Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko
2011-01-01
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.
HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors
DEFF Research Database (Denmark)
Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran
2017-01-01
BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles
International Nuclear Information System (INIS)
Bavand, M.R.; Laub, O.
1988-01-01
Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein
Immune pressure analysis of protease and reverse transcriptase ...
African Journals Online (AJOL)
/dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity
House, M.L.; Kim, C.H.; Reno, P.W.
1998-01-01
Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.
Wang, Shuwen; Zhu, Jiyue
2003-05-23
The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.
International Nuclear Information System (INIS)
Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.
1986-01-01
The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)
Directory of Open Access Journals (Sweden)
Su X
2016-11-01
Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?
Nolan, David
2005-01-01
Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.
Li, Runqin; Zhang, Yinglin
2016-01-01
Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632
Telomerase reverse transcriptase promoter mutations in bladder cancer
DEFF Research Database (Denmark)
Allory, Yves; Beukers, Willemien; Sagrera, Ana
2014-01-01
for detection of recurrences in urine in patients with urothelial bladder cancer (UBC). DESIGN, SETTING, AND PARTICIPANTS: A set of 111 UBCs of different stages was used to assess TERT promoter mutations by Sanger sequencing and TERT messenger RNA (mRNA) expression by reverse transcription...... surveillance after diagnosis of non-muscle-invasive UBC (n=194), was tested using a SNaPshot assay. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Association of mutation status with age, sex, tobacco, stage, grade, fibroblast growth factor receptor 3 (FGFR3) mutation, progression-free survival, disease...... frequent among FGFR3 mutant tumors (p=0.0002). There was no association between TERT mutations and mRNA expression (p=0.3). Mutations were not associated with clinical outcome. In urine, TERT mutations had 90% specificity in subjects with hematuria but no bladder tumor, and 73% in recurrence-free UBC...
Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.
Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari
2018-05-03
Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.
A second chance for telomerase reverse transcriptase in anticancer immunotherapy.
Zanetti, Maurizio
2017-02-01
Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.
Directory of Open Access Journals (Sweden)
Ana Luiza Chaves Valadão
2015-06-01
Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis
Reverse transcriptase inhibitors as microbicides.
Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido
2012-01-01
The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory
Directory of Open Access Journals (Sweden)
Edward J. Steele
2017-11-01
Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.
The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.
Zhao, Chen; Pyle, Anna Marie
2017-12-01
The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.
Collins, Kathleen; Nilsen, Timothy W
2013-08-01
Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.
Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel
1972-01-01
Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137
International Nuclear Information System (INIS)
Spadafora, C.; Sciamanna, I.; Misteli, T.
2009-01-01
Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.
Directory of Open Access Journals (Sweden)
Anna Figueiredo
2006-11-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-07-01
HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.
International Nuclear Information System (INIS)
Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.
2004-01-01
Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies
Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A
2013-11-01
Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.
DEFF Research Database (Denmark)
Lundgren, Jens
2008-01-01
BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...
Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase
DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami
2012-01-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Energy Technology Data Exchange (ETDEWEB)
Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)
2010-03-26
The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.
Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina
2013-01-01
The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma
Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...
Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification
Energy Technology Data Exchange (ETDEWEB)
Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P
2011-12-08
RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.
R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)
2013-01-01
textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the
DEFF Research Database (Denmark)
Borges, Álvaro H; Lundh, Andreas; Tendal, Britta
2016-01-01
BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...
Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M
2018-01-01
Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.
Reverse transcriptase inhibitors as potential colorectal microbicides.
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J
2009-05-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.
Sivan, Sree Kanth; Manga, Vijjulatha
2010-06-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.
Oude Essink, B. B.; Das, A. T.; Berkhout, B.
1995-01-01
Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA
DEFF Research Database (Denmark)
Kirk, Ole; Lundgren, Jens D; Pedersen, Court
2003-01-01
BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....
Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.
Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V
2011-12-20
Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.
Directory of Open Access Journals (Sweden)
Elisabeth Humphris-Narayanan
Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.
Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F
2008-10-01
Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
NMR structure of the HIV-1 reverse transcriptase thumb subdomain
Energy Technology Data Exchange (ETDEWEB)
Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)
2016-12-15
The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.
Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.
2004-01-01
Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add
Nicolas Sluis-Cremer
2014-01-01
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Directory of Open Access Journals (Sweden)
Ilaria eSciamanna
2016-02-01
Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado
2016-02-01
In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano
2017-01-17
Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.
Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †
Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.
2009-01-01
We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271
Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda
2016-01-01
Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2013-11-01
Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.
2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase
International Nuclear Information System (INIS)
Starnes, M.C.
1988-01-01
2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells
Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X
2002-12-01
Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.
Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.
Sharma, Mamta; Saravolatz, Louis D
2013-02-01
Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.
Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.
2015-01-01
BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2010-03-01
Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.
Directory of Open Access Journals (Sweden)
Dyah Ayu Hewajuli
2014-03-01
Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.
Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.
2010-01-01
Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved
Directory of Open Access Journals (Sweden)
Lucianna Helene Santos
2015-11-01
Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.
Directory of Open Access Journals (Sweden)
Liu Tiantian
2010-05-01
Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.
Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon
2015-08-01
The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription
Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.
Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E
2013-06-18
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.
2011-01-01
The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.
Directory of Open Access Journals (Sweden)
Dolores Bautista-España
Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.
Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S
2014-06-01
The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2008-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis
Directory of Open Access Journals (Sweden)
Ma Bi
2017-10-01
Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.
Czech Academy of Sciences Publication Activity Database
Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko
2016-01-01
Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016
Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M
2016-04-01
Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.
Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.
Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A
2011-01-01
We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.
Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J
2009-06-01
Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.
International Nuclear Information System (INIS)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki
2015-01-01
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)
2015-10-23
The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.
Directory of Open Access Journals (Sweden)
Weizi Liang
Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
Energy Technology Data Exchange (ETDEWEB)
Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)
2017-12-15
Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)
Directory of Open Access Journals (Sweden)
Lapadula Giuseppe
2007-05-01
Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C
2000-05-18
To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.
Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind
2014-04-01
A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats
Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin
2011-01-01
In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472
Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis
2010-01-01
Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948
International Nuclear Information System (INIS)
Ferkous, F.; Saihi, Y.
2018-01-01
Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)
Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells
Directory of Open Access Journals (Sweden)
Yong Teng
2014-02-01
Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.
I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)
2015-01-01
textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have
Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul
2004-01-01
The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Lescot, Magali
2015-11-27
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki
2015-01-01
Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.
Directory of Open Access Journals (Sweden)
Oluwafeyisetan O. Adebiyi
2015-12-01
Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.
Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X
2014-07-01
Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.
TERT promoter mutations are highly recurrent in SHH subgroup medulloblastoma
M. Remke (Marc); E.A. Ramaswamy; M. Peacock (Munro); D.J.H. Shih (David J.); C. Koelsche (Christian); P.A. Northcott (Paul A.); N. Hill (Nadia); S. Cavalli (Silvia); M. Kool (Marcel); X. Wang (Xin); S. Mack (Stephen); M. Barszczyk (Mark); A.S. Morrissy (A. Sorana); X. Wu (Xiaochong); S. Agnihotri (Sameer); P. Luu (Phan); D. Jones (David); L. Garzia (Livia); A.M. Dubuc (Adrian); N. Zhukova (Nataliya); R. Vanner (Robert); J.M. Kros (Johan); P.J. French (Pim); E.G. van Meir (Erwin); R. Vibhakar (Rajeev); K. Zitterbart (Karel); J.A. Chan (Jennifer); L. Bognár (László); A. Klekner (Almos); B. Lach (Boleslaw); S. Jung (Shin); F. Saad (Fred); L.M. Liau (Linda); S. Albrecht (Steffen); M. Zollo (Maurizio); M.K. Cooper (Michael); R.C. Thompson (Reid); O. Delattre (Olivier); F. Bourdeaut (Franck); F.F. Doz (François); M. Garami (Miklós); P. Hauser (Peter); C.G. Carlotti (Carlos); T.E. Van Meter (Timothy); L. Massimi (Luca); D. Fults (Daniel); L.W. Pomeroy (Laura); T. Kumabe (Toshiro); Y.S. Ra (Young Shin); J.R. Leonard (Jeffrey); S.K. Elbabaa (Samer); J. Mora (Jaume); J.B. Rubin (Joshua); Y.-J. Cho (Yoon-Jae); R.E. McLendon (Roger); D.D. Bigner (Darell); C.G. Eberhart (Charles); M. Fouladi (Maryam); R.J. Wechsler-Reya (Robert); R. Faria (Rui); S.E. Croul (Sidney); A. Huang (Anding); E. Bouffet (Eric); C.E. Hawkins (Cynthia); M. Dirks (Maaike); W.A. Weiss (William); U. Schüller (Ulrich); A. Pollack (Aaron); P. Rutkowski (Piotr); D. Meyronet (David); A. Jouvet (Anne); M. Fèvre-Montange (Michelle); N. Jabado (Nada); M. Perek-Polnik (Marta); W.A. Grajkowska (Wieslawa); S.-K. Kim (Seung-Ki); J.T. Rutka (James); E. Malkin (Elissa); U. Tabori (Uri); S.M. Pfister (Stefan); A. Korshunov (Andrey); A. von Deimling (Andreas); M.D. Taylor (Michael)
2013-01-01
textabstractTelomerase reverse transcriptase (TERT) promoter mutations were recently shown to drive telomerase activity in various cancer types, including medulloblastoma. However, the clinical and biological implications of TERT mutations in medulloblastoma have not been described. Hence, we sought
Directory of Open Access Journals (Sweden)
Gronenborn Angela M
2010-05-01
Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.
[Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].
Tarasova, O A; Filimonov, D A; Poroikov, V V
2017-10-01
Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.
Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.
2009-11-01
Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.
Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark
2013-11-01
BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.
Song, Yue; Xin, Xing; Xia, Zhijun; Zhai, Xingyue; Shen, Keng
2014-07-01
The objective of our study was to construct recombinant adenovirus (rAd) AdHTVP2G5-rev-casp3, which expresses autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp) with a two-step transcription amplification (TSTA) system and investigate its antitumor effects on ovarian cancer in vitro and in vivo. Fluorescent detection was used to detect EGFP expression in various cells. Cell viabilities were determined using the Cell Counting Kit-8 and flow cytometry. RT-PCR and immunoblotting assays were used to detect cellular apoptotic activities. Tumor growth and survival of tumor-bearing mice were studied. The hTERTp-TSTA system showed the strongest activity in hTERT-positive cancer cells when compared with hTERTp and cytomeglovirus promoter (CMVp). In contrast, it showed no activity in hTERT‑negative HUVECs. AdHTVP2G5‑rev-casp3 markedly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 17.8 ± 3.5% at an MOI of 70, which was significantly lower than that by AdHT-rev-casp3 and Ad-rev-casp3 (rAds which express rev-caspase-3 driven by hTERTp and CMVp, respectively). In contrast, AdHTVP2G5‑rev-casp3 induced little HUVEC death with a viability rate of 92.7 ± 5.2% at the same MOI. Additionally, AdHTVP2G5-rev-casp3 (MOI=70) caused significant apoptosis in AO cells with an apoptotic rate of 42%. The tumor growth suppression rate of AdHTVP2G5-rev-casp3 was 81.52%, significantly higher than that of AdHT-rev-casp3 (54.94%) or Ad-rev-casp3 (21.35%). AdHTVP2G5-rev-casp3 significantly improved the survival of tumor-bearing mice with little liver damage, with a mean survival of 258 ± 28 days. These results showed that AdHTVP2G5-rev-casp3 caused effective apoptosis with significant tumor selectivity, strongly suppressed tumor growth and improved mouse survival with little liver toxicity. It can be a potent therapeutic agent for tumor targeted treatment of ovarian cancer.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome
Directory of Open Access Journals (Sweden)
Marcin Kierczak
2009-10-01
Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-01-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...
DEFF Research Database (Denmark)
Fox, Zoe; Phillips, Andrew; Cohen, Cal
2008-01-01
the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...
Berman, Andrea J; Gooding, Anne R; Cech, Thomas R
2010-10-01
The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Directory of Open Access Journals (Sweden)
Niu Meijuan
2004-10-01
Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.
Reverse transcriptase directs viral evolution in a deep ocean methane seep
Paul, B. G.; Bagby, S. C.
2013-12-01
Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.
Sluis-Cremer, Nicolas
2014-07-31
Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni
2005-01-01
Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294
Song, Yue; Shen, Keng; Yu, Jing-rong
2007-11-06
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter (hTERTp), and investigate its antitumor effect on ovarian cancer in vitro and in vivo. Recombinant adenovirus expressing autocatalytic caspase-3 (rev-csapase-3) driven by hTERTp, AdHT-rev-casp3, was constructed. Ad-rev-casp3 expressing rev-caspase-3 driven by cytomegalovirus promoter (CMVp) was used as a positive control. hTERT positive human ovarian cancer cells of the line AO and hTERT-negative human umbilical venous endothelial cells (HUVECs) were cultured and transfected with AdHT-rev-casp3, Ad-rev-casp3, or Ad-EGFG expressing enhanced green fluorescent protein as control group. Western blotting, Cell Counting Kit (CCK-8), flow cytometry, and TUNEL were used to detect the expression of p17, active subunit of caspase-3, and p85, a poly ADP-ribose polymerase (PARP) cleavage fragment, and they were also used to measure the cell survival rate and apoptotic rate. Western blotting was used to detect the expression of active caspase-3 and its substrate PARP in the AO cells and HUVECs. Twenty nude BALB/c mice were inoculated subcutaneously with AO cells to establish subcutaneous tumor models, when the tumor grew to the volume of 150 mm3 the rats were divided into 4 equal groups to undergo intra-tumor injection of AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, and phosphate-buffered saline (PBS) respectively, the survival rate tumor inhibition rate was observed, 72 days later the mice were killed with their livers and tumors taken out, and Western blotting was used to detect the expression of active caspase-3. Another 40 mice underwent intraperitoneal injection of AO cells to establish intraperitoneal transplanted tumor models, 21 days later the rats were divided into 4 equal groups to be injected intraperitoneally with AdHT-rev-casp3, Ad-rev-casp3, Ad-EGFG, or PBS, the survival rate was observed, and the blood levels of alanine transaminase
Directory of Open Access Journals (Sweden)
Stefanou Nikolaos
2010-08-01
Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.
Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei
2018-01-01
Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .
Directory of Open Access Journals (Sweden)
Warrilow David
2008-12-01
Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Directory of Open Access Journals (Sweden)
Nicolas Sluis-Cremer
2014-07-01
Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.
Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael
2012-01-01
Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...
Fang, Evandro Fei; Ng, Tzi Bun
2015-04-01
Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors
Directory of Open Access Journals (Sweden)
S. Ganguly
2008-01-01
Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.
Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania
2018-02-01
Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L
1999-12-17
Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.
Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.
Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M
2017-12-01
Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these
Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.
2014-01-01
The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...
Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z
2017-07-11
Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From
Ngai, Patrick H K; Ng, T B
2003-11-14
From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.
Li, An; Ziehr, Jessica L; Johnson, Kenneth A
2017-04-21
Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DEFF Research Database (Denmark)
Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy
2011-01-01
Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...
Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong
2012-01-01
1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio
2016-09-30
We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.
Markowitz, Martin; Sarafianos, Stefan G
2018-07-01
4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.
Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami
2017-06-01
We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.
Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan
2012-01-01
The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.
Directory of Open Access Journals (Sweden)
Cha YJ
2014-09-01
Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600
Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin
2010-01-01
The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin
2008-01-01
Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems
Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad
2016-05-01
Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.
Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong
2013-01-01
In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.
Giacobbi, Nicholas S; Sluis-Cremer, Nicolas
2017-07-01
Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Mocroft, A; Horban, A; Clumeck, N
2006-01-01
increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Zhu, Tao; Niu, Deng-Ke
2013-03-05
Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.
Gnanasekaran, Ramachandran
2017-11-08
We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.
Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan
2016-05-01
Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.
Identiifcation and validation of root-speciifc promoters in rice
Institute of Scientific and Technical Information of China (English)
HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying
2015-01-01
Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).
Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat
2011-01-01
We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.
Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita
2018-01-01
Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673
Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R
2009-02-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.
Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.
2009-01-01
Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331
Directory of Open Access Journals (Sweden)
Ammad Ahmad Farooqi
2018-04-01
Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.
Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.
Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D
2006-11-15
TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients
Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H
2015-12-15
Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M
2007-01-01
Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.
Song, Yue; Shen, Keng; He, Chun-Xia
2007-09-01
To construct recombinant adenoviral vector expressing autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter amplified by two-step transcription amplification (hTERTp-TSTA), and investigate its antitumor effect in ovarian cancer in vitro and in vivo. Recombinant adenoviruses expressing autocatalytic caspase-3 (rev-caspase-3) driven by hTERTp-TSTA were prepared, which were named as AdHTVP2G5-rev-casp3. AdHT-rev-casp3, Ad-rev-casp3 and AdHTVP2G5-EGEP, which express rev-caspase-3 driven by hTERTp, cytomegalovirus promoter (CMVp) and enhanced green fluorescent protein (EGFP), respectively, were used as controls. Western blot, cell counting kit (CCK-8), flow cytometry (FCM) and TdT-mediated dUTP-biotin nick end labeling (TUNEL) were used to detect the expression of p17, active subunit of caspase-3, and p85, and to measure cell survival rates, apoptotic rates and cell cycle distribution in ovarian cell line AO and normal human umbilical vein endothelial cell line HUVEC, following treatments of AdHTVP2G5-rev-casp3. subcutaneous tumor models and abdominally spread tumor models of human ovarian carcinoma using AO cells in BALB/c nude mice were established. Following treatments of AdHTVP2G5-rev-casp3, western blot was used to detect the expression of active caspase-3 in abdominally spread tumors and liver tissues, respectively, and the mouse survival rates and the volume of tumor nodules were measured, and the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) were analyzed to monitor liver damages and HE staining was used to detect the histopathological changes of various organs. The levels of p17 expression in AdHTVP2G5-rev-casp3-treated AO cells were significantly higher than that in Ad-rev-casp3 or AdHT-rev-casp3 treated AO cells, while no expression was observed in AdHTVP2G5-rev-casp3-treated HUVEC. There was strong cell killing of AdHTVP2G5-rev-casp3 of hTERT positive AO cells, but not of the hTERT-negative HUVEC cells
Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang
2017-06-16
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Ma, Xiongchao; Sun, Baozhen; Zhu, Fei
2018-02-01
This study investigated the function of endonuclease-reverse transcriptase (mjERT) in Marsupenaeus japonicus. The 1129 bp cDNA sequence of mjERT was cloned from M. japonicus using rapid amplification of cDNA ends (RACE) PCR, and RT-qPCR analysis indicated that mjERT was highly expressed in the gills and hepatopancreas of M. japonicus. We also found that white spot syndrome virus (WSSV) or Vibrio alginolyticus challenge could enhance the expression of mjERT. When mjERT was inhibited, immune genes such as toll, p53, hemocyanin and tumor necrosis factor-α (TNF-α) were significantly down-regulated (P shrimp, while myosin was significantly up-regulated (P shrimps was significantly increased following mjERT RNA interfere (RNAi). Apoptosis data provided information to suggest that mjERT-dsRNA challenge caused less apoptosis in hemocytes in both the disease-free and viral group. We also revealed that mjERT-dsRNA treatment resulted in a lower phagocytosis rate in the hemocytes of V. alginolyticus-challenged shrimp. Finally, we found that the absence of mjERT had an significantly negative impact upon shrimp phenoloxidase (PO) activity, superoxide dismutase (SOD) activity and total hemocyte count (THC) following WSSV or V. alginolyticus infection, indicating a regulative role for mjERT in the innate immunity of shrimp in response to pathogenic infection. In summary, we concluded that mjERT might promote the anti-WSSV immune response of shrimp by regulating apoptosis, PO activity, THC and SOD activity, and also exert a positive role in the immune response against V. alginolyticus by regulating phagocytosis, SOD activity, PO activity and THC. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong
2005-01-01
The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M
2007-01-01
Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691
Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido
2013-09-01
Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.
Directory of Open Access Journals (Sweden)
Alessandra M. T. de Souza
2013-10-01
Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.
Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan
2010-12-12
Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.
DEFF Research Database (Denmark)
Sabin, Caroline A; Worm, Signe W; Weber, Rainer
2008-01-01
cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...
Directory of Open Access Journals (Sweden)
Madeleine Zerbato
Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.
Zhang, Xinsheng; Zhang, Yong; Liu, Yinghua; Wang, Jin; Xu, Qing; Yu, Xiaoming; Yang, Xueyan; Liu, Zhao; Xue, Changyong
2016-09-01
We previously observed that medium-chain triglycerides (MCTs) could reduce body fat mass and improve the metabolism of cholesterol. We hypothesized that MCTs can improve atherosclerosis by promoting the reverse cholesterol transport (RCT) process. Therefore, the objective of this study was to investigate the roles of MCTs in macrophage RCT and the progression of atherosclerosis. To test this hypothesis, 30 4-week-old ApoE-deficient (ApoE(-/-)) mice were randomly divided into 2 groups and fed a diet of 2% MCTs or long-chain triglycerides (LCTs) for 16 weeks. Ten age- and sex-matched C57BL/6J mice were fed a diet of 2% LCTs as the control. Macrophage-to-feces RCT was assessed in vivo by intraperitoneal injection of RAW 264.7 macrophages containing (3)H-labeled cholesterol, and atherosclerotic plaques were measured. The mRNA and protein expressions were determined by reverse transcriptase polymerase chain reaction and Western blot analyses, respectively. There was a greater decrease in body fat mass, atherosclerotic plaques, and an improvement in serum lipid profiles. In addition, the MCT mice group showed an increase in (3)H-tracer in the feces and a decrease in the liver. Significantly higher levels of mRNA and protein expression of hepatic ATP-binding cassette transporter A1, ATP-binding cassette transporter G5, cholesterol 7α-hydroxylase, and intestinal ATP-binding cassette transporter G8, as well as lower levels of expression of intestinal Niemann-Pick C1-like 1, were found in the MCT group. These results suggest that MCTs could obviously promote macrophage RCT and improve atherosclerosis in ApoE(-/-) mice, indicating that MCTs have the potential to prevent cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong
2007-01-01
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation
Energy Technology Data Exchange (ETDEWEB)
Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn
2007-04-06
The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.
Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis
2013-12-23
At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.
Directory of Open Access Journals (Sweden)
Meytal Galilee
2018-01-01
Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang
2017-12-01
Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50 = 0.04 μM) with decent antiviral potency (EC 50 = 7.4 μM) and no cytotoxicity (CC 50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Amendola, R
1994-11-01
The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.
Germline TERT promoter mutations are rare in familial melanoma
DEFF Research Database (Denmark)
Harland, Mark; Petljak, Mia; Robles-Espinoza, Carla Daniela
2016-01-01
Germline CDKN2A mutations occur in 40 % of 3-or-more case melanoma families while mutations of CDK4, BAP1, and genes involved in telomere function (ACD, TERF2IP, POT1), have also been implicated in melanomagenesis. Mutation of the promoter of the telomerase reverse transcriptase (TERT) gene (c.-57...... T>G variant) has been reported in one family. We tested for the TERT promoter variant in 675 multicase families wild-type for the known high penetrance familial melanoma genes, 1863 UK population-based melanoma cases and 529 controls. Germline lymphocyte telomere length was estimated in carriers....... The c.-57 T>G TERT promoter variant was identified in one 7-case family with multiple primaries and early age of onset (earliest, 15 years) but not among population cases or controls. One family member had multiple primary melanomas, basal cell carcinomas and a bladder tumour. The blood leukocyte...
Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi
2014-01-01
Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.
Directory of Open Access Journals (Sweden)
Rami Kantor
2005-04-01
Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.
Study of cancer-specific chimeric promoters induced by irradiation
International Nuclear Information System (INIS)
Xiong Jie; Zhou Yunfeng; Sun Wenjie; Wang Weifeng; Liao Zhengkai; Zhou Fuxiang; Xie Conghua
2010-01-01
Objective: To combine the radio-inducible CArG element with cancer-specific human telomerase reverse transcriptase (hTERT) gene promoter, and to construct the novel chimeric promoters. Methods: The synthetic hTERT promoters containing different number of radio-inducible CArG elements were constructed, and the activities of the promoters in the cancer cells (HeLa, A549, and MHCC97 cells) and nomal cells (hEL cells) were detected by using luciferase-reporter assays after the treatment of irradiation (a single or fractionated irradiation dose). Results: Synthetic promoter containing 6 repeated CArG units was better in radio-inducibility than any other promoters containing different number of CArG units, and nearly maximum levels obtained at 4-6 Gy. The very low activities of the chimeric promoters could be detected in normal hEL cells. A similar level of reporter gene expression was observed after 3 fractionated doses of 2 Gy compared with a single dose of 6 Gy in cancer cells. Conclusions: The cancer-specific chimeric promoter containing 6 CArG elements showes the best radio-response, and the chimeric promoter system has the potential in cancer gene therapy. (authors)
Energy Technology Data Exchange (ETDEWEB)
Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.
2017-02-06
The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.
Directory of Open Access Journals (Sweden)
Sukrit Silas
2017-07-01
Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.
Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun
2017-09-01
The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.
Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato
2012-06-06
Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic
Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen
2016-03-01
Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.
International Nuclear Information System (INIS)
Zhu Hanneng; Chen Wenying; Xiong Sidong
2000-01-01
Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)
Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W
2012-05-01
Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.
Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L
2017-11-08
The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.
