapy (pBrazilian HIV-infected children was associated with a lower prevalence of chronic otitis media.

Protease inhibitor associated mutations compromise the efficacy of therapy in human immunodeficiency virus – 1 (HIV-1 infected pediatric patients: a cross-sectional study

Directory of Open Access Journals (Sweden)

Petrova Anna

2007-07-01

Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n

A reversed-phase compatible thin-layer chromatography autography for the detection of acetylcholinesterase inhibitors.

Science.gov (United States)

Ramallo, I Ayelen; García, Paula; Furlan, Ricardo L E

2015-11-01

A dual readout autographic assay to detect acetylcholinesterase inhibitors present in complex matrices adsorbed on reversed-phase or normal-phase thin-layer chromatography plates is described. Enzyme gel entrapment with an amphiphilic copolymer was used for assay development. The effects of substrate and enzyme concentrations, pH, incubation time, and incubation temperature on the sensitivity and the detection limit of the assay were evaluated. Experimental design and response surface methodology were used to optimize conditions with a minimum number of experiments. The assay allowed the detection of 0.01% w/w of physostigmine in both a spiked Sonchus oleraceus L. extract chromatographed on normal phase and a spiked Pimenta racemosa (Mill.) J.W. Moore leaf essential oil chromatographed on reversed phase. Finally, the reversed-phase thin-layer chromatography assay was applied to reveal the presence of an inhibitor in the Cymbopogon citratus (DC.) Stapf essential oil. The developed assay is able to detect acetylcholinesterase inhibitors present in complex matrixes that were chromatographed in normal phase or reversed-phase thin-layer chromatography. The detection limit for physostigmine on both normal and reversed phase was of 1×10(-4) μg. The results can be read by a change in color and/or a change in fluorescence. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors

CSIR Research Space (South Africa)

Bode, ML

2011-06-01

Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...

Class 1-Selective Histone Deacetylase (HDAC) Inhibitors Enhance HIV Latency Reversal while Preserving the Activity of HDAC Isoforms Necessary for Maximal HIV Gene Expression.

Science.gov (United States)

Zaikos, Thomas D; Painter, Mark M; Sebastian Kettinger, Nadia T; Terry, Valeri H; Collins, Kathleen L

2018-03-15

Combinations of drugs that affect distinct mechanisms of HIV latency aim to induce robust latency reversal leading to cytopathicity and elimination of the persistent HIV reservoir. Thus far, attempts have focused on combinations of protein kinase C (PKC) agonists and pan-histone deacetylase inhibitors (HDIs) despite the knowledge that HIV gene expression is regulated by class 1 histone deacetylases. We hypothesized that class 1-selective HDIs would promote more robust HIV latency reversal in combination with a PKC agonist than pan-HDIs because they preserve the activity of proviral factors regulated by non-class 1 histone deacetylases. Here, we show that class 1-selective agents used alone or with the PKC agonist bryostatin-1 induced more HIV protein expression per infected cell. In addition, the combination of entinostat and bryostatin-1 induced viral outgrowth, whereas bryostatin-1 combinations with pan-HDIs did not. When class 1-selective HDIs were used in combination with pan-HDIs, the amount of viral protein expression and virus outgrowth resembled that of pan-HDIs alone, suggesting that pan-HDIs inhibit robust gene expression induced by class 1-selective HDIs. Consistent with this, pan-HDI-containing combinations reduced the activity of NF-κB and Hsp90, two cellular factors necessary for potent HIV protein expression, but did not significantly reduce overall cell viability. An assessment of viral clearance from in vitro cultures indicated that maximal protein expression induced by class 1-selective HDI treatment was crucial for reservoir clearance. These findings elucidate the limitations of current approaches and provide a path toward more effective strategies to eliminate the HIV reservoir. IMPORTANCE Despite effective antiretroviral therapy, HIV evades eradication in a latent form that is not affected by currently available drug regimens. Pharmacologic latency reversal that leads to death of cellular reservoirs has been proposed as a strategy for

Incidence of virological failure and major regimen change of initial combination antiretroviral therapy in the Latin America and the Caribbean: an observational cohort study

Science.gov (United States)

Cesar, Carina; Jenkins, Cathy A.; Shepherd, Bryan E.; Padgett, Denis; Mejía, Fernando; Ribeiro, Sayonara Rocha; Cortes, Claudia P.; Pape, Jean W.; Madero, Juan Sierra; Fink, Valeria; Sued, Omar; McGowan, Catherine; Cahn, Pedro

2015-01-01

Background Access to combination antiretroviral therapy (cART) is expanding in Latin America and the Caribbean (LAC). There is little information in this region regarding incidence of and factors associated with regimen failure and regimen change. Methods Antiretroviral-naïve adults starting cART from 2000-2014 at sites in seven countries throughout LAC were included. Cumulative incidence of virologic failure and major regimen change were estimated with death considered a competing event. Findings 14,027 cART initiators (60% male, median age 37 years, median CD4 156 cells/mm3, median HIV-RNA 5·0 log10 copies/mL, and 28% with clinical AIDS) were followed for a median of 3·9 years. 1,719 patients presented virologic failure and 1,955 had a major regimen change. Excluding GHESKIO-Haiti (which did not regularly measure HIV-RNA), cumulative incidence of virologic failure was 7·8%, 19·2%, and 25·8% at one, three, and five years after cART initiation, respectively; cumulative incidence of major regimen change was 5·9%, 12·7%, and 18·2%. Incidence of major regimen change at GHESKIO-Haiti at five years was 10·7%. Virologic failure was associated with younger age (adjusted hazard ratio[aHR]=2·03 for 20 vs. 40 years; 95% confidence interval[CI] 1·68-2·44), infection through injection-drug use (IDU) (aHR=1·60; 95%CI 1·02-2·52), initiation in earlier calendar years (aHR=1·28 for 2002 vs. 2006; 95%CI 1·13-1·46), and starting with a boosted protease inhibitor (aHR=1·17 vs. non-nucleoside reverse transcriptase inhibitor; 95%CI 1·00-1·64). Interpretation Incidence of virologic failure was generally lower than in North America/Europe. Our results suggest the need to design strategies to reduce failure and major regimen change among younger patients and those with a history of IDU. Funding US National Institutes of Health: U01 AI069923. PMID:26520929

