WorldWideScience

Sample records for response factor promotes

  1. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  2. Soluble factors from biofilm of Candida albicans and Staphylococcus aureus promote cell death and inflammatory response.

    de Carvalho Dias, Kassia; Barbugli, Paula Aboud; de Patto, Fernanda; Lordello, Virginia Barreto; de Aquino Penteado, Letícia; Medeiros, Alexandra Ivo; Vergani, Carlos Eduardo

    2017-06-30

    The objective of this study was to better understand the effects of soluble factors from biofilm of single- and mixed-species Candida albicans (C. albicans) and methicillin-sensitive Staphylococcus aureus (MSSA) cultures after 36 h in culture on keratinocytes (NOK-si and HaCaT) and macrophages (J774A.1). Soluble factors from biofilms of C. albicans and MSSA were collected and incubated with keratinocytes and macrophages, which were subsequently evaluated by cell viability assays (MTT). Lactate dehydrogenase (LDH) enzyme release was measured to assess cell membrane damage to keratinocytes. Cells were analysed by brightfield microscopy after 2 and 24 h of exposure to the soluble factors from biofilm. Cell death was detected by labelling apoptotic cells with annexin V and necrotic cells with propidium iodide (PI) and was visualized via fluorescence microscopy. Soluble factors from biofilm were incubated with J774A.1 cells for 24 h; the subsequent production of NO and the cytokines IL-6 and TNF-α was measured by ELISA. The cell viability assays showed that the soluble factors of single-species C. albicans cultures were as toxic as the soluble factors from biofilm of mixed cultures, whereas the soluble factors of MSSA cultures were less toxic than those of C. albicans or mixed cultures. The soluble factors from biofilm of mixed cultures were the most toxic to the NOK-si and HaCaT cells, as confirmed by analyses of PI labelling and cell morphology. Soluble factors from biofilm of single-species MSSA and mixed-species cultures induced the production of IL-6, NO and TNF-α by J744A.1 macrophages. The production of IL-6 and NO induced by the soluble factors from biofilm of mixed cultures was lower than that induced by the soluble factors from biofilm of single-species MSSA cultures, whereas the soluble factors from biofilm of C. albicans cultures induced only low levels of NO. Soluble factors from 36-h-old biofilm of C. albicans and MSSA cultures promoted cell death and

  3. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  4. Factors Promoting Environmental Responsibility in European SMEs: The Effect on Performance

    Francisco J. Sáez-Martínez

    2016-09-01

    Full Text Available There is increasing social and political awareness of the importance of developing environmental responsibility at a corporate level. When focusing on issues of responsibility, large companies are frequently perceived to be more responsible for driving climate change and resource depletion. However, small and medium enterprises (SMEs contribute significantly to the use of resources such as material and energy and produce approximately 64% of the pollution in Europe. Drawing on evidence from “The Eurobarometer 381 Survey on SMEs, Resource Efficiency and Green Markets”, we analyze the environmental responsibility of European SMEs, studying their compliance with environmental legislation and how several factors drive environmental orientation among SMEs. Our sample consists of 3647 SMEs operating in 38 countries. Only around a fifth of the firms go beyond environmental regulations, showing the highest levels of environmental responsibility. We conduct OLS regressions to analyze the factors that affect a positive environmental attitude among European SMEs (internal drivers being more significant than external ones and then, to observe the positive effect of environmental responsibility and firm’s experience in offering green services/products on performance, although a conjoint effect was not found. Implications for practitioners, academics, and policy-makers are outlined.

  5. Hypoxia Inducible FactorPromotes Endogenous Adaptive Response in Rat Model of Chronic Cerebral Hypoperfusion

    Ying Yang

    2017-01-01

    Full Text Available Hypoxia inducible factor 1α (HIF-1α, a pivotal regulator of gene expression in response to hypoxia and ischemia, is now considered to regulate both pro-survival and pro-death responses depending on the duration and severity of the stress. We previously showed that chronic global cerebral hypoperfusion (CCH triggered long-lasting accumulation of HIF-1α protein in the hippocampus of rats. However, the role of the stabilized HIF-1α in CCH is obscure. Here, we knock down endogenous HIF-1α to determine whether and how HIF-1α affects the disease processes and phenotypes of CCH. Lentivirus expressing HIF-1α small hairpin RNA was injected into the bilateral hippocampus and bilateral ventricles to knock down HIF-1α gene expression in the hippocampus and other brain areas. Permanent bilateral common carotid artery occlusions, known as 2-vessel occlusions (2VOs, were used to induce CCH in rats. Angiogenesis, oxidative stress, histopathological changes of the brain, and cognitive function were tested. Knockdown of HIF-1α prior to 2VO significantly exacerbates the impairment of learning and memory after four weeks of CCH. Mechanically, reduced cerebral angiogenesis, increased oxidative damage, and increased density of astrocytes and microglia in the cortex and some subregions of hippocampus are also shown after four weeks of CCH. Furthermore, HIF-1α knockdown also disrupts upregulation of regulated downstream genes. Our findings suggest that HIF-1α-protects the brain from oxidative stress and inflammation response in the disease process of CCH. Accumulated HIF-1α during CCH mediates endogenous adaptive processes to defend against more severe hypoperfusion injury of the brain, which may provide a therapeutic benefit.

  6. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  7. The cytokinin response factors modulate root and shoot growth and promote leaf senescence in Arabidopsis

    Raines, T.; Shanks, C.; Cheng, C.Y.; McPherson, D.; Argueso, C.T.; Kim, H.J.; Franco-Zorrilla, J.M.; Lopez-Vidriero, I.; Solano, R.; Vaňková, Radomíra; Schaller, G.E.; Kieber, J.J.

    2016-01-01

    Roč. 85, č. 1 (2016), s. 134-147 ISSN 0960-7412 Institutional support: RVO:61389030 Keywords : cytokinin * two-component signaling * transcription factors Subject RIV: EF - Botanics Impact factor: 5.901, year: 2016

  8. Activating transcription factor 3 promotes loss of the acinar cell phenotype in response to cerulein-induced pancreatitis in mice.

    Fazio, Elena N; Young, Claire C; Toma, Jelena; Levy, Michael; Berger, Kurt R; Johnson, Charis L; Mehmood, Rashid; Swan, Patrick; Chu, Alphonse; Cregan, Sean P; Dilworth, F Jeffrey; Howlett, Christopher J; Pin, Christopher L

    2017-09-01

    Pancreatitis is a debilitating disease of the exocrine pancreas that, under chronic conditions, is a major susceptibility factor for pancreatic ductal adenocarcinoma (PDAC). Although down-regulation of genes that promote the mature acinar cell fate is required to reduce injury associated with pancreatitis, the factors that promote this repression are unknown. Activating transcription factor 3 (ATF3) is a key mediator of the unfolded protein response, a pathway rapidly activated during pancreatic insult. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that ATF3 is bound to the transcriptional regulatory regions of >30% of differentially expressed genes during the initiation of pancreatitis. Of importance, ATF3-dependent regulation of these genes was observed only upon induction of pancreatitis, with pathways involved in inflammation, acinar cell differentiation, and cell junctions being specifically targeted. Characterizing expression of transcription factors that affect acinar cell differentiation suggested that acinar cells lacking ATF3 maintain a mature cell phenotype during pancreatitis, a finding supported by maintenance of junctional proteins and polarity markers. As a result, Atf3 -/- pancreatic tissue displayed increased tissue damage and inflammatory cell infiltration at early time points during injury but, at later time points, showed reduced acinar-to-duct cell metaplasia. Thus our results reveal a critical role for ATF3 as a key regulator of the acinar cell transcriptional response during injury and may provide a link between chronic pancreatitis and PDAC. © 2017 Fazio et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  9. The hypoxia-inducible factor-responsive proteins semaphorin 4D and vascular endothelial growth factor promote tumor growth and angiogenesis in oral squamous cell carcinoma

    Zhou, Hua; Yang, Ying-Hua [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Binmadi, Nada O. [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Department of Oral Basic and Clinical Sciences, King Abdulaziz University, Jeddah 21589 (Saudi Arabia); Proia, Patrizia [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Department of Sports Science (DISMOT), University of Palermo, Via Eleonora Duse 2 90146, Palermo (Italy); Basile, John R., E-mail: jbasile@umaryland.edu [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Greenebaum Cancer Center, 22S. Greene Street, Baltimore, MD 21201 (United States)

    2012-08-15

    Growth and metastasis of solid tumors requires induction of angiogenesis to ensure the delivery of oxygen, nutrients and growth factors to rapidly dividing transformed cells. Through either mutations, hypoxia generated by cytoreductive therapies, or when a malignancy outgrows its blood supply, tumor cells undergo a change from an avascular to a neovascular phenotype, a transition mediated by the hypoxia-inducible factor (HIF) family of transcriptional regulators. Vascular endothelial growth factor (VEGF) is one example of a gene whose transcription is stimulated by HIF. VEGF plays a crucial role in promoting tumor growth and survival by stimulating new blood vessel growth in response to such stresses as chemotherapy or radiotherapy-induced hypoxia, and it therefore has become a tempting target for neutralizing antibodies in the treatment of advanced neoplasms. Emerging evidence has shown that the semaphorins, proteins originally associated with control of axonal growth and immunity, are regulated by changes in oxygen tension as well and may play a role in tumor-induced angiogenesis. Through the use of RNA interference, in vitro and in vivo angiogenesis assays and tumor xenograft experiments, we demonstrate that expression of semaphorin 4D (SEMA4D), which is under the control of the HIF-family of transcription factors, cooperates with VEGF to promote tumor growth and vascularity in oral squamous cell carcinoma (OSCC). We use blocking antibodies to show that targeting SEMA4D function along with VEGF could represent a novel anti-angiogenic therapeutic strategy for the treatment of OSCC and other solid tumors. -- Highlights: Black-Right-Pointing-Pointer Similar to VEGF, SEMA4D promotes angiogenesis in vitro and in vivo. Black-Right-Pointing-Pointer Both VEGF and SEMA4D are produced by OSCC cells in a HIF-dependent manner. Black-Right-Pointing-Pointer These factors combine to elicit a robust pro-angiogenic phenotype in OSCC. Black-Right-Pointing-Pointer Anti-SEMA4D

  10. The hypoxia-inducible factor-responsive proteins semaphorin 4D and vascular endothelial growth factor promote tumor growth and angiogenesis in oral squamous cell carcinoma

    Zhou, Hua; Yang, Ying-Hua; Binmadi, Nada O.; Proia, Patrizia; Basile, John R.

    2012-01-01

    Growth and metastasis of solid tumors requires induction of angiogenesis to ensure the delivery of oxygen, nutrients and growth factors to rapidly dividing transformed cells. Through either mutations, hypoxia generated by cytoreductive therapies, or when a malignancy outgrows its blood supply, tumor cells undergo a change from an avascular to a neovascular phenotype, a transition mediated by the hypoxia-inducible factor (HIF) family of transcriptional regulators. Vascular endothelial growth factor (VEGF) is one example of a gene whose transcription is stimulated by HIF. VEGF plays a crucial role in promoting tumor growth and survival by stimulating new blood vessel growth in response to such stresses as chemotherapy or radiotherapy-induced hypoxia, and it therefore has become a tempting target for neutralizing antibodies in the treatment of advanced neoplasms. Emerging evidence has shown that the semaphorins, proteins originally associated with control of axonal growth and immunity, are regulated by changes in oxygen tension as well and may play a role in tumor-induced angiogenesis. Through the use of RNA interference, in vitro and in vivo angiogenesis assays and tumor xenograft experiments, we demonstrate that expression of semaphorin 4D (SEMA4D), which is under the control of the HIF-family of transcription factors, cooperates with VEGF to promote tumor growth and vascularity in oral squamous cell carcinoma (OSCC). We use blocking antibodies to show that targeting SEMA4D function along with VEGF could represent a novel anti-angiogenic therapeutic strategy for the treatment of OSCC and other solid tumors. -- Highlights: ► Similar to VEGF, SEMA4D promotes angiogenesis in vitro and in vivo. ► Both VEGF and SEMA4D are produced by OSCC cells in a HIF-dependent manner. ► These factors combine to elicit a robust pro-angiogenic phenotype in OSCC. ► Anti-SEMA4D blocking antibody inhibits Plexin-B1 activation. ► SEMA4D is a valid anti-angiogenic target in the

  11. Structural characterization of a novel full-length transcript promoter from Horseradish Latent Virus (HRLV) and its transcriptional regulation by multiple stress responsive transcription factors.

    Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha

    2018-01-01

    The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.

  12. The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples.

    Xie, Xing-Bin; Li, Shen; Zhang, Rui-Fen; Zhao, Jing; Chen, Ying-Chun; Zhao, Qiang; Yao, Yu-Xin; You, Chun-Xiang; Zhang, Xian-Sheng; Hao, Yu-Jin

    2012-11-01

    Low environmental temperatures promote anthocyanin accumulation and fruit colouration by up-regulating the expression of genes involved in anthocyanin biosynthesis and regulation in many fruit trees. However, the molecular mechanism by which fruit trees regulate this process in response to low temperature (LT) remains largely unknown. In this study, the cold-induced bHLH transcription factor gene MdbHLH3 was isolated from an apple tree and was found to interact physically and specifically through two regions (amino acids 1-23 and 186-228) at the N terminus with the MYB partner MdMYB1 (allelic to MdMYB10). Subsequently, MdbHLH3 bound to the promoters of the anthocyanin biosynthesis genes MdDFR and MdUFGT and the regulatory gene MdMYB1 to activate their expression. Furthermore, the MdbHLH3 protein was post-translationally modified, possibly involving phosphorylation following exposure to LTs, which enhanced its promoter-binding capacity and transcription activity. Our results demonstrate the molecular mechanism by which MdbHLH3 regulates LT-induced anthocyanin accumulation and fruit colouration in apple. © 2012 Blackwell Publishing Ltd.

  13. Matrix metalloproteinase 3 promotes cellular anti-dengue virus response via interaction with transcription factor NFκB in cell nucleus.

    Zuo, Xiangyang; Pan, Wen; Feng, Tingting; Shi, Xiaohong; Dai, Jianfeng

    2014-01-01

    Dengue virus (DENV), the causative agent of human Dengue hemorrhagic fever, is a mosquito-borne virus of immense global health importance. Characterization of cellular factors promoting or inhibiting DENV infection is important for understanding the mechanism of DENV infection. In this report, MMP3 (stromelysin-1), a secretory endopeptidase that degrades extracellular matrices, has been shown promoting cellular antiviral response against DENV infection. Quantitative RT-PCR and Western Blot showed that the expression of MMP3 was upregulated in DENV-infected RAW264.7 cells. The intracellular viral loads were significantly higher in MMP3 silenced cells compared with controls. The expression level of selective anti-viral cytokines were decreased in MMP3 siRNA treated cells, and the transcription factor activity of NFκB was significantly impaired upon MMP3 silencing during DENV infection. Further, we found that MMP3 moved to cell nucleus upon DENV infection and colocalized with NFκB P65 in nucleus. Co-immunoprecipitation analysis suggested that MMP3 directly interacted with NFκB in nucleus during DENV infection and the C-terminal hemopexin-like domain of MMP3 was required for the interaction. This study suggested a novel role of MMP3 in nucleus during viral infection and provided new evidence for MMPs in immunomodulation.

  14. TNF-α promotes nuclear enrichment of the transcription factor TonEBP/NFAT5 to selectively control inflammatory but not osmoregulatory responses in nucleus pulposus cells.