International Nuclear Information System (INIS)
Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun
2007-01-01
Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Directory of Open Access Journals (Sweden)
Wonkyoung Cho
Full Text Available Atherosclerosis, the major pathology of cardiovascular disease, is caused by multiple factors involving psychological stress. Corticotropin-releasing hormone (CRH, which is released by neurosecretory cells in the hypothalamus, peripheral nerve terminals and epithelial cells, regulates various stress-related responses. Our current study aimed to verify the role of CRH in macrophage foam cell formation, the initial critical stage of atherosclerosis. Our quantitative real-time reverse transcriptase PCR (qRT-PCR, semi-quantitative reverse transcriptase PCR, and Western blot results indicate that CRH down-regulates ATP-binding cassette transporter-1 (ABCA1 and liver X receptor (LXR-α, a transcription factor for ABCA1, in murine peritoneal macrophages and human monocyte-derived macrophages. Oil-red O (ORO staining and intracellular cholesterol measurement of macrophages treated with or without oxidized LDL (oxLDL and with or without CRH (10 nM in the presence of apolipoprotein A1 (apoA1 revealed that CRH treatment promotes macrophage foam cell formation. The boron-dipyrromethene (BODIPY-conjugated cholesterol efflux assay showed that CRH treatment reduces macrophage cholesterol efflux. Western blot analysis showed that CRH-induced down-regulation of ABCA1 is dependent on phosphorylation of Akt (Ser473 induced by interaction between CRH and CRH receptor 1(CRHR1. We conclude that activation of this pathway by CRH accelerates macrophage foam cell formation and may promote stress-related atherosclerosis.
Interface Promoted Reversible Mg Insertion in Nanostructured Tin-Antimony Alloys
Energy Technology Data Exchange (ETDEWEB)
Cheng, Yingwen; Shao, Yuyan; Parent, Lucas R.; Sushko, Maria L.; Li, Guosheng; Sushko, Petr; Browning, Nigel D.; Wang, Chong M.; Liu, Jun
2015-11-11
This paper demonstrates intermetallic compounds SnSb are highly active materials for reversibly hosting Mg ions. Compared with monometallic Sn and Sb, SnSb alloy exhibited exceptionally high reversible capacity (420 mAh/g), excellent rate capability and good cyclic stability. Mg insertion into pristine SnSb involves an activation process to complete, which induces particle breakdown and results in phase segregation to Sn-rich and Sb-rich phases. Both experimental analysis and DFT simulation suggest that the Sn-rich phase is particularly active and provides most of the capacity whereas the Sb-rich phase is not as active, and the interface between these two phases play a key role in promoting the formation and stabilization of the cubic Sn phase that is more favorable for fast and reversible Mg insertion. We further show that activated SnSb alloy has good compatibility with simple Mg electrolytes. Overall, this work could provide new approaches for designing materials capable of reversible Mg ion insertion and new opportunities for understanding Mg electrochemistry.
Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang
2010-01-01
A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408
Directory of Open Access Journals (Sweden)
Yanrui Li
2010-01-01
Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.
Directory of Open Access Journals (Sweden)
Isabel Hostettler
2014-12-01
Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Directory of Open Access Journals (Sweden)
Marius Lazea
2011-12-01
Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.
Directory of Open Access Journals (Sweden)
Parvathi Chary
Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.
de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão
2008-08-01
A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.
Directory of Open Access Journals (Sweden)
Johannes Van Staden
2010-10-01
Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.
LENUS (Irish Health Repository)
Bansode, Vijay B
2011-10-13
Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
International Nuclear Information System (INIS)
Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha
2005-01-01
Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols
Directory of Open Access Journals (Sweden)
Mok Helen OL
2006-09-01
Full Text Available Abstract Background Current understanding on the relationships between hypoxia, hypoxia-inducible factor-1 (HIF-1 and telomerase reverse transcriptase (TERT gene expression are largely based on in vitro studies in human cancer cells. Although several reports demonstrated HIF-1- mediated upregulation of the human TERT gene under hypoxia, conflicting findings have also been reported. Thus far, it remains uncertain whether these findings can be directly extrapolated to non-tumor tissues in other whole animal systems in vivo. While fish often encounter environmental hypoxia, the in vivo regulation of TERT by hypoxia in non-neoplastic tissues of fish remains virtually unknown. Results The adult marine medaka (Oryzias melastigma was employed as a model fish in this study. We have cloned and characterized a 3261-bp full-length TERT cDNA, omTERT, which encodes a protein of 1086 amino acids. It contains all of the functional motifs that are conserved in other vertebrate TERTs. Motif E is the most highly conserved showing 90.9–100% overall identity among the fish TERTs and 63.6% overall identity among vertebrates. Analysis of the 5'-flanking sequence of the omTERT gene identified two HRE (hypoxia-responsive element; nt. – 283 and – 892 cores. Overexpression of the HIF-1α induced omTERT promoter activity as demonstrated using transient transfection assays. The omTERT gene is ubiquitously expressed in fish under normoxia, albeit at varying levels, where highest expression was observed in gonads and the lowest in liver. In vivo expression of omTERT was significantly upregulated in testis and liver in response to hypoxia (at 96 h and 48 h, respectively, where concomitant induction of the omHIF-1α and erythropoietin (omEpo genes was also observed. In situ hybridization analysis showed that hypoxic induction of omTERT mRNA was clearly evident in hepatocytes in the caudal region of liver and in spermatogonia-containing cysts in testis. Conclusion This
Directory of Open Access Journals (Sweden)
Johnson Barry C
2012-12-01
Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.
International Nuclear Information System (INIS)
Lund, Kaleb C.; Wallace, Kendall B.
2008-01-01
Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug
Directory of Open Access Journals (Sweden)
Mark A Winters
Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.
Directory of Open Access Journals (Sweden)
Josh Lewis Stern
2017-12-01
Full Text Available A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2 on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival.
Yang, M K; Tang, J; Xiang, Z; Zhang, X; Wang, J; Li, Z; Li, Y; Sheng, W B
2018-02-06
Objective: To investigate the relationship between the content of human telomerase reverse transcriptase (hTERT) and its clinical features in serum free DNA in patients with different degree of spinal cord injury. Methods: From December 2013 to December 2016, inpatients of the Central Hospital of Bazhong, Sichuan Province were enrolledand divided into the experimental group, the disease control group and the negative control group. For the experimental group: 46 patients with spinal cord injury were graded according to the criteria of the American Association of Spinal Cord Injury (ASIA), including 12 cases of grade A, 10 cases of grade B, 10 cases of grade C, 7 cases of grade D and 7 cases of grade E; for the disease control group: 15 patients with spinal fractures (without spinal cord injury) at the same period were included; and for the negative control group: 20 healthy adult volunteers aged 18-50 years were selected.Real-time fluorescence quantitative PCR and immunoblotting were performed to detect the content of hTERT in serum free DNA both in patients and healthy controls and to compare the difference between them. The results of the somatosensory evoked potential (SEP) of all patients were compared and analyzed.The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of hTERT content in serum free DNA in patients with spinal cord injury. Results: Comparison of serum free DNA hTERT content: in the experimental group, the serum free DNA hTERT content of grade A, B, C, D, E was (99.63±8.23), (76.24±4.37), (46.07±5.43), (16.30±0.95) and (15.74±1.12)μg/L, respectively.While it was (15.01±1.39)μg/L in the disease control group and (14.54±1.03)μg/L in the negative control group. The total difference was statistically significant between patients of each group and the control group ( F =857.917, P spinal cord injury has a certain guiding significance for the diagnosis of spinal cord injury and the degree of injury.
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P
2000-05-04
Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.
Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni
2016-01-01
Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647
Directory of Open Access Journals (Sweden)
Jie Xu
Full Text Available High rate of viral replication and lacking of proofreading activity in hepatitis B virus (HBV polymerase lead to the generation of mutations in HBV virus. Mutations in the reverse transcriptase (RT region of HBV polymerase are demonstrated to be strongly associated with drug resistance during antiviral treatment. However, the presence of mutations as well as its clinical significance in treatment-naïve hepatitis patients (defined as pre-existing mutations need to be further investigated. In the present study, a total of 168 serum samples from treatment-naive chronic hepatitis B (CHB patients were collected, and the RT region of HBV polymerase was sequenced. The results showed that pre-existing mutations in the RT region of HBV polymerase were detected in 43 of 168 (25.6% treatment-naive CHB patients within which there were no well-characterized primary nucleotide analogs (NAs resistance sites. Three dominant sites at rt191, rt207 and rt226 were found mutant in 7(16.28%, 8(18.60%, and 14(32.56% samples respectively among these 43 patients. No significant correlation was found between pre-existing mutations and gender, age, HBV genotype, ALT, HBeAg or HBV DNA loads. However, patients with pre-existing RT mutations under HBeAg sero-negative status exhibited decreased HBV DNA loads, which contributed to the decreased HBV DNA loads in the total HBeAg sero-negative patients. The above investigation indicated that there was a prevalence of pre-existing mutations in RT region of HBV polymerase which might affect the serum HBV DNA level in treatment-naive CHB patients. Its effects on the occurrence of NAs resistance and the prognosis after treatment need to be further investigated.
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
Directory of Open Access Journals (Sweden)
Markus Hecht
Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic
Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun
2016-11-01
A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
International Nuclear Information System (INIS)
Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.
1999-01-01
We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia
2011-06-01
Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.
Stern, Josh Lewis; Paucek, Richard D; Huang, Franklin W; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C; Cech, Thomas R
2017-12-26
A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.
2007-01-01
Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni
2008-09-01
We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.
Directory of Open Access Journals (Sweden)
Meng Shuang
2010-06-01
Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.
International Nuclear Information System (INIS)
Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.
2006-01-01
Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)
Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake
2017-11-22
Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.
Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki
2014-01-01
Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.
Directory of Open Access Journals (Sweden)
Atsuko Hachiya
2011-01-01
Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.
Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N
2005-05-01
To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.
Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo
2017-08-31
In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi
2018-05-11
Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Gao, Ke; Li, Gang; Qu, Yiping; Wang, Maode; Cui, Bo; Ji, Meiju; Shi, Bingyin; Hou, Peng
2016-02-23
Increasing evidences have implicated somatic gain-of-function mutations at the telomerase reverse transcriptase (TERT) promoter as one of the major mechanisms that promote transcriptional activation of TERT and subsequently maintain telomere length in human cancers including glioma. To investigate the prognostic value of these mutations and telomere length, individually and their coexistence, in gliomas, we analyzed two somatic mutations C228T and C250T in the TERT promoter, relative telomere length (RTL), IDH1 mutation and MGMT methylation in 389 glioma patients, and explored their associations with patient characteristics and clinical outcomes. Our data showed that C228T and C250T mutations were found in 17.0% (66 of 389) and 11.8% (46 of 389) of gliomas, respectively, and these two mutations were mutually exclusive in this cancer. Moreover, they were significantly associated with WHO grade. We also found that the RTL was significant longer in gliomas than in meningiomas and normal brain tissues (Median, 0.89 vs. 0.44 and 0.50; P radiotherapy. Collectively, TERT promoter mutations and long RTL are not only prognostic factors for poor clinical outcomes, but also the predictors of radiotherapy resistance in gliomas.
Wang, Chung-Chieh; Huang, Chao-Yuan; Jhuang, Yu-Lin; Chen, Chih-Chi; Jeng, Yung-Ming
2018-04-01
Mutations in FGFR3 and the promoter region of the telomerase reverse transcriptase (TERT) gene have been found frequently in urothelial carcinoma of the urinary bladder. However, related data for papillary urothelial neoplasm of low malignant potential (PUNLMP) are limited. In this study, we investigated the mutation status of the TERT promoter, FGFR3 and HRAS in low-grade papillary urothelial neoplasms and evaluated their prognostic significance. The cases included in this study comprised 21 inverted papillomas, 30 PUNLMPs and 34 low-grade non-invasive papillary urothelial carcinomas (NIPUCs). TERT promoter mutations were observed in 10 (33%) PUNLMPs and 17 (50%) low-grade NIPUCs, but not in any inverted papilloma. FGFR3 mutations were observed more frequently in PUNLMP and low-grade NIPUC than in inverted papillomas (P = 0.009), whereas the opposite trend was noted for HRAS mutations (P low-grade NIPUC (P = 0.530). Notably, PUNLMP cases with TERT promoter mutations had a similar recurrence rate to that in low-grade NIPUC cases (P = 0.487). Our results suggest that the status of the TERT promoter mutation may serve as a biomarker of prognostic stratification in patients with PUNLMP. © 2017 John Wiley & Sons Ltd.
Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi
2016-12-10
The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Molecular and biochemical toxicology
National Research Council Canada - National Science Library
Smart, Robert C; Hodgson, Ernest
2008-01-01
... Expression and Regulation 2.6.1 Northern Analysis 2.6.2 Nuclear Run-On 2.6.3 Promoter Deletion Analysis/Reporter Gene Assays 2.6.4 Microarrays 2.6.5 Reverse Transcriptase-PCR (RT-PCR) and Real-Time P...
Directory of Open Access Journals (Sweden)
Tandale Babasaheb V
2008-12-01
Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy
CSIR Research Space (South Africa)
Khati, M
2012-03-01
Full Text Available RNA and Vpr, respectively pol Protease (PR) gag/pol cleavage pol Reverse Transcriptase (RT) Reverse transcription pol RNase H RNase H activity pol Integrase (IN) DNA provirus integration env Env (gp120 and gp41) gp120 binds CD4 receptor and CXCR4.../CCR5 co-receptors , gp41 mediates fusion tat Tat Viral transcription activator rev Rev RNA transport, stability and utilization factor (phosphoprotein) vif Vif Promotes virion maturation and infectivity vpr Vpr Promotes nuclear localization...
Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong
2018-06-18
We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H = 1.77 μM, IC 50 IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-06-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
From reverse transcription to human brain tumors
Directory of Open Access Journals (Sweden)
Dmitrenko V. V.
2013-05-01
Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line
Energy Technology Data Exchange (ETDEWEB)
Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy
2017-04-10
HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.
International Nuclear Information System (INIS)
Jung, Kyung oh; Youn, Hyewon; Kim, Seung Hoo; Kim, Young-Hwa; Kang, Keon Wook; Chung, June-Key
2016-01-01
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and "6"4Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Jung, Kyung oh [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Youn, Hyewon, E-mail: hwyoun@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of); Cancer Imaging Center, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, Seung Hoo [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kim, Young-Hwa [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Kang, Keon Wook [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Chung, June-Key, E-mail: jkchung@snu.ac.kr [Department of Nuclear Medicine, Seoul National University College of Medicine (Korea, Republic of); Biomedical Sciences, Seoul National University College of Medicine (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine (Korea, Republic of); Tumor Microenvironment Global Core Research Center, Seoul National University (Korea, Republic of)
2016-08-26
Despite an increasing need for methods to visualize intracellular proteins in vivo, the majority of antibody-based imaging methods available can only detect membrane proteins. The human telomerase reverse transcriptase (hTERT) is an intracellular target of great interest because of its high expression in several types of cancer. In this study, we developed a new probe for hTERT using the Tat peptide. An hTERT antibody (IgG or IgM) was conjugated with the Tat peptide, a fluorescence dye and {sup 64}Cu. HT29 (hTERT+) and U2OS (hTERT−) were used to visualize the intracellular hTERT. The hTERT was detected by RT-PCR and western blot. Fluorescence signals for hTERT were obtained by confocal microscopy, live cell imaging, and analyzed by Tissue-FAXS. In nude mice, tumors were visualized using the fluorescence imaging devices Maestro™ and PETBOX. In RT-PCR and western blot, the expression of hTERT was detected in HT29 cells, but not in U2OS cells. Fluorescence signals were clearly observed in HT29 cells and in U2OS cells after 1 h of treatment, but signals were only detected in HT29 cells after 24 h. Confocal microscopy showed that 9.65% of U2OS and 78.54% of HT29 cells had positive hTERT signals. 3D animation images showed that the probe could target intranuclear hTERT in the nucleus. In mice models, fluorescence and PET imaging showed that hTERT in HT29 tumors could be efficiently visualized. In summary, we developed a new method to visualize intracellular and intranuclear proteins both in vitro and in vivo. - Highlights: • We developed new probes for imaging hTERT using Tat-conjugated IgM antibodies labeled with a fluorescent dye and radioisotope. • This probes could be used to overcome limitation of conventional antibody imaging system in live cell imaging. • This system could be applicable to monitor intracellular and intranuclear proteins in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Francesca Carlini
Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.
International Nuclear Information System (INIS)
Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua
2011-01-01
Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Energy Technology Data Exchange (ETDEWEB)
Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others
2011-09-09
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.
2017-10-01
The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.
Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang
2006-05-01
To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.
Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram
2003-01-01
Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we
Detection of hepatitis C virus RNA using reverse transcription PCR
International Nuclear Information System (INIS)
Yap, S.F.
1998-01-01
Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory
APOBEC3G inhibits elongation of HIV-1 reverse transcripts.
Directory of Open Access Journals (Sweden)
Kate N Bishop
2008-12-01
Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.
Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark
2009-01-01
Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-07-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.
How decision reversibility affects motivation.
Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E
2014-04-01
The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.
Directory of Open Access Journals (Sweden)
Turyadi Turyadi
2018-01-01
Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase. Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis
Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R
2015-01-01
Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once
Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A
2017-01-01
Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N
Patick, A K; Boritzki, T J; Bloom, L A
1997-10-01
Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.
Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella
2005-01-01
The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650
Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen
2011-01-01
Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
Directory of Open Access Journals (Sweden)
Soo-Huey Yap
2007-12-01
Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which
He, Ling Feng; Wang, Yi Gang; Xiao, Tian; Zhang, Kang Jiang; Li, Gong Chu; Gu, Jin Fa; Chu, Liang; Tang, Wen Hao; Tan, Wen-Song; Liu, Xin Yuan
2009-12-28
Adeno-associated virus (AAV) has rapidly become a promising gene delivery vehicle for its excellent advantages of non-immunogenic, low pathogenicity and long-term gene expression in vivo. However, a major obstacle in development of effective AAV vector is the lack of tissue specificity, which caused low efficiency of AAV transfer to target cells. The application of human telomerase reverse transcriptase (hTERT) promoter is a prior targeting strategy for AAV in cancer gene therapy as hTERT activity is transcriptionally upregulated in most cancer cells. In the present work, we investigated whether AAV-mediated human interferon beta (IFN-beta) gene driven by hTERT promoter could specifically express in tumor cells and suppress tumor cell growth. Our data demonstrated that hTERT promoter-driven IFN-beta expression was the tumor-specific, decreased the cell viability of tumor cells but not normal cells, and induced tumor cell apoptosis via activation of caspase pathway and release of cytochrome c. AAV-mediated IFN-beta expression driven by hTERT promoter significantly suppressed the growth of colorectal cancer and lung cancer xenograft in mice and resulted in tumor cells death in vivo. These data suggested that AAVs in combination with hTERT-mediated IFN-beta expression could exert potential antitumor activity and provide a novel targeting approach to clinical gene therapy of varieties of cancers.
Directory of Open Access Journals (Sweden)
Lin Bai
Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.
Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong
2007-06-30
Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.
Bacterial lipopolysaccharide promotes profibrotic activation of intestinal fibroblasts.
LENUS (Irish Health Repository)
Burke, J P
2012-02-01
BACKGROUND: Fibroblasts play a critical role in intestinal wound healing. Lipopolysaccharide (LPS) is a cell wall component of commensal gut bacteria. The effects of LPS on intestinal fibroblast activation were characterized. METHODS: Expression of the LPS receptor, toll-like receptor (TLR) 4, was assessed in cultured primary human intestinal fibroblasts using flow cytometry and confocal microscopy. Fibroblasts were treated with LPS and\\/or transforming growth factor (TGF) beta1. Nuclear factor kappaB (NFkappaB) pathway activation was assessed by inhibitory kappaBalpha (IkappaBalpha) degradation and NFkappaB promoter activity. Fibroblast contractility was measured using a fibroblast-populated collagen lattice. Smad-7, a negative regulator of TGF-beta1 signalling, and connective tissue growth factor (CTGF) expression were assessed using reverse transcriptase-polymerase chain reaction and western blot. The NFkappaB pathway was inhibited by IkappaBalpha transfection. RESULTS: TLR-4 was present on the surface of intestinal fibroblasts. LPS treatment of fibroblasts induced IkappaBalpha degradation, enhanced NFkappaB promoter activity and increased collagen contraction. Pretreatment with LPS (before TGF-beta1) significantly increased CTGF production relative to treatment with TGF-beta1 alone. LPS reduced whereas TGF-beta1 increased smad-7 expression. Transfection with an IkappaBalpha plasmid enhanced basal smad-7 expression. CONCLUSION: Intestinal fibroblasts express TLR-4 and respond to LPS by activating NFkappaB and inducing collagen contraction. LPS acts in concert with TGF-beta1 to induce CTGF. LPS reduces the expression of the TGF-beta1 inhibitor, smad-7.
Raghunandan, Bangalore Nagarajachar; Sanjai, Karpagaselvi; Kumaraswamy, Jayalakshmi; Papaiah, Lokesh; Pandey, Bhavna; Jyothi, Bellur MadhavaRao
2016-01-01
Background: Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA sequences and almost universally provides the molecular basis for unlimited proliferative potential. The telomeres become shorter with each cycle of replication and reach a critical limit; most cells die or enter stage of replicative senescence. Telomere length maintenance by telomerase is required for all the cells that exhibit limitless replicative potential. It has been postulated that reactivation of telomerase expression is necessary for the continuous proliferation of neoplastic cells to attain immortality. Use of immunohistochemistry (IHC) is a useful, reliable method of localizing the human telomerase reverse transcriptase (hTERT) protein in tissue sections which permits cellular localization. Although there exists a lot of information on telomerase in oral cancer, little is known about their expression in oral epithelial dysplasia and their progression to oral squamous cell carcinoma (OSCC) compared to normal oral mucosa. This study addresses this lacuna. Aims: To compare the expression of hTERT protein in oral epithelial dysplasia and OSCC with normal oral mucosa by Immunohistochemical method. Subjects and Methods: In this preliminary study, IHC was used to detect the expression of hTERT protein in OSCC (n = 20), oral epithelial dysplasia (n = 21) and normal oral mucosa (n = 10). The tissue localization of immunostain, cellular localization of immunostain, nature of stain, intensity of stain, percentage of cells stained with hTERT protein were studied. A total number of 100 cells were counted in each slide. Statistical Analysis: All the data were analyzed using SPSS software version 16.0. The tissue localization, cellular localization of cytoplasmic/nuclear/both of hTERT stain, staining intensity was compared across the groups using Pearson's Chi-square test. The mean percentage of cells stained for oral epithelial dysplasia, OSCC and normal oral mucosa were
Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max
2014-01-01
During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.
Reverse logistics in the construction industry.
Hosseini, M Reza; Rameezdeen, Raufdeen; Chileshe, Nicholas; Lehmann, Steffen
2015-06-01
Reverse logistics in construction refers to the movement of products and materials from salvaged buildings to a new construction site. While there is a plethora of studies looking at various aspects of the reverse logistics chain, there is no systematic review of literature on this important subject as applied to the construction industry. Therefore, the objective of this study is to integrate the fragmented body of knowledge on reverse logistics in construction, with the aim of promoting the concept among industry stakeholders and the wider construction community. Through a qualitative meta-analysis, the study synthesises the findings of previous studies and presents some actions needed by industry stakeholders to promote this concept within the real-life context. First, the trend of research and terminology related with reverse logistics is introduced. Second, it unearths the main advantages and barriers of reverse logistics in construction while providing some suggestions to harness the advantages and mitigate these barriers. Finally, it provides a future research direction based on the review. © The Author(s) 2015.
Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng
2018-06-27
The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.
Wysoczanska, B; Wrobel, T; Dobrzynska, O; Mazur, G; Bogunia-Kubik, K
2015-04-01
MNS16A is a functional polymorphic tandem repeat within the human telomerase reverse transcriptase (hTERT) gene. To investigate whether any of the MNS16A repeats represents a genetic risk factor for NHL susceptibility, progression of or response to therapy in 75 patients with non-Hodgkin's lymphomas (NHLs) and 126 healthy individuals were genotyped using the PCR-VNTR technique. A slightly higher frequency of the MNS16A VNTR-243 variant was detected among patients who did not respond to treatment (NR) as compared to patients with complete or partial remission (0.83 vs. 0.51, P = 0.055). NR patients more frequently developed aggressive than indolent type of the disease (0.92 vs. 0.41, P = 0.001). The VNTR-243 allele was more frequently detected among patients with an intermediate-high/high International Prognostic Index (IPI 3-4) score (P = 0.063), especially in patients with advanced age and IPI 3-4 (P = 0.040). In multivariate analysis, higher IPI 3-4 score (OR = 11.364, P = 0.051) and aggressive type of the disease (OR = 18.182, P = 0.012) were found to be independent genetic markers associated with nonresponse to treatment. Presence of the MNS16A VNTR-243 variant also strongly tended to affect the risk of a less favourable response to therapy and was more frequently present among nonresponders (OR = 5.848, P = 0.059). Genetic variation within the hTERT gene may affect the progression and treatment of lymphoproliferative disorders. © 2015 John Wiley & Sons Ltd.
Annunziata, Clorinda; Pezzuto, Francesca; Greggi, Stefano; Ionna, Franco; Losito, Simona; Botti, Gerardo; Buonaguro, Luigi; Buonaguro, Franco M; Tornesello, Maria Lina
2018-03-31
Two recurrent mutations (-124 G > A and -146 G > A) in the core promoter region of the human telomerase reverse transcriptase (TERT) gene create consensus binding sites for ETS transcription factors and cause increased TERT expression in several tumour types. We analyzed TERT promoter mutations and TERT mRNA levels in head and neck cancer, cervical carcinoma and cervical intraepithelial neoplasia (CIN) as well as in C-4I, CaSki, HeLa and SiHa cervical cell lines. Nucleotide sequence analysis of TERT promoter region showed that 33.3% of oral squamous cell carcinoma (SCC) and 16.8% of cervical SCC harboured mutually exclusive G to A transitions at nucleotide position -124 or -146. TERT promoter was mutated at nucleotide -146 (G > A) in SiHa cell line. Other nucleotide changes creating in some cases putative ETS binding sites were more frequent in oral SCC (26.7%) than in cervical carcinoma (4.8%). The frequency of mutations was independent of human papillomavirus (HPV) tumour status in both cervical and oral cancer. Expression of TERT gene was significantly higher in TERT promoter mutated (-124G > A or -146G > A) cervical SCC compared to not mutated SCC irrespective of HPV16 E6 and E7 levels. Such hot spot changes were not detected in oropharyngeal SCC, cervical adenocarcinoma and CIN lesions. Our results suggest that TERT promoter mutations play a relevant role in oral SCC as well as in cervical SCC, besides the already known effect of HPV16 E6 protein on TERT expression. © 2018 UICC.