Impact of switching antiretroviral therapy on lipodystrophy and other metabolic complications: a review

DEFF Research Database (Denmark)

Hansen, Birgitte R; Haugaard, Steen B; Iversen, Johan

2004-01-01

Following the introduction of highly active antiretroviral therapy (HAART), metabolic and morphological complications known as HIV associated lipodystrophy syndrome (HALS) have been increasingly common. The approaches to target these complications span from resistance exercise, diet and use...... of the antidiabetics metformin or glitazones to high dose recombinant human growth hormone therapy or switching antiretroviral regimen. When looking at the effect of switching therapy, focus has been addressed to protease inhibitor (PI) based regimens, as PI was the first component of HAART recognized to be correlated...

HIV-1 transmission patterns in antiretroviral therapy-naive, HIV-infected North Americans based on phylogenetic analysis by population level and ultra-deep DNA sequencing.

Directory of Open Access Journals (Sweden)

Lisa L Ross

Full Text Available Factors that contribute to the transmission of human immunodeficiency virus type 1 (HIV-1, especially drug-resistant HIV-1 variants remain a significant public health concern. In-depth phylogenetic analyses of viral sequences obtained in the screening phase from antiretroviral-naïve HIV-infected patients seeking enrollment in EPZ108859, a large open-label study in the USA, Canada and Puerto Rico (ClinicalTrials.gov NCT00440947 were examined for insights into the roles of drug resistance and epidemiological factors that could impact disease dissemination. Viral transmission clusters (VTCs were initially predicted from a phylogenetic analysis of population level HIV-1 pol sequences obtained from 690 antiretroviral-naïve subjects in 2007. Subsequently, the predicted VTCs were tested for robustness by ultra deep sequencing (UDS using pyrosequencing technology and further phylogenetic analyses. The demographic characteristics of clustered and non-clustered subjects were then compared. From 690 subjects, 69 were assigned to 1 of 30 VTCs, each containing 2 to 5 subjects. Race composition of VTCs were significantly more likely to be white (72% vs. 60%; p = 0.04. VTCs had fewer reverse transcriptase and major PI resistance mutations (9% vs. 24%; p = 0.002 than non-clustered sequences. Both men-who-have-sex-with-men (MSM (68% vs. 48%; p = 0.001 and Canadians (29% vs. 14%; p = 0.03 were significantly more frequent in VTCs than non-clustered sequences. Of the 515 subjects who initiated antiretroviral therapy, 33 experienced confirmed virologic failure through 144 weeks while only 3/33 were from VTCs. Fewer VTCs subjects (as compared to those with non-clustering virus had HIV-1 with resistance-associated mutations or experienced virologic failure during the course of the study. Our analysis shows specific geographical and drug resistance trends that correlate well with transmission clusters defined by HIV sequences of similarity

Early nucleoside reverse transcriptase inhibitors for the treatment of HIV: a brief history of stavudine (D4T) and its comparison with other dideoxynucleosides.

Science.gov (United States)

Martin, John C; Hitchcock, Michael J M; De Clercq, Erik; Prusoff, William H

2010-01-01

The occasion of this 25th anniversary issue encouraged us to reminisce about the important history of the discovery of the dideoxynucleoside analogues for the treatment of HIV/AIDS and to chronicle our thoughts about a particular exciting and rewarding period of our scientific careers. Following the identification of the anti-HIV activity of zidovudine (AZT), we participated in the urgent quest to discover optimal treatments of HIV infection and AIDS. A number of previously synthesized nucleoside analogues were comparatively evaluated, and stavudine (D4T) emerged as a promising candidate for development. Following clinical evaluation, D4T became a mainstay of the initial antiretroviral combination therapy, prolonging and saving numerous lives. It has only recently been supplanted by better-tolerated treatments. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

Science.gov (United States)

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

Second-line failure and first experience with third-line antiretroviral therapy in Mumbai, India

Directory of Open Access Journals (Sweden)

Samsuddin Khan

2014-07-01

Full Text Available Background: There are limited data on the failure of second-line antiretroviral therapy (ART and the use of third-line ART in people living with HIV in resource-limited settings. Since 2011, the Médecins Sans Frontières (MSF HIV/tuberculosis programme in Mumbai, India, has been providing third-line ART to patients in care. Objective: To describe the experiences and programmatic challenges during management of suspected second-line ART failure and third-line ART therapy for patients living with HIV, including the use of HIV viral load (VL testing. Design: This was a retrospective, observational cohort study of patients with suspected second-line ART treatment failure, who were followed for at least 12 months between January 2011 and March 2014. Results: A total of 47 patients with suspected second-line failure met the inclusion criteria during the study period. Twenty-nine of them (62% responded to enhanced adherence support, had a subsequent undetectable VL after a median duration of 3 months and remained on second-line ART. The other 18 patients had to be initiated on a third-line ART regimen, which consisted of darunavir–ritonavir, raltegravir, and one or more appropriate nucleoside or nucleotide reverse transcriptase inhibitors, based on the results of HIV genotype testing. Of the 13 patients for whom follow-up VL results were available, 11 achieved virological suppression after a median duration of 3 months on third-line ART (interquartile range: 2.5–3.0. No serious treatment-related adverse events were recorded. Conclusions: With intensive counselling and adherence support in those suspected of failing second-line ART, unnecessary switching to more expensive third-line ART can be averted in the majority of cases. However, there is an increasing need for access to third-line ART medications such as darunavir and raltegravir, for which national ART programmes should be prepared. The cost of such medications and inadequate access to VL

Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives.