    Johnson, Zariel I; Doolittle, Alexandra C; Snuggs, Joseph W; Shapiro, Irving M; Le Maitre, Christine L; Risbud, Makarand V

    2017-10-20

    Intervertebral disc degeneration (IDD) causes chronic back pain and is linked to production of proinflammatory molecules by nucleus pulposus (NP) and other disc cells. Activation of tonicity-responsive enhancer-binding protein (TonEBP)/NFAT5 by non-osmotic stimuli, including proinflammatory molecules, occurs in cells involved in immune response. However, whether inflammatory stimuli activate TonEBP in NP cells and whether TonEBP controls inflammation during IDD is unknown. We show that TNF-α, but not IL-1β or LPS, promoted nuclear enrichment of TonEBP protein. However, TNF-α-mediated activation of TonEBP did not cause induction of osmoregulatory genes. RNA sequencing showed that 8.5% of TNF-α transcriptional responses were TonEBP-dependent and identified genes regulated by both TNF-α and TonEBP. These genes were over-enriched in pathways and diseases related to inflammatory response and inhibition of matrix metalloproteases. Based on RNA-sequencing results, we further investigated regulation of novel TonEBP targets CXCL1 , CXCL2 , and CXCL3 TonEBP acted synergistically with TNF-α and LPS to induce CXCL1 -proximal promoter activity. Interestingly, this regulation required a highly conserved NF-κB-binding site but not a predicted TonE, suggesting cross-talk between these two members of the Rel family. Finally, analysis of human NP tissue showed that TonEBP expression correlated with canonical osmoregulatory targets TauT/SLC6A6 , SMIT/SLC5A3 , and AR/AKR1B1 , supporting in vitro findings that the inflammatory milieu during IDD does not interfere with TonEBP osmoregulation. In summary, whereas TonEBP participates in the proinflammatory response to TNF-α, therapeutic strategies targeting this transcription factor for treatment of disc disease must spare osmoprotective, prosurvival, and matrix homeostatic activities. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Evidence for widespread changes in promoter methylation profile in human placenta in response to increasing gestational age and environmental/stochastic factors

    Craig Jeffrey M

    2011-10-01

    Full Text Available Abstract Background The human placenta facilitates the exchange of nutrients, gas and waste between the fetal and maternal circulations. It also protects the fetus from the maternal immune response. Due to its role at the feto-maternal interface, the placenta is subject to many environmental exposures that can potentially alter its epigenetic profile. Previous studies have reported gene expression differences in placenta over gestation, as well as inter-individual variation in expression of some genes. However, the factors contributing to this variation in gene expression remain poorly understood. Results In this study, we performed a genome-wide DNA methylation analysis of gene promoters in placenta tissue from three pregnancy trimesters. We identified large-scale differences in DNA methylation levels between first, second and third trimesters, with an overall progressive increase in average methylation from first to third trimester. The most differentially methylated genes included many immune regulators, reflecting the change in placental immuno-modulation as pregnancy progresses. We also detected increased inter-individual variation in the third trimester relative to first and second, supporting an accumulation of environmentally induced (or stochastic changes in DNA methylation pattern. These highly variable genes were enriched for those involved in amino acid and other metabolic pathways, potentially reflecting the adaptation of the human placenta to different environments. Conclusions The identification of cellular pathways subject to drift in response to environmental influences provide a basis for future studies examining the role of specific environmental factors on DNA methylation pattern and placenta-associated adverse pregnancy outcomes.

  16. Sigma factors and promoters in Corynebacterium glutamicum

    Pátek, Miroslav; Nešvera, Jan

    2011-01-01

    Roč. 154, 2-3 (2011), s. 101-113 ISSN 0168-1656 R&D Projects: GA ČR GC204/09/J015 Institutional research plan: CEZ:AV0Z50200510 Keywords : Corynebacterium glutamicum * Sigma factors * Promoters Subject RIV: EE - Microbiology, Virology Impact factor: 3.045, year: 2011

  17. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  18. The Policy to Promote Social Responsibility

    Rosdahl, Anders

    thinking, a vision for the Danish welfare society. An inclusive labour market is one with “a place for everyone”, i.e. also for persons with a reduced working capacity, disabled, ethnic minorities and long-term unemployed – that is persons who have traditionally had difficulties in obtaining or remaining...... viewpoints in the current Danish debate (section 4). Section 5 includes some concluding remarks. Encouraging social responsibility of enterprises is one of the means to promote what in Denmark today is termed an inclusive labour market. The inclusive labour market is, according to current governmental...... in employment. An inclusive labour market is adapted to the needs and capabilities of diverse human beings, also employees, who should be able to reconcile work and family life. The policy to increase the social responsibility of enterprises and to promote an inclusive labour market includes several specific...

  19. Self protection from anti-viral responses--Ro52 promotes degradation of the transcription factor IRF7 downstream of the viral Toll-Like receptors.

    Higgs, Rowan

    2010-01-01

    Ro52 is a member of the TRIM family of single-protein E3 ligases and is also a target for autoantibody production in systemic lupus erythematosus and Sjögren\\'s syndrome. We previously demonstrated a novel function of Ro52 in the ubiquitination and proteasomal degradation of IRF3 following TLR3\\/4 stimulation. We now present evidence that Ro52 has a similar role in regulating the stability and activity of IRF7. Endogenous immunoprecipitation of Ro52-bound proteins revealed that IRF7 associates with Ro52, an effect which increases following TLR7 and TLR9 stimulation, suggesting that Ro52 interacts with IRF7 post-pathogen recognition. Furthermore, we show that Ro52 ubiquitinates IRF7 in a dose-dependent manner, resulting in a decrease in total IRF7 expression and a subsequent decrease in IFN-alpha production. IRF7 stability was increased in bone marrow-derived macrophages from Ro52-deficient mice stimulated with imiquimod or CpG-B, consistent with a role for Ro52 in the negative regulation of IRF7 signalling. Taken together, these results suggest that Ro52-mediated ubiquitination promotes the degradation of IRF7 following TLR7 and TLR9 stimulation. As Ro52 is known to be IFN-inducible, this system constitutes a negative-feedback loop that acts to protect the host from the prolonged activation of the immune response.

  20. Promotion of responsible drinking in hotels.

    McLean, S; Wood, L J; Montgomery, I M; Davidson, J; Jones, M E

    1994-01-01

    This study reports on an intervention programme to promote responsible drinking in hotels. The licensees of eight hotels agreed to participate in a trial of measures designed to assist patrons to avoid drink-driving, and seven other hotels were used as controls. The interventions acceptable to licensees comprised commercial-quality promotional material with the theme "0.05 Know Your Limits", and a breath analysis machine and poster on its use. Patrons leaving the hotels on Thursday, Friday and Saturday nights were interviewed and breath-tested. Although the intervention material had been seen by one-third of patrons in the intervention hotels, there was no significant difference between them and control hotel patrons in either median BAC or the proportion who were going to drive with BAC over the legal limit. There was poor compliance by hotels with the intervention procedures, indicating that a major impediment to the implementation and evaluation of programmes to promote responsible drinking is a lack of motivation by many licensees, despite support by some licensees and the Australian Hotels Association.

  1. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  2. Embryogenesis-promoting factors in rat serum.

    Katoh, M; Kimura, R; Shoji, R

    1998-06-15

    Regarding whole rat embryo cultures in vitro, rat serum as a culture medium is known to support the normal growth of rat embryos in the organogenesis phase. The purpose of the present study was to isolate the embryogenesis-promoting factors from rat serum as a first step in the development of a defined serum-free medium for a whole embryo culture system. Pooled rat serum after heat inactivation was fractionated into three major peaks (frA, containing a region of void volume, frB, and frC) by gel filtration. The 9.5-day rat embryos that were cultivated for 48 hr in essential salt medium containing frB (with a molecular size range of 100-500 kDa) revealed normal growth. Three proteins (27 kDa, 76 kDa, and 190 kDa) that had the embryogenesis-promoting effects were isolated from 3-hr delayed centrifuged rat serum by the ion exchange chromatography. The 76-kDa protein was found to be rat transferrin by immunoblotting. The 27-kDa protein was identified as apo-AI (the major apoprotein of high-density lipoprotein) by immunoblotting. High-density lipoprotein obtained from pooled rat serum by a NaBr density gradient ultracentrifugation was found to have a positive effect on embryogenesis. The 10-kDa protein was also identified as alpha 1-inhibitor 3 by immunoblotting. In addition, the embryogenesis-promoting effect of the fraction containing 27-kDa and 190-kDa proteins declined within a short period of storage at -20 degrees C. This decrease was countered by supplementing its fraction (D-2) with albumin isolated from rat serum. These results in the present study suggest that transferrin, high-density lipoprotein, and alpha 1-inhibitor 3 in rat serum may be embryogenesis-promoting factors, and that albumin appeared to play a role in the embryogenesis of rat embryos in whole embryo cultures.

  3. Astrocytes promote myelination in response to electrical impulses.

    Ishibashi, Tomoko; Dakin, Kelly A; Stevens, Beth; Lee, Philip R; Kozlov, Serguei V; Stewart, Colin L; Fields, R Douglas

    2006-03-16

    Myelin, the insulating layers of membrane wrapped around axons by oligodendrocytes, is essential for normal impulse conduction. It forms during late stages of fetal development but continues into early adult life. Myelination correlates with cognitive development and can be regulated by impulse activity through unknown molecular mechanisms. Astrocytes do not form myelin, but these nonneuronal cells can promote myelination in ways that are not understood. Here, we identify a link between myelination, astrocytes, and electrical impulse activity in axons that is mediated by the cytokine leukemia inhibitory factor (LIF). These findings show that LIF is released by astrocytes in response to ATP liberated from axons firing action potentials, and LIF promotes myelination by mature oligodendrocytes. This activity-dependent mechanism promoting myelination could regulate myelination according to functional activity or environmental experience and may offer new approaches to treating demyelinating diseases.

  4. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  6. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  7. Effects of growth-promoting factors on proliferation of mouse ...

    AJL

    2012-02-16

    Feb 16, 2012 ... Key words: Growth-promoting factors, mouse spermatogonial stem cells (SSCs), proliferation. INTRODUCTION ... insulin-like growth factor-1 (IGF-1) can stimulate mitotic ...... A Model for Analysis of Spermatogenesis. Zool. Sci.

  8. Factors promoting tourism services and their development

    Simona Cristina Martin

    2013-10-01

    Because the fact that tourism services are intangible, sales through self-service are impossible, which makes indispensable the presence of the seller or counselor at the point of sale. Unable to clearly differentiate against competitors, tourist trips wholesalers will practice a more limited range of methods of sales promotion.

  9. Performance as a Factor in Enlisted Promotions

    1981-04-01

    the Airman Performance Report. When one reviews the previous research into the matter of enlisted promotions, one senses a feeling of corporate " deja ... vu ." An Air War College research report noted in 1952 that the 7 _... .. . .. _. ._. . . . . I I ’ . Air Force NCO corps had been "destroyed" during

  10. Promoting responsible research conduct in a developing world ...

    As reports of research misconduct seem to increase, research integrity and the promotion of responsible research conduct are important for academic institutions. This paper considers what research integrity means for individual researchers and institutions, and explores trends for promoting responsible research conduct.

  11. G-protein coupled receptor 56 promotes myoblast fusion through serum response factor- and nuclear factor of activated T-cell-mediated signalling but is not essential for muscle development in vivo.

    Wu, Melissa P; Doyle, Jamie R; Barry, Brenda; Beauvais, Ariane; Rozkalne, Anete; Piao, Xianhua; Lawlor, Michael W; Kopin, Alan S; Walsh, Christopher A; Gussoni, Emanuela

    2013-12-01

    Mammalian muscle cell differentiation is a complex process of multiple steps for which many of the factors involved have not yet been defined. In a screen to identify the regulators of myogenic cell fusion, we found that the gene for G-protein coupled receptor 56 (GPR56) was transiently up-regulated during the early fusion of human myoblasts. Human mutations in the gene for GPR56 cause the disease bilateral frontoparietal polymicrogyria; however, the consequences of receptor dysfunction on muscle development have not been explored. Using knockout mice, we defined the role of GPR56 in skeletal muscle. GPR56(-/-) myoblasts have decreased fusion and smaller myotube sizes in culture. In addition, a loss of GPR56 expression in muscle cells results in decreases or delays in the expression of myogenic differentiation 1, myogenin and nuclear factor of activated T-cell (NFAT)c2. Our data suggest that these abnormalities result from decreased GPR56-mediated serum response element and NFAT signalling. Despite these changes, no overt differences in phenotype were identified in the muscle of GPR56 knockout mice, which presented only a mild but statistically significant elevation of serum creatine kinase compared to wild-type. In agreement with these findings, clinical data from 13 bilateral frontoparietal polymicrogyria patients revealed mild serum creatine kinase increase in only two patients. In summary, targeted disruption of GPR56 in mice results in myoblast abnormalities. The absence of a severe muscle phenotype in GPR56 knockout mice and human patients suggests that other factors may compensate for the lack of this G-protein coupled receptor during muscle development and that the motor delay observed in these patients is likely not a result of primary muscle abnormalities. © 2013 FEBS.

  12. Promotion Factors For Enlisted Infantry Marines

    2017-06-01

    Marine Corps. However, due to periods of growth during two major conflicts , quality has given way to quantity to fulfill the needs of the Marine...Corps. As conflicts draw down, the Marine Corps shifts from promoting and retaining quantity to high-quality Marines. Throughout this thesis, we use...historically possessed an innate drive to succeed, to excel in all that they do, including winning in combat. We will sustain this trait and ensure this

  13. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  14. The Relevant Factors in Promoting Reading Activities in Elementary Schools

    Huang, Han-Chen; Tsai, Yao-Hsu; Huang, Shih-Hsiang

    2015-01-01

    In order to help students absorb knowledge, schools often conduct reading activities. Thorough planning and strategies, however, are needed to insure the effect of reading promotions, and make them a deeply-rooted part of life. This study adopted the analytic hierarchy process (AHP) to discuss the relevant factors in promoting reading activities…

  15. Effects of growth-promoting factors on proliferation of mouse ...

    SSCs) in vitro are critical to our understanding of male infertility, genetic resources and endangered species conservation. To investigate the effects of growth-promoting factors, epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1) and ...

  16. Epidemiological factors that promote the development of severe ...

    ... that promote the development of severe malaria anaemia in children in Ibadan. ... and epidemiological factors that affect the development of malaria anaemia. ... of parents or guardians to fever in the children;parents\\' preoccupation with ...

  17. Promoting Culturally Responsive Standards-Based Teaching

    Saifer, Steffen; Barton, Rhonda

    2007-01-01

    Culturally responsive standards-based (CRSB) teaching can help bring diverse school communities together and make learning meaningful. Unlike multicultural education--which is an important way to incorporate the world's cultural and ethnic diversity into lessons--CRSB teaching draws on the experiences, understanding, views, concepts, and ways of…

  18. TALE factors poise promoters for activation by Hox proteins.

    Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G

    2014-01-27

    Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. A multi-scale model of hepcidin promoter regulation reveals factors controlling systemic iron homeostasis.