NCBI nr-aa BLAST: CBRC-DDIS-06-0095 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DDIS-06-0095 gb|AAX19886.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excel...sa] gb|AAX19887.1| telomerase reverse transcriptase catalytic subunit [Doryanthes excelsa] AAX19886.1 1e-44 25% ...
Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre
2012-04-01
The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano
2005-01-13
Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.
Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.
2003-01-01
The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containin...
Directory of Open Access Journals (Sweden)
Yuuri Hashimoto
Full Text Available Hypoxia is a microenvironmental factor that contributes to the invasion, progression and metastasis of tumor cells. Hypoxic tumor cells often show more resistance to conventional chemoradiotherapy than normoxic tumor cells, suggesting the requirement of novel antitumor therapies to efficiently eliminate the hypoxic tumor cells. We previously generated a tumor-specific replication-competent oncolytic adenovirus (OBP-301: Telomelysin, in which the human telomerase reverse transcriptase (hTERT promoter drives viral E1 expression. Since the promoter activity of the hTERT gene has been shown to be upregulated by hypoxia, we hypothesized that, under hypoxic conditions, the antitumor effect of OBP-301 with the hTERT promoter would be more efficient than that of the wild-type adenovirus 5 (Ad5. In this study, we investigated the antitumor effects of OBP-301 and Ad5 against human cancer cells under a normoxic (20% oxygen or a hypoxic (1% oxygen condition. Hypoxic condition induced nuclear accumulation of the hypoxia-inducible factor-1α and upregulation of hTERT promoter activity in human cancer cells. The cytopathic activity of OBP-301 was significantly higher than that of Ad5 under hypoxic condition. Consistent with their cytopathic activity, the replication of OBP-301 was significantly higher than that of Ad5 under the hypoxic condition. OBP-301-mediated E1A was expressed within hypoxic areas of human xenograft tumors in mice. These results suggest that the cytopathic activity of OBP-301 against hypoxic tumor cells is mediated through hypoxia-mediated activation of the hTERT promoter. Regulation of oncolytic adenoviruses by the hTERT promoter is a promising antitumor strategy, not only for induction of tumor-specific oncolysis, but also for efficient elimination of hypoxic tumor cells.
NEW DRUGS NEW TARGETS AND NOVEL ANTIRETROVIRALS
African Journals Online (AJOL)
2005-11-02
Nov 2, 2005 ... Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs).
Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong
2018-01-01
As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens
2012-01-01
Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...
(3,4-dihydroisoquinolin-2(1H)-yl)
Indian Academy of Sciences (India)
Administrator
HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.
New targets and novel antiretrovirals | Wood | Southern African ...
African Journals Online (AJOL)
Highly active antiretroviral therapy (HAART) has to date been based on use of a triple combination of drugs chosen from three classes of antiretrovirals (ARVs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). These ARV classes ...
TERT promoter hot spot mutations are frequent in Indian cervical and oral squamous cell carcinomas.
Vinothkumar, Vilvanathan; Arunkumar, Ganesan; Revathidevi, Sundaramoorthy; Arun, Kanagaraj; Manikandan, Mayakannan; Rao, Arunagiri Kuha Deva Magendhra; Rajkumar, Kottayasamy Seenivasagam; Ajay, Chandrasekar; Rajaraman, Ramamurthy; Ramani, Rajendren; Murugan, Avaniyapuram Kannan; Munirajan, Arasambattu Kannan
2016-06-01
Squamous cell carcinoma (SCC) of the uterine cervix and oral cavity are most common cancers in India. Telomerase reverse transcriptase (TERT) overexpression is one of the hallmarks for cancer, and activation through promoter mutation C228T and C250T has been reported in variety of tumors and often shown to be associated with aggressive tumors. In the present study, we analyzed these two hot spot mutations in 181 primary tumors of the uterine cervix and oral cavity by direct DNA sequencing and correlated with patient's clinicopathological characteristics. We found relatively high frequency of TERT hot spot mutations in both cervical [21.4 % (30/140)] and oral [31.7 % (13/41)] squamous cell carcinomas. In cervical cancer, TERT promoter mutations were more prevalent (25 %) in human papilloma virus (HPV)-negative cases compared to HPV-positive cases (20.6 %), and both TERT promoter mutation and HPV infection were more commonly observed in advanced stage tumors (77 %). Similarly, the poor and moderately differentiated tumors of the uterine cervix had both the TERT hot spot mutations and HPV (16 and 18) at higher frequency (95.7 %). Interestingly, we observed eight homozygous mutations (six 228TT and two 250TT) only in cervical tumors, and all of them were found to be positive for high-risk HPV. To the best of our knowledge, this is the first study from India reporting high prevalence of TERT promoter mutations in primary tumors of the uterine cervix and oral cavity. Our results suggest that TERT reactivation through promoter mutation either alone or in association with the HPV oncogenes (E6 and E7) could play an important role in the carcinogenesis of cervical and oral cancers.
Energy Technology Data Exchange (ETDEWEB)
Wu, Yuting, E-mail: wuyuting1302@sina.com; Liu, Xuejiao; Zhou, Qun; Huang, Cheng; Meng, Xiaoming; Xu, Fengyun; Li, Jun, E-mail: lj@ahmu.edu.cn
2015-12-01
SIRT1 (silent information regulator 1), a conserved NAD +-dependent histone deacetylase, is closely related with various biological processes. Moreover, the important role of SIRT1 in alcoholic liver disease, nonalcoholic fatty liver and HCC had been widely reported. Recently, a novel role of SIRT1 was uncovered in organ fibrosis diseases. Here, we investigated the inhibitory effect of SIRT1 in liver fibrogenesis. SIRT1 protein was dramatically decreased in CCl4-treated mice livers. Stimulation of LX-2 cells with TGF-β1 also resulted in a significant suppression of SIRT1 protein. Nevertheless, TGF-β1-induced LX-2 cell activation was inhibited by SIRT1 plasmid, and this was accompanied by up-regulation of cell apoptosis-related proteins. Overexpression of SIRT1 also attenuated TGF-β1-induced expression of myofibroblast markers α-SMA and COL1a. However, the important characteristic of the recovery of liver fibrosis is not only the apoptosis of activated stellate cells but also the reversal of the myofibroblast-like phenotype to a quiescent-like phenotype. Restoration of SIRT1 protein was observed in the in vivo spontaneously liver fibrosis reversion model and in vitro MDI (isobutylmethylxanthine, dexamethasone, and insulin)-induced reversed stellate cells, and forced expression of SIRT1 also promoted the reversal of activated stellate cells. Furthermore, lncRNA MALAT1 (metastasis-associated lung adenocarcinoma transcript 1) was increased in liver fibrosis. RNAi-mediated suppression of MALAT1 resulted in a decrease of myofibroblast markers and restoration of SIRT1 protein. These observations suggested that SIRT1 contributed to apoptosis and reversion of activated LX-2 cells and SIRT1 might be regulated by MALAT1 in liver fibrosis. Therefore, SIRT1 could be considered as a valuable therapeutic target for translational studies of liver fibrosis. - Highlights: • This is the first report of SIRT1 expression and function in liver fibrogenesis and reversion.
Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd
2013-11-05
Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable
DEFF Research Database (Denmark)
Dukes, J.P.; King, D.P.; Alexandersen, Søren
2006-01-01
Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...
Cyclin A1 promoter hypermethylation in human papillomavirus-associated cervical cancer
International Nuclear Information System (INIS)
Kitkumthorn, Nakarin; Mutirangura, Apiwat; Yanatatsanajit, Pattamawadee; Kiatpongsan, Sorapop; Phokaew, Chureerat; Triratanachat, Surang; Trivijitsilp, Prasert; Termrungruanglert, Wichai; Tresukosol, Damrong; Niruthisard, Somchai
2006-01-01
The aim of this study was to evaluate epigenetic status of cyclin A1 in human papillomavirus-associated cervical cancer. Y. Tokumaru et al., Cancer Res 64, 5982-7 (Sep 1, 2004)demonstrated in head and neck squamous-cell cancer an inverse correlation between cyclin A1 promoter hypermethylation and TP53 mutation. Human papillomavirus-associated cervical cancer, however, is deprived of TP53 function by a different mechanism. Therefore, it was of interest to investigate the epigenetic alterations during multistep cervical cancer development. In this study, we performed duplex methylation-specific PCR and reverse transcriptase PCR on several cervical cancer cell lines and microdissected cervical cancers. Furthermore, the incidence of cyclin A1 methylation was studied in 43 samples of white blood cells, 25 normal cervices, and 24, 5 and 30 human papillomavirus-associated premalignant, microinvasive and invasive cervical lesions, respectively. We demonstrated cyclin A1 methylation to be commonly found in cervical cancer, both in vitro and in vivo, with its physiological role being to decrease gene expression. More important, this study demonstrated that not only is cyclin A1 promoter hypermethylation strikingly common in cervical cancer, but is also specific to the invasive phenotype in comparison with other histopathological stages during multistep carcinogenesis. None of the normal cells and low-grade squamous intraepithelial lesions exhibited methylation. In contrast, 36.6%, 60% and 93.3% of high-grade squamous intraepithelial lesions, microinvasive and invasive cancers, respectively, showed methylation. This methylation study indicated that cyclin A1 is a potential tumor marker for early diagnosis of invasive cervical cancer
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We
Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin
2017-04-01
Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.
International Nuclear Information System (INIS)
Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.
2003-01-01
Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span
Modulation of hepatic stellate cells and reversibility of hepatic fibrosis
Energy Technology Data Exchange (ETDEWEB)
Huang, Yu, E-mail: 1293363632@QQ.com [Faculty of Graduate Studies of Guangxi University of Chinese Medicine, Nanning 530001, Guangxi Zhuang Autonomous Region (China); Deng, Xin, E-mail: Hendly@163.com [Ruikang Hospital Affiliated to Guangxi University of Chinese Medicine, 10 East China Road, Nanning 530011, Guangxi Zhuang Autonomous Region (China); Liang, Jian, E-mail: lj99669@163.com [Guangxi University of Chinese Medicine, Nanning 530001, Guangxi Zhuang Autonomous Region (China)
2017-03-15
Hepatic fibrosis (HF) is the pathological component of a variety of chronic liver diseases. Hepatic stellate cells (HSC) are the main collagen-producing cells in the liver and their activation promotes HF. If HSC activation and proliferation can be inhibited, HF occurrence and development can theoretically be reduced and even reversed. Over the past ten years, a number of studies have addressed this process, and here we present a review of HSC modulation and HF reversal. - Highlights: • We present a review of the modulation of hepatic stellate cells (HSC) and reversibility of hepatic fibrosis (HF). • HSC are the foci of HF occurrence and development, HF could be prevented and treated by modulating HSC. • If HSC activation and proliferation can be inhibited, HF could theoretically be inhibited and even reversed. • Prevention or reversal of HSC activation, or promotion of HSC apoptosis, immune elimination, and senescence may prevent, inhibit or reverse HF.
Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa
Directory of Open Access Journals (Sweden)
Aline Aki Tanikawa
2013-08-01
Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.
Lee, Kyung Ju; Lee, Kwang Youl; Lee, You Mie
2010-05-01
Reversion-inducing cysteine-rich protein with Kazal motifs (RECK) is a tumor suppressor and the suppression of RECK is induced by Ras or Her-2/neu oncogenes. However, regulation of RECK under hypoxic microenvironment is largely unknown. Here, we identified that hypoxia significantly downregulates RECK mRNA and protein expression using semiquantitative RT-PCR, real-time RT-PCR and western blot analysis. This repression was reversed by the HDAC inhibitor, trichostatin A (TSA) and HIF-1 inhibitor, YC-1. Hypoxia-induced downregulation of RECK was abolished by knockdown of HDAC1 and HIF-1alpha with respective small interfering RNAs (siRNAs), whereas overexpression of HDAC1 and HIF-1alpha suppressed RECK expression similar to the level under hypoxic conditions. Transfection of a deletion mutant of the second reverse HRE (rHRE2, -2345 to -2333) site of RECK promoter completely removed RECK suppression under hypoxia, indicating that the rHRE2 site is responsible for the inhibition of RECK. Chromatin immunoprecipitation and DNA affinity precipitation assays demonstrated that HDAC1 and HIF-1alpha were recruited to the rHRE2 region of RECK promoter under hypoxic conditions, but the treatment of TSA or YC-1 inhibited their binding to the rHRE2 site. Moreover, TSA and YC-1 inhibited hypoxia-induced cancer cell migration, invasion and MMPs secretion. Taken together, we can conclude that hypoxia induces RECK downregulation through the recruitment of HDAC1 and HIF-1alpha to the rHRE2 site in the promoter and the inhibition of hypoxic RECK silencing would be a therapeutic and preventive target for early tumorigenesis. Copyright 2010 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Yang, Yan [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China); The First Affiliated Hospital of ChengDu Medical College, Department of Radiology, ChengDu (China); Gong, Ming-fu; Yang, Hua; Zhang, Song; Wang, Guang-xian; Su, Tong-sheng; Wen, Li; Zhang, Dong [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China)
2016-11-15
Using the human telomerase reverse transcriptase (hTERT) promoter and the modified ferritin heavy chain (Fth) reporter gene, reporter gene expression for MRI was examined in telomerase positive and negative tumour cells and xenografts. Activity of the reporter gene expression vector Lenti-hTERT-Fth1-3FLAG-Puro was compared to constitutive CMV-driven expression and to the untransfected parental control in five tumour cell lines: A549, SKOV3, 293T, U2OS and HPDLF. In vitro, transfected cells were evaluated for FLAG-tagged protein expression, iron accumulation and transverse relaxation. In vivo, tumours transduced by lentiviral vector injection were imaged using T2*WI. Changes in tumour signal intensity were validated by histology. Only telomerase positive tumour cells expressed FLAG-tagged Fth and displayed an increase in R2* above the parental control, with a corresponding change in T2*WI. In addition, only telomerase positive tumours, transduced by injection of the reporter gene expression construct, exhibited a change in signal intensity on T2*WI. Tumour histology verified the expression of FLAG-tagged Fth and iron accumulation in telomerase positive tissue. Reporter gene expression for MRI, using the Fth reporter and the hTERT promoter, may be a useful strategy for the non-invasive diagnosis of many types of cancer. (orig.)
The Reverse Supply Chain: Configuration, Integration and Profitability
DEFF Research Database (Denmark)
Gobbi, Chiara
2008-01-01
This thesis presents the results of a qualitative investigation that has been conducted in order to enhance knowledge of the reverse supply chain management field. Two aspects of the reverse flow need to be taken into consideration: the importance of introducing mechanisms that promote the circui......This thesis presents the results of a qualitative investigation that has been conducted in order to enhance knowledge of the reverse supply chain management field. Two aspects of the reverse flow need to be taken into consideration: the importance of introducing mechanisms that promote...... the circuitry of resources in order to protect the environment, and the increasing awareness that if strategically managed, the reverse chain represents an opportunity for profit generation and for improving the competitive position of a firm. In the first case, the main stakeholders are represented...... within the 27 Member States, reaching approximately 14-24 Kg. per inhabitant in Western Europe and the 6-12 Kg. per inhabitant in the New Member States. In the second case, the main stakeholder is the firm, the producer that has the possibility of exploring new opportunities to achieve a competitive...
Kaur, Simarjot; Mishra, Mukti Nath; Tripathi, Anil K
2009-10-01
Carbonic anhydrase (CA; [EC 4.2.1.1]) is a ubiquitous enzyme catalysing the reversible hydration of CO(2) to bicarbonate, a reaction that supports various biochemical and physiological functions. Genome analysis of Azospirillum brasilense, a nonphotosynthetic, nitrogen-fixing, rhizobacterium, revealed an ORF with homology to beta-class carbonic anhydrases (CAs). Biochemical characteristics of the beta-class CA of A. brasilense, analysed after cloning the gene (designated as bca), overexpressing in Escherichia coli and purifying the protein by affinity purification, revealed that the native recombinant enzyme is a homotetramer, inhibited by the known CA inhibitors. CA activity in A. brasilense cell extracts, reverse transcriptase (RT)-PCR and Western blot analyses showed that bca was constitutively expressed under aerobic conditions. Lower beta-galactosidase activity in A. brasilense cells harbouring bca promoter: lacZ fusion during the stationary phase or during growth on 3% CO(2) enriched air or at acidic pH indicated that the transcription of bca was downregulated by the stationary phase, elevated CO(2) levels and acidic pH conditions. These observations were also supported by RT-PCR analysis. Thus, beta-CA in A. brasilense seems to be required for scavenging CO(2) from the ambient air and the requirement of CO(2) hydration seems to be higher for the cultures growing exponentially at neutral to alkaline pH.
Detection of human telomerase reverse transcriptase messenger ...
African Journals Online (AJOL)
Introduction and Objectives: Bladder cancer is an important national health problem as it is the leading cancer in men in Egypt. Cystoscopy and biopsy, currently remains the gold standard procedure for diagnosis, yet, it is invasive and costly. Urinary cytopathology remains to be the only non-invasive alternative method for ...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India.
Satyanarayana, Kanikaram; Srivastava, Sadhana
2010-01-19
The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable
Arun, Muthukrishnan; Subramanyam, Kondeti; Theboral, Jeevaraj; Sivanandhan, Ganeshan; Rajesh, Manoharan; Kapil Dev, Gnanajothi; Jaganath, Balusamy; Manickavasagam, Markandan; Girija, Shanmugam; Ganapathi, Andy
2014-02-01
Soybean oil contains high levels of tocopherols which are an important source of vitamin E in human diet. The conversion of γ- to α-tocopherol catalyzed by γ-tocopherol methyltransferase (γ-TMT) is found to be the rate limiting factor in soybean which influences the tocopherol composition. Using Agrobacterium-mediated transformation, we overexpressed the γ-TMT gene of Perilla frutescens under the control of the seed-specific promoter vicillin in cultivar Pusa 16. Transgene integration and expression was confirmed in five independently transformed GUS positive soybean plants by polymerase chain reaction (PCR), Southern hybridization, and reverse transcriptase-PCR (RT-PCR). High-performance liquid chromatography (HPLC) analysis showed that overexpression of Pf-γ-TMT resulted in efficient conversion of γ-tocopherol to α-tocopherol and concomitant increase in seed α-tocopherol content in RT-PCR positive plants. The protocol was successfully applied to three more cultivars PK 416, Gujarat soybean 1, and VL soya 1 in which seeds of transformed plants showed elevated level of α-tocopherol than wild-type seeds.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa
2012-11-01
Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.
Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William
2007-01-01
Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...
Directory of Open Access Journals (Sweden)
Alena Klapalová
2013-01-01
Full Text Available One of the of the key barriers that hampers effective and efficient management of reverse flows detected within a number of empirical surveys and case studies focused on reverse logistics and/or return management is business (organisational policy, specifically lack of policy, deficiency in existing policy or inferior policy. Despite this fact, there is a gap in literature which would show some evidence from practice that innovative reverse logistics policy both can pay off and is associated with certain aspects of reverse logistics management. Such proof can have several implications. It can support the call for better understanding and more research of the linkages of reverse logistics with other corporate functions, promote the acceptation of strategic character of reverse logistics and stress the role of RL policy within the rest of overall corporate management.The aim of this paper is to contribute and to enrich the existing body of knowledge concerning the above-mentioned gap through presentation of survey results that was realized in 2012 among managers of 244 Czech firms. The results demonstrate the statistically significant association between the innovativeness of RL policy and profitability of firms, quality of RL planning, perception of RL importance, level of RL knowledge and perception of product innovation importance for firms’ competitiveness and frequency of product innovation. They also reveal statistically significant differences between firms with conservative and innovative RL policy and the perceived existence of some barriers to manage RL.
Directory of Open Access Journals (Sweden)
Chen Hao-tai
2011-10-01
Full Text Available Abstract A reverse transcriptase loop-mediated isothermal amplification (RT-LAMP assay was rapidly used to detect serotype Asia 1 of foot-and-mouth disease virus (FMDV within 45 min at 61°C. All FMDV serotype Asia 1 reference strains were positive by RT-LAMP, while other viruses such as FMDV serotypes O, C, A and classical swine fever virus, swine vesicular disease virus, porcine reproductive and respiratory syndrome virus and Japanese encephalitis virus remained negative. Furthermore, FMDV sreotype Asia 1 positive samples were able to detect by RT-LAMP assay. This RT-LAMP assay may be suitable particularly for diagnosis of FMDV serotype Asia 1 infection in field stations.
Directory of Open Access Journals (Sweden)
Raheleh Farahzadi
Full Text Available The use of mesenchymal stem cells (MSCs for cell therapy and regenerative medicine has received widespread attention over the past few years, but their application can be complicated by factors such as reduction in proliferation potential, the senescent tendency of the MSCs upon expansion and their age-dependent decline in number and function. It was shown that all the mentioned features were accompanied by a reduction in telomerase activity and telomere shortening. Furthermore, the role of epigenetic changes in aging, especially changes in promoter methylation, was reported. In this study, MSCs were isolated from the adipose tissue with enzymatic digestion. In addition, immunocytochemistry staining and flow cytometric analysis were performed to investigate the cell-surface markers. In addition, alizarin red-S, sudan III, toluidine blue, and cresyl violet staining were performed to evaluate the multi-lineage differentiation of hADSCs. In order to improve the effective application of MSCs, these cells were treated with 1.5 × 10-8 and 2.99 × 10-10 M of ZnSO4 for 48 hours. The length of the absolute telomere, human telomerase reverse transcriptase (hTERT gene expression, telomerase activity, the investigation of methylation status of the hTERT gene promoter and the percentage of senescent cells were analyzed with quantitative real-time PCR, PCR-ELISA TRAP assay, methylation specific PCR (MSP, and beta-galactosidase (SA-β-gal staining, respectively. The results showed that the telomere length, the hTERT gene expression, and the telomerase activity had significantly increased. In addition, the percentage of senescent cells had significantly decreased and changes in the methylation status of the CpG islands in the hTERT promoter region under treatment with ZnSO4 were seen. In conclusion, it seems that ZnSO4 as a proper antioxidant could improve the aging-related features due to lengthening of the telomeres, increasing the telomerase gene expression
Evaluation of oxidative DNA damage promoted by storage in sperm from sex-reversed rainbow trout.
Pérez-Cerezales, S; Martínez-Páramo, S; Cabrita, E; Martínez-Pastor, F; de Paz, P; Herráez, M P
2009-03-01
Short-term storage and cryopreservation of sperm are two common procedures in aquaculture, used for routine practices in artificial insemination reproduction and gene banking, respectively. Nevertheless, both procedures cause injuries affecting sperm motility, viability, cell structure and DNA stability, which diminish reproductive success. DNA modification is considered extremely important, especially when sperm storage is carried out with gene banking purposes. DNA damage caused by sperm storage is not well characterized and previous studies have reported simple and double strand breaks that have been attributed to oxidative events promoted by the generation of free radicals during storage. The objective of this study was to reveal DNA fragmentation and to explore the presence of oxidized bases that could be produced by oxidative events during short-term storage and cryopreservation in sex-reversed rainbow trout (Oncorhynchus mykiss) spermatozoa. Sperm from six males was analyzed separately. Different aliquots of the samples were stored 2h (fresh) or 5 days at 4 degrees C or were cryopreserved. Then spermatozoa were analyzed using the Comet assay, as well as combining this method with digestion with two endonucleases from Escherichia coli (Endonuclease III, that cut in oxidized cytosines, and FPG, cutting in oxidized guanosines). Both storage procedures yielded DNA fragmentation, but only short-term storage oxidative events were clearly detected, showing that oxidative processes affect guanosines rather than cytosines. Cryopreservation increases DNA fragmentation but the presence of oxidized bases was not noticed, suggesting that mechanisms other than oxidative stress could be involved in DNA fragmentation promoted by freezing.
Directory of Open Access Journals (Sweden)
Pedersen Niels C
2007-04-01
Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be
DEFF Research Database (Denmark)
Chen, Yun; Pai, Athma A; Herudek, Jan
2016-01-01
Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...
Cheng, Chia-Wei; Adams, Gregor B; Perin, Laura; Wei, Min; Zhou, Xiaoying; Lam, Ben S; Da Sacco, Stefano; Mirisola, Mario; Quinn, David I; Dorff, Tanya B; Kopchick, John J; Longo, Valter D
2014-06-05
Immune system defects are at the center of aging and a range of diseases. Here, we show that prolonged fasting reduces circulating IGF-1 levels and PKA activity in various cell populations, leading to signal transduction changes in long-term hematopoietic stem cells (LT-HSCs) and niche cells that promote stress resistance, self-renewal, and lineage-balanced regeneration. Multiple cycles of fasting abated the immunosuppression and mortality caused by chemotherapy and reversed age-dependent myeloid-bias in mice, in agreement with preliminary data on the protection of lymphocytes from chemotoxicity in fasting patients. The proregenerative effects of fasting on stem cells were recapitulated by deficiencies in either IGF-1 or PKA and blunted by exogenous IGF-1. These findings link the reduced levels of IGF-1 caused by fasting to PKA signaling and establish their crucial role in regulating hematopoietic stem cell protection, self-renewal, and regeneration. Copyright © 2014 Elsevier Inc. All rights reserved.