Science.gov (United States)

Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano

2005-01-13

Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

Antiretroviral treatment switch strategies for lowering the costs of antiretroviral therapy in subjects with suppressed HIV-1 viremia in Spain

Directory of Open Access Journals (Sweden)

Llibre JM

2013-05-01

Full Text Available Josep M Llibre,1,2 Gloria Cardona,3 José R Santos,2 Angels Andreu,3 Josep O Estrada,4 Jordi Ara,4 Xavier Bonafont,3 Bonaventura Clotet1,21HIV Unit, University Hospital Germans Trias i Pujol, Badalona, Barcelona, Spain; 2Lluita contra la SIDA Foundation, Badalona, Barcelona, Spain; 3Hospital Pharmacy, University Hospital Germans Trias i Pujol, Badalona, Barcelona, Spain; 4Hospital Management, University Hospital Germans Trias i Pujol, Badalona, Barcelona, SpainBackground: The current economic recession in European countries has forced governments to design emergency measures to reduce spending on drugs, including antiretroviral therapy (ART. Switching antiretroviral drugs for others that have the same efficacy and safety profile at a lower cost (cost-reduction measures, CRM could prove to be a valid means of generating savings.Methods: Descriptive study of prospective consensus-based CRM undertaken in 2011 in a Catalonian hospital HIV unit among patients with prolonged plasma HIV-1 RNA <50 copies/mL.Results: During the study period, we made 673 switches (87.5% more than the previous year, of which 378 (56.2% were CRM (16% of all patients treated, leading to a savings of €87,410/month. Switching tenofovir/emtricitabine for abacavir/lamivudine was the most common CRM (129, 31.3%, followed by simplification to boosted protease inhibitor monotherapy (bPImono, 102, 26%. The CRM that generated the greatest saving were switching to bPImono (38%, withdrawal or replacement of raltegravir (24%, switching tenofovir/emtricitabine for abacavir/lamivudine (13%, and switching to nevirapine (5%. Cost savings with CRM were slightly higher than those achieved with medication paid for by clinical trial sponsors (€80,333/month or through discount arrangements (€76,389/month.Conclusion: Proactively switching antiretroviral therapy in selected treated patients with sustained virological suppression can generate significant cost savings in pharmacy spending in

Effect of the scale inhibitor on ion content in reverse osmosis system for seawater desalination

Science.gov (United States)

Gao, Yuhua; Liu, Zhenfa; Zhang, Lihui; Li, Haihua

2017-09-01

A scale inhibitor was synthesized from polysuccinimide with 2-aminoethanesulfonic acid and aspartic acid. The effect of scale inhibitor on ion content in reverse osmosis system for seawater desalination was studied. The results showed that the ion content of permeate water is lower with the scale inhibitor added in RO system for seawater desalination than without scale inhibitor. On the contrary, the ion content of concentrate water is higher when with scale inhibitor in RO system.

Guidelines for using antiretroviral agents among HIV-infected adults and adolescents.

Science.gov (United States)

Dybul, Mark; Fauci, Anthony S; Bartlett, John G; Kaplan, Jonathan E; Pau, Alice K

2002-09-03

, treatment should be offered to persons who have 55,000 copies/mL (by b-deoxyribonucleic acid [bDNA] or reverse transcriptase-polymerase chain reaction [RT-PCR] assays). The recommendation to treat asymptomatic patients should be based on the willingness and readiness of the person to begin therapy; the degree of existing immunodeficiency as determined by the CD4+ T cell count; the risk for disease progression as determined by the CD4+ T cell count and level of plasma HIV RNA; the potential benefits and risks of initiating therapy in an asymptomatic person; and the likelihood, after counseling and education, of adherence to the prescribed treatment regimen. Treatment goals should be maximal and durable suppression of viral load, restoration and preservation of immunologic function, improvement of quality of life, and reduction of HIV-related morbidity and mortality. Results of therapy are evaluated through plasma HIV RNA levels, which are expected to indicate a 1.0 log10 decrease at 2-8 weeks and no detectable virus (<50 copies/mL) at 4-6 months after treatment initiation. Failure of therapy at 4-6 months might be ascribed to nonadherence, inadequate potency of drugs or suboptimal levels of antiretroviral agents, viral resistance, and other factors that are poorly understood. Patients whose therapy fails in spite of a high level of adherence to the regimen should have their regimen changed; this change should be guided by a thorough drug treatment history and the results of drug-resistance testing. Because of limitations in the available alternative antiretroviral regimens that have documented efficacy, optimal changes in therapy might be difficult to achieve for patients in whom the preferred regimen has failed. These decisions are further confounded by problems with adherence, toxicity, and resistance. For certain patients, participating in a clinical trial with or without access to new drugs or using a regimen that might not achieve complete suppression of viral

Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

Science.gov (United States)

Ngai, Patrick H K; Ng, T B

2003-11-14

From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

The successes and failures of HIV drug discovery.

Science.gov (United States)

Hashimoto, Chie; Tanaka, Tomohiro; Narumi, Tetsuo; Nomura, Wataru; Tamamura, Hirokazu

2011-10-01

To date, several anti-human immunodeficiency virus (HIV) drugs, including reverse transcriptase inhibitors and protease inhibitors, have been developed and used clinically for the treatment of patients infected with HIV. Recently, novel drugs have been discovered which have different mechanisms of action from those of the above inhibitors, including entry inhibitors and integrase (IN) inhibitors; the clinical use of three of these inhibitors has been approved. Other inhibitors are still in development. This review article summarizes the history of the development of anti-HIV drugs and also focuses on successes in the development of these entry and IN inhibitors, along with looking at exploratory approaches for the development of other inhibitors. Currently used highly active antiretroviral therapy can be subject to a loss of efficacy, due to the emergence of multi-drug resistant (MDR) strains; a change of regimens of the drug combination is required to combat this, along with careful monitoring of the virus and CD4 in the blood, by methods such as cellular tropism testing. In such a situation, entry inhibitors such as CCR5/CXCR4 antagonists, CD4 mimics, fusion inhibitors and IN inhibitors might be optional agents for an expansion of the drug repertoire available to patients at all stages of HIV infection.