    Guillem Casanovas

    2014-01-01

    Full Text Available Systemic iron homeostasis involves a negative feedback circuit in which the expression level of the peptide hormone hepcidin depends on and controls the iron blood levels. Hepcidin expression is regulated by the BMP6/SMAD and IL6/STAT signaling cascades. Deregulation of either pathway causes iron-related diseases such as hemochromatosis or anemia of inflammation. We quantitatively analyzed how BMP6 and IL6 control hepcidin expression. Transcription factor (TF phosphorylation and reporter gene expression were measured under co-stimulation conditions, and the promoter was perturbed by mutagenesis. Using mathematical modeling, we systematically analyzed potential mechanisms of cooperative and competitive promoter regulation by the transcription factors, and experimentally validated the model predictions. Our results reveal that hepcidin cross-regulation primarily occurs by combinatorial transcription factor binding to the promoter, whereas signaling crosstalk is insignificant. We find that the presence of two BMP-responsive elements enhances the steepness of the promoter response towards the iron-sensing BMP signaling axis, which promotes iron homeostasis in vivo. IL6 co-stimulation reduces the promoter sensitivity towards the BMP signal, because the SMAD and STAT transcription factors compete for recruiting RNA polymerase to the transcription start site. This may explain why inflammatory signals disturb iron homeostasis in anemia of inflammation. Taken together, our results reveal why the iron homeostasis circuit is sensitive to perturbations implicated in disease.

  20. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  1. Corporate responsibility for childhood physical activity promotion in the UK.

    Leone, Liliana; Ling, Tom; Baldassarre, Laura; Barnett, Lisa M; Capranica, Laura; Pesce, Caterina

    2016-12-01

    The alarming epidemic of obesity and physical inactivity at paediatric age urges societies to rise to the challenge of ensuring an active lifestyle. As one response to this, business enterprises are increasingly engaged in promoting sport and physical activity (PA) initiatives within the frame of corporate social responsibility (CSR). However, comparative analyses among industry sectors of CSR strategies for PA promotion with a particular focus on children are still lacking. This study aimed to explore (i) what are the CSR strategies for PA promotion adopted in different industry sectors and (ii) whether corporate engagement in promoting PA for children is supportive of children's rights to play and be physically active. Corporate pledges pertaining to CSR initiatives to promote PA were analysed. The hypothesis was that companies from different sectors employ different CSR strategies and that companies with a higher profile as regard to public health concerns for children tend to legitimate their action by adopting a compensatory strategy. Results show that the issue of PA promotion is largely represented within CSR commitments. CSR strategies for PA promotion vary across industry sectors and the adoption of a compensatory strategy for rising childhood obesity allows only a limited exploitation of the potential of CSR commitments for the provision of children's rights to play and be physically active. Actors within the fields of public health ethics, human rights and CSR should be considered complementary to develop mainstreaming strategies and improve monitoring systems of PA promotion in children. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Communication Breakdown: How Conflict Can Promote Responsible Leadership in Students

    Higham, Rupert

    2016-01-01

    This study of an outdoor-based leadership course for teenagers shows how open-ended, difficult group tasks can enable participants to develop "dispositions for learning," which promote "responsible leadership." The latter is defined as responding ethically and uniquely to encounters with difference. Uses of educational…

  3. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  4. Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

    Kleftogiannis, Dimitrios A.; Kalnis, Panos; Arner, Erik; Bajic, Vladimir B.

    2016-01-01

    factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers

  5. Analysis of Influencing Factors Related to Health Promotion Behavior in Hospital Radiological Technologists

    Ko, Jong Kyung; Kwon, Duk Mun; Kang, Yeong Han

    2009-01-01

    The purpose of this study was to analyze factors that could affect health of radiological technologists, which is useful for health care and development of programs for health promotion. Subjects were 234 of radiological technologists who work in general hospitals. Some questionnaires were made about perceptions of health condition and promotional behavior of health for this study. The questionnaires of health perception were 20 items that consist of the present condition of health, health concern and sensitivity. The reliability was sufficient(Cronbach's α=0.79). The other questionnaires about health promotion behavior were 47 items that consist of self-realization, health responsibility, exercise, nutrition, personal relationships, and stress management. The results turned out to be was sufficient (Cronbach's α=0.93). Every data was treated statistically, comparison of average(t-test, ANOVA), correlation, and multiple regression. Related factors to health promotion behavior were age, marriage, salary, class of one's position, career, employment, and religion, in general features. In health life habit, related factors were smoke and exercise. Results of health promotion behavior was 2.90 of mean score, 0.37 of standard deviation. Correlations between factors of health perception and health promotion behavior was positive(p<0.01). Health promotion behavior were affected by sensitivity, presents condition of health, exercise, smoke, career. Sensitivity was the most affectable variable, which means that promotional behavior score became higher and higher as the score of sensitivity and present condition were increased. In addition, persons who exercise regularly, had been smoked, and has higher career showed higher score of promotional behavior. Radiological technologists have to keep their health, trying not to infected by a disease. Most of all, no smoking and regular exercise are the most important thing to all of members.

  6. Analysis of Influencing Factors Related to Health Promotion Behavior in Hospital Radiological Technologists

    Ko, Jong Kyung [Kim, In Hwan Internal Medicine Health Promotion Cnter, Youngcheon (Korea, Republic of); Kwon, Duk Mun [Dept. of Radiology Technology, Daegu Health College, Daegu (Korea, Republic of); Kang, Yeong Han [Dept. of Diagnostic Radiology, Daegu Catholic Univesity Hospital, Daegu (Korea, Republic of)

    2009-12-15

    The purpose of this study was to analyze factors that could affect health of radiological technologists, which is useful for health care and development of programs for health promotion. Subjects were 234 of radiological technologists who work in general hospitals. Some questionnaires were made about perceptions of health condition and promotional behavior of health for this study. The questionnaires of health perception were 20 items that consist of the present condition of health, health concern and sensitivity. The reliability was sufficient(Cronbach's {alpha}=0.79). The other questionnaires about health promotion behavior were 47 items that consist of self-realization, health responsibility, exercise, nutrition, personal relationships, and stress management. The results turned out to be was sufficient (Cronbach's {alpha}=0.93). Every data was treated statistically, comparison of average(t-test, ANOVA), correlation, and multiple regression. Related factors to health promotion behavior were age, marriage, salary, class of one's position, career, employment, and religion, in general features. In health life habit, related factors were smoke and exercise. Results of health promotion behavior was 2.90 of mean score, 0.37 of standard deviation. Correlations between factors of health perception and health promotion behavior was positive(p<0.01). Health promotion behavior were affected by sensitivity, presents condition of health, exercise, smoke, career. Sensitivity was the most affectable variable, which means that promotional behavior score became higher and higher as the score of sensitivity and present condition were increased. In addition, persons who exercise regularly, had been smoked, and has higher career showed higher score of promotional behavior. Radiological technologists have to keep their health, trying not to infected by a disease. Most of all, no smoking and regular exercise are the most important thing to all of members.

  7. Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

    Kleftogiannis, Dimitrios A.

    2016-10-17

    Promoters and enhancers regulate the initiation of gene expression and maintenance of expression levels in spatial and temporal manner. Recent findings stemming from the Cap Analysis of Gene Expression (CAGE) demonstrate that promoters and enhancers, based on their expression profiles after stimulus, belong to different transcription response subclasses. One of the most promising biological features that might explain the difference in transcriptional response between subclasses is the local chromatin environment. We introduce a novel computational framework, PEDAL, for distinguishing effectively transcriptional profiles of promoters and enhancers using solely histone modification marks, chromatin accessibility and binding sites of transcription factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers that discriminate with minimized classification error MCF-7 promoter and enhancer transcription response subclasses. Our work provides a general computational approach for identifying effectively cell-specific and stimulation-specific promoter and enhancer transcriptional profiles, and thus, contributes to improve our understanding of transcriptional activation in human.

  8. Factors influencing workplace health promotion intervention: a qualitative systematic review.

    Rojatz, Daniela; Merchant, Almas; Nitsch, Martina

    2017-10-01

    Although workplace health promotion (WHP) has evolved over the last 40 years, systematically collected knowledge on factors influencing the functioning of WHP is scarce. Therefore, a qualitative systematic literature review was carried out to systematically identify and synthesize factors influencing the phases of WHP interventions: needs assessment, planning, implementation and evaluation. Research evidence was identified by searching electronic databases (Scopus, PubMed, Social Sciences Citation Index, ASSIA, ERIC, IBBS and PsycINFO) from 1998 to 2013, as well as by cross-checking reference lists of included peer-reviewed articles. The inclusion criteria were: original empirical research, description of WHP, description of barriers to and/or facilitators of the planning, implementation and/or evaluation of WHP. Finally, 54 full texts were included. From these, influencing factors were extracted and summarized using thematic analysis. The majority of influencing factors referred to the implementation phase, few dealt with planning and/or evaluation and none with needs assessment. The influencing factors were condensed into topics with respect to factors at contextual level (e.g. economic crisis); factors at organizational level (e.g. management support); factors at intervention level (e.g. quality of intervention concept); factors at implementer level (e.g. resources); factors at participant level (e.g. commitment to intervention) and factors referring to methodological and data aspects (e.g. data-collection issues). Factors regarding contextual issues and organizational aspects were identified across three phases. Therefore, future research and practice should consider not only the influencing factors at different levels, but also at different phases of WHP interventions. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Health Promotion Behaviors of Women and Affecting Factors

    Naile Bilgili

    2009-12-01

    Full Text Available AIM: Women should be healthy and have health promotion behaviors, so they can accomplish both their maternal and social tasks. This descriptive study was conducted to determine the healthy life-style behaviors of married women and the factors which could affect those behaviors. METHOD: The population comprised all married women older than 15 years and who live in Ankara Kale region. Three hundred-sixty five married women were included in the study. The questionnaire form and the healthy life-style behaviors scale was used for data collection. RESULTS: The mean score taken from scale was 112.2±19.4. The scores of the women who graduated from middle school / high school, who have sufficient income and good socio-economic status, who have a perception of physical health fairly good and who have any chronic disease in their families, have significantly higher mean scores from healthy life-style behaviors scale and subgroups (p<0.05 CONCLUSION: Health promotion behaviors of the women was low and some factors like education level, income, socioeconomic status, perception of health, having any chronic illness and using regular medicine affected healthy life-style behaviors. It is recommended that nurses, who have education and consultation roles, should inform the women about health promotion behaviors and encourage them to use that information in their lives. [TAF Prev Med Bull 2009; 8(6.000: 497-502

  10. Melanopsin Regulates Both Sleep-Promoting and Arousal-Promoting Responses to Light.

    Violetta Pilorz

    2016-06-01

    Full Text Available Light plays a critical role in the regulation of numerous aspects of physiology and behaviour, including the entrainment of circadian rhythms and the regulation of sleep. These responses involve melanopsin (OPN4-expressing photosensitive retinal ganglion cells (pRGCs in addition to rods and cones. Nocturnal light exposure in rodents has been shown to result in rapid sleep induction, in which melanopsin plays a key role. However, studies have also shown that light exposure can result in elevated corticosterone, a response that is not compatible with sleep. To investigate these contradictory findings and to dissect the relative contribution of pRGCs and rods/cones, we assessed the effects of light of different wavelengths on behaviourally defined sleep. Here, we show that blue light (470 nm causes behavioural arousal, elevating corticosterone and delaying sleep onset. By contrast, green light (530 nm produces rapid sleep induction. Compared to wildtype mice, these responses are altered in melanopsin-deficient mice (Opn4-/-, resulting in enhanced sleep in response to blue light but delayed sleep induction in response to green or white light. We go on to show that blue light evokes higher Fos induction in the SCN compared to the sleep-promoting ventrolateral preoptic area (VLPO, whereas green light produced greater responses in the VLPO. Collectively, our data demonstrates that nocturnal light exposure can have either an arousal- or sleep-promoting effect, and that these responses are melanopsin-mediated via different neural pathways with different spectral sensitivities. These findings raise important questions relating to how artificial light may alter behaviour in both the work and domestic setting.

  11. The coat protein of Alfalfa mosaic virus interacts and interferes with the transcriptional activity of the bHLH transcription factor ILR3 promoting salicylic acid-dependent defence signalling response.

    Aparicio, Frederic; Pallás, Vicente

    2017-02-01

    During virus infection, specific viral component-host factor interaction elicits the transcriptional reprogramming of diverse cellular pathways. Alfalfa mosaic virus (AMV) can establish a compatible interaction in tobacco and Arabidopsis hosts. We show that the coat protein (CP) of AMV interacts directly with transcription factor (TF) ILR3 of both species. ILR3 is a basic helix-loop-helix (bHLH) family member of TFs, previously proposed to participate in diverse metabolic pathways. ILR3 has been shown to regulate NEET in Arabidopsis, a critical protein in plant development, senescence, iron metabolism and reactive oxygen species (ROS) homeostasis. We show that the AMV CP-ILR3 interaction causes a fraction of this TF to relocate from the nucleus to the nucleolus. ROS, pathogenesis-related protein 1 (PR1) mRNAs, salicylic acid (SA) and jasmonic acid (JA) contents are increased in healthy Arabidopsis loss-of-function ILR3 mutant (ilr3.2) plants, which implicates ILR3 in the regulation of plant defence responses. In AMV-infected wild-type (wt) plants, NEET expression is reduced slightly, but is induced significantly in ilr3.2 mutant plants. Furthermore, the accumulation of SA and JA is induced in Arabidopsis wt-infected plants. AMV infection in ilr3.2 plants increases JA by over 10-fold, and SA is reduced significantly, indicating an antagonist crosstalk effect. The accumulation levels of viral RNAs are decreased significantly in ilr3.2 mutants, but the virus can still systemically invade the plant. The AMV CP-ILR3 interaction may down-regulate a host factor, NEET, leading to the activation of plant hormone responses to obtain a hormonal equilibrium state, where infection remains at a level that does not affect plant viability. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  12. Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.

    Sudhir Kumar Rai

    2017-12-01

    Full Text Available Retroviruses and Long Terminal Repeat (LTR-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.

  13. Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.

    Rai, Sudhir Kumar; Sangesland, Maya; Lee, Michael; Esnault, Caroline; Cui, Yujin; Chatterjee, Atreyi Ghatak; Levin, Henry L

    2017-12-01

    Retroviruses and Long Terminal Repeat (LTR)-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs) encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.

  14. FACTORS THAT PROMOTE THE DEFECTION OF THE VIRTUAL CLASSROOM

    Jenniz La Madriz

    2016-01-01

    It education virtual is a resource that allows leverage them Tics for reduce barriers of space / time to learn and decrease the dropout school. The research had by objective determine them factors that promote the desertion of the classroom virtual of the subject of methods I, of support to them classes face-to-face, in the Faculty of Sciences economic and social, of the University of Carabobo.  The methodological design was based on the quantitative paradigm and as technical survey, obtainin...

  15. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  16. Detecting privatization factors on promoting exports of steel companies

    Seyed Mohsen SeyedAliAkbar

    2016-05-01

    Full Text Available Privatization is considered as the transfer of business from the government to the private sector. This process is often accomplished in an attempt to reduce the size of government, increase the productivity and export activities. There is no doubt that in an export oriented economy, government tries to promote expert based activities by making necessary changes on rules and regulations. This paper presents an empirical investigation to determine important factors on promoting export in Iran. The study designs a questionnaire in Likert scale and distributes it among some experts active in steel industry. Kaiser-Meyer-Olkin Measure of Sampling Adequacy is equal to 0.839 and Bartlett's Test of Sphericity yields an approximation Chi-Square value of 2485.02 (Sig. = 0.000, df = 276. Using principle component analysis with Varimax rotation, the study has detected five important factors including human resources development, productivity management, marketing management, creating competitive environment and building necessary infrastructures, which influence the most on export activities.