Chemical reactions in reverse micelle systems
Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.
1993-08-24
This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.
Management of HIV During Pregnancy
Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M
2016-01-01
According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...
Colour break in reverse bicolour daffodils is associated with the presence of Narcissus mosaic virus
Directory of Open Access Journals (Sweden)
Davies Kevin M
2011-08-01
Full Text Available Abstract Background Daffodils (Narcissus pseudonarcissus are one of the world's most popular ornamentals. They also provide a scientific model for studying the carotenoid pigments responsible for their yellow and orange flower colours. In reverse bicolour daffodils, the yellow flower trumpet fades to white with age. The flowers of this type of daffodil are particularly prone to colour break whereby, upon opening, the yellow colour of the perianth is observed to be 'broken' into patches of white. This colour break symptom is characteristic of potyviral infections in other ornamentals such as tulips whose colour break is due to alterations in the presence of anthocyanins. However, reverse bicolour flowers displaying colour break show no other virus-like symptoms such as leaf mottling or plant stunting, leading some to argue that the carotenoid-based colour breaking in reverse bicolour flowers may not be caused by virus infection. Results Although potyviruses have been reported to cause colour break in other flower species, enzyme-linked-immunoassays with an antibody specific to the potyviral family showed that potyviruses were not responsible for the occurrence of colour break in reverse bicolour daffodils. Colour break in this type of daffodil was clearly associated with the presence of large quantities of rod-shaped viral particles of lengths 502-580 nm in tepals. Sap from flowers displaying colour break caused red necrotic lesions on Gomphrena globosa, suggesting the presence of potexvirus. Red necrotic lesions were not observed in this indicator plant when sap from reverse bicolour flowers not showing colour break was used. The reverse transcriptase polymerase reactions using degenerate primers to carla-, potex- and poty-viruses linked viral RNA with colour break and sequencing of the amplified products indicated that the potexvirus Narcissisus mosaic virus was the predominant virus associated with the occurrence of the colour break
Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B
1993-08-01
Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.
Role reversal and problem solving in international negotiations: the Partial Nuclear Test Ban case
International Nuclear Information System (INIS)
King, T.D.
1978-01-01
To facilitate finding bargaining space and to reinforce cooperative potential, a number of analysts have promoted the use of role reversal and problem solving. Role reversal involves restating the positions of one's adversary to demonstrate understanding and to develop empathy, while problem solving involves searching for alternatives that promote joint interests. The case of the negotiations in the Eighteen Nation Disarmament Conference from 1962--1963 leading to the Partial Nuclear Test Ban Treaty provided the context for examining bargaining relationships involving role reversal and problem solving. Interactions among the United States, the United Kingdom, and the Soviet Union, as recorded in transcripts of 112 sessions, were coded using Bargaining Process Analysis II, a content analysis instrument used to classify negotiation behaviors. Role reversal was measured by the frequency of paraphrases of the adversary's positions. Problem solving was measured by the frequency of themes promoting the exploration of alternatives and the search for mutually beneficial outcomes. The findings on the use of paraphrasing suggest that it can be used to restrict exploration as well as to promote it. The exploratory focus of problem solving was somewhat limited by its use in association with demands, suggesting that problem solving was interpreted as a sign of weakness
The history of antiretrovirals: key discoveries over the past 25 years.
De Clercq, Erik
2009-09-01
Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.
Wang, Na; Liu, Tiantian; Sofiadis, Anastasios; Juhlin, C Christofer; Zedenius, Jan; Höög, Anders; Larsson, Catharina; Xu, Dawei
2014-10-01
The telomerase reverse transcriptase (TERT) promoter mutations C228T and C250T have been found in many malignancies, including in thyroid carcinomas. However, it is unclear how early these mutations occur in thyroid tumorigenesis. The study included primary tumors from 58 patients initially diagnosed with follicular thyroid adenoma (FTA), a benign entity, 18 with atypical FTA (AFTA) having an uncertain malignant potential, and 52 with follicular thyroid carcinoma (FTC). Sanger sequencing was used to investigate the mutational status of the TERT promoter. Telomere length and TERT messenger RNA (mRNA) expression were determined using quantitative polymerase chain reaction (PCR). Telomerase activity was assessed using a Telomerase PCR enzyme-linked immunosorbent assay kit. The C228T mutation was identified in 1 of 58 FTA (2%) and 3 of 18 AFTA (17%) samples. These 4 tumors all expressed TERT mRNA and telomerase activity, whereas the majority of C228T-negative adenomas lacked TERT expression (C228T versus wild-type, P = .008). The C228T mutation was associated with NRAS gene mutations (P = .016). The patient with C228T-mutated FTA later developed a scar recurrence and died of FTC, whereas none of the remaining 57 patients with FTA had recurrence. No recurrence occurred in 3 patients with AFTA who carried C228T during the follow-up period (36-285 months). Nine of the 52 FTCs (17%) exhibited the TERT mutation (8 of 9 C228T and 1 of 9 C250T), and the presence of the mutation was associated with shorter patient survival. TERT promoter mutations may occur as an early genetic event in thyroid follicular tumors that have not developed malignant features on routine histopathological workup. © 2014 American Cancer Society.
Foitzik, Kerstin; Krause, Karoline; Conrad, Franziska; Nakamura, Motonobu; Funk, Wolfang; Paus, Ralf
2006-01-01
The prototypic pituitary hormone prolactin (PRL) exerts a wide variety of bioregulatory effects in mammals and is also found in extrapituitary sites, including murine skin. Here, we show by reverse transcriptase-polymerase chain reaction and immunohistology that, contrary to a previous report, human skin and normal human scalp hair follicles (HFs), in particular, express both PRL and PRL receptors (PRL-R) at the mRNA and protein level. PRL and PRL-R immunoreactivity can be detected in the epi...
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
International Nuclear Information System (INIS)
Van Dijk, A.A.; Huismans, H.
1982-01-01
Virions of bluetongue virus (BTV), epizootic haemorrhagic disease virus (EHDV) and African horsesickness virus (AHSV) can be converted to core particles by treatment with chymotrypsin and magnesium. The conversion is characterized by the removal of the 2 outer capsid polypeptides of the virion. The loss of these 2 proteins results in an increase in density from 1,36 g/ml to 1,40 g/ml on CsCl gradients. The BTV, EHDV and AHSV core particles have an associated double-stranded RNA dependent RNA transcriptase that appears to transcribe mRNA optimally at 28 degrees Celsius. It was found, at least in the case of BTV, that this low temperature preference is not an intrinsic characteristic of the transcriptase, but is due to a temperature-dependent inhibition of transcription at high core concentrations
Nanostructured graphite-induced destabilization of LiBH4 for reversible hydrogen storage
CSIR Research Space (South Africa)
Wang, K
2016-11-01
Full Text Available been conducted to gain insight into the promoting effect of nano-G on the reversible dehydrogenation of the LiBH(sub4). Our study found that nano-G exerts its promoting effect via interaction with LiBH(sub4) and as grinding aid....
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
das Neves, José; Sarmento, Bruno; Amiji, Mansoor M; Bahia, Maria Fernanda
2010-06-05
The objective of this work was to develop and validate a rapid reversed-phase (RP) high-performance liquid chromatography (HPLC) method for the in vitro pharmaceutical characterization of dapivirine-loaded polymeric nanoparticles. Chromatographic runs were performed on a RP C18 column with a mobile phase comprising acetonitrile-0.5% (w/v) triethanolamine solution in isocratic mode (80:20, v/v) at a flow rate of 1 ml/min. Dapivirine was detected at a wavelength of 290 nm. The method was shown to be specific, linear in the range of 1-50 microg/ml (R(2)=0.9998), precise at the intra-day and inter-day levels as reflected by the relative standard deviation values (less than 0.85%), accurate (recovery rate of 100.17+/-0.35%), and robust to changes in the mobile phase and column brand. The detection and quantitation limits were 0.08 and 0.24 microg/ml, respectively. The method was successfully used to determine the loading capacity and association efficiency of dapivirine in poly(lactic-co-glycolic acid)-based nanoparticles and its in vitro release. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Giri, Shibashish; Bader, Augustinus
2014-09-01
Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a
Dastan, Maryam; Najafzadeh, Nowruz; Abedelahi, Ali; Sarvi, Mohammadreza; Niapour, Ali
2016-12-01
Minoxidil and human platelet lysate (HPL) are commonly used to treat patients with hair loss. However, the roles of HPL versus minoxidil in hair follicle biology largely remain unknown. Here, we hypothesized that bulge and dermal papilla (DP) cells may express specific genes, including Kras, Erk, Akt, Shh and β-catenin after exposure to minoxidil or HPL. The mouse hair follicles were isolated on day 10 after depilation and bulge or DP regions were dissected. The bulge and DP cells were cultured for 14days in DMEM/F12 medium. Then, the cells were treated with 100μM minoxidil and 10% HPL for 10 days. Nuclear morphology was identified using DAPi staining. Reverse transcriptase and real-time polymerase chain reaction (PCR) analysis were also performed to examine the expression of Kras, Erk, Akt, Shh and β-catenin mRNA levels in the treated bulge and DP regions after organ culture. Here, we found that minoxidil influences bulge and DP cell survival (Pminoxidil treatment in both bulge and DP cells. HPL mediated Erk upregulation in both bulge and DP cells (Pminoxidil-treated bulge cells. In contrast, the expression of β-cateinin and Shh in the DP cells was not meaningfully increased after treatment with HPL. Our results suggest that minoxidil and HPL can promote hair growth by activating the main anagen inducing signaling pathways. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Bioactive silica nanoparticles reverse age-associated bone loss in mice.
Weitzmann, M Neale; Ha, Shin-Woo; Vikulina, Tatyana; Roser-Page, Susanne; Lee, Jin-Kyu; Beck, George R
2015-05-01
We recently reported that in vitro, engineered 50nm spherical silica nanoparticles promote the differentiation and activity of bone building osteoblasts but suppress bone-resorbing osteoclasts. Furthermore, these nanoparticles promote bone accretion in young mice in vivo. We have now investigated the capacity of these nanoparticles to reverse bone loss in aged mice, a model of human senile osteoporosis. Aged mice received nanoparticles weekly and bone mineral density (BMD), bone structure, and bone turnover were quantified. Our data revealed a significant increase in BMD, bone volume, and biochemical markers of bone formation. Biochemical and histological examinations failed to identify any abnormalities caused by nanoparticle administration. Our studies demonstrate that silica nanoparticles effectively blunt and reverse age-associated bone loss in mice by a mechanism involving promotion of bone formation. The data suggest that osteogenic silica nanoparticles may be a safe and effective therapeutic for counteracting age-associated bone loss. Osteoporosis poses a significant problem in the society. Based on their previous in-vitro findings, the authors' group investigated the effects of spherical silica nanoparticles in reversing bone loss in a mouse model of osteoporosis. The results showed that intra-peritoneal injections of silica nanoparticles could increase bone mineral density, with little observed toxic side effects. This novel method may prove important in future therapy for combating osteoporosis. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Jeffrey J Wallin
Full Text Available The PTEN/PI3K pathway is commonly mutated in cancer and therefore represents an attractive target for therapeutic intervention. To investigate the primary phenotypes mediated by increased pathway signaling in a clean, patient-relevant context, an activating PIK3CA mutation (H1047R was knocked-in to an endogenous allele of the MCF10A non-tumorigenic human breast epithelial cell line. Introduction of an endogenously mutated PIK3CA allele resulted in a marked epithelial-mesenchymal transition (EMT and invasive phenotype, compared to isogenic wild-type cells. The invasive phenotype was linked to enhanced PIP(3 production via a S6K-IRS positive feedback mechanism. Moreover, potent and selective inhibitors of PI3K were highly effective in reversing this phenotype, which is optimally revealed in 3-dimensional cell culture. In contrast, inhibition of Akt or mTOR exacerbated the invasive phenotype. Our results suggest that invasion is a core phenotype mediated by increased PTEN/PI3K pathway activity and that therapeutic agents targeting different nodes of the PI3K pathway may have dramatic differences in their ability to reverse or promote cancer metastasis.
Locker, Morgane; Kellermann, Odile; Boucquey, Marie; Khun, Huot; Huerre, Michel; Poliard, Anne
2004-01-01
The pluripotent mesoblastic C1 cell line was used under serum-free culture conditions to investigate how paracrine and autocrine signals cooperate to drive chondrogenesis. Sequential addition of two systemic hormones, dexamethasone and triiodothyronine, permits full chondrogenic differentiation. The cell intrinsic activation of the BMP signaling pathway and Sox9 expression occurring on mesoblastic condensation is insufficient for recruitment of the progenitors. Dexamethasone-dependent Sox9 upregulation is essential for chondrogenesis. Differentiation of lineage stem cells relies on cell autonomous regulations modulated by external signals. We used the pluripotent mesoblastic C1 cell line under serum-free culture conditions to investigate how paracrine and autocrine signals cooperate to induce differentiation of a precursor clone along the chondrogenic lineage. C1 cells, cultured as aggregates, were induced toward chondrogenesis by addition of 10(-7) M dexamethasone in serum-free medium. After 30 days, dexamethasone was replaced by 10 nM triiodothyronine to promote final hypertrophic conversion. Mature and hypertrophic phenotypes were characterized by immunocytochemistry using specific antibodies against types II and X collagens, respectively. Type II collagen, bone morphogenetic proteins (BMPs), BMP receptors, Smads, and Sox9 expression were monitored by reverse transcriptase-polymerase chain reaction (RT-PCR), Northern blot, and/or Western blot analysis. Once C1 cells have formed nodules, sequential addition of two systemic hormones is sufficient to promote full chondrogenic differentiation. In response to dexamethasone, nearly 100% of the C1 precursors engage in chondrogenesis and convert within 30 days into mature chondrocytes, which triggers a typical cartilage matrix. On day 25, a switch in type II procollagen mRNA splicing acted as a limiting step in the acquisition of the mature chondrocyte phenotype. On day 30, substitution of dexamethasone with
Müllers, Erik; Uhlig, Tobias; Stirnnagel, Kristin; Fiebig, Uwe; Zentgraf, Hanswalter; Lindemann, Dirk
2011-02-01
Prototype foamy virus (PFV) Gag lacks the characteristic orthoretroviral Cys-His motifs that are essential for various steps of the orthoretroviral replication cycle, such as RNA packaging, reverse transcription, infectivity, integration, and viral assembly. Instead, it contains three glycine-arginine-rich boxes (GR boxes) in its C terminus that putatively represent a functional equivalent. We used a four-plasmid replication-deficient PFV vector system, with uncoupled RNA genome packaging and structural protein translation, to analyze the effects of deletion and various substitution mutations within each GR box on particle release, particle-associated protein composition, RNA packaging, DNA content, infectivity, particle morphology, and intracellular localization. The degree of viral particle release by all mutants was similar to that of the wild type. Only minimal effects on Pol encapsidation, exogenous reverse transcriptase (RT) activity, and genomic viral RNA packaging were observed. In contrast, particle-associated DNA content and infectivity were drastically reduced for all deletion mutants and were undetectable for all alanine substitution mutants. Furthermore, GR box I mutants had significant changes in particle morphology, and GR box II mutants lacked the typical nuclear localization pattern of PFV Gag. Finally, it could be shown that GR boxes I and III, but not GR box II, can functionally complement each other. It therefore appears that, similar to the orthoretroviral Cys-His motifs, the PFV Gag GR boxes are important for RNA encapsidation, genome reverse transcription, and virion infectivity as well as for particle morphogenesis.
Baaße, Annemarie; Juerß, Dajana; Reape, Elaine; Manda, Katrin; Hildebrandt, Guido
2018-04-01
Partial breast irradiation of early breast cancer patients after lumpectomy and the use of endogenous adipose tissue (AT) for breast reconstruction are promising applications to reduce the side effects of breast cancer therapy. This study tries to investigate the possible risks associated with these therapeutic approaches. It also examines the influence of adipose derived stem cells (ADSCs) as part of the breast cancer microenvironment, and endogenous AT on breast cancer cells following radiation therapy. ADSCs, isolated from human reduction mammoplasties of healthy female donors, exhibited multilineage capacity and specific surface markers. The promoting effects of ADSCs on the growth and survival fraction of breast cancer cells were reversed by treatment with high (8 Gy) or medium (2 Gy) radiation doses. In addition, a suppressing influence on breast cancer growth could be detected by co-culturing with irradiated ADSCs (8 Gy). Furthermore the clonogenic survival of unirradiated tumor cells was reduced by medium of irradiated ADSCs. In conclusion, radiation therapy changed the interactions of ADSCs and breast cancer cells. On the basis of our work, the importance of further studies to exclude potential risks of ADSCs in regenerative applications and radiotherapy has been emphasized.
The macrophage scavenger receptor CD163
DEFF Research Database (Denmark)
Nielsen, Marianne Jensby; Madsen, Mette; Møller, Holger J
2006-01-01
CD163 is the monocyte/macrophage-specific receptor for haptoglobin-hemoglobin (Hp-Hb) complexes. The cytoplasmic tail of human CD163 exists as a short tail variant and two long tail variants. Reverse transcriptase-polymerase chain reaction analysis indicated that all three CD163 variants are subs......CD163 is the monocyte/macrophage-specific receptor for haptoglobin-hemoglobin (Hp-Hb) complexes. The cytoplasmic tail of human CD163 exists as a short tail variant and two long tail variants. Reverse transcriptase-polymerase chain reaction analysis indicated that all three CD163 variants...
DEFF Research Database (Denmark)
Uhrbrand, Katrine; Myrmel, Mette; Maunula, Leena
2010-01-01
Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently to evalu......Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently...
Probenazole treatment inhibits anthocyanins biosynthesis via ...
African Journals Online (AJOL)
ELO
2012-01-05
Jan 5, 2012 ... State Key Laboratory of Genetic Engineering and Institute of Plant Biology, School of Life .... was reverse-transcribed with SuperScript reverse transcriptase ..... treated plant have more drought and salt stress tolerance.
Integrating reverse logistics and eco-design: a proposal for a new framework
Directory of Open Access Journals (Sweden)
Felipe Kich Gontijo
2014-07-01
Full Text Available The concepts of Reverse Logistics and Eco-design are discussed in this paper, suggesting that these applications are often treated differently, thus not being able to achieve a higher performance in relation to environmental sustainability. The reason is most reverse logistics applications have a repairer action, since their waste generation is not planned along with product design. The proposal shows how the two concepts can work together, describing the time of each application.Unfolding the two concepts into reverse channels concerning logistics and life cycle analysis of the product as per eco-design, an application model has been developed, promoting integration between the two practices, so that the reverse supply chain is planned along with the product.The result is the development of a model for implementing reverse logistics integrating eco-design, thus optimizing the reverse flow of waste.
Artificial Self-Sufficient P450 in Reversed Micelles
Directory of Open Access Journals (Sweden)
Teruyuki Nagamune
2010-04-01
Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.
Directory of Open Access Journals (Sweden)
Kashanchi Fatah
2006-01-01
Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their
Telomere-independent functions of telomerase in nuclei, cytoplasm, and mitochondria
Energy Technology Data Exchange (ETDEWEB)
Chiodi, Ilaria; Mondello, Chiara, E-mail: mondello@igm.cnr.it [Istituto di Genetica Molecolare, Consiglio Nazionale delle Ricerche, Pavia (Italy)
2012-09-28
Telomerase canonical activity at telomeres prevents telomere shortening, allowing chromosome stability and cellular proliferation. To perform this task, the catalytic subunit (telomerase reverse transcriptase, TERT) of the enzyme works as a reverse transcriptase together with the telomerase RNA component (TERC), adding telomeric repeats to DNA molecule ends. Growing evidence indicates that, besides the telomeric-DNA synthesis activity, TERT has additional functions in tumor development and is involved in many different biological processes, among which cellular proliferation, gene expression regulation, and mitochondrial functionality. TERT has been shown to act independently of TERC in the Wnt-β-catenin signaling pathway, regulating the expression of Wnt target genes, which play a role in development and tumorigenesis. Moreover, TERT RNA-dependent RNA polymerase activity has been found, leading to the genesis of double-stranded RNAs that act as precursor of silencing RNAs. In mitochondria, a TERT TERC-independent reverse transcriptase activity has been described that could play a role in the protection of mitochondrial integrity. In this review, we will discuss some of the extra-telomeric functions of telomerase.
Reverse case study: to think like a nurse.
Beyer, Deborah A
2011-01-01
Reverse case study is a collaborative, innovative, active learning strategy that nurse educators can use in the classroom. Groups of students develop a case study and a care plan from a list of medications and a short two- to three-sentence scenario. The students apply the nursing process to thoroughly develop a complete case study written as a concept map. The strategy builds on previous learned information and applies the information to new content, thus promoting critical thinking and problem solving. Reverse case study has been used in both associate and baccalaureate nursing degree theory courses to generate discussion and assist students in thinking like a nurse. 2011, SLACK Incorporated.
Greater mindful eating practice is associated with better reversal learning
Janssen, Lieneke K.; Duif, Iris; Loon, Van Ilke; Vries, De Jeanne H.M.; Speckens, Anne E.M.; Cools, Roshan; Aarts, Esther
2018-01-01
Mindfulness-based interventions are thought to reduce compulsive behavior such as overeating by promoting behavioral flexibility. Here the main aim was to provide support for mindfulness-mediated improvements in reversal learning, a direct measure of behavioral flexibility. We investigated
Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002
Directory of Open Access Journals (Sweden)
Watitpun Chotip
2003-03-01
Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.
Tenofovir-related nephrotoxicity: case report and review of the literature.
James, Christopher W; Steinhaus, Mary C; Szabo, Susan; Dressier, Robert M
2004-03-01
Tenofovir is a nucleotide reverse transcriptase inhibitor for treatment of human immunodeficiency virus (HIV) infection. Several cases of renal failure associated with tenofovir therapy recently have been reported. A 54-year-old man with HIV experienced decreasing renal function and Fanconi's syndrome secondary to tenofovir therapy. His condition gradually improved after discontinuation of the drug. The available medical literature for reported cases of tenofovir-related nephrotoxicity indicates that this complication is apparently rare. However, our case report and literature review underscore the importance of monitoring renal function when treating patients with any nucleotide reverse transcriptase inhibitor.
Hermann, Patrick C; Sancho, Patricia; Cañamero, Marta; Martinelli, Paola; Madriles, Francesc; Michl, Patrick; Gress, Thomas; de Pascual, Ricardo; Gandia, Luis; Guerra, Carmen; Barbacid, Mariano; Wagner, Martin; Vieira, Catarina R; Aicher, Alexandra; Real, Francisco X; Sainz, Bruno; Heeschen, Christopher
2014-11-01
Although smoking is a leading risk factor for pancreatic ductal adenocarcinoma (PDAC), little is known about the mechanisms by which smoking promotes initiation or progression of PDAC. We studied the effects of nicotine administration on pancreatic cancer development in Kras(+/LSLG12Vgeo);Elas-tTA/tetO-Cre (Ela-KRAS) mice, Kras(+/LSLG12D);Trp53+/LSLR172H;Pdx-1-Cre (KPC) mice (which express constitutively active forms of KRAS), and C57/B6 mice. Mice were given nicotine for up to 86 weeks to produce blood levels comparable with those of intermediate smokers. Pancreatic tissues were collected and analyzed by immunohistochemistry and reverse transcriptase polymerase chain reaction; cells were isolated and assayed for colony and sphere formation and gene expression. The effects of nicotine were also evaluated in primary pancreatic acinar cells isolated from wild-type, nAChR7a(-/-), Trp53(-/-), and Gata6(-/-);Trp53(-/-) mice. We also analyzed primary PDAC cells that overexpressed GATA6 from lentiviral expression vectors. Administration of nicotine accelerated transformation of pancreatic cells and tumor formation in Ela-KRAS and KPC mice. Nicotine induced dedifferentiation of acinar cells by activating AKT-ERK-MYC signaling; this led to inhibition of Gata6 promoter activity, loss of GATA6 protein, and subsequent loss of acinar differentiation and hyperactivation of oncogenic KRAS. Nicotine also promoted aggressiveness of established tumors as well as the epithelial-mesenchymal transition, increasing numbers of circulating cancer cells and their dissemination to the liver, compared with mice not exposed to nicotine. Nicotine induced pancreatic cells to acquire gene expression patterns and functional characteristics of cancer stem cells. These effects were markedly attenuated in K-Ras(+/LSL-G12D);Trp53(+/LSLR172H);Pdx-1-Cre mice given metformin. Metformin prevented nicotine-induced pancreatic carcinogenesis and tumor growth by up-regulating GATA6 and promoting
Directory of Open Access Journals (Sweden)
Gheila Corrêa Ferres Baptestini
2016-01-01
Full Text Available The objective of the present study was to evaluate the effect of reversal of the flow direction, when used the surface flow as an operating criteria, on hydrodynamic characteristics and plants grown in horizontal subsurface-flow constructed wetland systems (HSF-CWs. For this purpose, six HSF-CWs were used: two non-cultivated (HSF-CWs 1 and 4, two cultivated with Tifton 85 grass (Cynodon spp. (HSF-CWs 2 and 5 and two cultivated with Alternanthera (Alternanthera philoxeroides (HSF-CWs 3 and 6. It was made a reversal in the flow direction of the HSF-CWs 1, 2 and 3. The reversal of the wastewater flow direction was performed when the superficial flow of the wastewater applied (SF reached 50% of the length of the HSF-CWs. There was a single reversal for each system, on different dates. Reversing the flow direction promoted distinction on the dry matter yield of Tifton 85 grass. This was not observed in HSF-CWs cultivated with Alternanthera. The reversal of the wastewater flow direction promoted, in principle, the extinction of the SF advance in the HSF-CWs, but did not prevent its return. Waiting for the SF to reach 50% of the length was not the best criterion for reversing the flow direction.