Raltegravir: first in class HIV integrase inhibitor

Directory of Open Access Journals (Sweden)

Zelalem Temesgen

2008-06-01

Full Text Available Zelalem Temesgen1, Dawd S Siraj21Mayo Clinic, Rochester, MN, USA; 2East Carolina University Greenville, NC, USAAbstract: On October 16, 2007, the US Food and Drug Administration (FDA approved raltegravir for treatment of human immunodeficiency virus (HIV-1 infection in combination with other antiretroviral agents in treatment-experienced adult patients who have evidence of viral replication and HIV-1 strains resistant to multiple antiretroviral agents. Raltegravir is first in a novel class of antiretroviral drugs known as integrase inhibitors. It has demonstrated potent anti HIV activity in both antiretroviral treatment-naïve and experienced patients. The most common adverse events reported with raltegravir during phase 2 and 3 clinical trials were diarrhea, nausea, and headache. Laboratory abnormalities include mild elevations in liver transaminases and creatine phosphokinase.Keywords: raltegravir, HIV, antiretroviral agents, integrase inhibitors

Surveillance of transmitted antiretroviral drug resistance among HIV-1 infected women attending antenatal clinics in Chitungwiza, Zimbabwe.

Directory of Open Access Journals (Sweden)

Mqondisi Tshabalala

Full Text Available The rapid scale-up of highly active antiretroviral therapy (HAART and use of single dose Nevirapine (SD NVP for prevention of mother-to-child transmission (pMTCT have raised fears about the emergence of resistance to the first line antiretroviral drug regimens. A cross-sectional study was conducted to determine the prevalence of primary drug resistance (PDR in a cohort of young (<25 yrs HAART-naïve HIV pregnant women attending antenatal clinics in Chitungwiza, Zimbabwe. Whole blood was collected in EDTA for CD4 counts, viral load, serological estimation of duration of infection using the BED Calypte assay and genotyping for drug resistance. Four hundred and seventy-one women, mean age 21 years; SD: 2.1 were enrolled into the study between 2006 and 2007. Their median CD4 count was 371cells/µL; IQR: 255-511 cells/µL. Two hundred and thirty-six samples were genotyped for drug resistance. Based on the BED assay, 27% were recently infected (RI whilst 73% had long-term infection (LTI. Median CD4 count was higher (p<0.05 in RI than in women with LTI. Only 2 women had drug resistance mutations; protease I85V and reverse transcriptase Y181C. Prevalence of PDR in Chitungwiza, 4 years after commencement of the national ART program remained below WHO threshold limit (5%. Frequency of recent infection BED testing is consistent with high HIV acquisition during pregnancy. With the scale-up of long-term ART programs, maintenance of proper prescribing practices, continuous monitoring of patients and reinforcement of adherence may prevent the acquisition and transmission of PDR.

New subtypes and genetic recombination in HIV type 1-infecting patients with highly active antiretroviral therapy in Peru (2008-2010).

Science.gov (United States)

Yabar, Carlos Augusto; Acuña, Maribel; Gazzo, Cecilia; Salinas, Gabriela; Cárdenas, Fanny; Valverde, Ada; Romero, Soledad

2012-12-01

HIV-1 subtype B is the most frequent strain in Peru. However, there is no available data about the genetic diversity of HIV-infected patients receiving highly active antiretroviral therapy (HAART) here. A group of 267 patients in the Peruvian National Treatment Program with virologic failure were tested for genotypic evidence of HIV drug resistance at the Instituto Nacional de Salud (INS) of Peru between March 2008 and December 2010. Viral RNA was extracted from plasma and the segments of the protease (PR) and reverse transcriptase (RT) genes were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), purified, and fully sequenced. Consensus sequences were submitted to the HIVdb Genotypic Resistance Interpretation Algorithm Database from Stanford University, and then aligned using Clustal X v.2.0 to generate a phylogenetic tree using the maximum likelihood method. Intrasubtype and intersubtype recombination analyses were performed using the SCUEAL program (Subtype Classification by Evolutionary ALgo-rithms). A total of 245 samples (91%) were successfully genotyped. The analysis obtained from the HIVdb program showed 81.5% resistance cases (n=198). The phylogenetic analysis revealed that subtype B was predominant in the population (98.8%), except for new cases of A, C, and H subtypes (n=4). Of these cases, only subtype C was imported. Likewise, recombination analysis revealed nine intersubtype and 20 intrasubtype recombinant cases. This is the first report of the presence of HIV-1 subtypes C and H in Peru. The introduction of new subtypes and circulating recombinants forms can make it difficult to distinguish resistance profiles in patients and consequently affect future treatment strategies against HIV in this country.

A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

Science.gov (United States)

Li, An; Ziehr, Jessica L; Johnson, Kenneth A

2017-04-21

Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Avances recientes en VIH/SIDA: Terapia antiretroviral.

Directory of Open Access Journals (Sweden)

Ernesto Scerpella

1997-01-01

Full Text Available Recent advances in our understanding of HIV infection in patients with the acquired immunodeficiency syndrome (AIDS are leading us to explore new treatment strategies, including the use of combination antiretroviral therapy. In this review, we present information from recently completed clinical trials explore the use of combination therapy, including ACTG 175, the Delta studies, and the NUCA studies. In addition, we present preliminary about use of protease inhibitors, the newest class of antiretrovirals. (Rev Med Hered 1997; 8: 23-31.

Impact of Antiretroviral Regimens on CSF Viral Escape in a Prospective Multicohort Study of ART-Experienced HIV-1 Infected Adults in the United States.