  17. Structure of Vibrio cholerae ribosome hibernation promoting factor

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  18. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

    Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

    2017-05-01

    High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

  19. Corporate social responsibility and the significance of its promotion

    Veljković Dobrinka

    2010-01-01

    Full Text Available Corporate Social Responsibility is today frequently used concept, as companies to a larger extent are held accountable for what is happening in the society. In their effort to make a contribution on the solution of various societal problems, the companies engage in different corporative social initiatives. To enjoy multiple benefits arising from implementation of CSR practices companies should reaffirm their commitment to issues of wide public interests as well as promote all the activities pursued in diminishing and solving different social and environmental problems. It is very important to make company's social involvement as transparent as possible, which can be, aparat from other ways, enhanced by proper and up-to-date use of the web site. Through the web site company can inform wide public (all relevant stakeholders about its CSR activities - programs, undertaken initiatives, partners involved, results achieved and future plans and goals in CSR domain. Placing these informating represents an efficient way of promoting company's CSR profile. Aparat from that, company can regulary place announcements on its web site about all other ways of promoting its CSR engagement.

  20. Mobile communications technology: The singular factor responsible ...

    This paper investigated the factors responsible for the growth of Internet usage on the African continent. The principal finding was that increasing growth of Internet usage is also down to one singular factor: mobile communications technology. The proliferation of mobile phone usage in Africa has resulted in the sustained ...

  1. Engineering of synthetic, stress-responsive yeast promoters

    Rajkumar, Arun Stephen; Liu, Guodong; Bergenholm, David

    2016-01-01

    Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducibleby specific endogenous or environmental conditions...

  2. Predictive factors of health promoting behavior in nursing teachers from three universities in Cali, Colombia

    Zaider Gloria Triviño-Vargas

    2018-05-01

    Full Text Available Introduction: Health promotion has been a constant concern in the human being. It allows to understand behaviors related to it and orientates towards the generation of health promoting behaviors (HPB that promote personal well-being. Objective: To determine the predictor factors influencing the HPB of the teachers according to Pender’s health promotion model. Materials and methods: A correlational descriptive design was made with a representative sample of the teachers with current contract during the study. Instruments such as the EVPS II scale of Pender were applied to measure the dependent variable CPS, as well as for the independent ones such as sociodemographic, knowledge on health promotion, perception of health status and perception of self-efficacy. Results: They are descriptive, according to the coefficient of variation in each of the subdimensions of the behaviors: spiritual growth, interpersonal relations, responsibility in health, nutrition, management of stress and physical activity. The predictor factors were based on the multiple regression model. Conclusions: Favorable HPB were spiritual growth, interpersonal relationships and nutrition. Predictors that have effect on HPB were presented on the basis of teacher rankings, age, senior adult performance area, stratum, income and area of performance, mental health and psychiatry.

  3. Internal dental school environmental factors promoting faculty survival and success.

    Masella, Richard S

    2005-04-01

    A career in dental academics offers ample rewards and challenges. To promote successful careers in dental education, prospective and new dental faculty should possess a realistic view of the dental school work environment, akin to the informed consent so valuable to patients and doctors. Self-assessment of personal strengths and weaknesses provides helpful information in matching faculty applicants with appropriate dental schools. Essential prehiring information also includes a written job description detailing duties and responsibilities, professional development opportunities, and job performance evaluation protocol. Prehiring awareness of what constitutes excellence in job performance will aid new faculty in allotting time to productive venues. New faculty should not rely solely on professional expertise to advance careers. Research and regular peer-reviewed publications are necessary elements in academic career success, along with the ability to secure governmental, private foundation, and corporate grant support. Tactful self-promotion and self-definition to the dental school community are faculty responsibilities, along with substantial peer collaboration. The recruitment period is a singular opportunity to secure job benefits and privileges. It is also the time to gain knowledge of institutional culture and assess administrative and faculty willingness to collaborate on teaching, research, professional development, and attainment of change. Powerful people within dental schools and parent institutions may influence faculty careers and should be identified and carefully treated. The time may come to leave one's position for employment at a different dental school or to step down from full-time academics. Nonetheless, the world of dental and health professional education in 2005 is rapidly expanding and offers unlimited opportunities to dedicated, talented, and informed educators.

  4. FACTORS THAT PROMOTE THE DEFECTION OF THE VIRTUAL CLASSROOM

    Jenniz La Madriz

    2016-12-01

    Full Text Available It education virtual is a resource that allows leverage them Tics for reduce barriers of space / time to learn and decrease the dropout school. The research had by objective determine them factors that promote the desertion of the classroom virtual of the subject of methods I, of support to them classes face-to-face, in the Faculty of Sciences economic and social, of the University of Carabobo.  The methodological design was based on the quantitative paradigm and as technical survey, obtaining the percentage ranges for each item of the questionnaire. The results of the study indicate that to reduce the drop-out necessary to face and avoid the feeling of frustration that the student can conceive with the disadvantages in the use of the virtual environment, personal, technical, academic and economic components.

  5. Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

    Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko

    2011-01-01

    Highlights: → Genistein (GEN) is a phytoestrogen found in soy products. → GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. → GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. → A high-resolution melting assay was used to screen for epigenetic change. → We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.

  6. Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

    Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun [Division of Cellular and Molecular Toxicology, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Muramatsu, Masaaki [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Sudo, Katsuko [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Animal Research Center, Tokyo Medical University, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160-8402 (Japan); Sato, Noriko, E-mail: nsato.epi@tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan)

    2011-08-26

    Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.

  7. Promoting Corporate Social Responsibility in Logistics throughout Horizontal Cooperation

    Angel A. Juan

    2014-03-01

    Full Text Available This paper discusses how Corporate Social Responsibility (CSR can be promoted in Logistics and Transportation (L&T companies by means of Horizontal Cooperation (HC practices. The L&T sector is experiencing important changes because of new trends in markets and society. These changes have a strong impact on the way L&T companies develop their distribution activities.On the one hand, globalisation and increasing competition are creating incentives for these companies to cooperate in different ways – with the aim of becoming more efficient by sharing resources and reducing costs. On the other hand, the increasing sustainability awareness within society is pressuring L&T companies to integrate CSR principles into their strategies and policies. Accordingly, this paper discusses the current trends in these areas and offers some examples of how HC can contribute to reduce both distributions costs as well as the environmental impact of the distribution activities.

  8. Caregivers' support needs and factors promoting resiliency after brain injury.

    Kitter, Bryony; Sharman, Rachael

    2015-01-01

    This article explores the challenges, support needs and coping strategies of caregivers of people with an acquired brain injury (ABI). Semi-structured interviews were conducted with caregivers (n = 20) to explore their support services received, access barriers, utility of services, needed supports, coping strategies and factors promoting life satisfaction. The team recorded, transcribed verbatim and inductively analysed all interviews. Through thematic data analysis, three central themes were revealed: (a) barriers impeding quality-of-life, (b) support needed to improve quality-of-life and (c) factors enabling quality-of-life. All perspectives from the participants involved are synthesized to provide a rich depiction of caregivers' support needs and coping strategies. Two specific findings of interest include a negative association between severity of brain injury and caregiver's desire to direct treatment, as well as a distinct service gap in assistance for caregivers who are caring for someone with violent/offending behaviours. This study recommends short- and long-term changes, given Australia's upcoming National Disability Insurance Scheme, to increase caregiver quality-of-life, which will ultimately affect the rehabilitation outcomes of persons with ABI.

  9. Health Promotion and Related Factors Among Korean Goose Mothers

    Chiyoung Cha, PhD, RN

    2010-12-01

    Conclusions: The findings of this study contributed to the body of knowledge of health promotion among international migrant populations by identifying the differential effects of social support, acculturation attitudes, and perceived family health for six areas of health promotion.

  10. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  11. hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

    Shunsuke Ohnishi

    Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

  12. A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1

    Dao, T.; Holan, V.; Minowada, J.

    1993-01-01

    A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)

  13. Factors influencing advanced practice nurses' ability to promote evidence-based practice among frontline nurses.

    Gerrish, Kate; Nolan, Mike; McDonnell, Ann; Tod, Angela; Kirshbaum, Marilyn; Guillaume, Louise

    2012-02-01

    Advanced practice nurses (APNs) have an important role in promoting evidence-based practice (EBP) among frontline nurses (FLNs). Factors influencing FLNs' engagement with EBP are well documented but little is known about factors that affect APNs' ability to facilitate evidence in practice. To identify factors that influence APNs' ability to promote EBP among FLNs. A multiple case study of 23 APNs from hospital and primary care settings across seven English health authorities was undertaken. Data collection comprised interviews and observation of APNs and interviews with FLNs and other healthcare professionals. Data were analysed using the Framework approach. Four groups of influencing factors were identified: (1) Personal attributes of APNs included knowledge and skills in EBP, clinical credibility with frontline staff and leadership style. (2) Relationships with stakeholders included APNs' interactions with FLNs and the level of support from managers and medical colleagues. (3) Aspects of the APN role included their sphere of responsibility and workload. (4) Organisational context included the organisational culture, FLNs' workload, professional networks and available resources. Educational preparation for APNs should enable them to develop expertise in EBP plus interpersonal and leadership skills to manage relational dynamics in clinical settings. APN role specifications should provide the opportunity to promote EBP. The organisational culture should be conducive to enabling EBP with managers supportive of this aspect of the APNs' role. APNs need to be supported to address the individual, interpersonal and organisational factors, which influence their ability to promote EBP. Organisational commitment at the highest level is key to APNs' ability to fulfil this aspect of their role. ©2011 Sigma Theta Tau International.

  14. Functional analysis of jasmonate-responsive transcription factors in Arabidopsis thaliana

    Zarei, Adel

    2007-01-01

    The aim of the studies described in this thesis was the functional analysis of JA-responsive transcription factors in Arabidopsis with an emphasis on the interaction with the promoters of their target genes. In short, the following new results were obtained. The promoter of the PDF1.2 gene contains

  15. Critical success factors for physical activity promotion through community partnerships.

    Lucidarme, Steffie; Marlier, Mathieu; Cardon, Greet; De Bourdeaudhuij, Ilse; Willem, Annick

    2014-02-01

    To define key factors of effective evidence-based policy implementation for physical activity promotion by use of a partnership approach. Using Parent and Harvey's model for sport and physical activity community-based partnerships, we defined determinants of implementation based on 13 face-to-face interviews with network organisations and 39 telephone interviews with partner organisations. Furthermore, two quantitative data-sets (n = 991 and n = 965) were used to measure implementation. In total, nine variables were found to influence implementation. Personal contact was the most powerful variable since its presence contributed to success while its absence led to a negative outcome. Four contributed directly to success: political motive, absence of a metropolis, high commitment and more qualified staff. Four others resulted in a less successful implementation: absence of positive merger effects, exposure motive and governance, and dispersed leadership. Community networks are a promising instrument for the implementation of evidence-based policies. However, determinants of both formation and management of partnerships influence the implementation success. During partnership formation, special attention should be given to partnership motives while social skills are of utmost importance for the management.

  16. Potential factors that may promote successful cognitive aging

    Vance DE

    2012-06-01

    Full Text Available David E VanceCenter for Nursing Research, School of Nursing, Edward R Roybal Center for Translational Research in Aging and Mobility, University of Alabama at Birmingham (UAB, Birmingham, AL, USAAbstract: With the unprecedented number of older adults worldwide, it is important to consider ways of facilitating successful cognitive aging. One way to think of this is by augmenting or bolstering cognitive reserve. Loosely defined, cognitive reserve is considered a neurological reservoir that can be depleted by physiological insults (eg, white matter hyperintensities, oxidative stress to the brain but yet maintain optimal cognitive functioning. Cognitive reserve is built up or depleted by processes of positive and negative neuroplasticity, respectively. Lifestyle factors such as physical exercise (+, mental stimulation (+, good sleep hygiene (+, substance abuse (-, sedentary lifestyle (-, chronic stress and depression (-, social isolation (-, and poor health (- can either promote or discourage positive and negative neuroplasticity, which in turn impacts cognitive reserve. Nurses are encouraged to understand these processes so they can help facilitate successful cognitive aging in their patients.Keywords: cognitive reserve, Alzheimer's disease, neuroplasticity

  17. Personal factors of moral responsibility in adolescence

    Sergey V. Molchanov

    2017-12-01

    Full Text Available Background. Responsibility as a measure of individual freedom comes only under the condition of freedom of choice and the ability to anticipate and take into account the consequences of acts. Therefore, personal factors play a key role in taking moral responsibility. Scholars have studied the personal bases of responsibility that comprises autonomy, independence, confidence, the locus of control, the motivation to achieve a goal, the level of aspiration. However, the role of the moral self and moral identity in the determination of responsibility is not sufficiently studied. Objective. The objective of the research is to study the relationship between the moral identity of the individual and the willingness to accept moral responsibility in adolescence. Proceeding from the general hypothesis about the essential role of moral identity in adopting and actualising themoral responsibility, two specific hypotheses are articulated, specifying the role of values and moral self-esteem in taking moral responsibility. Design. An empirical study of adolescents aged 13–17 years was conducted. Subjects are students of educational institutions of general education in Moscow (a total of 314 subjects. The study poses the challenges of studying the readiness to accept moral responsibility by adolescents in the situation of a moral dilemma, the connection of the moral and value orientation of adolescents and the willingness to accept moral responsibility, the connection of self-esteem of moral qualities and the readiness of adolescents to accept moral responsibility. The methodology for assessing moral responsibility in the situation of solving the moral dilemma «Moral Situations from Real Life» (MORS, a modified version of M. Rokich’s method for evaluating value orientations, the method of structured moral self-esteem (A.I. Podolsky, P. Heymans, O.A. Karabanova are used. Conclusion. The results revealed the influence of the participants’ moral dilemma

  18. LKB1 promotes metabolic flexibility in response to energy stress.

    Parker, Seth J; Svensson, Robert U; Divakaruni, Ajit S; Lefebvre, Austin E; Murphy, Anne N; Shaw, Reuben J; Metallo, Christian M

    2017-09-01

    The Liver Kinase B1 (LKB1) tumor suppressor acts as a metabolic energy sensor to regulate AMP-activated protein kinase (AMPK) signaling and is commonly mutated in various cancers, including non-small cell lung cancer (NSCLC). Tumor cells deficient in LKB1 may be uniquely sensitized to metabolic stresses, which may offer a therapeutic window in oncology. To address this question we have explored how functional LKB1 impacts the metabolism of NSCLC cells using 13 C metabolic flux analysis. Isogenic NSCLC cells expressing functional LKB1 exhibited higher flux through oxidative mitochondrial pathways compared to those deficient in LKB1. Re-expression of LKB1 also increased the capacity of cells to oxidize major mitochondrial substrates, including pyruvate, fatty acids, and glutamine. Furthermore, LKB1 expression promoted an adaptive response to energy stress induced by anchorage-independent growth. Finally, this diminished adaptability sensitized LKB1-deficient cells to combinatorial inhibition of mitochondrial complex I and glutaminase. Together, our data implicate LKB1 as a major regulator of adaptive metabolic reprogramming and suggest synergistic pharmacological strategies for mitigating LKB1-deficient NSCLC tumor growth. Copyright © 2016. Published by Elsevier Inc.

  19. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

    Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

    2017-09-12

    Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription

    Chen-Chun Pai

    2017-09-01

    Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.