Reversed austenite in 0Cr13Ni4Mo martensitic stainless steels
Energy Technology Data Exchange (ETDEWEB)
Song, Y.Y., E-mail: songyuanyuan@imr.ac.cn [Institute of Metal Research, Chinese Academy of Science, Shenyang 110016 (China); Li, X.Y.; Rong, L.J.; Li, Y.Y. [Institute of Metal Research, Chinese Academy of Science, Shenyang 110016 (China); Nagai, T. [National Institute for Materials Science, Sengen 1-2-1, Tsukuba 305-0047 (Japan)
2014-01-15
The austenite reversion process and the distribution of carbon and other alloying elements during tempering in 0Cr13Ni4Mo martensitic stainless steel have been investigated by in-situ high temperature X-ray diffraction (XRD) and scanning transmission electron microscopy (STEM). The microstructure of the reversed austenite was characterized using transmission electron microscopy (TEM). The results revealed that the amount of the reversed austenite formed at high temperature increased with the holding time. Direct experimental evidence supported carbon partitioning to carbides and Ni to the reversed austenite. The reversed austenite almost always nucleated in contact with lath boundary M{sub 23}C{sub 6} carbides during tempering and the diffusion of Ni promoted its growth. The Ni enrichment and the ultrafine size of the reversed austenite were considered to be the main factors that accounted for the stability of the reversed austenite. - Highlights: • The amount of the reversed austenite formed at high temperature increases with the holding time. • STEM results directly show that carbon is mainly partitioned into the carbides and Ni into the reversed austenite. • The Ni enrichment and the ultrafine size are the main factors leading to the stabilization of the reversed austenite.
Reversible flowchart languages and the structured reversible program theorem
DEFF Research Database (Denmark)
Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert
2008-01-01
Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
Lipid profile of HIV-infected patients in relation to antiretroviral therapy: a review.
Souza, Suelen Jorge; Luzia, Liania Alves; Santos, Sigrid Sousa; Rondó, Patrícia Helen Carvalho
2013-01-01
This study reviewed the lipid profile of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in relation to use of antiretroviral therapy (ART), and its different classes of drugs. A total of 190 articles published in peer-reviewed journals were retrieved from PubMed and LILACS databases; 88 of them met the selection criteria and were included in the review. Patients with HIV/AIDS without ART presented an increase of triglycerides and decreases of total cholesterol, low density lipoprotein (LDL-c), and high density lipoprotein (HDL-c) levels. Distinct ART regimens appear to promote different alterations in lipid metabolism. Protease inhibitors, particularly indinavir and lopinavir, were commonly associated with hypercholesterolemia, high LDL-c, low HDL-c, and hypertriglyceridemia. The protease inhibitor atazanavir is apparently associated with a more advantageous lipid profile. Some nucleoside reverse-transcriptase inhibitors (didanosine, stavudine, and zidovudine) induced lipoatrophy and hypertriglyceridemia, whereas abacavir increased the risk of cardiovascular diseases even in the absence of apparent lipid disorders, and tenofovir resulted in lower levels of cholesterol and triglycerides. Although non-nucleoside reverse-transcriptase inhibitors predisposed to hypertriglyceridemia and hypercholesterolemia, nevirapine was particularly associated with high HDL-c levels, a protective factor against cardiovascular diseases. Therefore, the infection itself, different classes of drugs, and some drugs from the same class of ART appear to exert distinct alterations in lipid metabolism. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.
Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro ...
Indian Academy of Sciences (India)
(50 U) of reverse transcriptase. This cDNA pool ... reverse primers for each and 0.2 μL Taq polymerase (1 U). The initial ..... learned from B.t. toxin genes; in Genetic engineering (ed) JK ... KO 2007 Improved drought tolerance without undesired.
Short Telomere Length and Ischemic Heart Disease
DEFF Research Database (Denmark)
Madrid, Alexander Scheller; Rode, Line; Nordestgaard, Børge Grønne
2016-01-01
are associated with high risk of ischemic heart disease using a Mendelian randomization approach free of reverse causation and of most confounding. METHODS: We genotyped 3 genetic variants in OBFC1 (oligonucleotide/oligosaccharide binding fold containing 1), TERT (telomerase reverse transcriptase), and TERC...
Leung, K. C.
1989-01-01
Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.
Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H
2017-02-01
Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.
Martin-Odoom, Alexander; Adiku, Theophilus; Delgado, Elena; Lartey, Margaret; Ampofo, William K
2017-03-01
Access to antiretroviral therapy in Ghana has been scaled up across the country over the last decade. This study sought to determine the occurrence of transmitted HIV-1 drug resistance in pregnant HIV-1 positive women yet to initiate antiretroviral therapy at selected HIV Care Centres in Ghana. Plasma specimens from twenty-six (26) HIV seropositive pregnant women who were less than 28weeks pregnant with their first pregnancy and ART naïve were collected from selected HIV care centres in three (3) regions in Ghana. Genotypic testing was done for the reverse transcriptase gene and the sequences generated were analyzed for HIV-1 drug resistance mutations using the Stanford University HIV Drug Resistance Database. Resistance mutations associated with the reverse transcriptase gene were detected in 4 (15.4%) of the participants. At least one major drug resistance mutation in the reverse transcriptase gene was found in 3 (11.5%) of the women. The detection of transmitted HIV-1 drug resistance in this drug-naïve group in two regional HIV care sites is an indication of the need for renewed action in monitoring the emergence of transmitted HIV-1 drug resistance in Ghana. None declared.
Directory of Open Access Journals (Sweden)
Crumpacker Clyde S
2011-01-01
Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus
Managing Reverse Logistics or Reversing Logistics Management?
Brito, Marisa
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Kuhn, Josef; Tengler, Ulrike; Binder, Stefan
2001-01-01
To determine the influence of posttranscriptional modifications on 3′ end processing and RNA stability in plant mitochondria, pea atp9 and Oenothera atp1 transcripts were investigated for the presence and function of 3′ nonencoded nucleotides. A 3′ rapid amplification of cDNA ends approach initiated at oligo(dT)-adapter primers finds the expected poly(A) tails predominantly attached within the second stem or downstream of the double stem-loop structures at sites of previously mapped 3′ ends. Functional studies in a pea mitochondrial in vitro processing system reveal a rapid removal of the poly(A) tails up to termini at the stem-loop structure but little if any influence on further degradation of the RNA. In contrast 3′ poly(A) tracts at RNAs without such stem-loop structures significantly promote total degradation in vitro. To determine the in vivo identity of 3′ nonencoded nucleotides more accurately, pea atp9 transcripts were analyzed by a direct anchor primer ligation-reverse transcriptase PCR approach. This analysis identified maximally 3-nucleotide-long nonencoded extensions most frequently of adenosines combined with cytidines. Processing assays with substrates containing homopolymer stretches of different lengths showed that 10 or more adenosines accelerate RNA processivity, while 3 adenosines have no impact on RNA life span. Thus polyadenylation can generally stimulate the decay of RNAs, but processivity of degradation is almost annihilated by the stabilizing effect of the stem-loop structures. These antagonistic actions thus result in the efficient formation of 3′ processed and stable transcripts. PMID:11154261
Identification of transcription-factor genes expressed in the Arabidopsis female gametophyte
Directory of Open Access Journals (Sweden)
Kang Il-Ho
2010-06-01
Full Text Available Abstract Background In flowering plants, the female gametophyte is typically a seven-celled structure with four cell types: the egg cell, the central cell, the synergid cells, and the antipodal cells. These cells perform essential functions required for double fertilization and early seed development. Differentiation of these distinct cell types likely involves coordinated changes in gene expression regulated by transcription factors. Therefore, understanding female gametophyte cell differentiation and function will require dissection of the gene regulatory networks operating in each of the cell types. These efforts have been hampered because few transcription factor genes expressed in the female gametophyte have been identified. To identify such genes, we undertook a large-scale differential expression screen followed by promoter-fusion analysis to detect transcription-factor genes transcribed in the Arabidopsis female gametophyte. Results Using quantitative reverse-transcriptase PCR, we analyzed 1,482 Arabidopsis transcription-factor genes and identified 26 genes exhibiting reduced mRNA levels in determinate infertile 1 mutant ovaries, which lack female gametophytes, relative to ovaries containing female gametophytes. Spatial patterns of gene transcription within the mature female gametophyte were identified for 17 transcription-factor genes using promoter-fusion analysis. Of these, ten genes were predominantly expressed in a single cell type of the female gametophyte including the egg cell, central cell and the antipodal cells whereas the remaining seven genes were expressed in two or more cell types. After fertilization, 12 genes were transcriptionally active in the developing embryo and/or endosperm. Conclusions We have shown that our quantitative reverse-transcriptase PCR differential-expression screen is sufficiently sensitive to detect transcription-factor genes transcribed in the female gametophyte. Most of the genes identified in this
Automated external defibrillators in the hospital: A case of medical reversal.
Stewart, John A
2018-05-01
Automated external defibrillators (AEDs) emerged in the 1980s as an important innovation in pre-hospital emergency cardiac care (ECC). In the years since, the American Heart Association (AHA) and the International Liaison Committee for Resuscitation (ILCOR) have promoted AED technology for use in hospitals as well, resulting in the widespread purchase and use of AED-capable defibrillators. In-hospital use of AEDs now appears to have decreased survival from cardiac arrests. This article will look at the use of AEDs in hospitals as a case of "medical reversal." Medical reversal occurs when an accepted, widely used treatment is found to be ineffective or even harmful. This article will discuss the issue of AEDs in the hospital using a conceptual framework provided by recent work on medical reversal. It will go on to consider the implications of the reversal for in-hospital resuscitation programs and emergency medicine more generally. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhihong Xu
2015-10-01
Full Text Available Phosphorus-modified prodrugs of dideoxynucleoside triphosphates (ddNTPs have shown promise as pronucleotide strategies for improving antiviral activity compared to their parent dideoxynucleosides. Borane modified NTPs offer a promising choice as nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs. However, the availability of α-P-borano-γ-P-substituted NTP analogs remains limited due to challenges with synthesis and purification. Here, we report the chemical synthesis and stability of a new potential class of NRTI prodrugs: stavudine (d4T 5′-α-P-borano-γ-P-N-L-tryptophanyltriphosphates. One-pot synthesis of these compounds was achieved via a modified cyclic trimetaphosphate approach. Pure Rp and Sp diastereomers were obtained after HPLC separation. Based on LC-MS analysis, we report degradation pathways, half-lives (5–36 days and mechanisms arising from structural differences to generate the corresponding borano tri- and di-phosphates, and H-phosphonate, via several parallel routes in buffer at physiologically relevant pH and temperature. Here, the major hydrolysis products, d4T α-P-boranotriphosphate Rp and Sp isomers, were isolated by HPLC and identified with spectral data. We first propose that one of the major degradation products, d4T H-phosphonate, was generated from the d4T pronucleotides via a protonation-promoted intramolecular reduction followed by a second step nucleophilic attack. This report could provide valuable information for pronucleotide-based drug design in terms of selective release of target nucleotides.
Charge reversal at a planar boundary between two dielectrics
Wang, Zhi-Yong
2016-01-01
Despite the ubiquitous character and relevance of the electric double layer in the entire realm of interface and colloid science, very little is known of the effect that surface heterogeneity exerts on the underlying mechanisms of ion adsorption. Herein, computer simulations offer a perspective that, in sharp contrast to the homogeneously charged surface, discrete groups promote multivalent counterion binding, leading to charge reversal but possibly having not a sign change of the electrophoretic mobility. Counterintuitively, the introduction of dielectric images yields a significantly greater accumulation of counterions, which further facilitates the magnitude of charge reversal. The reported results are very sensitive to both the degree of ion hydration and the representation of surface charges. Our findings shed light on the mechanism for charge reversal over a broad range of coupling regimes operating the adsorption of counterions through surface group bridging attraction with their own images and provide opportunities for experimental studies and theoretical development.
Kulikova, Olga
2016-01-01
This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...
Directory of Open Access Journals (Sweden)
Shweta Gupta
Full Text Available Efavirenz is an anti-viral agent of non-nucleoside reverse transcriptase inhibitor category used as a part of highly active retroviral therapy for the treatment of infections of human immune deficiency virus type-1. A simple, sensitive and rapid reversed-phase high performance liquid chromatographic gradient method was developed and validated for the determination of efavirenz in plasma. The method was developed with high performance liquid chromatography using Waters X-Terra Shield, RP18 50 x 4.6 mm, 3.5 μm column and a mobile phase consisting of phosphate buffer pH 3.5 and Acetonitrile. The elute was monitored with the UV-Visible detector at 260 nm with a flow rate of 1.5 mL/min. Tenofovir disoproxil fumarate was used as internal standard. The method was validated for linearity, precision, accuracy, specificity, robustness and data obtained were statistically analyzed. Calibration curve was found to be linear over the concentration range of 1-300 μg/mL. The retention times of efavirenz and tenofovir disoproxil fumarate (internal standard were 5.941 min and 4.356 min respectively. The regression coefficient value was found to be 0.999. The limit of detection and the limit of quantification obtained were 0.03 and 0.1 μg/mL respectively. The developed HPLC method can be useful for quantitative pharmacokinetic parameters determination of efavirenz in plasma.
Update on HIV-1 acquired and transmitted drug resistance in Africa.
Ssemwanga, Deogratius; Lihana, Raphael W; Ugoji, Chinenye; Abimiku, Alash'le; Nkengasong, John; Dakum, Patrick; Ndembi, Nicaise
2015-01-01
The last ten years have witnessed a significant scale-up and access to antiretroviral therapy in Africa, which has improved patient quality of life and survival. One major challenge associated with increased access to antiretroviral therapy is the development of antiretroviral resistance due to inconsistent drug supply and/or poor patient adherence. We review the current state of both acquired and transmitted drug resistance in Africa over the past ten years (2001-2011) to identify drug resistance associated with the different drug regimens used on the continent and to help guide affordable strategies for drug resistance surveillance. A total of 161 references (153 articles, six reports and two conference abstracts) were reviewed. Antiretroviral resistance data was available for 40 of 53 African countries. A total of 5,541 adult patients from 99 studies in Africa were included in this analysis. The pooled prevalence of drug resistance mutations in Africa was 10.6%, and Central Africa had the highest prevalence of 54.9%. The highest prevalence of nucleoside reverse transcriptase inhibitor mutations was in the west (55.3%) and central (54.8%) areas; nonnucleoside reverse transcriptase inhibitor mutations were highest in East Africa (57.0%) and protease inhibitors mutations highest in Southern Africa (16.3%). The major nucleoside reverse transcriptase inhibitor mutation in all four African regions was M184V. Major nonnucleoside reverse transcriptase inhibitor as well as protease inhibitor mutations varied by region. The prevalence of drug resistance has remained low in several African countries although the emergence of drug resistance mutations varied across countries. Continued surveillance of antiretroviral therapy resistance remains crucial in gauging the effectiveness of country antiretroviral therapy programs and strategizing on effective and affordable strategies for successful treatment.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
DEFF Research Database (Denmark)
Bracher, Linda; Valerius, Niels Henrik; Rosenfeldt, Vibeke
2007-01-01
children treated with HAART. Initial HAART included 2 nucleoside reverse-transcriptase inhibitors in combination with either a protease inhibitor (n =38) or a non-nucleoside reverse-transcriptase inhibitor (n =12). 19 (39%) patients were previously treated with mono- or dual therapy. Baseline......The long-term impact of highly active antiretroviral therapy (HAART) on HIV-1 infected children is not well known. The Danish Paediatric HIV Cohort Study includes all patients ... characteristics were median CD4 percentage 14% and HIV-RNA viral load 4.9 log(10). Within the first 12 weeks of therapy approximately 60% achieved HIV-RNA viral load children changed the components of HAART. The proportion of children with CD4...
Directory of Open Access Journals (Sweden)
Sun Woo Sophie Kang
Full Text Available Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK. When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury.
Taniane, Caitlin; Farrell, Geoffrey; Arias, Irwin M.; Lippincott-Schwartz, Jennifer; Fu, Dong
2016-01-01
Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK). When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury. PMID:27792760
Directory of Open Access Journals (Sweden)
Maia Hightower
Full Text Available Human immunodeficiency virus type 1 (HIV-1 and type 2 (HIV-2 are the causative agents of AIDS. HIV-2 is prevalent at moderate to high rates in West African countries, such as Senegal, Guinea, Gambia, and Cape Verde. Diagnosis of HIV-2 is made with a positive HIV-1/HIV-2 ELISA or simple/rapid assay, followed by one or two confirmatory tests specific for HIV-2. Following CD4+ T cell counts, HIV-2 viral burden and clinical signs and symptoms of immunodeficiency are beneficial in monitoring HIV-2 disease progression. Although non-nucleoside reverse transcriptase inhibitors are ineffective in treating HIV-2, nucleoside reverse transcriptase inhibitors and protease inhibitors can be effective in dual and triple antiretroviral regimens. Their use can decrease HIV-2 viral load, increase CD4+ T cell counts and improve AIDS-related symptoms. HIV-2 resistance to various nucleoside reverse transcriptase inhibitors and protease inhibitors, including zidovudine, lamivudine, ritonavir and indinavir, has been identified in some HIV-2 infected patients on antiretroviral therapy. The knowledge of HIV-2 peculiarities, when compared to HIV-1, is crucial to helping diagnose and guide the clinician in the choice of the initial antiretroviral regimen and for monitoring therapy success.
Reversal of dopamine system dysfunction in response to high-fat diet.
Carlin, Jesselea; Hill-Smith, Tiffany E; Lucki, Irwin; Reyes, Teresa M
2013-12-01
To test whether high-fat diet (HFD) decreases dopaminergic tone in reward regions of the brain and evaluate whether these changes reverse after removal of the HFD. Male and female mice were fed a 60% HFD for 12 weeks. An additional group was evaluated 4 weeks after removal of the HFD. These groups were compared with control fed, age-matched controls. Sucrose and saccharin preference was measured along with mRNA expression of dopamine (DA)-related genes by Real Time-quantitative PCR (RT-qPCR). DA and 3,4-dihydroxyphenylacetic acid (DOPAC) were measured using high-performance liquid chromatography. DNA methylation of the dopamine transporter (DAT) promoter was measured by methylated DNA immunoprecipitation and RT-qPCR. After chronic HFD, sucrose preference was reduced, and then normalized after removal of the HFD. Decreased expression of DA genes, decreased DA content and alterations in DAT promoter methylation, was observed. Importantly, response to HFD and the persistence of changes depended on sex and brain region. These data identify diminished DA tone after early-life chronic HFD with a complex pattern of reversal and persistence that varies by both sex and brain region. Central nervous system changes that did not reverse after HFD withdrawal may contribute to the difficulty in maintaining weight-loss after diet intervention. Copyright © 2013 The Obesity Society.
Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip
Directory of Open Access Journals (Sweden)
Yanling Xia
2018-04-01
Full Text Available Objective Molecular cloning and bioinformatics analysis of annexin A2 (ANXA2 gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. Methods The reverse transcriptase polymerase chain reaction (RT-PCR was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer (Cervus Nippon hortulorum and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR. Results The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus. Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period. Conclusion ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.
Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.
2003-01-01
The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containing template pairs, indicating that template dimerization, and not the mere presence of the DIS, promotes efficient transfers. Additionally, we show evidence that the overall transfer process spans an extended region of the template and proceeds through a two-step mechanism. Transfer is initiated through an RNase H-facilitated acceptor invasion step, while synthesis continues on the donor template. The invasion then propagates towards the primer terminus by branch migration. Transfer is completed with the translocation of the primer terminus at a site distant from the invasion point. In our system, most invasions initiated before synthesis reached the DIS. However, transfer of the primer terminus predominantly occurred after synthesis through the DIS. The two steps were separated by 60 to 80 nucleotides. Sequence markers revealed the position of primer terminus switch, whereas DNA oligomers designed to block acceptor-cDNA interactions defined sites of invasion. Within the region of homology, certain positions on the template were inherently more favorable for invasion than others. In templates with DIS, the proximity of the acceptor facilitates invasion, thereby enhancing transfer efficiency. Nucleocapsid protein enhanced the overall efficiency of transfers but did not alter the mechanism. PMID:12663778
Effects of water extract of Curcuma longa (L.) roots on immunity and telomerase function.
Pan, Min-Hsiung; Wu, Jia-Ching; Ho, Chi-Tang; Badmaev, Vladimir
2017-05-12
Background Immunity and Longevity Methods A water extract of Curcuma longa (L.) [vern. Turmeric] roots (TurmericImmune™) standardized for a minimum 20 % of turmeric polysaccharides ukonan A, B, C and D was evaluated for its biological properties in in vitro tissue culture studies. Results The water extract of turmeric (TurP) exhibited induced-nitric oxide (NO) production in RAW264.7 macrophages. These results suggested the immunomodulatory effects of TurP. In addition, the polysaccharides up-regulated function of telomerase reverse transcriptase (TERT) equally to the phenolic compound from turmeric, curcumin. Conclusions The ukonan family of polysaccharides may assist in promoting cellular immune responses, tissue repair and lifespan by enhancing immune response and telomere function.
A copper-mediated reverse aromatic Finkelstein reaction in ionic liquid
Directory of Open Access Journals (Sweden)
Anh T.H. Nguyen
2018-03-01
Full Text Available We have developed a general method for reverse aromatic Finkelstein reactions. Good reaction yields were obtained when aryl iodides or aryl bromides were treated with copper halide salts as promoters in a 1-butyl-3-methylimidazolium bromide ([BMIM]Br ionic liquid (IL solvent at 140 °C for 8 h. Preliminary investigation supported that the copper salts were also the halide sources in halogen exchange reactions. The optimized conditions are applicable to a variety of substrates and have excellent functional group tolerance. Additionally, the [BMIM]Br solvent showed good stability for at least 10 consecutive runs. Results indicated that the [BMIM]Br solvent was recyclable for reverse aromatic Finkelstein reactions.
Functional behavior and reproduction in androgenic sex reversed zebrafish (Danio rerio).
Larsen, Mia G; Baatrup, Erik
2010-08-01
Endocrine-disrupting chemicals released into natural watercourses may cause biased sex ratios by sex reversal in fish populations. The present study investigated the androgenic sex reversal of zebrafish (Danio rerio) exposed to the androgenic compound 17beta-trenbolone (TB) and whether sex-changed females would revert to the female phenotype after cessation of TB exposure. 17beta-Trenbolone is a metabolite of trenbolone acetate, an anabolic steroid used as a growth promoter in beef cattle. 17beta-Trenbolone in runoff from cattle feedlots may reach concentrations that affect fish sexual development. Zebrafish were exposed to a concentration of 20 ng/L TB in a flow-through system for five months from egg until sexual maturity. This resulted in an all-male population. It was further found that all these phenotypic males displayed normal male courtship behavior and were able to reproduce successfully, implying that the sex reversal was complete and functional. None of the phenotypic males developed into females after six months in clean water, demonstrating that androgenic sex reversal of zebrafish is irreversible. Copyright 2010 SETAC
The role of cortisol and interleukin-10 gene expression patterns in ...
African Journals Online (AJOL)
International Journal of Biological and Chemical Sciences ... were detected using reverse transcriptase polymerase chain reaction method. ... and interleukin-10 genes to reinstate homeostasis through modulation of the immune response.
Greenberg, Katherine Blumoff; Jenks, Sara Catherine; Piazza, Nina; Malibiran, Beatriz Ramos; Aligne, C Andrew
2017-08-01
To contextualize young women's knowledge and attitudes regarding contraception at the outset of an intervention promoting long-acting reversible contraceptive (LARC) use for teen pregnancy prevention. Our intervention was on the basis of diffusion of innovation theory, and at the outset we were interested in likely early adopters' existing knowledge and attitudes toward contraception. This mixed methods study consisted of focus groups within positive youth development programs in Rochester, New York; we discussed young women's knowledge and sources of information for all US Food and Drug Administration-approved contraceptive methods. Seven focus groups and 24 female adolescent participants aged 15-19 years. Quantitative ranking of all contraceptive methods; qualitative themes from focus group discussions. Our findings showed a high level of knowledge about a select group of methods, which included LARC methods, and that participants received contraceptive information from peers and family. Participants had more concerns than positive impressions regarding the effectiveness, safety, practicality, and partner reception of the contraceptive methods, with the exception of the condom. Quantitatively, the condom received the highest average rating. The importance of personal anecdotes in our findings supports the use of outreach and information campaigns; providing medically accurate information and spreading positive personal anecdotes will be key to improving young women's impressions of the safety and acceptability of LARC use. This snapshot of contraceptive knowledge indicates that young women can be mature, informed consumers of sexual and reproductive health care, and through diffusion of innovation could be key players in promoting the most effective means of pregnancy prevention. Copyright © 2017 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.