Science.gov (United States)

Mukerji, Shibani S; Misra, Vikas; Lorenz, David R; Uno, Hajime; Morgello, Susan; Franklin, Donald; Ellis, Ronald J; Letendre, Scott; Gabuzda, Dana

2018-04-03

Cerebrospinal fluid (CSF) viral escape occurs in 4-20% of HIV-infected adults, yet the impact of antiretroviral therapy (ART) on CSF escape is unclear. Prospective study of 1063 participants with baseline plasma viral load (VL) ≤400 copies/ml between 2005-2016. Odds ratio for ART regimens (PI with nucleoside reverse transcriptase inhibitor [PI+NRTI] versus other ART) and CSF escape was estimated using mixed-effects models. Drug resistance mutation frequencies were calculated. Baseline mean age was 46, median plasma VL, CD4 nadir, and CD4 count were 50 copies/mL, 88 cells/μL, and 424 cells/μL, respectively; 48% on PI+NRTI, 33% on non-NRTI, and 6% on integrase inhibitors. During median follow-up of 4.4 years, CSF escape occurred in 77 participants (7.2%). PI+NRTI use was an independent predictor of CSF escape (OR 3.1 [95% CI 1.8-5.0]) in adjusted analyses and models restricted to plasma VL ≤50 copies/ml (pCSF viral escape than non-ATV PI+NRTI regimens. Plasma and CSF M184V/I combined with thymidine-analog mutations were more frequent in CSF escape versus no escape (23% vs. 2.3%). Genotypic susceptibility score-adjusted CNS penetration-effectiveness (CPE) values were calculated for CSF escape with M184V/I mutations (n=34). Adjusted CPE values were low (CSF and plasma in 27 (79%) and 13 (38%), respectively, indicating suboptimal CNS drug availability. PI+NRTI regimens are independent predictors of CSF escape in HIV-infected adults. Reduced CNS ART bioavailability may predispose to CSF escape in patients with M184V/I mutations. Optimizing ART regimens may reduce risk of CSF escape.

Effect of Cobicistat on Tenofovir Disoproxil Fumarate (TDF): What Is True for TAF May Also Be True for TDF.

Science.gov (United States)

Cattaneo, Dario; Minisci, Davide; Baldelli, Sara; Mazzali, Cristina; Giacomelli, Andrea; Milazzo, Laura; Meraviglia, Paola; Resnati, Chiara; Rizzardini, Giuliano; Clementi, Emilio; Galli, Massimo; Gervasoni, Cristina

2018-01-01

The dose of tenofovir alafenamide is reduced from 25 to 10 mg daily when given with boosting agents. However, such dose reduction has never been adopted for tenofovir disoproxil fumarate (TDF). In this study, we aim to quantify the effect of cobicistat (COBI) both on tenofovir concentrations and TDF durability in real life setting. HIV-positive patients receiving TDF-containing antiretroviral therapies with at least 1 assessment of tenofovir plasma trough concentrations were included in the study. Univariate and multivariate regression analyses were performed considering tenofovir concentration as the dependent variable and clinical characteristics as independent covariates. Subsequently, survival and Cox analyses were performed considering as the primary outcome TDF discontinuation for any reasons. Patients were given TDF with protease inhibitors/ritonavir (n = 212), non-nucleoside reverse transcriptase inhibitors (n = 176), integrase inhibitors (dolutegravir or raltegravir, n = 46), or with elvitegravir/COBI (ELV/COBI) (n = 76). By multivariate analysis, concomitant antiretroviral therapies resulted significantly associated with tenofovir levels, with the highest drug concentrations measured in patients given ELV/COBI. By survival analysis, we found that patients given TDF with ELV/COBI had the lowest rate of drug durability. Overall, these patients had a 2.3-fold increased risk to experience TDF discontinuation. Coadministration with COBI resulted in significantly higher tenofovir concentrations and higher TDF discontinuation compared with other antiretroviral regimens. Accordingly, the possibility that the lack of proper dose adjustment for TDF when given with COBI might have biased the safety comparisons with tenofovir alafenamide during registrative trials cannot be ruled out.

Nanoparticle-based drug delivery to improve the efficacy of antiretroviral therapy in the central nervous system

Directory of Open Access Journals (Sweden)

Gomes MJ

2014-04-01

Full Text Available Maria João Gomes,1 José das Neves,1,2 Bruno Sarmento1,2 1Instituto de Engenharia Biomédica (INEB, Porto, Portugal; 2Instituto de Investigação e Formação Avançada em Ciências e Tecnologias da Saúde (IINFACTS, Instituto Superior de Ciências da Saúde-Norte, CESPU, Gandra, Portugal Abstract: Antiretroviral drug therapy plays a cornerstone role in the treatment of human immunodeficiency virus (HIV/acquired immunodeficiency syndrome patients. Despite obvious advances over the past 3 decades, new approaches toward improved management of infected individuals are still required. Drug distribution to the central nervous system (CNS is required in order to limit and control viral infection, but the presence of natural barrier structures, in particular the blood–brain barrier, strongly limits the perfusion of anti-HIV compounds into this anatomical site. Nanotechnology-based approaches may help providing solutions for antiretroviral drug delivery to the CNS by potentially prolonging systemic drug circulation, increasing the crossing and reducing the efflux of active compounds at the blood–brain barrier, and providing cell/tissue-targeting and intracellular drug delivery. After an initial overview on the basic features of HIV infection of the CNS and barriers to active compound delivery to this anatomical site, this review focuses on recent strategies based on antiretroviral drug-loaded solid nanoparticles and drug nanosuspensions for the potential management of HIV infection of the CNS. Keywords: HIV/AIDS, blood–brain barrier, protease inhibitors, efflux transporters, drug targeting

Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA.