  1. The TLR5 ligand flagellin promotes asthma by priming allergic responses to indoor allergens

    Wilson, Rhonda H.; Maruoka, Shuichiro; Whitehead, Gregory S.; Foley, Julie F.; Flake, Gordon P.; Sever, Michelle L.; Zeldin, Darryl C.; Kraft, Monica; Garantziotis, Stavros; Nakano, Hideki; Cook, Donald N.

    2012-01-01

    Allergic asthma is a complex disease characterized by eosinophilic pulmonary inflammation, mucus production and reversible airway obstruction1. Exposure to indoor allergens is a clear risk factor for asthma, but this disease is also associated with high household levels of total and Gram-negative bacteria2. The ability of bacterial products to act as adjuvants3 suggests they might promote asthma by priming allergic sensitization to inhaled allergens. In support of this idea, house dust extracts (HDEs) can activate antigen presenting dendritic cells (DC) in vitro and promote allergic sensitization to inhaled innocuous proteinsin vivo4. It is unknown which microbial products provide most of the adjuvant activity in HDEs. A screen of microbial products for their adjuvant activity in the airway revealed that the bacterial protein, flagellin (FLA) stimulated strong allergic responses to an innocuous inhaled protein. Moreover, toll-like receptor (TLR)5, the mammalian receptor for FLA5,6, was required for priming strong allergic responses to natural indoor allergens present in HDEs. In addition, the incidence of human asthma was associated with high serum levels of FLA-specific antibodies. Together, these findings suggest that household FLA promotes the development of allergic asthma by TLR5-dependent priming of allergic responses to indoor allergens. PMID:23064463

  2. Factors affecting seismic response of submarine slopes

    G. Biscontin

    2006-01-01

    Full Text Available The response of submerged slopes on the continental shelf to seismic or storm loading has become an important element in the risk assessment for offshore structures and 'local' tsunami hazards worldwide. The geological profile of these slopes typically includes normally consolidated to lightly overconsolidated soft cohesive soils with layer thickness ranging from a few meters to hundreds of meters. The factor of safety obtained from pseudo-static analyses is not always a useful measure for evaluating the slope response, since values less than one do not necessarily imply slope failure with large movements of the soil mass. This paper addresses the relative importance of different factors affecting the response of submerged slopes during seismic loading. The analyses use a dynamic finite element code which includes a constitutive law describing the anisotropic stress-strain-strength behavior of normally consolidated to lightly overconsolidated clays. The model also incorporates anisotropic hardening to describe the effect of different shear strain and stress histories as well as bounding surface principles to provide realistic descriptions of the accumulation of the plastic strains and excess pore pressure during successive loading cycles. The paper presents results from parametric site response analyses on slope geometry and layering, soil material parameters, and input ground motion characteristics. The predicted maximum shear strains, permanent deformations, displacement time histories and maximum excess pore pressure development provide insight of slope performance during a seismic event.

  3. Placental Growth Factor Promotes Cardiac Muscle Repair via Enhanced Neovascularization

    Jianfeng Zhang

    2015-06-01

    Full Text Available Background/Aims: Transplantation of mesenchymal stem cells (MSCs improves post-injury cardiac muscle repair using ill-defined mechanisms. Recently, we have shown that production and secretion of placental growth factor (PLGF by MSCs play a critical role in the MSCs-mediated post-injury cardiac muscle repair. In this study, we addressed the underlying molecular mechanisms, focusing specifically on the interactions between MSCs, macrophages and endothelial cells. Methods: We isolated macrophages (BM-MΦ from mouse bone-marrow derived cells based on F4/80 expression by flow cytometry. BM-MΦ were treated with different doses of PLGF. Cell number was analyzed by a MTT assay. Macrophage polarization was examined based on CD206 expression by flow cytometry. PLGF levels in macrophage subpopulations were analyzed by RT-qPCR and ELISA. Effects of macrophages on vascularization were evaluated by a collagen gel assay using Human umbilical vein endothelial cells (HUVECs co-cultured with PLGF-treated macrophages. Results: PLGF did not increase macrophage number, but dose-dependently polarized macrophages into a M2 subpopulation. M2 macrophages expressed high levels of PLGF. PLGF-polarized M2 macrophages significantly increased tubular structures in the collagen gel assay. Conclusion: Our data suggest that MSCs-derived PLGF may induce macrophage polarization into a M2 subpopulation, which in turn releases more PLGF to promote local neovascularization for augmenting post-injury cardiac muscle repair. This study thus sheds novel light on the role of PLGF in cardiac muscle regeneration.

  4. DAF-16/FOXO and EGL-27/GATA promote developmental growth in response to persistent somatic DNA damage.

    Mueller, Michael M; Castells-Roca, Laia; Babu, Vipin; Ermolaeva, Maria A; Müller, Roman-Ulrich; Frommolt, Peter; Williams, Ashley B; Greiss, Sebastian; Schneider, Jennifer I; Benzing, Thomas; Schermer, Bernhard; Schumacher, Björn

    2014-12-01

    Genome maintenance defects cause complex disease phenotypes characterized by developmental failure, cancer susceptibility and premature ageing. It remains poorly understood how DNA damage responses function during organismal development and maintain tissue functionality when DNA damage accumulates with ageing. Here we show that the FOXO transcription factor DAF-16 is activated in response to DNA damage during development, whereas the DNA damage responsiveness of DAF-16 declines with ageing. We find that in contrast to its established role in mediating starvation arrest, DAF-16 alleviates DNA-damage-induced developmental arrest and even in the absence of DNA repair promotes developmental growth and enhances somatic tissue functionality. We demonstrate that the GATA transcription factor EGL-27 co-regulates DAF-16 target genes in response to DNA damage and together with DAF-16 promotes developmental growth. We propose that EGL-27/GATA activity specifies DAF-16-mediated DNA damage responses to enable developmental progression and to prolong tissue functioning when DNA damage persists.

  5. Plant responses to plant growth-promoting rhizobacteria

    Loon, L.C. van

    2007-01-01

    Non-pathogenic soilborne microorganisms can promote plant growth, as well as suppress diseases. Plant growth promotion is taken to result from improved nutrient acquisition or hormonal stimulation. Disease suppression can occur through microbial antagonism or induction of resistance in the plant.

  6. Factors That Impact the Success of Interorganizational Health Promotion Collaborations: A Scoping Review.

    Seaton, Cherisse L; Holm, Nikolai; Bottorff, Joan L; Jones-Bricker, Margaret; Errey, Sally; Caperchione, Cristina M; Lamont, Sonia; Johnson, Steven T; Healy, Theresa

    2018-05-01

    To explore published empirical literature in order to identify factors that facilitate or inhibit collaborative approaches for health promotion using a scoping review methodology. A comprehensive search of MEDLINE, CINAHL, ScienceDirect, PsycINFO, and Academic Search Complete for articles published between January 2001 and October 2015 was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. To be included studies had to: be an original research article, published in English, involve at least 2 organizations in a health promotion partnership, and identify factors contributing to or constraining the success of an established (or prior) partnership. Studies were excluded if they focused on primary care collaboration or organizations jointly lobbying for a cause. Data extraction was completed by 2 members of the author team using a summary chart to extract information relevant to the factors that facilitated or constrained collaboration success. NVivo 10 was used to code article content into the thematic categories identified in the data extraction. Twenty-five studies across 8 countries were identified. Several key factors contributed to collaborative effectiveness, including a shared vision, leadership, member characteristics, organizational commitment, available resources, clear roles/responsibilities, trust/clear communication, and engagement of the target population. In general, the findings were consistent with previous reviews; however, additional novel themes did emerge.

  7. Construction of predictive promoter models on the example of antibacterial response of human epithelial cells

    Wingender Edgar

    2005-01-01

    Full Text Available Abstract Background Binding of a bacteria to a eukaryotic cell triggers a complex network of interactions in and between both cells. P. aeruginosa is a pathogen that causes acute and chronic lung infections by interacting with the pulmonary epithelial cells. We use this example for examining the ways of triggering the response of the eukaryotic cell(s, leading us to a better understanding of the details of the inflammatory process in general. Results Considering a set of genes co-expressed during the antibacterial response of human lung epithelial cells, we constructed a promoter model for the search of additional target genes potentially involved in the same cell response. The model construction is based on the consideration of pair-wise combinations of transcription factor binding sites (TFBS. It has been shown that the antibacterial response of human epithelial cells is triggered by at least two distinct pathways. We therefore supposed that there are two subsets of promoters activated by each of them. Optimally, they should be "complementary" in the sense of appearing in complementary subsets of the (+-training set. We developed the concept of complementary pairs, i.e., two mutually exclusive pairs of TFBS, each of which should be found in one of the two complementary subsets. Conclusions We suggest a simple, but exhaustive method for searching for TFBS pairs which characterize the whole (+-training set, as well as for complementary pairs. Applying this method, we came up with a promoter model of antibacterial response genes that consists of one TFBS pair which should be found in the whole training set and four complementary pairs. We applied this model to screening of 13,000 upstream regions of human genes and identified 430 new target genes which are potentially involved in antibacterial defense mechanisms.

  8. WRKY transcription factors in plant responses to stresses.

    Jiang, Jingjing; Ma, Shenghui; Ye, Nenghui; Jiang, Ming; Cao, Jiashu; Zhang, Jianhua

    2017-02-01

    The WRKY gene family is among the largest families of transcription factors (TFs) in higher plants. By regulating the plant hormone signal transduction pathway, these TFs play critical roles in some plant processes in response to biotic and abiotic stress. Various bodies of research have demonstrated the important biological functions of WRKY TFs in plant response to different kinds of biotic and abiotic stresses and working mechanisms. However, very little summarization has been done to review their research progress. Not just important TFs function in plant response to biotic and abiotic stresses, WRKY also participates in carbohydrate synthesis, senescence, development, and secondary metabolites synthesis. WRKY proteins can bind to W-box (TGACC (A/T)) in the promoter of its target genes and activate or repress the expression of downstream genes to regulate their stress response. Moreover, WRKY proteins can interact with other TFs to regulate plant defensive responses. In the present review, we focus on the structural characteristics of WRKY TFs and the research progress on their functions in plant responses to a variety of stresses. © 2016 Institute of Botany, Chinese Academy of Sciences.

  9. Promoter And Duties And Responsibilities Of Promoters In English Company Law

    Neval Okan

    2003-01-01

    Any person who does an act with reference to the formation of a company or in aid of its organization whether he has the intention to be a partners or not is a promoter. No statuory definition of promoter is given in English company law; definition is given in case law. Promoters stand in a fiduciary relation to the proposed company. Apromoter is not an agent for the company which he is forming because a company cannot have an agent before it comes into existence. The fiduciary duty is owed t...

  10. Tumor Necrosis Factor-Mediated Survival of CD169+ Cells Promotes Immune Activation during Vesicular Stomatitis Virus Infection

    Shinde, Prashant V; Xu, Haifeng C; Maney, Sathish Kumar

    2018-01-01

    Innate immune activation is essential to mount an effective antiviral response and to prime adaptive immunity. Although a crucial role of CD169(+) cells during vesicular stomatitis virus (VSV) infections is increasingly recognized, factors regulating CD169(+) cells during viral infections remain...... stomatitis virus infection, phagocytes produce tumor necrosis factor (TNF) which signals via TNFR1 and promote "enforced virus replication" in CD169(+) macrophages. Consequently, lack of TNF or TNFR1 resulted in defective immune activation and VSV clearance....

  11. Customer response to media in marketing promotion: print versus online

    Ieva, Marco

    2016-01-01

    Il lavoro di tesi, che si compone di tre articoli di ricerca, analizza, nel contesto della marketing promotion, la risposta del consumatore ai media in termini di ricordo, intenzione di acquisto, comportamento di acquisto e preferenza per il medium. Il lavoro, in particolare, mette a confronto due tipologie di media, carta e online, nell’ambito della price e loyalty promotion, utilizzando due disegni di ricerca sperimentali ed uno correlazionale. I risultati del lavoro mostrano che la rispost...

  12. The GATA transcription factor egl-27 delays aging by promoting stress resistance in Caenorhabditis elegans.

    Xiao Xu

    Full Text Available Stress is a fundamental aspect of aging, as accumulated damage from a lifetime of stress can limit lifespan and protective responses to stress can extend lifespan. In this study, we identify a conserved Caenorhabditis elegans GATA transcription factor, egl-27, that is involved in several stress responses and aging. We found that overexpression of egl-27 extends the lifespan of wild-type animals. Furthermore, egl-27 is required for the pro-longevity effects from impaired insulin/IGF-1 like signaling (IIS, as reduced egl-27 activity fully suppresses the longevity of worms that are mutant for the IIS receptor, daf-2. egl-27 expression is inhibited by daf-2 and activated by pro-longevity factors daf-16/FOXO and elt-3/GATA, suggesting that egl-27 acts at the intersection of IIS and GATA pathways to extend lifespan. Consistent with its role in IIS signaling, we found that egl-27 is involved in stress response pathways. egl-27 expression is induced in the presence of multiple stresses, its targets are significantly enriched for many types of stress genes, and altering levels of egl-27 itself affects survival to heat and oxidative stress. Finally, we found that egl-27 expression increases between young and old animals, suggesting that increased levels of egl-27 in aged animals may act to promote stress resistance. These results identify egl-27 as a novel factor that links stress and aging pathways.

  13. Health-promoting practices and the factors associated with self ...

    According to self-reports, the most common new health problems since taking up the caregiving role were chronic ill health (97%), social isolation (95%) and mental stress (92%). The health-promoting practices most often engaged in were eating a balanced diet (67%), seeking spiritual support (58%), and performing ...

  14. Psychosocial factors and mental health in cancer patients: opportunities for health promotion

    Boer, Henk; Elving, Wim; Seydel, Erwin

    1998-01-01

    A first step in planning health promotion with respect to mental health is analysing the factors that influence mental health. Diagnosis of the relevant variables may contribute to the design of effective health promotion programmes. In this paper the relationship between psychosocial factors and

  15. FACTORS RESPONSIBLE FOR CONSUMER’S ATTITUDE TOWARDS ADVERGAMES

    Ghirvu Alina

    2013-07-01

    Full Text Available Internet technology, as well as development of mobile phone was fast adopted by people for recreational, economical and business reasons. The Internet technology development and the new communication systems made marketers to orientate their promotional campaigns and efforts towards new ways of reaching their actual and potential client. They started to use new and innovative ways to get public’s interest and to encourage purchase. In this context, Internet offered a complex environment to support the development of innovative brand strategies. One of the emerging new techniques in advertising is advergaming. Advergames represent the use of video game interactive technology for delivering brand messages to public. They are electronic games accessible on companies own websites, on social media sites and on application which can be downloaded on mobile devices. For marketers is important to understand the way that advergames work and what consumer’s attitude towards this practice is. The formation of attitude depends on a series of factors which are common to all types of advertisements based on Internet technology. These factors responsible for consumers’ attitude towards online advertising and implicit for attitude formation over advergames are informative component, entertainment, source credibility and irritation. Beside these four elements, there are additional criterions which consumers use for evaluating advertising in video games: the viral component, interactivity and telepresence. For marketers it is important to understand these factors and to find practical ways for using them for a better brand communication and for higher result of advertising campaigns which include the use of advergames as part of the promotional strategy. The present paper is looking to make a description of the factors influencing consumer’s attitude formation towards advergames, in conjunction with the Internet environment and the specific features of

  16. Valproic acid promotes neuronal differentiation by induction of proneural factors in association with H4 acetylation.