Foitzik, Kerstin; Krause, Karoline; Conrad, Franziska; Nakamura, Motonobu; Funk, Wolfang; Paus, Ralf
2006-01-01
The prototypic pituitary hormone prolactin (PRL) exerts a wide variety of bioregulatory effects in mammals and is also found in extrapituitary sites, including murine skin. Here, we show by reverse transcriptase-polymerase chain reaction and immunohistology that, contrary to a previous report, human skin and normal human scalp hair follicles (HFs), in particular, express both PRL and PRL receptors (PRL-R) at the mRNA and protein level. PRL and PRL-R immunoreactivity can be detected in the epithelium of human anagen VI HFs, while the HF mesenchyme is negative. During the HF transformation from growth (anagen) to apoptosis-driven regression (catagen), PRL and PRL-R immunoreactivity appear up-regulated. Treatment of organ-cultured human scalp HFs with high-dose PRL (400 ng/ml) results in a significant inhibition of hair shaft elongation and premature catagen development, along with reduced proliferation and increased apoptosis of hair bulb keratinocytes (Ki-67/terminal dUTP nick-end labeling immunohistomorphometry). This shows that PRL receptors, expressed in HFs, are functional and that human skin and human scalp HFs are both direct targets and sources of PRL. Our data suggest that PRL acts as an autocrine hair growth modulator with catagen-promoting functions and that the hair growth-inhibitory effects of PRL demonstrated here may underlie the as yet ill-understood hair loss in patients with hyperprolactinemia. PMID:16507890
Foitzik, Kerstin; Krause, Karoline; Conrad, Franziska; Nakamura, Motonobu; Funk, Wolfang; Paus, Ralf
2006-03-01
The prototypic pituitary hormone prolactin (PRL) exerts a wide variety of bioregulatory effects in mammals and is also found in extrapituitary sites, including murine skin. Here, we show by reverse transcriptase-polymerase chain reaction and immunohistology that, contrary to a previous report, human skin and normal human scalp hair follicles (HFs), in particular, express both PRL and PRL receptors (PRL-R) at the mRNA and protein level. PRL and PRL-R immunoreactivity can be detected in the epithelium of human anagen VI HFs, while the HF mesenchyme is negative. During the HF transformation from growth (anagen) to apoptosis-driven regression (catagen), PRL and PRL-R immunoreactivity appear up-regulated. Treatment of organ-cultured human scalp HFs with high-dose PRL (400 ng/ml) results in a significant inhibition of hair shaft elongation and premature catagen development, along with reduced proliferation and increased apoptosis of hair bulb keratinocytes (Ki-67/terminal dUTP nick-end labeling immunohistomorphometry). This shows that PRL receptors, expressed in HFs, are functional and that human skin and human scalp HFs are both direct targets and sources of PRL. Our data suggest that PRL acts as an autocrine hair growth modulator with catagen-promoting functions and that the hair growth-inhibitory effects of PRL demonstrated here may underlie the as yet ill-understood hair loss in patients with hyper-prolactinemia.
Directory of Open Access Journals (Sweden)
W. Ali
2017-06-01
Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.
Reversible Thermoset Adhesives
Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)
2016-01-01
Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.
African Journals Online (AJOL)
ADEYEYE
compared using univariate and logistic regression analyses to identify factors associated with vaccination ... reverse transcriptase- Polymerase chain ... Individuals at risk of rabies virus infection ..... vaccine supply in Nigerian hospitals might.
Indian Academy of Sciences (India)
2015-01-30
Jan 30, 2015 ... Reverse transcriptase and Lamarckian scenarios of evolution. MICHEL MORANGE .... tools of genetic engineering permitted a rapid accumulation of .... nological tolerance to foreign histocompatibility antigens in mice. Proc.
Generation of recombinant pestiviruses using a full genome amplification strategy
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Reimann, Ilona; Uttenthal, Åse
Aim Complete genome amplification of viral RNA provides a new tool for generation of modified pestiviruses. We have recently reported a full genome amplification strategy for direct recovery of infectious pestivirus (Rasmussen et al., 2008). This comprised rescue of BDV strain “Gifhorn” from a full......-length RT-PCR amplicon demonstrating that long RT-PCR can be used for direct generation of an infectious pestivirus. The strategy is not limited to amplification of BDV “Gifhorn”, but can be further utilized for amplification of a diverse selection of pestivirus strains and for the generation of modified...... was reverse transcribed to cDNA at 50C for 90 minutes using SuperScript III reverse transcriptase (Invitrogen). Full-length PCR amplification was performed using primers specific for the extreme 5’- and 3’-ends of the viral genomes. A T7 promoter was incorporated in the 5’-primers for direct in vitro...
Zero field reversal probability in thermally assisted magnetization reversal
Prasetya, E. B.; Utari; Purnama, B.
2017-11-01
This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.
Hornyák, Ákos; Lipinski, Kai S; Bakonyi, Tamás; Forgách, Petra; Horváth, Ernő; Farsang, Attila; Hedley, Susan J; Palya, Vilmos; Bakács, Tibor; Kovesdi, Imre
2015-01-01
Despite spectacular successes in hepatitis B and C therapies, severe hepatic impairment is still a major treatment problem. The clinically tested infectious bursal disease virus (IBDV) superinfection therapy promises an innovative, interferon-free solution to this great unmet need, provided that a consistent manufacturing process preventing mutations or reversions to virulent strains is obtained. To address safety concerns, a tissue culture adapted IBDV vaccine strain V903/78 was cloned into cDNA plasmids ensuring reproducible production of a reverse engineered virus R903/78. The therapeutic drug candidate was characterized by immunocytochemistry assay, virus particle determination and immunoblot analysis. The biodistribution and potential immunogenicity of the IBDV agent was determined in mice, which is not a natural host of this virus, by quantitative detection of IBDV RNA by a quantitative reverse transcriptase-polymerase chain reaction and virus neutralization test, respectively. Several human cell lines supported IBDV propagation in the absence of visible cytopathic effect. The virus was stable from pH 8 to pH 6 and demonstrated significant resistance to low pH and also proved to be highly resistant to high temperatures. No pathological effects were observed in mice. Single and multiple oral administration of IBDV elicited antibodies with neutralizing activities in vitro. Repeat oral administration of R903/78 was successful despite the presence of neutralizing antibodies. Single oral and intravenous administration indicated that IBDV does not replicate in mammalian liver alleviating some safety related concerns. These data supports the development of an orally delivered anti-hepatitis B virus/ anti-hepatitis C virus viral agent for human use. Copyright © 2015 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Yoshimura, Shusaku; Kasamatsu, Atsushi; Nakashima, Dai; Iyoda, Manabu; Kasama, Hiroki; Saito, Tomoaki; Takahara, Toshikazu; Endo-Sakamoto, Yosuke; Shiiba, Masashi; Tanzawa, Hideki; Uzawa, Katsuhiro
2017-01-01
Ubiquitin-conjugating enzyme E2S (UBE2S), a family of E2 protein in the ubiquitin-proteasome system, is highly expressed in several types of cancers; however, its roles in oral squamous cell carcinoma (OSCC) have not yet been well elucidated. The purpose of this study was to clarify the functional activities of UBE2S in OSCCs. We analyzed the expression levels of UBE2S in nine OSCC cell lines and primary OSCC tissues by quantitative reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemistry (IHC). The correlations between UBE2S expression and clinical classifications of OSCCs were analyzed using the IHC scoring system. We also used UBE2S knockdown OSCC cells for functional assays (proliferation assay, flow cytometry, and Western blotting). UBE2S was overexpressed in OSCCs in vitro and in vivo and was correlated significantly (P < 0.05) with the primary tumoral size. The cellular growth was decreased and the cell-cycle was arrested in the G2/M phase in the UBE2S knockdown (shUBE2S) cells. The expression level of P21, a target of the ubiquitin-proteasome system, was increased in the shUBE2S cells because of lower anaphase activity that promotes complex subunit 3 (APC3), an E3 ubiquitin ligase, compared with shMock cells. These findings might promote the understanding of the relationship between UBE2S overexpression and oral cancer proliferation, indicating that UBE2S would be a potential biomarker of and therapeutic target in OSCCs. - Highlights: • UBE2S contributes to tumor progression in OSCCs. • UBE2S regulated the cell-cycle arrest at G2/M phase in OSCC cells. • UBE2S and APC3 co-regulate the expression level of P21 at G2/M check point via the ubiquitin-proteasome system. • P21 is one of the proliferation-regulating factors in OSCC. • UBE2S would be a potential therapeutic target for OSCCs.
Indian Academy of Sciences (India)
many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Artemisia desertorum Spreng; drought tolerance; mRNA differential display; RING zinc ... Semi-quantitative reverse-transcriptase-polymerase chain reaction ... College of Life Sciences, National Key Laboratory of Protein Engineering and Plant ...
Isolation and characterization of differentially expressed genes in ...
African Journals Online (AJOL)
USER
Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.
African Journals Online (AJOL)
User
Accepted: April, 2016. ISSN 2006 – 6996 .... educational/social activities were seriously jeopardized causing significant ..... Molecular test using reverse transcriptase polymerase ... and logistics by government or donor agencies. -. Setting up ...
Energy Technology Data Exchange (ETDEWEB)
Shi, Wen-Zhu [Anesthesia and Operation Center, Hainan Branch of Chinese PLA General Hospital, Hainan 572013 (China); Anesthesia and Operation Center, Chinese PLA General Hospital, Beijing 100853 (China); Miao, Yu-Liang [Department of Anesthesiology, PLA No. 306 Hospital, Beijing 100101 (China); Guo, Wen-Zhi [Department of Anesthesiology, Beijing Military General Hospital of Chinese People’s Liberation Army, Beijing 100700 (China); Wu, Wei, E-mail: wwzwgk@163.com [Department of Head and Neck Surgery of Otolaryngology, PLA No. 306 Hospital, Beijing 100101 (China); Li, Bao-Wei [Department of Head and Neck Surgery of Otolaryngology, PLA No. 306 Hospital, Beijing 100101 (China); An, Li-Na [Department of Anesthesiology, Armed Police General Hospital, Beijing 100039 (China); Fang, Wei-Wu [Department of Anesthesiology, PLA No. 306 Hospital, Beijing 100101 (China); Mi, Wei-Dong, E-mail: elite2005gg@163.com [Anesthesia and Operation Center, Chinese PLA General Hospital, Beijing 100853 (China)
2014-04-25
Highlights: • Leptin promotes the proliferation of neural stem cells isolated from embryonic mouse hippocampus. • Leptin reverses corticosterone-induced inhibition of neural stem cell proliferation. • The effects of leptin are partially mediated by upregulating NR2B subunits. - Abstract: Corticosterone inhibits the proliferation of hippocampal neural stem cells (NSCs). The removal of corticosterone-induced inhibition of NSCs proliferation has been reported to contribute to neural regeneration. Leptin has been shown to regulate brain development, improve angiogenesis, and promote neural regeneration; however, its effects on corticosterone-induced inhibition of NSCs proliferation remain unclear. Here we reported that leptin significantly promoted the proliferation of hippocampal NSCs in a concentration-dependent pattern. Also, leptin efficiently reversed the inhibition of NSCs proliferation induced by corticosterone. Interestingly, pre-treatment with non-specific NMDA antagonist MK-801, specific NR2B antagonist Ro 25-6981, or small interfering RNA (siRNA) targeting NR2B, significantly blocked the effect of leptin on corticosterone-induced inhibition of NSCs proliferation. Furthermore, corticosterone significantly reduced the protein expression of NR2B, whereas pre-treatment with leptin greatly reversed the attenuation of NR2B expression caused by corticosterone in cultured hippocampal NSCs. Our findings demonstrate that leptin reverses the corticosterone-induced inhibition of NSCs proliferation. This process is, at least partially mediated by increased expression of NR2B subunits of NMDA receptors.
Contact mechanics of reverse engineered distal humeral hemiarthroplasty implants.
Willing, Ryan; King, Graham J W; Johnson, James A
2015-11-26
Erosion of articular cartilage is a concern following distal humeral hemiarthroplasty, because native cartilage surfaces are placed in contact with stiff metallic implant components, which causes decreases in contact area and increases in contact stresses. Recently, reverse engineered implants have been proposed which are intended to promote more natural contact mechanics by reproducing the native bone or cartilage shape. In this study, finite element modeling is used in order to calculate changes in cartilage contact areas and stresses following distal humeral hemiarthroplasty with commercially available and reverse engineered implant designs. At the ulna, decreases in contact area were -34±3% (p=0.002), -27±1% (pengineered and cartilage reverse engineered designs, respectively. Peak contact stresses increased by 461±57% (p=0.008), 387±127% (p=0.229) and 165±16% (p=0.003). At the radius, decreases in contact area were -21±3% (p=0.013), -13±2% (p0.999), 241±32% (p=0.010) and 61±10% (p=0.021). Between the three different implant designs, the cartilage reverse engineered design yielded the largest contact areas and lowest contact stresses, but was still unable to reproduce the contact mechanics of the native joint. These findings align with a growing body of evidence indicating that although reverse engineered hemiarthroplasty implants can provide small improvements in contact mechanics when compared with commercially available designs, further optimization of shape and material properties is required in order reproduce native joint contact mechanics. Copyright © 2015 Elsevier Ltd. All rights reserved.
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
Backup_of_7. The Prevalence of Kidney Dysfunction and ...
African Journals Online (AJOL)
user
3University of Zambia, School of Public Health, Lusaka, Zambia. 176 .... Nucleoside Reverse Transcriptase Inhibitors. (NRTIs), and a ... Multivariate logistic regression was used to determine ... the Ethics Committee of ERES Converge approval.
Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães
2017-04-12
The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.
Managing Reverse Logistics or Reversing Logistics Management?
M.P. de Brito (Marisa)
2004-01-01
textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse
Lactic acidosis, risk factors and predictive laboratory markers: a ...
African Journals Online (AJOL)
2013-12-21
Dec 21, 2013 ... due to nucleoside reverse transcriptase inhibitors (NRTIs) ... of Public Health Medicine, School of Nursing and Public Health, University of KwaZulu-Natal, Durban ... Conditional logistic regression modelling was used to.
Diabetes mellitus in HIV-infected patients receiving antiretroviral ...
African Journals Online (AJOL)
Primary analysis using conditional logistic regression was employed to estimate univariate .... Refers to first-line regimen in Botswana – either non-nucleoside reverse transcriptase inhibitor-based regimen (NVP or. EFV) or .... Public Health.
ORIGINAL ARTICLES Symptomatic hyperlactataemia in adults on ...
African Journals Online (AJOL)
2008-09-29
Sep 29, 2008 ... in combination with other antiretroviral drugs in a schedule .... males developed gynaecomastia without other symptoms of ..... nucleoside reverse transcriptase inhibitor (NRTI)-induced lactic acidosis in HIV-infected patients in ...
Czech Academy of Sciences Publication Activity Database
Krečmerová, Marcela
2012-01-01
Roč. 8, č. 1 (2012), s. 18-21 ISSN 1801-2434 Institutional support: RVO:61388963 Keywords : HIV * AIDS * cART * HAART * tenofovir * reverse transcriptase * HIV protease * mikrobicides Subject RIV: CC - Organic Chemistry
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
HIV-1 reverse transcriptase; MD simulations; ribonuclease H activity; retroviral therapy; conformational transition; protein-nucleic acid interactions. ... Details of key interactions found at the interface of enzyme-nucleic acid complex that are ...
Directory of Open Access Journals (Sweden)
Wang Xiang
2012-07-01
Full Text Available Abstract Background Human metapneumovirus (hMPV is a major cause of acute respiratory infections ranging from wheezing to bronchiolitis and pneumonia in children worldwide. The objective of this study is to develop a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP assay for the detection of hMPV and applied to the clinical samples. Results In this study, visual RT-LAMP assay for hMPV was performed in one step with the addition of hydroxynaphthol blue (HNB, and were used to detect respiratory samples. Six primers, including two outer primers (F3 and B3, two inner primers (FIP, BIP and two loop primers (LF and LB, were designed for hMPV N gene by the online software. Moreover, the RT-LAMP assay showed good specificity and no cross-reactivity was observed with human rhinovirus (HRV, human respiratory syncytial Virus (RSV, or influenza virus A/PR/8/34 (H1N1. The detection limit of the RT-LAMP assay was approximately ten viral RNA copies, lower than that of traditional reverse transcriptase polymerase chain reaction (RT-PCR 100 RNA copies. In the 176 nasopharyngeal samples, 23 (13.1% were conformed as hMPV positive by RT-LAMP, but 18 (10.2% positive by RT-PCR. Conclusion Compared with conventional RT-PCR, the visual hMPV RT-LAMP assay performed well in the aspect of detect time, sensitivity, specificity and visibility. It is anticipated that the RT-LAMP will be used for clinical tests in hospital or field testing during outbreaks and in emergency.
Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin
2017-01-01
Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse
Restoration of hippocampal growth hormone reverses stress-induced hippocampal impairment
Directory of Open Access Journals (Sweden)
Caitlin M. Vander Weele
2013-06-01
Full Text Available Though growth hormone (GH is synthesized by hippocampal neurons, where its expression is influenced by stress exposure, its function is poorly characterized. Here, we show that a regimen of chronic stress that impairs hippocampal function in rats also leads to a profound decrease in hippocampal GH levels. Restoration of hippocampal GH in the dorsal hippocampus via viral-mediated gene transfer completely reversed stress-related impairment of two hippocampus-dependent behavioral tasks, auditory trace fear conditioning and contextual fear conditioning, without affecting hippocampal function in unstressed control rats. GH overexpression reversed stress-induced decrements in both fear acquisition and long-term fear memory. These results suggest that loss of hippocampal GH contributes to hippocampal dysfunction following prolonged stress and demonstrate that restoring hippocampal GH levels following stress can promote stress resilience.
Self-reported adverse effects as barriers to adherence to ...
African Journals Online (AJOL)
School of Public Health, University of Limpopo, Medunsa Campus. Correspondence to: Dr .... variables were performed using logistic regression. The findings .... non-reverse transcriptase inhibitors.11 The implication of this finding is that the ...
Czech Academy of Sciences Publication Activity Database
Ogrocká, A.; Sýkorová, Eva; Fajkus, Jiří; Fojtová, M.
2012-01-01
Roč. 63, č. 11 (2012), s. 4233-4241 ISSN 0022-0957 Institutional support: RVO:68081707 Keywords : TELOMERASE REVERSE-TRANSCRIPTASE * ARABIDOPSIS-THALIANA * DNA METHYLATION Subject RIV: BO - Biophysics Impact factor: 5.242, year: 2012
Literature Reference for Influenza H5N1 (Emerging Infectious Diseases. 2005. 11(8): 1303–1305)
Procedures are described for analysis of clinical samples and may be adapted for assessment of solid, particulate, aerosol, liquid and water samples. This is a two-step, real-time reverse transcriptase-PCR multiplex assay.
Directory of Open Access Journals (Sweden)
Kaoru Mitsui
Full Text Available Incomplete abolition of tumorigenicity creates potential safety concerns in clinical trials of regenerative medicine based on human pluripotent stem cells (hPSCs. Here, we demonstrate that conditionally replicating adenoviruses that specifically target cancers using multiple factors (m-CRAs, originally developed as anticancer drugs, may also be useful as novel antitumorigenic agents in hPSC-based therapy. The survivin promoter was more active in undifferentiated hPSCs than the telomerase reverse transcriptase (TERT promoter, whereas both promoters were minimally active in differentiated normal cells. Accordingly, survivin-responsive m-CRA (Surv.m-CRA killed undifferentiated hPSCs more efficiently than TERT-responsive m-CRAs (Tert.m-CRA; both m-CRAs exhibited efficient viral replication and cytotoxicity in undifferentiated hPSCs, but not in cocultured differentiated normal cells. Pre-infection of hPSCs with Surv.m-CRA or Tert.m-CRA abolished in vivo teratoma formation in a dose-dependent manner following hPSC implantation into mice. Thus, m-CRAs, and in particular Surv.m-CRAs, represent novel antitumorigenic agents that could facilitate safe clinical applications of hPSC-based regenerative medicine.
Directory of Open Access Journals (Sweden)
Holly A. Basta
2007-01-01
Full Text Available Retroid agents are genomes that encode a reverse transcriptase (RT and replicate or transpose by way of an RNA intermediate. The Genome Parsing Suite (GPS is software created to identify and characterize Retroid agents in any genome database (McClure et al. 2005. The detailed analysis of all Retroid agents found by the GPS in Danio rerio (zebrafsh, Oryzias latipes (medaka, Gasterosteus aculeatus (stickleback and Tetraodon nigroviridis (spotted green pufferfish reveals extensive Retroid agent diversity in the compact genomes of all four fish. Novel Retroid agents were identified by the GPS software: the telomerase reverse transcriptase (TERT in O. latipes, G. aculeatus and T. nigroviridis and a potential TERT in D. rerio, a retrotransposon in D. rerio, and multiple lineages of endogenous retroviruses (ERVs in D. rerio, O. latipes and G. aculeatus.
International Nuclear Information System (INIS)
Al-Allaf, T.; Rashan, L
1996-01-01
The antiviral activity of complexes cis-[Pt(DMSO) 2 CI 2 ] and trans-[Pd(DMSO) 2 CI 2 ] against the reverse transcriptase enzyme, herpes and influenza viruses have been studied in vitro. Both complexes demonstrated some activity against the reverse transcriptase enzyme in which the inhibition concentration (IC 5 0) of the cis-Pt and the trans-Pd complexes were shown to be 37.6 and 35.5 μ g/ml respectively. This activity was compared with that of the standard reference; the phosphonoformate (PFA). On the other hand, both complexes have no antiviral activity against herpes and influenza viruses No cytotoxic effects on the three cell lines, Raji, K562 and Mrc-5 were demonstrated by these complexes at the concentrations studied in vitro. (authors). 16 refs., 1 tab., 2 figs
Potent Inhibition of HIV-1 Replication in Resting CD4 T Cells by Resveratrol and Pterostilbene.
Chan, Chi N; Trinité, Benjamin; Levy, David N
2017-09-01
HIV-1 infection of resting CD4 T cells plays a crucial and numerically dominant role during virus transmission at mucosal sites and during subsequent acute replication and T cell depletion. Resveratrol and pterostilbene are plant stilbenoids associated with several health-promoting benefits. Resveratrol has been shown to inhibit the replication of several viruses, including herpes simplex viruses 1 and 2, papillomaviruses, severe acute respiratory syndrome virus, and influenza virus. Alone, resveratrol does not inhibit HIV-1 infection of activated T cells, but it does synergize with nucleoside reverse transcriptase inhibitors in these cells to inhibit reverse transcription. Here, we demonstrate that resveratrol and pterostilbene completely block HIV-1 infection at a low micromolar dose in resting CD4 T cells, primarily at the reverse transcription step. The anti-HIV effect was fully reversed by exogenous deoxynucleosides and Vpx, an HIV-1 and simian immunodeficiency virus protein that increases deoxynucleoside triphosphate (dNTP) levels. These findings are consistent with the reported ability of resveratrol to inhibit ribonucleotide reductase and to lower dNTP levels in cells. This study supports the potential use of resveratrol, pterostilbene, or related compounds as adjuvants in anti-HIV preexposure prophylaxis (PrEP) formulations. Copyright © 2017 American Society for Microbiology.
NCBI nr-aa BLAST: CBRC-MMUS-08-0010 [SEVENS
Lifescience Database Archive (English)
Full Text Available ong interspersed element-1) (L1) [Includes: Reverse transcriptase ; Endonuclease] gb|AAA66024.1| 2855 is the position of the first start codon in ORF 2; putative P11369 0.0 82% ...
Docking mode of delvardine and its analogues into the p66 domain ...
Indian Academy of Sciences (India)
SEARCHU
Delvardine and its structural derivatives are important non-nucleoside HIV-1 reverse transcriptase inhibitors (NNRTIs). .... [PDB ID:1REV] was taken from the Protein Data Bank ... Water molecules were removed and H atoms were added.
African Journals Online (AJOL)
Mr Olusoji
On logistic regression, factors that retained an ... used was a non-nucleoside reverse transcriptase (NNRTI) based HAART. Preterm births were .... Approval was obtained from the joint UI/ ... Package for Social Sciences (SPSS Inc, Chicago, Ill).
Mechanism of polypurine tract primer generation by HIV-1 reverse transcriptase
Czech Academy of Sciences Publication Activity Database
Figiel, M.; Krepl, Miroslav; Park, S.; Poznanski, J.; Skowronek, K.; Golab, A.; Ha, T.; Šponer, Jiří; Nowotny, M.
2018-01-01
Roč. 293, č. 1 (2018), s. 191-202 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68081707 Keywords : human-immunodeficiency-virus * strand dna -synthesis * retroviral rnases-h * rna/ dna hybrid Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.125, year: 2016
Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV ...
African Journals Online (AJOL)
and LA are related to the use of nucleoside reverse transcriptase ... 4 Discipline of Public HealthMedicine, School of Nursing and Public Health, College of Health Sciences, .... Finally, a multivariable adjusted logistic regression model was also.
NCBI nr-aa BLAST: CBRC-MMUS-18-0028 [SEVENS
Lifescience Database Archive (English)
Full Text Available ong interspersed element-1) (L1) [Includes: Reverse transcriptase ; Endonuclease] gb|AAA66024.1| 2855 is the position of the first start codon in ORF 2; putative P11369 2e-49 84% ...
Reverse genetics with animal viruses. NSV reverse genetics
International Nuclear Information System (INIS)
Mebatsion, T.
2005-01-01
New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)
Formation of stable and functional HIV-1 nucleoprotein complexes in vitro.
Tanchou, V; Gabus, C; Rogemond, V; Darlix, J L
1995-10-06
HIV genomic RNA resides within the nucleocapsid, in the interior of the virus, which serves to protect the RNA against nuclease degradation and to promote its reverse transcription. To investigate the role of nucleocapsid protein (NCp7) in the stability and replication of genomic RNA within the nucleocapsid, we used NCp7, reverse transcriptase (RT) and RNAs representing the 5' and 3' regions of the genome to reconstitute functional HIV-1 nucleocapsids. The nucleoprotein complexes generated in vitro were found to be stable, which, according to biochemical and genetic data, probably results from the tight binding of NCp7 molecules to the RNA and strong NCp7/NCp7 interactions. The nucleoprotein complexes efficiently protected viral RNA against RNase degradation and, at the same time, promoted viral DNA synthesis by RT. DNA strand transfer from the 5' to the 3' RNA template was very efficient in nucleoprotein complexes formed in the presence of both RNAs, but not when the RNAs were in separate complexes. These results indicate that the in vitro reconstituted HIV-1 nucleoprotein complexes function like virion nucleocapsids and thus provide a way to study at the molecular level this viral substructure and the synthesis of proviral DNA, and to search for new anti-HIV agents.