Science.gov (United States)

Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin

2010-01-01

The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

International Nuclear Information System (INIS)

Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

2008-01-01

Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

High prevalence of HIV-1 transmitted drug-resistance mutations from proviral DNA massively parallel sequencing data of therapy-naïve chronically infected Brazilian blood donors.

Directory of Open Access Journals (Sweden)

Rodrigo Pessôa

Full Text Available An improved understanding of the prevalence of low-abundance transmitted drug-resistance mutations (TDRM in therapy-naïve HIV-1-infected patients may help determine which patients are the best candidates for therapy. In this study, we aimed to obtain a comprehensive picture of the evolving HIV-1 TDRM across the massive parallel sequences (MPS of the viral entire proviral genome in a well-characterized Brazilian blood donor naïve to antiretroviral drugs.The MPS data from 128 samples used in the analysis were sourced from Brazilian blood donors and were previously classified by less-sensitive (LS or "detuned" enzyme immunoassay as non-recent or longstanding HIV-1 infections. The Stanford HIV Resistance Database (HIVDBv 6.2 and IAS-USA mutation lists were used to interpret the pattern of drug resistance. The minority variants with TDRM were identified using a threshold of ≥ 1.0% and ≤ 20% of the reads sequenced. The rate of TDRM in the MPS data of the proviral genome were compared with the corresponding published consensus sequences of their plasma viruses.No TDRM were detected in the integrase or envelope regions. The overall prevalence of TDRM in the protease (PR and reverse transcriptase (RT regions of the HIV-1 pol gene was 44.5% (57/128, including any mutations to the nucleoside analogue reverse transcriptase inhibitors (NRTI and non-nucleoside analogue reverse transcriptase inhibitors (NNRTI. Of the 57 subjects, 43 (75.4% harbored a minority variant containing at least one clinically relevant TDRM. Among the 43 subjects, 33 (76.7% had detectable minority resistant variants to NRTIs, 6 (13.9% to NNRTIs, and 16 (37.2% to PR inhibitors. The comparison of viral sequences in both sources, plasma and cells, would have detected 48 DNA provirus disclosed TDRM by MPS previously missed by plasma bulk analysis.Our findings revealed a high prevalence of TDRM found in this group, as the use of MPS drastically increased the detection of these

HIV type-1 genotypic resistance profiles in vertically infected patients from Argentina reveal an association between K103N+L100I and L74V mutations.

Science.gov (United States)

Aulicino, Paula C; Rocco, Carlos A; Mecikovsky, Debora; Bologna, Rosa; Mangano, Andrea; Sen, Luisa

2010-01-01

Patterns and pathways of HIV type-1 (HIV-1) antiretroviral (ARV) drug resistance-associated mutations in clinical isolates are conditioned by ARV history and factors such as viral subtype and fitness. Our aim was to analyse the frequency and association of ARV drug resistance mutations in a group of long-term vertically infected patients from Argentina. Plasma samples from 71 patients (38 children and 33 adolescents) were collected for genotypic HIV-1 ARV resistance testing during the period between February 2006 and October 2008. Statistically significant pairwise associations between ARV resistance mutations in pol, as well as associations between mutations and drug exposure, were identified using Fisher's exact tests with Bonferroni and false discovery rate corrections. Phylogenetic analyses were performed for subtype assignment. In protease (PR), resistance-associated mutations M46I/L, I54M/L/V/A/S and V82A/F/T/S/M/I were associated with each other and with minor mutations at codons 10, 24 and 71. Mutations V82A/F/T/S/M/I were primarily selected by the administration of ritonavir (RTV) in an historical ARV regimen. In reverse transcriptase, thymidine analogue mutation (TAM)1 profile was more common than TAM2. The non-nucleoside K103N+L100I mutations were observed at high frequency (15.5%) and were significantly associated with the nucleoside mutation L74V in BF recombinants. Associations of mutations at PR sites reflect the frequent use of RTV at an early time in this group of patients and convergent resistance mechanisms driven by the high exposure to protease inhibitors, as well as local HIV-1 diversity. The results provide clinical evidence of a molecular interaction between K103N+L100I and L74V mutations at the reverse transcriptase gene in vivo, limiting the future use of second-generation non-nucleoside reverse transcriptase inhibitors such as etravirine.

HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia.

Science.gov (United States)

Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick C K; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher K C; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

2014-01-01

First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance - Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥ 2 TAMs; or M184V+≥ 1 TAM. Virological suppression was defined as viral load (VL) failure and (2) factors associated with virological suppression after 12 months on second-line. A total of 105 patients from 10 sites in Thailand, Hong Kong, Indonesia, Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥ 1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥ 2 TAMs; and 32 with M184V+≥ 1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤ 200 cells/µL at genotyping (OR=4.43, 95% CI [1.59-12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39-16.36], pfailure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving virological response. This emphasizes the importance of continued adherence counselling well into second-line therapy.

Full Viral Suppression, Low-Level Viremia, and Quantifiable Plasma HIV-RNA at the End of Pregnancy in HIV-Infected Women on Antiretroviral Treatment.

Science.gov (United States)

Baroncelli, Silvia; Pirillo, Maria F; Tamburrini, Enrica; Guaraldi, Giovanni; Pinnetti, Carmela; Degli Antoni, Anna; Galluzzo, Clementina M; Stentarelli, Chiara; Amici, Roberta; Floridia, Marco