    Yu, In Tag; Park, Jin-Yong; Kim, Sung Hyun; Lee, Jeong-Sik; Kim, Yong-Seok; Son, Hyeon

    2009-02-01

    Valproate (VPA) influences the proliferation and differentiation of neuronal cells. However, little is known about the downstream events, such as alterations in gene transcription, that are associated with cell fate choice. To determine whether VPA plays an instructive role in cell fate choice during hippocampal neurogenesis, the expression of genes involved in the cell cycle and neuronal differentiation was investigated. Treatment with VPA during the progenitor stages resulted in strong inhibition of cell proliferation and induction of neuronal differentiation, accompanied by increases in the expression of proneural transcription factors and in neuronal cell numbers. The increased expression of Ngn1, Math1 and p15 points to a shift towards neuronal fate in response to histone deacetylase inhibitors (HDACi). Chromatin immunoprecipitation (ChIP) analysis showed that acetylated histone H4 (Ac-H4) was associated with the Ngn1, Math1 and p15 promoters in cultured hippocampal neural progenitor cells. VPA-induced hippocampal neurogenesis was also accompanied by association of Ac-H4 with the Ngn1 promoter in hippocampal extracts. The discovery of an association between HDACi and the Ngn1, Math1 and p15 promoters extends the importance of HDAC inhibition as a key regulator of neuronal differentiation at the transcriptional level.

  17. Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.

    Kitamura, Kazuya; Fujiyoshi, Kanehiro; Yamane, Jun-Ichi; Toyota, Fumika; Hikishima, Keigo; Nomura, Tatsuji; Funakoshi, Hiroshi; Nakamura, Toshikazu; Aoki, Masashi; Toyama, Yoshiaki; Okano, Hideyuki; Nakamura, Masaya

    2011-01-01

    Many therapeutic interventions for spinal cord injury (SCI) using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF), which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF) intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.

  18. Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.

    Kazuya Kitamura

    Full Text Available Many therapeutic interventions for spinal cord injury (SCI using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF, which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.

  19. Self-evaluations of factors promoting and disturbing sleep: an epidemiological survey in Finland.

    Urponen, H; Vuori, I; Hasan, J; Partinen, M

    1988-01-01

    The purpose of this epidemiological survey (N = 1600) was to describe the factors which middle-aged urban people in Finland perceived as promoting or disturbing sleep. The response rate was 75%. The results suggested that quality of sleep is determined by numerous factors; social and psychological factors, health status, external sleeping conditions, life style and living habits. Every third respondent felt that exercise had a positive impact on sleep. Second in importance were reading and listening to music. Furthermore, sauna, shower and bath, stability in life, psychological factors, positive experience in work, satisfactory sexual life and good and quiet sleeping environment were reported to have positive effects on sleep. Men considered work-related pressure and fatigue (20%) as the most important factor disturbing falling asleep or quality of sleep. In women's ranking work problems appeared no sooner than in the third place. Women reported worries, interpersonal problems, and marital and family discord as the most disturbing factors to sleep (37%). Coffee in the evening had a negative effect on falling asleep. Although a 'nightcap' was considered to improve relaxation on falling sleep, men ranked alcohol as the fourth disturbing factor. Other disturbing factors were stress, irregularities in everyday life because of social events, travelling or atypical catnaps. Eating and exercising too heavily or too late in the evening were found to disturb sleep. On the other hand, temporary lack of exercise seemed to impair the quality of sleep. As external factors disturbing sleep the subjects considered noise light, too high room temperature, tight clothing, unfamiliar sleeping environment and restless children.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  1. Factors influencing induction of adaptive response

    Misonoh, Jun; Ojima, Mitsuaki; Yonezawa, Morio

    2000-01-01

    Exposure to low doses of X-rays makes ICR mice resistant to subsequent sublethal irradiation and decrease mortality from hematopoietic death. Many factors, however, influence the induction of radioresistance. For instances, in ICR mice, the priming irradiation with 0.50 Gy was effective in the induction of radioresistance, when it is given at 6-week old, 2 weeks prior to subsequent sublethal irradiation. One hundred-fifty kV X-ray filtered off the soft component through 1.0 mm aluminum and 0.2 mm copper induces radioadaptive response as well as the harder radiation such as 260 kV X-ray filtered through 0.5 mm aluminum and 0.3 mm copper. Dose rate of priming irradiation also seemed to influence the induction of radioresistance. Priming irradiation with 0.50 Gy at 0.50 Gy/min and 0.25 Gy/min induced adaptive response, while same 0.50 Gy given at 0.063 Gy/min didn't. To make the matter complicated, when mice were pre-irradiated with 0.50 Gy at 0.013 Gy/min in the irradiation cell which was 1.2 x 1.2 x 1.4 times larger than the usual one, adaptive response was induced again. These results suggested that mice felt more uncomfortable when they were packing in the irradiation cell with little free space even for several minutes than when they were placed in the cell with much free space for about 40 minutes, and such a stress might give the mice some resistance to the subsequent sublethal irradiation. (author)

  2. Promoting Response Variability and Stimulus Generalization in Martial Arts Training

    Harding, Jay W.; Wacker, David P.; Berg, Wendy K.; Rick, Gary; Lee, John F.

    2004-01-01

    The effects of reinforcement and extinction on response variability and stimulus generalization in the punching and kicking techniques of 2 martial arts students were evaluated across drill and sparring conditions. During both conditions, the students were asked to demonstrate different techniques in response to an instructor's punching attack.…

  3. Growth/differentiation factor-15: prostate cancer suppressor or promoter?

    Vaňhara, P.; Hampl, A.; Kozubík, Alois; Souček, Karel

    2012-01-01

    Roč. 15, č. 4 (2012), s. 320-328 ISSN 1365-7852 R&D Projects: GA MZd NS9600; GA MZd NS9956 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : MACROPHAGE-INHIBITORY CYTOKINE-1 * GROWTH-DIFFERENTIATION FACTOR-15 * TGF-BETA SUPERFAMILY Subject RIV: BO - Biophysics Impact factor: 2.811, year: 2012

  4. Factors influencing primary health care professionals' physical activity promotion behaviors: a systematic review.

    Huijg, Johanna M; Gebhardt, Winifred A; Verheijden, Marieke W; van der Zouwe, Nicolette; de Vries, Juriena D; Middelkoop, Barend J C; Crone, Mathilde R

    2015-02-01

    Despite the promising findings related to the efficacy of interventions aimed at promoting physical activity (PA) in primary health care (PHC), the translation of these interventions to PHC practice does not always happen as desired. To help understand why efficacious PHC-based PA interventions are not effectively translated to practice, this study systematically reviewed the literature on factors influencing PHC professionals' PA promotion practices. Literature searches were conducted in Web of Science, PubMed, and PsycINFO for peer-reviewed articles published in English from 1990 onwards. Studies were included that met the following criteria: (1) involving PHC-based PA interventions, and (2) reporting factors influencing PHC professionals' PA promotion behaviors. Two researchers independently screened studies and extracted data. A narrative synthesis using thematic analysis was conducted to identify factors. Of the 4,469 identified articles, 59 were included in the review. Factors were identified by qualitative methods, barrier/facilitator ratings, and the examination of the relationship between factors and PA promotion, and the effectiveness of introduction strategies. Many factors related to the development, delivery, and effects of the innovation, the sociopolitical and organizational culture, resources, and support, patient and PHC professional characteristics, and innovation strategies were identified as potential influences on PHC professionals' PA promotion practices. However, the lack of evidence on the relationship between factors and PA promotion indicated insufficient evidence on PA promotion determinants. This extensive overview of potential factors can inform intervention developers and implementers on which factors may play a role when introducing PA interventions in PHC. Future research should further investigate relationships between factors and PA promotion, which should be guided by qualitative in-depth knowledge on influencing factors.

  5. Ethylene response factor AtERF72 negatively regulates Arabidopsis thaliana response to iron deficiency.

    Liu, Wei; Li, Qiwei; Wang, Yi; Wu, Ting; Yang, Yafei; Zhang, Xinzhong; Han, Zhenhai; Xu, Xuefeng

    2017-09-23

    Ethylene regulates the plant's response to stress caused by iron (Fe) deficiency. However, specific roles of ERF proteins in response to Fe deficiency remain poorly understood. Here, we investigated the role of ERF72 in response to iron deficiency in Arabidopsis thaliana. In this study, the levels of the ethylene response factor AtERF72 increased in leaves and roots induced under the iron deficient conditions. erf72 mutant plants showed increased growth compared to wild type (WT) when grown in iron deficient medium for 5 d. erf72 mutants had increased root H + velocity and the ferric reductase activity, and increase in the expression of the iron deficiency response genes iron-regulated transporter 1 (IRT1) and H + -ATPase (HA2) levels in iron deficient conditions. Compared to WT plants, erf72 mutants retained healthy chloroplast structure with significantly higher Fe and Mg content, and decreased chlorophyll degradation gene pheophorbide a oxygenase (PAO) and chlorophyllase (CLH1) expression when grown in iron deficient media. Yeast one-hybrid analysis showed that ERF72 could directly bind to the promoter regions of iron deficiency responses genes IRT1, HA2 and CLH1. Based on our results, we suggest that ethylene released from plants under iron deficiency stress can activate the expression of ERF72, which responds to iron deficiency in the negative regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Women-Centered and Culturally Responsive Heart Health Promotion Among Indigenous Women in Canada.

    Ziabakhsh, Shabnam; Pederson, Ann; Prodan-Bhalla, Natasha; Middagh, Diane; Jinkerson-Brass, Sharon

    2016-11-01

    Most women in Canada confront a combination of bio-psychosocial factors that put them at risk for cardiovascular disease. The challenge for health planners is to address these factors while contextualizing interventions that meet the specific needs of particular social and cultural groupings. The article will discuss a women-centered, group-based heart health pilot initiative designed to engage with indigenous approaches to healing. The nurse practitioners co-led the group with a representative from the indigenous community to balance women-centered practices with more traditional and culturally appropriate ones. In particular, indigenous processes, such as a Talking Circle, combined with indigenous knowledge/content were integrated into the pilot program. The project was evaluated to investigate its outcomes (how the intervention impacted the participants) and processes (how participants perceived the intervention). Evaluation involved analysis of the Talking Circle's content, a focus group, field observations, and self-completed surveys. Most women made changes regarding their diet, some began physical activities, and others focused on better managing their emotional health. Women viewed the group as successful because it embraced both women-centered and culturally appropriate health promotion practices. The intervention created a culturally safe space for learning and transformation. The findings confirm the need for employing culturally relevant, gender-specific approaches to heart health promotion that are situated in and responsive to community needs. © 2016 Society for Public Health Education.

  7. Cytokinin biosynthesis promotes cortical cell responses during nodule development

    Reid, D.E.; Nadzieja, M.; Novák, Ondřej; Heckmann, A.B.; Sandal, N.; Stougaard, J.

    2017-01-01

    Roč. 175, č. 1 (2017), s. 361-375 ISSN 0032-0889 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : MEDICAGO-TRUNCATULA ROOT * ERN1 TRANSCRIPTION FACTOR * DEPENDENT PROTEIN-KINASE Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 6.456, year: 2016

  8. 40 CFR 1065.845 - Response factor determination.

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Response factor determination. 1065... POLLUTION CONTROLS ENGINE-TESTING PROCEDURES Testing With Oxygenated Fuels § 1065.845 Response factor... each FID analyzer's alcohol/carbonyl response factor (such as RF MeOH) after FID optimization to...

  9. Biomechanical, microvascular, and cellular factors promote muscle and bone regeneration.

    Duda, Georg N; Taylor, William R; Winkler, Tobias; Matziolis, Georg; Heller, Markus O; Haas, Norbert P; Perka, Carsten; Schaser, Klaus-D

    2008-04-01

    It is becoming clear that the long-term outcome of complex bone injuries benefits from approaches that selectively target biomechanical, vascular, and cellular pathways. The typically held view of either biological or mechanical aspects of healing is oversimplified and does not correspond to clinical reality. The fundamental mechanisms of soft tissue regeneration most likely hold the key to understanding healing response.

  10. Epidemiological Factors that Promote the Development of Severe ...

    FOMCS2

    2007-06-02

    Jun 2, 2007 ... status included: age of the child, level of parasitaemia, careless response and attitude of parents or guardians to fever in the children; parents' preoccupation with ... treatment when the child was ill. We were also interested in ..... and endurance of the children who participated in this study. We are grateful to ...

  11. Transferring disease management and health promotion programs to other countries: critical success factors.

    Azarmina, Pejman; Prestwich, Graham; Rosenquist, Joel; Singh, Debbie

    2008-12-01

    Governments and health service providers around the world are under pressure to improve health outcomes while containing rising healthcare costs. In response to such challenges, many regions have implemented services that have been successful in other countries-but 'importing' initiatives has many challenges. This article summarizes factors found to be critical to the success of adapting a US disease management and health promotion programme for use in Italy and the UK. Using three illustrative case studies, it describes how in each region the programme needed to adapt (i) the form and content of the disease management service, (ii) the involvement and integration with local clinicians and services and (iii) the evaluation of programme outcomes. We argue that it is important to implement evidence-based practice by learning lessons from other countries and service initiatives, but that it is equally important to take into consideration the '3Ps' that are critical for successful service implementation: payers, practitioners and patients.

  12. Brain-derived neurotrophic factor promoter methylation and cortical thickness in recurrent major depressive disorder

    Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo

    2016-01-01

    Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the gr...

  13. Promoter hypomethylation and upregulation of trefoil factors in prostate cancer

    Vestergaard, Else Marie; Nexø, Ebba; Tørring, Niels

    2010-01-01

    cell lines with significant TFF expression as compared to benign immortalized prostate cell lines and PC cell lines not expressing trefoil factor. The most striking difference was observed for CpG sites located close to the AUG start codon overlapping several putative binding sites for cellular...

  14. [Work as a basic human need and health promoting factor].

    Bertazzi, P A

    2010-01-01

    that due to violent causes, but also mortality for all causes, cardiovascular diseases and cancer. A survey in the Turin area, Northern Italy, showed a twofold increase in mortality among unemployed men. Women were affected both by husbands' unemployment and by their own unemployment because of the previous increasing rate of female occupation. The worse the occupational condition (from "seeking work" to "temporary employment" down to "unemployed and no longer seeking work") the higher the mortality: in the latter category, where the most evident problem is marginalization and social exclusion, the increase in mortality was fourfold. The role of occupational health physicians is to recognize the possible negative effects of working conditions and at the same time promote a positive approach to work, even in difficult conditions. This makes prevention more effective and promotes health. To be aware of the meaning of work makes work itself more liveable and more productive. This is how health promotion contributes to the wellbeing of the individual and, at the same time, to the development of the economy and society at large.

  15. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  16. An activated unfolded protein response promotes retinal degeneration and triggers an inflammatory response in the mouse retina.