Feline immunodeficiency virus: Studies on pathogenesis and vaccine development
C.H.J. Siebelink (Kees)
1995-01-01
textabstractFeline immunodeficiency virus (FIV) is classified as a member of the genus Lentivirus (subfamily Lentivirinae) of the Retroviridae family on basis of its morphology, biochemical characteristics, genomic organization, Mg'+ dependent reverse transcriptase, and nucleotide sequence homology
Rapid and reversible epigenome editing by endogenous chromatin regulators.
Braun, Simon M G; Kirkland, Jacob G; Chory, Emma J; Husmann, Dylan; Calarco, Joseph P; Crabtree, Gerald R
2017-09-15
Understanding the causal link between epigenetic marks and gene regulation remains a central question in chromatin biology. To edit the epigenome we developed the FIRE-Cas9 system for rapid and reversible recruitment of endogenous chromatin regulators to specific genomic loci. We enhanced the dCas9-MS2 anchor for genome targeting with Fkbp/Frb dimerizing fusion proteins to allow chemical-induced proximity of a desired chromatin regulator. We find that mSWI/SNF (BAF) complex recruitment is sufficient to oppose Polycomb within minutes, leading to activation of bivalent gene transcription in mouse embryonic stem cells. Furthermore, Hp1/Suv39h1 heterochromatin complex recruitment to active promoters deposits H3K9me3 domains, resulting in gene silencing that can be reversed upon washout of the chemical dimerizer. This inducible recruitment strategy provides precise kinetic information to model epigenetic memory and plasticity. It is broadly applicable to mechanistic studies of chromatin in mammalian cells and is particularly suited to the analysis of endogenous multi-subunit chromatin regulator complexes.Understanding the link between epigenetic marks and gene regulation requires the development of new tools to directly manipulate chromatin. Here the authors demonstrate a Cas9-based system to recruit chromatin remodelers to loci of interest, allowing rapid, reversible manipulation of epigenetic states.
46,XY female sex reversal syndrome with bilateral gonadoblastoma and dysgerminoma.
DU, Xue; Zhang, Xuhong; Li, Yongmei; Han, Yukun
2014-10-01
Sex reversal syndrome is a rare congenital condition of complete or disordered gonadal development leading to discordance between the genetic, gonadal and phenotypic sexes, including 46,XX and 46,XY. The gonadoblastoma on the Y-chromosome (GBY) region is associated with an increased risk of developing type II germ cell tumors/cancer. The present study reports a unique case of a phenotypically normal female (age 17 years), presenting with primary amenorrhea and later diagnosed with 46,XY female sex reversal syndrome. Following bilateral gonadectomy, bilateral gonadoblastoma and dysgerminoma were diagnosed. Thus, estrogen replacement therapy was administered periodically to promote the development of secondary sexual characteristics and menstruation, and to prevent osteoporosis. A four year follow-up showed no tumor recurrence and a regular menstrual cycle in this patient.
Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R
2018-01-01
The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Poppe, Lisa K; Chunda-Liyoka, Catherine; Kwon, Eun H; Gondwe, Clement; West, John T; Kankasa, Chipepo; Ndongmo, Clement B; Wood, Charles
2017-08-24
The objectives of this study were to determine HIV drug resistance (HIVDR) prevalence in Zambian infants upon diagnosis, and to determine how changing prevention of mother-to-child transmission (PMTCT) drug regimens affect drug resistance. Dried blood spot (DBS) samples from infants in the Lusaka District of Zambia, obtained during routine diagnostic screening, were collected during four different years representing three different PMTCT drug treatment regimens. DNA extracted from dried blood spot samples was used to sequence a 1493 bp region of the reverse transcriptase gene. Sequences were analyzed via the Stanford HIVDRdatabase (http://hivdb.standford.edu) to screen for resistance mutations. HIVDR in infants increased from 21.5 in 2007/2009 to 40.2% in 2014. Nonnucleoside reverse transcriptase inhibitor resistance increased steadily over the sampling period, whereas nucleoside reverse transcriptase inhibitor resistance and dual class resistance both increased more than threefold in 2014. Analysis of drug resistance scores in each group revealed increasing strength of resistance over time. In 2014, children with reported PMTCT exposure, defined as infant prophylaxis and/or maternal treatment, showed a higher prevalence and strength of resistance compared to those with no reported exposure. HIVDR is on the rise in Zambia and presents a serious problem for the successful lifelong treatment of HIV-infected children. PMTCT affects both the prevalence and strength of resistance and further research is needed to determine how to mitigate its role leading to resistance.
In vitro resistance profile of the candidate HIV-1 microbicide drug dapivirine.
Schader, Susan M; Oliveira, Maureen; Ibanescu, Ruxandra-Ilinca; Moisi, Daniela; Colby-Germinario, Susan P; Wainberg, Mark A
2012-02-01
Antiretroviral-based microbicides may offer a means to reduce the sexual transmission of HIV-1. Suboptimal use of a microbicide may, however, lead to the development of drug resistance in users that are already, or become, infected with HIV-1. In such cases, the efficacy of treatments may be compromised since the same (or similar) antiretrovirals used in treatments are being developed as microbicides. To help predict which drug resistance mutations may develop in the context of suboptimal use, HIV-1 primary isolates of different subtypes and different baseline resistance profiles were used to infect primary cells in vitro in the presence of increasing suboptimal concentrations of the two candidate microbicide antiretrovirals dapivirine (DAP) and tenofovir (TFV) alone or in combination. Infections were ongoing for 25 weeks, after which reverse transcriptase genotypes were determined and scrutinized for the presence of any clinically recognized reverse transcriptase drug resistance mutations. Results indicated that suboptimal concentrations of DAP alone facilitated the emergence of common nonnucleoside reverse transcriptase inhibitor resistance mutations, while suboptimal concentrations of DAP plus TFV gave rise to fewer mutations. Suboptimal concentrations of TFV alone did not frequently result in the development of resistance mutations. Sensitivity evaluations for stavudine (d4T), nevirapine (NVP), and lamivudine (3TC) revealed that the selection of resistance as a consequence of suboptimal concentrations of DAP may compromise the potential for NVP to be used in treatment, a finding of potential relevance in developing countries.
A. Phillips (Andrew); V. Cambiano (Valentina); F. Nakagawa (Fumiyo); P. Revill (Paul); M.R. Jordan (Michael); T.B. Hallett (Timothy); M.C. Doherty (Meg); A. de Luca (Andrea); Lundgren, J.D. (Jens D.); Mhangara, M. (Mutsa); Apollo, T. (Tsitsi); J.W. Mellors (John W.); B.E. Nichols (Brooke); Parikh, U. (Urvi); D. Pillay (Deenan); T.F. Rinke de Wit (Tobias); K.C. Sigaloff (Kim); Havlir, D. (Diane); D.R. Kuritzkes (Daniel); A. Pozniak (Anton); D.A.M.C. van de Vijver (David); M. Vitoria (Marco); Wainberg, M.A. (Mark A.); E. Raizes (Elliot); S. Bertagnolio (Silvia)
2017-01-01
textabstractBackground: There is concern over increasing prevalence of non-nucleoside reverse-transcriptase inhibitor (NNRTI) resistance in people initiating antiretroviral therapy (ART) in low-income and middle-income countries. We assessed the effectiveness and cost-effectiveness of alternative
Bienczak, A.; Denti, P.; Cook, A.; Wiesner, L.; Mulenga, V.; Kityo, C.; Kekitiinwa, A.; Gibb, D.M.; Burger, D.M.; Walker, A.S.; McIlleron, H.
2017-01-01
BACKGROUND: Nevirapine is the only nonnucleoside reverse transcriptase inhibitor currently available as a paediatric fixed-dose-combination tablet and is widely used in African children. Nonetheless, the number of investigations into pharmacokinetic determinants of virological suppression in African
Collaboration, H.-C.; Koopmans †, P.P.; Brouwer, A.M.; Dofferhoff, A.S.M.; Flier, M. van der; Groot, R. de; Hofstede, H.J.M. ter; Keuter, M.; Ven, A.J.A.M. van der; et al.,
2012-01-01
OBJECTIVE: To compare regimens consisting of either efavirenz or nevirapine and two or more nucleoside reverse transcriptase inhibitors (NRTIs) among HIV-infected, antiretroviral-naive, and AIDS-free individuals with respect to clinical, immunologic, and virologic outcomes. DESIGN: Prospective
Granata, Riccarda; Trovato, Letizia; Gallo, Maria Pia; Destefanis, Silvia; Settanni, Fabio; Scarlatti, Francesca; Brero, Alessia; Ramella, Roberta; Volante, Marco; Isgaard, Jorgen; Levi, Renzo; Papotti, Mauro; Alloatti, Giuseppe; Ghigo, Ezio
2009-07-15
The hypothalamic neuropeptide growth hormone-releasing hormone (GHRH) stimulates GH synthesis and release in the pituitary. GHRH also exerts proliferative effects in extrapituitary cells, whereas GHRH antagonists have been shown to suppress cancer cell proliferation. We investigated GHRH effects on cardiac myocyte cell survival and the underlying signalling mechanisms. Reverse transcriptase-polymerase chain reaction analysis showed GHRH receptor (GHRH-R) mRNA in adult rat ventricular myocytes (ARVMs) and in rat heart H9c2 cells. In ARVMs, GHRH prevented cell death and caspase-3 activation induced by serum starvation and by the beta-adrenergic receptor agonist isoproterenol. The GHRH-R antagonist JV-1-36 abolished GHRH survival action under both experimental conditions. GHRH-induced cardiac cell protection required extracellular signal-regulated kinase (ERK)1/2 and phosphoinositide-3 kinase (PI3K)/Akt activation and adenylyl cyclase/cAMP/protein kinase A signalling. Isoproterenol strongly upregulated the mRNA and protein of the pro-apoptotic inducible cAMP early repressor, whereas GHRH completely blocked this effect. Similar to ARVMs, in H9c2 cardiac cells, GHRH inhibited serum starvation- and isoproterenol-induced cell death and apoptosis through the same signalling pathways. Finally, GHRH improved left ventricular recovery during reperfusion and reduced infarct size in Langendorff-perfused rat hearts, subjected to ischaemia-reperfusion (I/R) injury. These effects involved PI3K/Akt signalling and were inhibited by JV-1-36. Our findings suggest that GHRH promotes cardiac myocyte survival through multiple signalling mechanisms and protects against I/R injury in isolated rat heart, indicating a novel cardioprotective role of this hormone.
DEFF Research Database (Denmark)
Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels
2011-01-01
Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...
DEFF Research Database (Denmark)
Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels
2011-01-01
Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...
European recommendations for the clinical use of HIV drug resistance testing: 2011 update
DEFF Research Database (Denmark)
Vandamme, Anne-Mieke; Camacho, Ricardo J; Ceccherini-Silberstein, Francesca
2011-01-01
, and other drug targets (integrase and envelope) if such drugs were part of the failing regimen; (iii) consider testing for CCR5 tropism at virologic failure or when a change of therapy has to be made in absence of detectable viral load, and in the latter case test DNA or last detectable plasma RNA; (iv...... the following recommendations concerning the indications for resistance testing: for HIV-1 (i) test earliest sample for protease and reverse transcriptase drug resistance in drug-naive patients with acute or chronic infection; (ii) test protease and reverse transcriptase drug resistance at virologic failure...... is needed after treatment failure. The Panel recommends genotyping in most situations, using updated and clinically evaluated interpretation systems. It is mandatory that laboratories performing HIV resistance tests take part regularly in external quality assurance programs, and that they consider storing...
Research on the application of the internet of things in reverse logistics information management
Directory of Open Access Journals (Sweden)
Yuexia Gu
2013-09-01
Full Text Available Objective: Combined the current situation with the development trend of reverse logistics, the article focus on the research of Internet of Things application in the reverse logistics information management, starts with the study of reverse logistics information system, and describes the system structure and system process in applying Internet of Things in reverse logistics information management, finally brings forward the constraints like management and economic ones in applying the technology to the system. Research methods: By analyzing the current situation of reverse logistics information system, utilizing literature research methods to put forward characters of reverse logistics information system, and expanding the previous studies on Internet information transmission, we gradually establish the reverse logistics management information system on the basis of the application of Internet of Things. Research Results: Through applying the Internet of Things in the reverse logistics system, we can build a complete close-loop logistics system by linking both extreme ends of positive and negative logistics. Besides, the system will be engaged in data mining in backflow prediction data and re-processing data at regular and irregular intervals. Moreover, advice will be provided to design, purchase, manufacturing and customer service departments for their reference so as to promote respective business. Research Application and Limits: This paper focuses on how the enterprise should apply the Internet of Things technology in reverse logistics, and how to build this system in detail and what the flow planning is made. This thesis is only limited to the analysis of constraints impeding the development of the reverse logistics MIS, including management constraints, economic constraints, hardware technology, data security and rights management constraints. Detailed solutions to address these problems will be put forward in the further research.
Directory of Open Access Journals (Sweden)
Fox Jane
2010-12-01
Full Text Available Abstract Background Agonist stimulation of airway smooth muscle (ASM results in IP3 mediated Ca2+ release from the sarcoplasmic reticulum followed by the activation of store operated and receptor operated non-selective cation channels. Activation of these non-selective channels also results in a Na+ influx. This localised increase in Na+ levels can potentially switch the Na+/Ca2+ exchanger into reverse mode and so result in a further influx of Ca2+. The aim of this study was to characterise the expression and physiological function of the Na+/Ca2+ exchanger in cultured human bronchial smooth muscle cells and determine its contribution to agonist induced Ca2+ influx into these cells. Methods The expression profile of NCX (which encodes the Na+/Ca2+ exchanger homologues in cultured human bronchial smooth muscle cells was determined by reverse transcriptase PCR. The functional activity of reverse mode NCX was investigated using a combination of whole cell patch clamp, intracellular Ca2+ measurements and porcine airway contractile analyses. KB-R7943 (an antagonist for reverse mode NCX and target specific siRNA were utilised as tools to inhibit NCX function. Results NCX1 protein was detected in cultured human bronchial smooth muscle cells (HBSMC cells and NCX1.3 was the only mRNA transcript variant detected. A combination of intracellular Na+ loading and addition of extracellular Ca2+ induced an outwardly rectifying current which was augmented following stimulation with histamine. This outwardly rectifying current was inhibited by 10 μM KB-R7943 (an antagonist of reverse mode NCX1 and was reduced in cells incubated with siRNA against NCX1. Interestingly, this outwardly rectifying current was also inhibited following knockdown of STIM1, suggesting for the first time a link between store operated cation entry and NCX1 activation. In addition, 10 μM KB-R7943 inhibited agonist induced changes in cytosolic Ca2+ and induced relaxation of porcine
Over-expression of Arabidopsis DnaJ (Hsp40) contributes to NaCl ...
African Journals Online (AJOL)
USER
2010-02-15
Feb 15, 2010 ... levels of DnaJ in their transgenic sense lines exhibited tolerance to NaCl stress. Under 120 mM ... polymerase chain reaction; RT-PCR, reverse transcriptase –. PCR; CTAB ..... Engineering salt tolerance in plants. Curr. Opin.
Evaluation of NGS and RT-PCR methods for ALK rearrangement in European NSCLC patients
DEFF Research Database (Denmark)
Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota
2018-01-01
INTRODUCTION: The reported prevalence of ALK rearrangement in NSCLC ranges from 2%-7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proven to be a reproducible and sensitive technique. Reverse transcriptase...
DEFF Research Database (Denmark)
Bannister, Wendy P; Ruiz, Lidia; Cozzi-Lepri, Alessandro
2008-01-01
OBJECTIVE: To compare virological outcome and genotypic resistance profiles in HIV-1-infected patients starting non-nucleoside reverse transcriptase inhibitor (NNRTI)-containing regimens. METHODS: NNRTI-naive patients were included who started treatment with nevirapine (NVP) or efavirenz (EFV) wi...
From heresy to dogma in accounts of opposition to Howard Temin's DNA provirus hypothesis.
Marcum, James A
2002-01-01
In 1964 the Wisconsin virologist Howard Temin proposed the DNA provirus hypothesis to explain the mechanism by which a cancer-producing virus containing only RNA infects and transforms cells. His hypothesis reversed the flow of genetic information, as ordained by the central dogma of molecular biology. Although there was initial opposition to his hypothesis it was widely accepted, after the discovery of reverse transcriptase in 1970. Most accounts of Temin's hypothesis after the discovery portray the hypothesis as heretical, because it challenged the central dogma. Temin himself in his Nobel Prize speech of 1975 narrates a similar story about its reception. But are these accounts warranted? I argue that members of the virology community opposed Temin's provirus hypothesis not simply because it was a counterexample to the central dogma, but more importantly because his experimental evidence for supporting it was inconclusive. Furthermore, I propose that these accounts of opposition to the DNA provirus hypothesis as heretical, written by Temin and others after the discovery of reverse transcriptase, played a significant role in establishing retrovirology as a specialized field.
An algebra of reversible computation.
Wang, Yong
2016-01-01
We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.
DEFF Research Database (Denmark)
Soerensen, K. E.; Olsen, H. G.; Skovgaard, Kerstin
2013-01-01
for thromboelastography (TEG) and assessment of plasma-based haemostatic parameters. Tissue was collected for histopathology and reverse transcriptase quantitative real-time polymerase chain reaction for measurement of mRNA encoding EC markers. All infected animals developed DIC; including procoagulant activation...
Forensic pregnancy diagnostics with placental mRNA markers
J. Gauvin (Jeanot); D. Zubakov (Dmitry); J. van Rhee-Binkhorst (Joke); A. Kloosterman (Ate); E.A.P. Steegers (Eric); M.H. Kayser (Manfred)
2010-01-01
textabstractCurrent methods for pregnancy diagnostics are based on immunodetection of pregnancy-specific proteins and in a forensic context suffer from sensitivity and specificity issues. Here, we applied reverse transcriptase polymerase chain reaction (RT-PCR) technology to 11 genes previously
Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA
Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.
2011-01-01
Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine
Going, JJ; Fletcher-Monaghan, AJ; Neilson, L; Wisman, BA; van der Zee, A; Stuart, RC; Keith, WN
2004-01-01
Glandular dysplasia in Barrett's esophagus may regress spontaneously but can also progress to cancer. The human telomerase RNA template and the human telomerase reverse transcriptase enzyme which do not, of themselves, correlate strongly with telomerase activity, are too often overexpressed in
On thermodynamic and microscopic reversibility
International Nuclear Information System (INIS)
Crooks, Gavin E
2011-01-01
The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa
Coon, J S; Knudson, W; Clodfelter, K; Lu, B; Weinstein, R S
1991-02-01
A recently developed non-ionic surfactant called Solutol HS 15 (poly-oxyethylene esters of 12-hydroxystearic acid), with low toxicity in vivo, was shown to reverse completely the multidrug resistance of KB 8-5 and KB 8-5-11 human epidermoid carcinoma cells in vitro but did not potentiate drug toxicity in drug-sensitive KB 3-1 cells. At a concentration of 10% of its own IC50 (mean concentration of drug that causes 50% inhibition of cell growth compared to controls), Solutol HS 15 produced a 35-, 28-, and 42-fold reduction in the resistance of KB 8-5-11 cells to colchicine, vinblastine, and doxorubicin, respectively. Solutol HS 15 was relatively much more potent than the prototypic reversing agent, verapamil, for reversing colchicine resistance, compared to the ability of each agent to reverse colchicine resistance, compared to the ability of each agent to reverse vinblastine resistance. Like verapamil, Solutol HS 15 promoted a 50-fold accumulation of rhodamine 123 in KB 8-5-11 cells, as measured by flow cytometry. Also, Solutol HS 15 and verapamil reduced the efflux of rhodamine 123 from KB 8-5-11 cells previously loaded with rhodamine 123 to a similar low rate. Solutol HS 15 did not affect the transport of alanine or glucose into KB 8-5-11 cells, indicating that its effect upon membrane active transport is not entirely nonspecific. Considering their different structure and different relative potency for reversing colchicine resistance, Solutol HS 15 and verapamil probably reverse multidrug resistance by different mechanisms. Solutol HS 15 merits consideration as a potential therapeutic agent because of its effectiveness for reversing multidrug resistance in vitro and its low toxicity in vivo.
SIPA1 promotes invasion and migration in human oral squamous cell carcinoma by ITGB1 and MMP7
International Nuclear Information System (INIS)
Takahara, Toshikazu; Kasamatsu, Atsushi; Yamatoji, Masanobu; Iyoda, Manabu; Kasama, Hiroki; Saito, Tomoaki; Takeuchi, Shin; Endo-Sakamoto, Yosuke; Shiiba, Masashi; Tanzawa, Hideki; Uzawa, Katsuhiro
2017-01-01
Signal-induced proliferation-associated protein 1 (SIPA1) is known to be a GTPase activating protein. Overexpressed SIPA1 is related to metastatic progression in breast and prostate cancers; however, the relevance of SIPA1 in oral squamous cell carcinoma (OSCC) is still unknown. The aim of this study was to examine SIPA1 expression and its functional mechanisms in OSCC. SIPA1 mRNA and protein expressions were analyzed by quantitative reverse transcriptase-polymerase chain reaction, Western blot analysis, and immunohistochemistry. The expressions of SIPA1 were up-regulated significantly in vitro and in vivo. Moreover, SIPA1 expression was correlated with regional lymph node metastasis. We next assessed the cellular functions associated with tumoral metastasis using SIPA1 knockdown (shSIPA1) cells and analyzed the downstream molecules of SIPA1, i.e., bromodomain containing protein 4(BRD4), integrin beta1 (ITGB1), and matrix metalloproteinase 7 (MMP7). The shSIPA1 cells showed decreased invasiveness and migratory activities, however cellular adhesion ability was maintained at a high level. In addition, ITGB1 expression was greater in shSIPA1 cells, whereas MMP7 expression was lower than in control cells. This research is the first to establish that SIPA1 promotes cancer metastasis by regulating the ITGB1 and MMP7. Therefore, SIPA1 might be a novel therapeutic target for patients with lymph node metastasis of OSCC. - Highlights: • SIPA1 expression was up-regulated in oral squamous cell carcinoma (OSCC). • SIPA1-positive OSCCs were correlated with regional lymph node metastasis. • SIPA1 controlled BRD4 and influenced transcription of ITGB1and MMP7. • SIPA1 induced cellular invasion and migration and decreased cellular adhesion. • SIPA1 might be a potential biomarker of cancer metastasis for OSCC.
SIPA1 promotes invasion and migration in human oral squamous cell carcinoma by ITGB1 and MMP7
Energy Technology Data Exchange (ETDEWEB)
Takahara, Toshikazu [Department of Oral Science, Graduate School of Medicine, Chiba University, Chiba (Japan); Kasamatsu, Atsushi, E-mail: kasamatsua@faculty.chiba-u.jp [Department of Dentistry and Oral-Maxillofacial Surgery, Chiba University Hospital, Chiba (Japan); Yamatoji, Masanobu [Department of Dentistry and Oral-Maxillofacial Surgery, Chiba University Hospital, Chiba (Japan); Iyoda, Manabu; Kasama, Hiroki; Saito, Tomoaki [Division of Oral Surgery, Chiba Rosai Hospital, Chiba (Japan); Takeuchi, Shin [Department of Oral Science, Graduate School of Medicine, Chiba University, Chiba (Japan); Endo-Sakamoto, Yosuke [Department of Dentistry and Oral-Maxillofacial Surgery, Chiba University Hospital, Chiba (Japan); Shiiba, Masashi [Department of Medical Oncology, Graduate School of Medicine, Chiba University, Chiba (Japan); Tanzawa, Hideki [Department of Oral Science, Graduate School of Medicine, Chiba University, Chiba (Japan); Department of Dentistry and Oral-Maxillofacial Surgery, Chiba University Hospital, Chiba (Japan); Uzawa, Katsuhiro, E-mail: uzawak@faculty.chiba-u.jp [Department of Oral Science, Graduate School of Medicine, Chiba University, Chiba (Japan); Department of Dentistry and Oral-Maxillofacial Surgery, Chiba University Hospital, Chiba (Japan)
2017-03-15
Signal-induced proliferation-associated protein 1 (SIPA1) is known to be a GTPase activating protein. Overexpressed SIPA1 is related to metastatic progression in breast and prostate cancers; however, the relevance of SIPA1 in oral squamous cell carcinoma (OSCC) is still unknown. The aim of this study was to examine SIPA1 expression and its functional mechanisms in OSCC. SIPA1 mRNA and protein expressions were analyzed by quantitative reverse transcriptase-polymerase chain reaction, Western blot analysis, and immunohistochemistry. The expressions of SIPA1 were up-regulated significantly in vitro and in vivo. Moreover, SIPA1 expression was correlated with regional lymph node metastasis. We next assessed the cellular functions associated with tumoral metastasis using SIPA1 knockdown (shSIPA1) cells and analyzed the downstream molecules of SIPA1, i.e., bromodomain containing protein 4(BRD4), integrin beta1 (ITGB1), and matrix metalloproteinase 7 (MMP7). The shSIPA1 cells showed decreased invasiveness and migratory activities, however cellular adhesion ability was maintained at a high level. In addition, ITGB1 expression was greater in shSIPA1 cells, whereas MMP7 expression was lower than in control cells. This research is the first to establish that SIPA1 promotes cancer metastasis by regulating the ITGB1 and MMP7. Therefore, SIPA1 might be a novel therapeutic target for patients with lymph node metastasis of OSCC. - Highlights: • SIPA1 expression was up-regulated in oral squamous cell carcinoma (OSCC). • SIPA1-positive OSCCs were correlated with regional lymph node metastasis. • SIPA1 controlled BRD4 and influenced transcription of ITGB1and MMP7. • SIPA1 induced cellular invasion and migration and decreased cellular adhesion. • SIPA1 might be a potential biomarker of cancer metastasis for OSCC.