2015-07-01

There is limited information on full viral suppression and low-level HIV-RNA viremia in HIV-infected women at the end of pregnancy. We investigated HIV-RNA levels close to delivery in women on antiretroviral treatment in order to define rates of complete suppression, low-level viremia, and quantifiable HIV-RNA, exploring as potential determinants some clinical and viroimmunological variables. Plasma samples from a national study in Italy, collected between 2003 and 2012, were used. According to plasma HIV-RNA levels, three groups were defined: full suppression (target not detected), low-level viremia (target detected but HIV-RNA (≥37 copies/ml). Multivariable logistic regression was used to define determinants of full viral suppression and of quantifiable HIV-RNA. Among 107 women evaluated at a median gestational age of 35 weeks, 90 (84.1%) had HIV-RNA HIV-RNA was 109 copies/ml (IQR 46-251), with only one case showing resistance (mutation M184V; rate: 9.1%). In multivariable analyses, women with higher baseline HIV-RNA levels and with hepatitis C virus (HCV) coinfection were significantly more likely to have quantifiable HIV-RNA in late pregnancy. Full viral suppression was significantly more likely with nonnucleoside reverse transcriptase inhibitor (NNRTI)-based regimens and significantly less likely with higher HIV-RNA in early pregnancy. No cases of HIV transmission occurred. In conclusion, HIV-infected pregnant women showed a high rate of viral suppression and a low resistance rate before delivery. In most cases no target HIV-RNA was detected in plasma, suggesting a low risk of subsequent virological rebound and development of resistance. Women with high levels of HIV-RNA in early pregnancy and those who have concomitant HCV infection should be considered at higher risk of having quantifiable HIV-RNA at the end of pregnancy.

Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen

Directory of Open Access Journals (Sweden)

Colebunders Robert

2010-11-01

Full Text Available Abstract Background Vitamin D is an important determinant of bone health and also plays a major role in the regulation of the immune system. Interestingly, vitamin D status before the start of highly active antiretroviral therapy (HAART has been recently associated with HIV disease progression and overall mortality in HIV-positive pregnant women. We prospectively studied vitamin D status in HIV individuals on HAART in Belgium. We selected samples from HIV-positive adults starting HAART with a pre-HAART CD4 T-cell count >100 cells/mm3 followed up for at least 12 months without a treatment change. We compared 25-hydroxyvitamin D plasma [25-(OHD] concentration in paired samples before and after 12 months of HAART. 25-(OHD levels are presented using two different cut-offs: Results Vitamin D deficiency was common before HAART, the frequency of plasma 25-(OHD concentrations below 20 ng/ml and 30 below ng/ml was 43.7% and 70.1% respectively. After 12 months on HAART, the frequency increased to 47.1% and 81.6%. HAART for 12 months was associated with a significant decrease of plasma 25-(OHD concentration (p = 0.001. Decreasing plasma 25-(OHD concentration on HAART was associated in the multivariate model with NNRTI-based regimen (p = 0.001 and lower body weight (p = 0.008. Plasma 25-(OHD concentrations decreased significantly in both nevirapine and efavirenz-containing regimens but not in PI-treated patients. Conclusions Vitamin D deficiency is frequent in HIV-positive individuals and NNRTI therapy further decreases 25-(OHD concentrations. Consequently, vitamin D status need to be checked regularly in all HIV-infected patients and vitamin D supplementation should be given when needed.

HIV-associated Lipodystrophy Syndrome: A Review of Clinical Aspects

Directory of Open Access Journals (Sweden)

Jean-Guy Baril

2005-01-01

Full Text Available Approximately two years after the introduction of highly active antiretroviral therapy for the treatment of HIV infection, body shape changes and metabolic abnormalities were increasingly observed. Initially, these were ascribed to protease inhibitors, but it is now clear that nucleoside reverse transcriptase inhibitors also contribute to lipodystrophy syndrome. The syndrome groups together clinical conditions describing changes in body fat distribution that include lipoatrophy, lipoaccumulation or both. However, there does not appear to be a direct link between lipoatrophy and lipoaccumulation that would support a single mechanism for the redistribution of body fat. Currently, there is no clear definition of lipodystrophy, which explains the difficulty in determining its prevalence and etiology. There are no current guidelines for the treatment of fat distribution abnormalities that occur in the absence of other metabolic complications. The present article reviews the current state of knowledge of the definition, symptoms, risk factors, pathogenesis, diagnosis and treatment of the morphological changes associated with lipodystrophy syndrome.

HIV-associated lipodystrophy syndrome: A review of clinical aspects

Science.gov (United States)

Baril, Jean-Guy; Junod, Patrice; LeBlanc, Roger; Dion, Harold; Therrien, Rachel; Laplante, François; Falutz, Julian; Côté, Pierre; Hébert, Marie-Nicole; Lalonde, Richard; Lapointe, Normand; Lévesque, Dominic; Pinault, Lyse; Rouleau, Danielle; Tremblay, Cécile; Trottier, Benoît; Trottier, Sylvie; Tsoukas, Chris; Weiss, Karl

2005-01-01

Approximately two years after the introduction of highly active antiretroviral therapy for the treatment of HIV infection, body shape changes and metabolic abnormalities were increasingly observed. Initially, these were ascribed to protease inhibitors, but it is now clear that nucleoside reverse transcriptase inhibitors also contribute to lipodystrophy syndrome. The syndrome groups together clinical conditions describing changes in body fat distribution that include lipoatrophy, lipoaccumulation or both. However, there does not appear to be a direct link between lipoatrophy and lipoaccumulation that would support a single mechanism for the redistribution of body fat. Currently, there is no clear definition of lipodystrophy, which explains the difficulty in determining its prevalence and etiology. There are no current guidelines for the treatment of fat distribution abnormalities that occur in the absence of other metabolic complications. The present article reviews the current state of knowledge of the definition, symptoms, risk factors, pathogenesis, diagnosis and treatment of the morphological changes associated with lipodystrophy syndrome. PMID:18159551

Genotypic Characterization of Human Immunodeficiency Virus Type 1 Derived from Antiretroviral Drug-Treated Individuals Residing in Earthquake-Affected Areas in Nepal.