    Rana, T; Shinde, V M; Starr, C R; Kruglov, A A; Boitet, E R; Kotla, P; Zolotukhin, S; Gross, A K; Gorbatyuk, M S

    2014-12-18

    Recent studies on the endoplasmic reticulum stress have shown that the unfolded protein response (UPR) is involved in the pathogenesis of inherited retinal degeneration caused by mutant rhodopsin. However, the main question of whether UPR activation actually triggers retinal degeneration remains to be addressed. Thus, in this study, we created a mouse model for retinal degeneration caused by a persistently activated UPR to assess the physiological and morphological parameters associated with this disease state and to highlight a potential mechanism by which the UPR can promote retinal degeneration. We performed an intraocular injection in C57BL6 mice with a known unfolded protein response (UPR) inducer, tunicamycin (Tn) and examined animals by electroretinography (ERG), spectral domain optical coherence tomography (SD-OCT) and histological analyses. We detected a significant loss of photoreceptor function (over 60%) and retinal structure (35%) 30 days post treatment. Analysis of retinal protein extracts demonstrated a significant upregulation of inflammatory markers including interleukin-1β (IL-1β), IL-6, tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1) and IBA1. Similarly, we detected a strong inflammatory response in mice expressing either Ter349Glu or T17M rhodopsin (RHO). These mutant rhodopsin species induce severe retinal degeneration and T17M rhodopsin elicits UPR activation when expressed in mice. RNA and protein analysis revealed a significant upregulation of pro- and anti-inflammatory markers such as IL-1β, IL-6, p65 nuclear factor kappa B (NF-kB) and MCP-1, as well as activation of F4/80 and IBA1 microglial markers in both the retinas expressing mutant rhodopsins. We then assessed if the Tn-induced inflammatory marker IL-1β was capable of inducing retinal degeneration by injecting C57BL6 mice with a recombinant IL-1β. We observed ~19% reduction in ERG a-wave amplitudes and a 29% loss of photoreceptor cells compared with

  17. Educational community stakeholders’ perspectives about teachers’ responsibilities for mental health promotion in Maltese schools

    Askell-Williams, Helen; Cefai, Carmel; Skrzypiec, Grace; Wyra, Mirella

    2013-01-01

    The role of school teachers in promoting students’ mental health is receiving increasing international attention. However, before venturing into schools with new initiatives such as mental health promotion, it is essential to take into account local contextual affordances and constraints. One issue is whether teachers and other school community stakeholders believe that activities related to mental health promotion are within teachers’ realms of responsibility and capabilities. This paper rep...

  18. A Study of Predictive Factors Affecting Health: Promoting Behaviors of North Korean Adolescent Refugees

    Jin-Won Noh; Hyo-Young Yun; Hyunchun Park; Shi-Eun Yu

    2015-01-01

    Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p

  19. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  20. Impact factor and its role in academic promotion

    Richard Russell

    2009-07-01

    Full Text Available Richard Russell,1 Dave Singh21Wrexham Park Hospital, Berkshire, UK; 2Northwest Lung Research Centre, South Manchester University Hospitals Trust, Manchester, UKThis statement was adopted unanimously at the May 17, 2009 meeting of the International Respiratory Journal Editors Roundtable.In our collective experience as editors of international peer-reviewed journals, we propose that the impact factor calculated for individual journals should not be used as a basis for evaluating the significance of an individual scientist’s past performance or scientific potential. There are several reasons not to equate the impact factor of a journal in which the scientist publishes with the quality of the scientist’s research.

  1. Embedded promotions in online services: how goal-relevance ambiguity shapes response and affect.

    Brasel, S Adam

    2010-09-01

    Adding promotions to online services is increasingly commonplace, yet consumers may have difficulty determining whether service-embedded promotions are goal-relevant, due to the linear and transactional nature of online services. This contextual effect of goal-relevance ambiguity on promotions is explored across three studies. An exploratory study utilizing actual service websites and a broad range of consumers as participants showed promotional elements in online services generated considerable confusion, and instructions labeling promotions as optional did little to relieve goal-relevance ambiguity. A second study using student participants inserted promotions into an online airline ticket service, a shopping site, a local news blog, and a news headline aggregator, to explore how linear and transactional sites such as online services compared to more exploratory or informational online environments. Results showed that service-embedded promotions enjoyed initial compliance far beyond promotions in traditional websites but also generated increased confusion, frustration, and anger. A third study utilizing student participants explored how varying levels of online service experience created differing responses to promotions in services; novices were less able to judge promotional goal-relevance and experienced more confusion, whereas experienced searchers were more likely to respond with frustration and anger. Many participants complied with promotional offers at the time of the service transaction, but stated intentions to use the promotion postservice were very low. The overall results spotlight goal-relevance ambiguity as an important driver of consumer response to online promotions, and highlight the role website context can play in the processing of online promotional elements. PsycINFO Database Record (c) 2010 APA, all rights reserved.

  2. Promoting responsible research conduct in a developing world ...

    2013-06-22

    Jun 22, 2013 ... from 51 countries, it contains 4 principles and 14 responsibilities and has been .... Likewise, all institutions must have an 'assurance' registered with the ... requirements and standards, via process auditing. Whether these .... Office for Human Research Protections, Health and Human Services, US Federal.

  3. Autonomy promotion, responsiveness, and emotion regulation promote effective social support in times of stress.

    Cutrona, Carolyn E; Russell, Daniel W

    2017-02-01

    Adult attachment theory provides guidance for providing optimal social support in intimate relationships. According to attachment theory, facilitating autonomy (secure base support) sometimes is more important than providing nurturance (safe haven support). In addition, it is important that couples celebrate one another's triumphs and successes (another form of secure base support). A key construct that explains the development of attachment is responsiveness to the individual's needs. Support that is delivered in a responsive manner (i.e., that leads the individual to feel understood, validated, and cared for) is more likely to enhance the relationship and less likely to damage self-esteem than assistance that is not responsive. A responsive exchange is more likely if emotion dysregulation can be prevented. Attachment theory offers explanations for why people vary in their effectiveness at emotion regulation. Appropriate emotion regulation is more likely if disclosures of current difficulties can be made in a way that is not defensive or accusatory, an ability that varies as a function of attachment orientation. Attachment theory also offers guidance regarding the optimal forms of social support for specific individuals. All these insights from adult attachment theory can be integrated into interventions to help couples become more effective support providers. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Hypoxia-induced mitogenic factor enhances angiogenesis by promoting proliferation and migration of endothelial cells

    Tong Qiangsong; Zheng Liduan; Li Bo; Wang Danming; Huang Chuanshu; Matuschak, George M.; Li Dechun

    2006-01-01

    Our previous studies have indicated that hypoxia-induced mitogenic factor (HIMF) has angiogenic properties in an in vivo matrigel plug model and HIMF upregulates expression of vascular endothelial growth factor (VEGF) in mouse lungs and cultured lung epithelial cells. However, whether HIMF exerts angiogenic effects through modulating endothelial cell function remains unknown. In this study, mouse aortic rings cultured with recombinant HIMF protein resulted in enhanced vascular sprouting and increased endothelial cell spreading as confirmed by Dil-Ac-LDL uptake, von Willebrand factor and CD31 staining. In cultured mouse endothelial cell line SVEC 4-10, HIMF dose-dependently enhanced cell proliferation, in vitro migration and tubulogenesis, which was not attenuated by SU1498, a VEGFR2/Flk-1 receptor tyrosine kinase inhibitor. Moreover, HIMF stimulation resulted in phosphorylation of Akt, p38 and ERK1/2 kinases in SVEC 4-10 cells. Treatment of mouse aortic rings and SVEC 4-10 cells with LY294002, but not SB203580, PD098059 or U0126, abolished HIMF-induced vascular sprouting and angiogenic responses. In addition, transfection of a dominant-negative mutant of phosphatidylinositol 3-kinase (PI-3K), Δp85, blocked HIMF-induced phosphorylation of Akt, endothelial activation and tubulogenesis. These results indicate that HIMF enhances angiogenesis by promoting proliferation and migration of endothelial cells via activation of the PI-3K/Akt pathways

  5. Nerve growth factor promotes human hemopoietic colony growth and differentiation

    Matsuda, H.; Coughlin, M.D.; Bienenstock, J.; Denburg, J.A.

    1988-01-01

    Nerve growth factor (NGF) is a neurotropic polypeptide necessary for the survival and growth of some central neurons, as well as sensory afferent and sympathetic neurons. Much is now known of the structural and functional characteristics of NGF, whose gene has recently been clones. Since it is synthesized in largest amounts by the male mouse submandibular gland, its role exclusively in nerve growth is questionable. These experiments indicate that NGF causes a significant stimulation of granulocyte colonies grown from human peripheral blood in standard hemopoietic methylcellulose assays. Further, NGF appears to act in a relatively selective fashion to induce the differentiation of eosinophils and basophils/mast cells. Depletion experiments show that the NGF effect may be T-cell dependent and that NGF augments the colony-stimulating effect of supernatants from the leukemic T-cell (Mo) line. The hemopoietic activity of NGF is blocked by 125 I-polyclonal and monoclonal antibodies to NGF. The authors conclude that NGF may indirectly act as a local growth factor in tissues other than those of the nervous system by causing T cells to synthesize or secrete molecules with colony-stimulating activity. In view of the synthesis of NGF in tissue injury, the involvement of basophils/mast cells and eosinophils in allergic and other inflammatory processes, and the association of mast cells with fibrosis and tissue repair, they postulate that NGF plays an important biological role in a variety of repair processes

  6. A Study of Predictive Factors Affecting Health: Promoting Behaviors of North Korean Adolescent Refugees

    Jin-Won Noh

    2015-09-01

    Full Text Available Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p<0.05, having family members in South Korea (t=2.02, p<0.05, and subjective health status (t=4.96, p<0.01. Scores on health-responsible behaviors were higher with higher age (t=2.90, p<0.01 and for subjects without family or friends (t=2.43, p<0.05. Higher physical-activity behaviors were observed in males (t=3.32, p<0.01, in those with better subjective health status (t=3.46, p<0.05 and lower body mas index (t=3.48, p<0.05, and in smokers (t=3.17, p<0.01. Nutritional behaviors were higher in those who followed a religion (t=2.17, p<0.05. Spiritual growth behaviors were higher in those who followed a religion (t=4.21, p<0.001, had no family in South Korea (t=2.04, p<0.05, and had higher subjective health status (t=5.74, p<0.01. Scores on interpersonal relationships and stress-management behaviors were higher for those with higher subjective health status. A multiple regression analysis showed greater effects on health-promoting behaviors when subjective health status was better. Older people and non-smokers exhibited more health-responsible behaviors, while more physical-activity behaviors and spiritual growth activities were observed when subjective health status was better. Interpersonal relationship behaviors had positive effects on those with good subjective heath status and on non-smokers. Conclusions: Based on the results of the current study, an alternative was suggested for promoting health in North Korean adolescent refugees.

  7. The importance of 'social responsibility' in the promotion of health.

    Semplici, Stefano

    2011-11-01

    The publication of the Report of the International Bioethics Committee of Unesco on Social responsibility and health provides an opportunity to reshape the conceptual framework of the right to health care and its practical implications. The traditional distinctions between negative and positive, civil-political and economic-social, legal and moral rights are to be questioned and probably overcome if the goal is to pursue 'the highest attainable standard of health' as a fundamental human right, that should as such be guaranteed to every human being. What we are called upon to, is the commitment not to exclude now and forever anyone from having access to the 'excellence' of scientific and medical progress. Therefore, the addressees of this 'responsibility' cannot be just the governments and the states within the limits of their 'jurisdiction'. The challenge is to tackle at the same time the social and global determinants of health.

  8. Hypercalciuria, a promoting factor to urinary tract infection in children

    Gheissari Alaleh

    2009-01-01

    Full Text Available Aim: Urinary tract infection (UTI is one of the most common diseases of urogenital tract in children. Detecting predisposing factors for UTI takes an important place in managing patients with UTI. Recently, a few studies emphasized on idiopathic hypercalciuria (IH as a predisposing factor for UTI and dysfunctional voiding. Therefore, we carried out a survey to find out whether non-calculus IH is a contributing factor in children with the first attack of pyelonephritis. Materials and Methods: This is a case-control study carried out on 60 children aged 2-11 years admitted at St Al-Zahra hospital, Isfahan, Iran, with the first episode of upper UTI and 200 age- and gender-matched normal healthy children between September 2003 and February 2005. We used second fasting spot urine sample to measure calcium and creatinine. Two urine samples were obtained one week apart to increase the accuracy of measurement. All samples were collected after at least 6 weeks of completing the treatment course of pyelonephritis. Ultrasound examination and VCUG were performed in all patients before entering the survey as case group to rule out obstruction and VUR. Results: Mean age of case and control group were 4.86 ± 3.08 years and 4.22 ± 2.9 years, respectively. The mean calcium to creatinine ratio (Ca/Cr in case and control group were 0.308 ± 0.21 and 0.208 ± 0.12 mg/mg, respectively, P < 0.001. The difference between the mean values of these two groups was significant only in age group ≤6 years, P < 0.0001 and odds ratio was 2.1 (95% CI 1.03-7.8. After determining the mean values of urine Ca/Cr ration according to both age groups and gender, it was cleared that only significant difference was related to male < 6 years. Conclusion: The likelihood of hypercalciuria should be assessed especially in male children with UTI and without any urinary tract obstruction.

  9. Identifying work ability promoting factors for home care aides and assistant nurses

    Larsson Agneta

    2012-01-01

    Full Text Available Abstract Background In workplace health promotion, all potential resources needs to be taken into consideration, not only factors relating to the absence of injury and the physical health of the workers, but also psychological aspects. A dynamic balance between the resources of the individual employees and the demands of work is an important prerequisite. In the home care services, there is a noticeable trend towards increased psychosocial strain on employees at work. There are a high frequency of work-related musculoskeletal disorders and injuries, and a low prevalence of sustainable work ability. The aim of this research was to identify factors promoting work ability and self-efficacy in care aides and assistant nurses within home care services. Methods This study is based on cross-sectional data collected in a municipality in northern Sweden. Care aides (n = 58 and assistant nurses (n = 79 replied to a self-administered questionnaire (response rate 46%. Hierarchical multiple regression analyses were performed to assess the influence of several independent variables on self-efficacy (model 1 and work ability (model 2 for care aides and assistant nurses separately. Results Perceptions of personal safety, self-efficacy and musculoskeletal wellbeing contributed to work ability for assistant nurses (R2adj of 0.36, p 2adj of 0.29, p = 0.001. Self-efficacy was associated with the safety climate and the physical demands of the job in both professions (R2adj of 0.24, p = 0.003 for care aides, and also by sex and age for the assistant nurses (R2adj of 0.31, p Conclusions The intermediate factors contributed differently to work ability in the two professions. Self-efficacy, personal safety and musculoskeletal wellbeing were important for the assistant nurses, while the work ability of the care aides was associated with the safety climate, but also with the non-changeable factors age and seniority. All these factors are important to acknowledge in

  10. Promoting health in response to global tourism expansion in Cuba.

    Spiegel, J M; Gonzalez, M; Cabrera, G J; Catasus, S; Vidal, C; Yassi, A

    2008-03-01

    The ability of communities to respond to the pressures of globalization is an important determinant of community health. Tourism is a rapidly growing industry and there is an increasing concern about its health impact on local communities. Nonetheless, little research has been conducted to identify potential mitigating measures. We therefore took advantage of the 'natural experiment' provided by the expansion of tourism in Cuba, and conducted four focus groups and key informants interviews in each of two coastal communities. Participants expressed concerns about psycho-social impacts as well as occupational and environmental concerns, and both infectious and chronic diseases. A wide array of programs that had been developed to mitigate potential negative were described. Some of the programs were national in scope and others were locally developed. The programs particularly targeted youth as the most vulnerable population at risk of addictions and sexually transmitted infections. Occupational health concerns for workers in the tourism sector were also addressed, with many of the measures implemented protecting tourists as well. The health promotion and various other participatory action initiatives implemented showed a strong commitment to address the impacts of tourism and also contributed to building capacity in the two communities. Although longitudinal studies are needed to assess the sustainability of these programs and to evaluate their long-term impact in protecting health, other communities can learn from the initiatives taken.