Reversibility of female sterilization.
Siegler, A M; Hulka, J; Peretz, A
1985-04-01
The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their
Raees Ahmad, Sufiyan Ahmad; Patil, Lalit; Mohammed Usman, Mohammed Rageeb; Imran, Mohammad; Akhtar, Rashid
2018-01-01
A simple rapid, accurate, precise, and reproducible validated reverse phase high performance liquid chromatography (HPLC) method was developed for the determination of Abacavir (ABAC) and Lamivudine (LAMI) in bulk and tablet dosage forms. The quantification was carried out using Symmetry Premsil C18 (250 mm × 4.6 mm, 5 μm) column run in isocratic way using mobile phase comprising methanol: water (0.05% orthophosphoric acid with pH 3) 83:17 v/v and a detection wavelength of 245 nm and injection volume of 20 μl, with a flow rate of 1 ml/min. In the developed method, the retention times of ABAC and LAMI were found to be 3.5 min and 7.4 min, respectively. The method was validated in terms of linearity, precision, accuracy, limits of detection, limits of quantitation, and robustness in accordance with the International Conference on Harmonization guidelines. The assay of the proposed method was found to be 99% - 101%. The recovery studies were also carried out and mean % recovery was found to be 99% - 101%. The % relative standard deviation from reproducibility was found to be performance liquid chromatography, UV: Ultraviolet, ICH: International Conference on Harmonization, ABAC: Abacavir, LAMI: Lamivudine, HIV: Human immunodeficiency virus, AIDS: Acquired immunodeficiency syndrome, NRTI: Nucleoside reverse transcriptase inhibitors, ARV: Antiretroviral, RSD: Relative standard deviation, RT: Retention time, SD: Standard deviation.
Gallet, Y.; Pavlov, V.; Shatsillo, A.; Hulot, G.
2015-12-01
Constraining the evolution in the geomagnetic reversal frequency over hundreds of million years is not a trivial matter. Beyond the fact that there are long periods without reversals, known as superchrons, and periods with many reversals, the way the reversal frequency changes through time during reversing periods is still debated. A smooth evolution or a succession of stationary segments have both been suggested to account for the geomagnetic polarity time scale since the Middle-Late Jurassic. Sudden changes from a reversing mode to a non-reversing mode of the geodynamo may also well have happened, the switch between the two modes having then possibly been controlled by the thermal conditions at the core-mantle boundary. There is, nevertheless, a growing set of magnetostratigraphic data, which could help decipher a proper interpretation of the reversal history, in particular in the early Paleozoic and even during the Precambrian. Although yielding a fragmentary record, these data reveal the occurrence of both additional superchrons and periods characterized by extremely high, not to say extraordinary, magnetic reversal frequencies. In this talk, we will present a synthesis of these data, mainly obtained from Siberia, and discuss their implication for the magnetic reversal behavior over the past billion years.
Exploring strain-promoted 1,3-dipolar cycloadditions of end functionalized polymers
Ledin, Petr A; Kolishetti, Nagesh; Hudlikar, Manish S; Boons, Geert-Jan
2014-01-01
Strain-promoted 1,3-dipolar cycloaddition of cyclooctynes with 1,3-dipoles such as azides, nitrones, and nitrile oxides, are of interest for the functionalization of polymers. In this study, we have explored the use of a 4-dibenzocyclooctynol (DIBO)-containing chain transfer agent in reversible
Investigating the reversed causality of engagement and burnout in job demands-resources theory
Directory of Open Access Journals (Sweden)
Leon T. de Beer
2013-03-01
Full Text Available Orientation: Reversed causality is an area that has not commanded major attention within the South African context, specifically pertaining to engagement, burnout and job demands resources. Therefore, this necessitated an investigation to elucidate the potential effects. Research purpose: To investigate the reversed causal hypotheses of burnout and engagement in job demands-resources theory over time. Motivation for the study: Organisations and researchers should be made aware of the effects that burnout and engagement could have over time on resources and demands. Research design, approach and method: A longitudinal design was employed. The availability sample (n = 593 included participants from different demographic backgrounds. A survey was used to measure all constructs at both points in time. Structural equation modelling techniques were implemented with a categorical estimator to investigate the proposed hypotheses. Main findings: Burnout was found to have a significant negative longitudinal relationship with colleague support and supervisor support, whilst the negative relationship with supervisor support over time was more prominent. Engagement showed only one significant but small, negative relationship with supervisor support over time. All other relationships were statistically non-significant. Practical/managerial implications: This study makes organisations aware of the relationship between burnout and relationships at work over time. Proactive measures to promote relationships at work, specifically supervisor support, should be considered in addition to combatting burnout itself and promoting engagement. Contribution/value-add: This study provides insights and information on reversed causality, namely, the effects that engagement and burnout can have over time.
Combined treatment with lisofylline and exendin-4 reverses autoimmune diabetes
International Nuclear Information System (INIS)
Yang Zandong; Chen Meng; Carter, Jeffrey D.; Nunemaker, Craig S.; Garmey, James C.; Kimble, Sarah D.; Nadler, Jerry L.
2006-01-01
Type 1 diabetes mellitus (T1DM) is an autoimmune disease leading to near complete pancreatic β-cell destruction. New evidence suggests that β-cell regeneration is possible, but ongoing autoimmune damage prevents restoration of β-cell mass. We tested the hypothesis that simultaneously blocking autoimmune cytokine damage and supplying a growth-promoting stimulus for β-cells would provide a novel approach to reverse T1DM. Therefore, in this study we combined lisofylline to suppress autoimmunity and exendin-4 to enhance β-cell proliferation for treating autoimmune-mediated diabetes in the non-obese diabetic (NOD) mouse model. We found that this combined therapy effectively reversed new-onset diabetes within a week of therapy, and even maintained euglycemia up to 145 days after treatment withdrawal. The therapeutic effect of this regimen was associated with improved β-cell metabolism and insulin secretion, while reducing β-cell apoptosis. It is possible that such combined therapy could become a new strategy to defeat T1DM in humans
Thakkar, Vidhi D; Cox, Robert M; Sawatsky, Bevan; da Fontoura Budaszewski, Renata; Sourimant, Julien; Wabbel, Katrin; Makhsous, Negar; Greninger, Alexander L; von Messling, Veronika; Plemper, Richard K
2018-04-15
The paramyxovirus replication machinery comprises the viral large (L) protein and phosphoprotein (P-protein) in addition to the nucleocapsid (N) protein, which encapsidates the single-stranded RNA genome. Common to paramyxovirus N proteins is a C-terminal tail (Ntail). The mechanistic role and relevance for virus replication of the structurally disordered central Ntail section are unknown. Focusing initially on members of the Morbillivirus genus, a series of measles virus (MeV) and canine distemper virus (CDV) N proteins were generated with internal deletions in the unstructured tail section. N proteins with large tail truncations remained bioactive in mono- and polycistronic minireplicon assays and supported efficient replication of recombinant viruses. Bioactivity of Ntail mutants extended to N proteins derived from highly pathogenic Nipah virus. To probe an effect of Ntail truncations on viral pathogenesis, recombinant CDVs were analyzed in a lethal CDV/ferret model of morbillivirus disease. The recombinant viruses displayed different stages of attenuation ranging from ameliorated clinical symptoms to complete survival of infected animals, depending on the molecular nature of the Ntail truncation. Reinfection of surviving animals with pathogenic CDV revealed robust protection against a lethal challenge. The highly attenuated virus was genetically stable after ex vivo passaging and recovery from infected animals. Mechanistically, gradual viral attenuation coincided with stepwise altered viral transcriptase activity in infected cells. These results identify the central Ntail section as a determinant for viral pathogenesis and establish a novel platform to engineer gradual virus attenuation for next-generation paramyxovirus vaccine design. IMPORTANCE Investigating the role of the paramyxovirus N protein tail domain (Ntail) in virus replication, we demonstrated in this study that the structurally disordered central Ntail region is a determinant for viral
Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de W.M.; Vaughan, E.E.
2002-01-01
The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and
Osmotic stress upregulates the transcription of thiamine (vitamin B1 ...
African Journals Online (AJOL)
Syamimi Mimi
2016-07-20
Jul 20, 2016 ... damage tolerance when subjected to abiotic stress. (Machado et al. ... µg/µl of total RNA, 4 µl of 5× Reverse Transcriptase Buffer, 1 µl of 10 mM ..... facilitate vitamin B1 biofortification of plants by genetic engineering;. Front.
DEFF Research Database (Denmark)
Rosa, Fabíola E; Caldeira, José R F; Felipes, Joice
2008-01-01
To elucidate the molecular profile of hormonal steroid receptor status, we analyzed ER-alpha, ER-beta, and PGR mRNA and protein expression in 80 breast carcinomas using reverse transcriptase polymerase chain reaction (RT-PCR), quantitative RT-PCR, and immunohistochemical analysis. Qualitative ana...
The Genomic Grade Assay Compared With Ki67 to Determine Risk of Distant Breast Cancer Recurrence
DEFF Research Database (Denmark)
Ignatiadis, Michail; Azim, Hatem A; Desmedt, Christine
2016-01-01
Importance: The Genomic Grade Index (GGI) was previously developed, evaluated on frozen tissue, and shown to be prognostic in early breast cancer. To test the GGI in formalin-fixed, paraffin-embedded breast cancer tumors, a quantitative reverse transcriptase polymerase chain reaction assay...
Mariot, Roberta Fogliatto; Oliveira, De Luisa Abruzzi; Voorhuijzen, M.M.; Staats, Martijn; Hutten, R.C.B.; Dijk, Van J.P.; Kok, Esther; Frazzon, Jeverson
2015-01-01
Potato (Solanum tuberosum) yield has increased dramatically over the last 50 years and this has been achieved by a combination of improved agronomy and biotechnology efforts. Gene studies are taking place to improve new qualities and develop new cultivars. Reverse transcriptase quantitative
Imidazo[1,2-a]pyridines as NNRTIs
CSIR Research Space (South Africa)
Bode, ML
2010-01-01
Full Text Available The enzyme reverse transcriptase (RT) is a validated target for the development of anti-HIV drugs. Drugs acting against RT may act at either the catalytic site (NRTIs) or the allosteric site (NNRTIs). During random screening of a small in...
Gupta, Ravindra K.; Gregson, John; Parkin, Neil; Haile-Selassie, Hiwot; Tanuri, Amilcar; Andrade Forero, Liliana; Kaleebu, Pontiano; Watera, Christine; Aghokeng, Avelin; Mutenda, Nicholus; Dzangare, Janet; Hone, San; Hang, Zaw Zaw; Garcia, Judith; Garcia, Zully; Marchorro, Paola; Beteta, Enrique; Giron, Amalia; Hamers, Raph; Inzaule, Seth; Frenkel, Lisa M.; Chung, Michael H.; de Oliveira, Tulio; Pillay, Deenan; Naidoo, Kogie; Kharsany, Ayesha; Kugathasan, Ruthiran; Cutino, Teresa; Hunt, Gillian; Avila Rios, Santiago; Doherty, Meg; Jordan, Michael R.; Bertagnolio, Silvia
2018-01-01
Pretreatment drug resistance in people initiating or re-initiating antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTIs) might compromise HIV control in low-income and middle-income countries (LMICs). We aimed to assess the scale of this problem and whether
Evgen'ev, M B; Corces, V G; Lankenau, D H
1992-06-05
We have determined the DNA structure of the Ulysses transposable element of Drosophila virilis and found that this transposon is 10,653 bp and is flanked by two unusually large direct repeats 2136 bp long. Ulysses shows the characteristic organization of LTR-containing retrotransposons, with matrix and capsid protein domains encoded in the first open reading frame. In addition, Ulysses contains protease, reverse transcriptase, RNase H and integrase domains encoded in the second open reading frame. Ulysses lacks a third open reading frame present in some retrotransposons that could encode an env-like protein. A dendrogram analysis based on multiple alignments of the protease, reverse transcriptase, RNase H, integrase and tRNA primer binding site of all known Drosophila LTR-containing retrotransposon sequences establishes a phylogenetic relationship of Ulysses to other retrotransposons and suggests that Ulysses belongs to a new family of this type of elements.
Towards novel therapeutics for HIV through fragment-based screening and drug design.
Tiefendbrunn, Theresa; Stout, C David
2014-01-01
Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.
An intravaginal ring that releases the NNRTI MIV-150 reduces SHIV transmission in macaques.
Singer, Rachel; Mawson, Paul; Derby, Nina; Rodriguez, Aixa; Kizima, Larisa; Menon, Radhika; Goldman, Daniel; Kenney, Jessica; Aravantinou, Meropi; Seidor, Samantha; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Robbiani, Melissa; Zydowsky, Thomas M
2012-09-05
Microbicides may prevent HIV and sexually transmitted infections (STIs) in women; however, determining the optimal means of delivery of active pharmaceutical ingredients remains a major challenge. We previously demonstrated that a vaginal gel containing the non-nucleoside reverse transcriptase inhibitor MIV-150 partially protected macaques from SHIV-RT (simian/HIV reverse transcriptase) infection, and the addition of zinc acetate rendered the gel significantly protective. We test the activity of MIV-150 without the addition of zinc acetate when delivered from either ethylene vinyl acetate (EVA) or silicone intravaginal rings (IVRs). MIV-150 was successfully delivered, because it was detected in vaginal fluids and tissues by radioimmunoassay in pharmacokinetic studies. Moreover, EVA IVRs significantly protected macaques from SHIV-RT infection. Our results demonstrate that MIV-150-containing IVRs have the potential to prevent HIV infection and highlight the possible use of IVRs for delivering drugs that block HIV and other STIs.
Sex-role reversal of a monogamous pipefish without higher potential reproductive rate in females.
Sogabe, Atsushi; Yanagisawa, Yasunobu
2007-12-07
In monogamous animals, males are usually the predominant competitors for mates. However, a strictly monogamous pipefish Corythoichthys haematopterus exceptionally exhibits a reversed sex role. To understand why its sex role is reversed, we measured the adult sex ratio and the potential reproductive rate (PRR), two principal factors influencing the operational sex ratio (OSR), in a natural population of southern Japan. The adult sex ratio was biased towards females throughout the breeding season, but the PRR, which increased with water temperature, did not show sexual difference. We found that an alternative index of the OSR (Sf/Sm: sex ratio of 'time in') calculated from the monthly data was consistently biased towards females. The female-biased OSR associated with sex-role reversal has been reported in some polyandrous or promiscuous pipefish, but factors biasing the OSR differed between these pipefish and C. haematopterus. We concluded that the similar PRR between the sexes in C. haematopterus does not confer reproductive benefit of polygamous mating on either sex, resulting in strict monogamous mating, and its female-biased adult sex ratio promotes female-female competition for a mate, resulting in sex-role reversal.
Reverse logistics - a framework
M.P. de Brito (Marisa); R. Dekker (Rommert)
2002-01-01
textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of
... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...
Peng, Zhang
2018-03-01
the prestress under anchorage is directly related to the structural security and performance of PC beam bridge. The reverse tension method is a kind of inspection which confirms the prestress by exerting reversed tension load on the exposed prestressing tendon of beam bridge anchoring system. The thesis elaborately expounds the inspection mechanism and mechanical effect of reverse tension method, theoretically analyzes the influential elements of inspection like tool anchorage deformation, compression of conjuncture, device glide, friction of anchorage loop mouth and elastic compression of concrete, and then presents the following formula to calculate prestress under anchorage. On the basis of model experiment, the thesis systematically studies some key issues during the reverse tension process of PC beam bridge anchorage system like the formation of stress-elongation curve, influential factors, judgment method of prestress under anchorage, variation trend and compensation scale, verifies the accuracy of mechanism analysis and demonstrates: the prestress under anchorage is less than or equal to 75% of the ultimate strength of prestressing tendon, the error of inspect result is less than 1%, which can meet with the demands of construction. The research result has provided theoretical basis and technical foundation for the promotion and application of reverse tension in bridge construction.
Health promotion and cardiovascular disease prevention in sub-Saharan Africa.
Sampson, Uchechukwu K A; Amuyunzu-Nyamongo, Mary; Mensah, George A
2013-01-01
Recent population studies demonstrate an increasing burden of cardiovascular disease (CVD) and related risk factors in sub-Saharan Africa (SSA). The mitigation or reversal of this trend calls for effective health promotion and preventive interventions. In this article, we review the core principles, challenges, and progress in promoting cardiovascular health with special emphasis on interventions to address physical inactivity, poor diet, tobacco use, and adverse cardiometabolic risk factor trends in SSA. We focus on the five essential strategies of the Ottawa Charter for Health Promotion. Successes highlighted include community-based interventions in Ghana, Nigeria, South Africa, and Mauritius and school-based programs in Kenya, Namibia, and Swaziland. We address the major challenge of developing integrated interventions, and showcase partnerships opportunities. We conclude by calling for intersectoral partnerships for effective and sustainable intervention strategies to advance cardiovascular health promotion and close the implementation gap in accordance with the 2009 Nairobi Call to Action on Health Promotion. © 2013.
Else, Laura J; Taylor, Stephen; Back, David J; Khoo, Saye H
2011-01-01
HIV resides within anatomical 'sanctuary sites', where local drug exposure and viral dynamics may differ significantly from the systemic compartment. Suboptimal antiretroviral concentrations in the genital tract may result in compartmentalized viral replication, selection of resistant mutations and possible re-entry of wild-type/resistant virus into the systemic circulation. Therefore, achieving adequate antiretroviral exposure in the genital tract has implications for the prevention of sexual and vertical transmission of HIV. Penetration of antiretrovirals in the genital tract is expressed by accumulation ratios derived from the measurement of drug concentrations in time-matched seminal plasma/cervicovaginal fluid and plasma samples. Penetration varies by gender and may be drug (as opposed to class) specific with high interindividual variability. Concentrations in seminal plasma are highest for nucleoside analogues and lowest for protease inhibitors and efavirenz. Seminal accumulation of newer agents, raltegravir and maraviroc, is moderate (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitors [lamivudine/zidovudine/tenofovir/didanosine > stavudine/abacavir] > raltegravir > indinavir/maraviroc/nevirapine > efavirenz/protease inhibitors [amprenavir/atazanavir/darunavir > lopinavir/ritonavir > saquinavir] > enfuvirtide). In the female genital tract, the nucleoside analogues exhibit high accumulation ratios, whereas protease inhibitors have limited penetration; however, substantial variability exists between individuals and study centres. Second generation non-nucleoside reverse transcriptase inhibitor etravirine, and maraviroc and raltegravir, demonstrate effective accumulation in cervicovaginal secretions (rank order of accumulation is nucleoside/nucleotide reverse transcriptase inhibitor [zidovudine/lamivudine/didanosine > emtricitabine/tenofovir] > indinavir > maraviroc/raltegravir/darunavir/etravirine > nevirapine
Energy Technology Data Exchange (ETDEWEB)
Walspurger, S.; Boels, L.; Cobden, P.D.; Elzinga, G.D.; Haije, W.G.; Van den Brink, R.W. [Energy Research Centre of the Netherlands ECN, Westerduinweg 3, 1755LE, Petten (Netherlands)
2008-09-15
CO2-free hydrogen can be produced from coal gasification power plants by pre-combustion decarbonisation and carbon dioxide capture. Potassium carbonate promoted hydrotalcite-based and alumina-based materials are cheap and excellent materials for high-temperature (300-500C) adsorption of CO2, and particularly promising in the sorption-enhanced water gas shift (SEWGS) reaction. Alkaline promotion significantly improves CO2 reversible sorption capacity at 300-500C for both materials. Hydrotalcites and promoted hydrotalcites, promoted magnesium oxide and promoted -alumina were investigated by in situ analytical methods (IR spectroscopy, sorption experiments, X-ray diffraction) to identify structural and surface rearrangements. All experimental results show that potassium ions actually strongly interact with aluminium oxide centres in the aluminium-containing materials. This study unambiguously shows that potassium promotion of aluminium oxide centres in hydrotalcite generates basic sites which reversibly adsorb CO2 at 400C.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Reverse gear. 230.89 Section 230.89 Transportation... Reversing Gear § 230.89 Reverse gear. (a) General provisions. Reverse gear, reverse levers, and quadrants... quadrant. Proper counterbalance shall be provided for the valve gear. (b) Air-operated power reverse gear...
Reversible Communicating Processes
Directory of Open Access Journals (Sweden)
Geoffrey Brown
2016-02-01
Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.
UniProt search blastx result: AK289070 [KOME
Lifescience Database Archive (English)
Full Text Available ol3) (Transposon Ty3-2 TYA-TYB polyprotein) [Contains: Capsid protein (CA) (p24); Spacer peptide p3; Nucleoc...apsid protein p11 (NC); Ty3 protease (EC 3.4.23.-) (PR) (p16); Spacer peptide J; Reverse transcriptase/ribon
UniProt search blastx result: AK288702 [KOME
Lifescience Database Archive (English)
Full Text Available ol3) (Transposon Ty3-1 TYA-TYB polyprotein) [Contains: Capsid protein (CA) (p24); Spacer peptide p3; Nucleoc...apsid protein p11 (NC); Ty3 protease (EC 3.4.23.-) (PR) (p16); Spacer peptide J; Reverse transcriptase/ribon
UniProt search blastx result: AK289070 [KOME
Lifescience Database Archive (English)
Full Text Available ol3) (Transposon Ty3-1 TYA-TYB polyprotein) [Contains: Capsid protein (CA) (p24); Spacer peptide p3; Nucleoc...apsid protein p11 (NC); Ty3 protease (EC 3.4.23.-) (PR) (p16); Spacer peptide J; Reverse transcriptase/ribon
de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A
2013-01-01
BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared
Lambert-Niclot, S.; George, E. C.; Pozniak, A.; White, E.; Schwimmer, C.; Jessen, H.; Johnson, M.; Dunn, D.; Perno, C. F.; Clotet, B.; Plettenberg, A.; Blaxhult, A.; Palmisano, L.; Wittkop, L.; Calvez, V.; Marcelin, A. G.; Raffi, F.; Dedes, Nikos; Chêne, Geneviève; Richert, Laura; Allavena, Clotilde; Raffi, François; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raff Aella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurélie; Wallet, Cédrick; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Schwimmer, Christine; Soussi, Malika; Taieb, Audrey; Termote, Monique; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jansson, Per O.; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisiano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, Andre; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Ragnaud, Jean Marie; Weiss, Laurence; Yazdan, Yazdanpanah; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Di Perri, Giovanni; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Carlo, Torti; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; van Eeden, Arne; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Garcia, Juan Gonzalez; Aldeguer, José López; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Miralles, Martin Pilar; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Calvez, Vincent; Boucher, Charles; Collins, Simon; Dunn, David; Lambert, Sidonie; Marcelin, Anne-Geneviève; Perno, Carlo Federico; White, Ellen; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Bucciardini, Raffaella; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria; Braggion, Marco; Focà, Emanuele
2016-01-01
To describe the pattern of drug resistance at virological failure in the NEAT001/ANRS143 trial (first-line treatment with ritonavir-boosted darunavir plus either tenofovir/emtricitabine or raltegravir). Genotypic testing was performed at baseline for reverse transcriptase (RT) and protease genes and
Raffi, François; Babiker, Abdel G.; Richert, Laura; Molina, Jean-Michel; George, Elizabeth C.; Antinori, Andrea; Arribas, Jose R.; Grarup, Jesper; Hudson, Fleur; Schwimmer, Christine; Saillard, Juliette; Wallet, Cédrick; Jansson, Per O.; Allavena, Clotilde; van Leeuwen, Remko; Delfraissy, Jean-François; Vella, Stefano; Chêne, Geneviève; Pozniak, Anton; Dedes, Nikos; Autran, Brigitte; Bucciardini, Raffaella; Horban, Andrzej; Arribas, José; Boffito, Marta; Pillay, Deenan; Franquet, Xavier; Schwarze, Siegfried; Fischer, Aurélie; Diallo, Alpha; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; Gatell, José; Sandström, Eric; Flepp, Markus; Ewings, Fiona; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Soussi, Malika; Taieb, Audrey; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, André; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Raffi, Francois; Ragnaud, Jean Marie; Weiss, Laurence; Yazdanpanah, Yazdan; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; Eeden, Van; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Gonzalez Garcia, Juan; López Aldeguer, José; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Pilar Miralles, Martin; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Boucher, Charles; Calvez, Vincent; Collins, Simon; Dunn, David; Fox, Zoe; Perno, Carlo Federico; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; Arribas, Jose; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria
2014-01-01
Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. Between August, 2010, and September, 2011, we
Efficacy and durability of nevirapine in antiretroviral drug naive patients
Lange, Joep M. A.
2003-01-01
Nevirapine is a non-nucleoside reverse transcriptase inhibitor (NNRTI) that was first reported in the scientific literature in 1990. Varying doses of nevirapine (NVP) and a number of regimens containing this NNRTI have been studied in antiretroviral (ARV) naive patients. Four key studies have
African Journals Online (AJOL)
2017-09-28
Sep 28, 2017 ... made by blending fresh J. gendarussa leaves in cold water. Then the ... The structure of the HIV-1 reverse transcriptase receptor is obtained from Protein Data Bank (http://www.pdb.org/pdb/home/home.do) with 3V4I code.
DEFF Research Database (Denmark)
Christoffersen, Mette; Woodward, Elizabeth; Bojesen, Anders Miki
2012-01-01
. Endometrial biopsies were obtained 3, 12, 24 and 72 hours (h) after bacterial inoculation and blood samples were obtained during the 7 day period post bacterial inoculation. Expression levels of cytokines and SAA were determined by quantitative real-time reverse transcriptase PCR (qRT-PCR)....