Science.gov (United States)

Negi, Bharat Singh; Kotaki, Tomohiro; Joshi, Sunil Kumar; Bastola, Anup; Nakazawa, Minato; Kameoka, Masanori

2017-09-01

Molecular epidemiological data on human immunodeficiency virus type 1 (HIV-1) are limited in Nepal and have not been available in areas affected by the April 2015 earthquake. Therefore, we conducted a genotypic study on HIV-1 genes derived from individuals on antiretroviral therapy residing in 14 districts in Nepal highly affected by the earthquake. HIV-1 genomic fragments were amplified from 40 blood samples of HIV treatment-failure individuals, and a sequencing analysis was performed on these genes. In the 40 samples, 29 protease, 32 reverse transcriptase, 25 gag, and 21 env genes were sequenced. HIV-1 subtyping revealed that subtype C (84.2%, 32/38) was the major subtype prevalent in the region, while CRF01_AE (7.9%, 3/38) and other recombinant forms (7.9%, 3/38) were also detected. In addition, major drug resistance mutations were identified in 21.9% (7/32) of samples, indicating the possible emergence of HIV-1 drug resistance in earthquake-affected areas in Nepal.

Basic science and pathogenesis of ageing with HIV: potential mechanisms and biomarkers.

Science.gov (United States)

Lagathu, Claire; Cossarizza, Andrea; Béréziat, Véronique; Nasi, Milena; Capeau, Jacqueline; Pinti, Marcello

2017-06-01

: The increased prevalence of age-related comorbidities and mortality is worrisome in ageing HIV-infected patients. Here, we aim to analyse the different ageing mechanisms with regard to HIV infection. Ageing results from the time-dependent accumulation of random cellular damage. Epigenetic modifications and mitochondrial DNA haplogroups modulate ageing. In antiretroviral treatment-controlled patients, epigenetic clock appears to be advanced, and some haplogroups are associated with HIV infection severity. Telomere shortening is enhanced in HIV-infected patients because of HIV and some nucleoside analogue reverse transcriptase inhibitors. Mitochondria-related oxidative stress and mitochondrial DNA mutations are increased during ageing and also by some nucleoside analogue reverse transcriptase inhibitors. Overall, increased inflammation or 'inflammageing' is a major driver of ageing and could result from cell senescence with secreted proinflammatory mediators, altered gut microbiota, and coinfections. In HIV-infected patients, the level of inflammation and innate immunity activation is enhanced and related to most comorbidities and to mortality. This status could result, in addition to age, from the virus itself or viral protein released from reservoirs, from HIV-enhanced gut permeability and dysbiosis, from antiretroviral treatment, from frequent cytomegalovirus and hepatitis C virus coinfections, and also from personal and environmental factors, as central fat accumulation or smoking. Adaptive immune activation and immunosenescence are associated with comorbidities and mortality in the general population but are less predictive in HIV-infected patients. Biomarkers to evaluate ageing in HIV-infected patients are required. Numerous systemic or cellular inflammatory, immune activation, oxidative stress, or senescence markers can be tested in serum or peripheral blood mononuclear cells. The novel European Study to Establish Biomarkers of Human Ageing MARK

Dissimilarities in the metabolism of antiretroviral drugs used in HIV pre-exposure prophylaxis in colon and vagina tissues.

Science.gov (United States)

To, Elaine E; Hendrix, Craig W; Bumpus, Namandjé N

2013-10-01

Attempts to prevent HIV infection through pre-exposure prophylaxis (PrEP) include topical application of anti-HIV drugs to the mucosal sites of infection; however, a potential role for local drug metabolizing enzymes in modulating the exposure of the mucosal tissues to these drugs has yet to be explored. Here we present the first report that enzymes belonging to the cytochrome P450 (CYP) and UDP-glucuronosyltransferase (UGT) families of drug metabolizing enzymes are expressed and active in vaginal and colorectal tissue using biopsies collected from healthy volunteers. In doing so, we discovered that dapivirine and maraviroc, a non-nucleoside reverse transcriptase inhibitor and an entry inhibitor currently in development as microbicides for HIV PrEP, are differentially metabolized in colorectal tissue and vaginal tissue. Taken together, these data should help to guide the optimization of small molecules being developed for HIV PrEP. Copyright © 2013 Elsevier Inc. All rights reserved.

Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

Science.gov (United States)

Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

2013-05-01

To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies.

Science.gov (United States)

Gnanasekaran, Ramachandran

2017-11-08

We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

Science.gov (United States)

Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

2010-01-01

Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

International Nuclear Information System (INIS)

Zhu Hanneng; Chen Wenying; Xiong Sidong

2000-01-01

Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

Relationship between antiretrovirals used as part of a cART regimen and CD4 count increases in patients with suppressed viremia

DEFF Research Database (Denmark)

Mocroft, A; Phillips, A; Ledergerber, B

2006-01-01

consecutive measurements with VL points according to nucleoside backbones and other antiretrovirals used. METHODS: Generalized linear models, accounting for multiple measurements within patients, were used to compare CD4 cell count changes after adjustment for antiretrovirals, time...... to the boosted-protease inhibitor regimen (n = 5915), use of an abacavir-based triple-nucleoside regimen was associated with a lower annual change in CD4 cell count (n = 2504 pairs; -26.1/microl; P = 0.011). CONCLUSIONS: A nucleoside backbone of zidovudine/lamivudine or any tenofovir-based backbone...... was associated with significantly poorer increases in CD4 cell count compared to a nucleoside backbone of stavudine/lamivudine, as was an abacavir-based triple nucleoside regimen compared to a boosted protease inhibitor regimen. Long-term studies are needed to determine whether the differences in immunological...

DNA-directed control of enzyme-inhibitor complex formation: a modular approach to reversibly switch enzyme activity

NARCIS (Netherlands)

Janssen, B.M.G.; Engelen, W.; Merkx, M.

2015-01-01

DNA-templated reversible assembly of an enzyme–inhibitor complex is presented as a new and highly modular approach to control enzyme activity. TEM1-ß-lactamase and its inhibitor protein BLIP were conjugated to different oligonucleotides, resulting in enzyme inhibition in the presence of template