  11. INVESTIGATION INTO CONSUMER RESPONSE TO SALES PROMOTIONAL ACTIVITIES: THE CASE OF UNILEVER GHANA LIMITED

    Martin Owusu Ansah

    2013-10-01

    Full Text Available The promotional activities have become more sophisticated and an increasing number of companies are using them to ensure their survival in today’s competitive market. Essentially, the study analyzed the nature of sales promotional activities of Unilever Ghana Limited; determined factors that influence the consumption of Unilever products in Kumasi and finally examined the relationship between sales promotions and the consumption of Unilever products. Primary and secondary data sources were used to select 220 consumers of Unilever in Kumasi and an in-depth interview with the Managers of the companies in Kumasi. Convenient sampling technique was employed in the study. Cross tabulation was done on the demographics whilst a regression model was used to establish the relationship between sales promotions and consumption of products. The findings revealed that Personalities in promotions, Prices in promotions, Messages in promotions and Promotional tools have strong influence on consumption but the Medium in promotion did not have influence on consumption during promotions. It was therefore recommended for celebrities to be used in the company’s promotions.

  12. A secreted Salmonella protein induces a proinflammatory response in epithelial cells, which promotes neutrophil migration.

    Lee, C A; Silva, M; Siber, A M; Kelly, A J; Galyov, E; McCormick, B A

    2000-10-24

    In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal epithelial cells, bacterial internalization is not required for the signaling mechanisms that induce PMN movement. Here, we sought to determine which S. typhimurium factors and intestinal epithelial signaling pathways elicit the production of PMN chemoattractants by enterocytes. Our results suggest that S. typhimurium activates a protein kinase C-dependent signal transduction pathway that orchestrates transepithelial PMN movement. We show that the type III effector protein, SipA, is not only necessary but is sufficient to induce this proinflammatory response in epithelial cells. Our results force us to reconsider the long-held view that Salmonella effector proteins must be directly delivered into host cells from bacterial cells.

  13. The Associations Among Individual Factors, eHealth Literacy, and Health-Promoting Lifestyles Among College Students.

    Yang, Shu-Ching; Luo, Yi-Fang; Chiang, Chia-Hsun

    2017-01-10

    eHealth literacy is gaining importance for maintaining and promoting health. Studies have found that individuals with high eHealth literacy are more likely to adopt healthy eating, exercise, and sleep behaviors. In addition, previous studies have shown that various individual factors (eg, frequency of seeking information on health issues, degree of health concern, frequency of eating organic food, and students' college major) are associated with eHealth literacy and health-promoting lifestyles. Nevertheless, few studies have explored the associations among individual factors, eHealth literacy, and health-promoting lifestyles among college students. Moreover, there is a lack of studies that focus on eHealth literacy as a predictor of psychological health behaviors. To examine the associations among various individual factors, eHealth literacy, and health-promoting lifestyles. The eHealth Literacy Scale is a 12-item instrument designed to measure college students' functional, interactive, and critical eHealth literacy. The Health-promoting Lifestyle Scale is a 23-item instrument developed to measure college students' self-actualization, health responsibility, interpersonal support, exercise, nutrition, and stress management. A nationally representative sample of 556 valid college students in Taiwan was surveyed. A questionnaire was administered to gather the respondents' background information, including the frequency of seeking information on health issues, the frequency of eating organic food, the degree of health concern, and the students' major. We then conducted a multiple regression analysis to examine the associations among individual factors, eHealth literacy, and health-promoting lifestyles. The study found that factors such as medical majors (t 550 =2.47-7.55, PeHealth literacy. Moreover, critical eHealth literacy positively predicted all 6 health-promoting lifestyle dimensions (t 547 =2.66-7.28, PeHealth literacy, and had a positive health-promoting

  14. Integrated response toward HIV: a health promotion case study from China.

    Jiang, Zhen; Wang, Debin; Yang, Sen; Duan, Mingyue; Bu, Pengbin; Green, Andrew; Zhang, Xuejun

    2011-06-01

    Integrated HIV response refers to a formalized, collaborative process among organizations in communities with HIV at-risk populations. It is a both comprehensive and flexible scheme, which may include community-based environment promotion, skill coalition, fund linkage, human resource collaboration and service system jointly for both HIV prevention and control. It enables decisions and actions responds over time. In 1997, the Chinese government developed a 10-year HIV project supported by World Bank Loan (H9-HIV/AIDS/STIs). It was the first integrated STI/HIV intervention project in China and provides a unique opportunity to explore the long-term comprehensive STI/HIV intervention in a low-middle income country setting. Significant outcomes were identified as development and promotion of the national strategic plan and its ongoing implementation; positive knowledge, behavioral and STI/HIV prevalence rate change; and valuable experiences for managing integrated HIV/STI intervention projects. Essential factors for the success of the project and the key tasks for the next step were identified and included well-designed intervention in rural and low economic regions, unified program evaluation framework and real-time information collection and assessment.

  15. Factors Promoting Development of Fibrosis in Crohn’s Disease

    Gerhard Rogler

    2017-07-01

    Full Text Available The concepts on the pathophysiology of intestinal fibrosis in Crohn’s disease (CD have changed in recent years. Some years ago fibrosis was regarded to be a consequence of long-standing inflammation with subsequent destruction of the gut wall matrix followed by scar formation and collagen deposition. Fibrosis in CD patients appeared to be an irreversible process that could hardly be influenced. Therefore, the main target in CD therapy was to control inflammation to avoid fibrosis development. Many of these assumptions seem to be only partially true. Inflammation may be a necessary prerequisite for the initiation of fibrosis. However, when the pathophysiologic processes that lead to fibrosis in CD patients have been initiated fibrosis development may be independent of inflammation and may continue even when inflammation is under good medical control. Fibrosis in CD also may be reversible. After strictureplasty local collagen deposits decrease or even disappear. With new animal models for intestinal fibrosis on the horizon, we need to spend more efforts on understanding the factors influencing fibrosis in CD patients to finally find specific therapies. In this context, it will be as important to find markers and quantitative imaging tools to have reliable endpoints for clinical trials in fibrosing CD.

  16. Analysis on the restriction factors of the green building scale promotion based on DEMATEL

    Wenxia, Hong; Zhenyao, Jiang; Zhao, Yang

    2017-03-01

    In order to promote the large-scale development of the green building in our country, DEMATEL method was used to classify influence factors of green building development into three parts, including green building market, green technology and macro economy. Through the DEMATEL model, the interaction mechanism of each part was analyzed. The mutual influence degree of each barrier factor that affects the green building promotion was quantitatively analysed and key factors for the development of green building in China were also finally determined. In addition, some implementation strategies of promoting green building scale development in our country were put forward. This research will show important reference value and practical value for making policies of the green building promotion.

  17. Extending the bidding format to promote demand response

    Liu, Yanchao; Holzer, Jesse T.; Ferris, Michael C.

    2015-01-01

    We propose an extended bidding structure to allow more realistic demand characteristics and behaviors to be expressed via flexible bids. In today's ISO-run energy markets, demand bid formats are all separable over time. However, a significant and growing segment of demand can be shifted across time and therefore has no way to bid its true valuation of consumption. We propose additional bid types that allow deferrable, adjustable and storage-type loads to better express their value, and thus elicit demand response in the most natural way – via direct participation in the market. We show that the additional bid types are easily incorporated into the existing market with no technological barrier and that they preserve the market's efficiency and incentive-compatibility properties. Using real market data, we give a numerical demonstration that the extended bid format could substantially increase social welfare, and also present additional insight on storage expansion scenarios. - Highlights: • Three new bid types are proposed to enrich demand-side participation. • Time value of electricity demand can be clearly conveyed to central dispatcher. • The extended format preserves market efficiency and incentive compatibility. • Energy storage is most effective to neutralize price volatility, with a limitation.

  18. Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

    Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

    2016-01-01

    Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

  19. Modifiable risk factors promoting neurodegeneration is associated with two novel brain degradation markers measured in serum

    Neergaard, Jesper; Møller, Katrine Dragsbæk; Christiansen, Claus

    2017-01-01

    truncated tau fragments (Tau-A and Tau-C) in serum. Platelets, albumin and several modifiable risk factors, including Body Mass Index, high density lipoprotein and White Blood Cell count were associated with the serum level of tau fragments. The factors associated with tau in serum may promote...

  20. Cumulative Effects of Mothers' Risk and Promotive Factors on Daughters' Disruptive Behavior

    van der Molen, Elsa; Hipwell, Alison E.; Vermeiren, Robert; Loeber, Rolf

    2012-01-01

    Little is known about the ways in which the accumulation of maternal factors increases or reduces risk for girls' disruptive behavior during preadolescence. In the current study, maternal risk and promotive factors and the severity of girls' disruptive behavior were assessed annually among girls' ages 7-12 in an urban community sample (N = 2043).…

  1. Factors Promoting Vocational Students' Learning at Work: Study on Student Experiences

    Virtanen, Anne; Tynjälä, Päivi; Eteläpelto, Anneli

    2014-01-01

    In order to promote effective pedagogical practices for students' work-based learning, we need to understand better how students' learning at work can be supported. This paper examines the factors explaining students' workplace learning (WPL) outcomes, addressing three aspects: (1) student-related individual factors, (2) social and…

  2. Assignment of sigma factors of RNA polymerase to promoters in Corynebacterium glutamicum

    Dostálová, Hana; Holátko, Jiří; Busche, T.; Rucká, Lenka; Rapoport, Andrey; Halada, Petr; Nešvera, Jan; Kalinowski, J.; Pátek, Miroslav

    2017-01-01

    Roč. 7, JUN 23 (2017), s. 1-13, č. článku 133. ISSN 2191-0855 R&D Projects: GA ČR(CZ) GA17-06991S Institutional support: RVO:61388971 Keywords : Corynebacterium glutamicum * Promoter * Sigma factor Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.825, year: 2016

  3. The role of tobacco promoting and restraining factors in smoking intentions among Ghanaian youth.

    Doku, David; Raisamo, Susanna; Wiium, Nora

    2012-08-15

    In Western countries, the relationship between smoking intentions and smoking behaviour is well established. However, youth smoking intentions and associated factors in developing countries are largely unexplored and the former may occur for a variety of reasons. We investigated youth smoking intentions in Ghana with regard to several tobacco promoting and restraining factors, including environmental, familial, attitudinal and knowledge measures. A school-based survey of a representative sample of 12-20-year-olds was conducted in 2008 in Ghana (N = 1338, response rate 89.7%). In a bivariate model, both among ever and never smokers, allowing smoking on school compound, exposure to tobacco advertisement and parental smoking were associated with future intention to smoke. Compared to those who agreed that smoking is harmful to health, smoking is difficult to quit and that tobacco should not be sold to minors, those who disagreed or were not sure were more likely to have an intention to smoke. In the multivariate analyses, these associations persisted, except that the attitude measures concerning the difficulty of quitting smoking once started and tobacco sales ban were no longer significantly associated with smoking intentions. These findings underscore the importance of school smoking policy, parental smoking behaviour and knowledge of the harmful effects of tobacco use in determining Ghanaian youths' future smoking intentions. Because current high percentages of smoking intentions may turn into high smoking rates in the future, the introduction of effective tobacco control measures at all levels of society to prevent youth smoking in Ghana may be essential.

  4. A secreted Salmonella protein induces a proinflammatory response in epithelial cells, which promotes neutrophil migration

    Lee, Catherine A.; Silva, Milton; Siber, Andrew M.; Kelly, Aaron J.; Galyov, Edouard; McCormick, Beth A.

    2000-01-01

    In response to Salmonella typhimurium, the intestinal epithelium generates an intense inflammatory response consisting largely of polymorphonuclear leukocytes (neutrophils, PMN) migrating toward and ultimately across the epithelial monolayer into the intestinal lumen. It has been shown that bacterial-epithelial cell interactions elicit the production of inflammatory regulators that promote transepithelial PMN migration. Although S. typhimurium can enter intestinal ...

  5. Plasma rich in growth factors promotes dermal fibroblast proliferation, migration and biosynthetic activity.

    Anitua, E; Pino, A; Orive, G

    2016-11-02

    The use of plasma rich in growth factors (PRGF) has gained importance in many medical fields due to its regenerative potential. The aim of this study is to evaluate the effects of PRGF on primary skin fibroblasts assessing cell proliferation, migration and secretion of growth factors. The age of the patients from who PRGF was prepared was also studied to determine whether it influenced the outcomes. Human dermal fibroblasts were isolated from three healthy volunteers. Using PRGF-Endoret technology, PRGF was prepared from two groups of different ages (18-35 years and 50+ years). The effects of increasing concentration of PRGF (5%, 10% and 20%) on cell proliferation and migration was evaluated. Biosynthetic behaviour of cells was also analysed measuring vascular endothelial growth factor (VEGF), transforming growth factor b1 (TGFb1) and pro-collagen type I secreted levels with or without PRGF treatment. Mean platelet enrichment reached 2.4X and 2X in 18-35 and 50+ groups respectively. A dose-dependent response was observed in proliferation assays achieving the highest levels with 20% PRGF. Migration was also promoted in cells but not in a dose-dependent manner. Cell proliferation and migration outcomes obtained with PRGF (from both groups) were significantly higher compared to non-stimulated groups (pPRGF, however, with the exception of VEGF, no statistical significances were observed between the different age groups. Results from this study concluded that PRGF is safe and effective in stimulating skin regeneration by enhancing proliferation, migration and expression of pivotal bioactive molecules involved in wound healing and haemostasis.

  6. Free fatty acid palmitate activates unfolded protein response pathway and promotes apoptosis in meniscus cells.

    Haywood, J; Yammani, R R

    2016-05-01

    Obesity is the major risk factor for the development of osteoarthritis (OA); however, the mechanisms involved are not clearly understood. Obesity is associated with increased production of adipokine and elevated levels of circulating free fatty acids (FFA). A recent study has shown that saturated fatty acid palmitate induced pro-inflammatory and pro-apoptotic pathways in chondrocytes. Meniscus has been shown to be more susceptible than articular cartilage to catabolic stimuli. Thus, the aim of this study was to determine the effect of FFA (specifically, palmitate) on meniscus cells. Cultured primary porcine meniscus cells were stimulated with 500 μM FFA (palmitate and oleate) for 24 h to induce endoplasmic reticulum (ER) stress. After treatment, cell lysates were prepared and immunoblotted for C/EBP homologous protein (CHOP). To determine the activation of unfolded protein response (UPR) signaling, cell lysates were probed for cJun n-terminal kinase (JNK), cleaved caspase -3 and Xbp-1s, an alternative mRNA splicing product generated due to Ire1α activation. Treatment of isolated primary meniscus cells with palmitate but not oleate induced expression of CHOP and Xbp-1s. Palmitate treatment of meniscus cells also activated JNK and increased expression of caspase-3, thus promoting apoptosis in meniscus cells. Palmitate induces ER stress and promotes apoptotic pathways in meniscus cells. This is the first study to establish ER stress as a key metabolic mechanistic link between obesity and OA, in addition to (or operating with) biomechanical factors. Copyright © 2015 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  7. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  8. AN APPRAISAL OF FACTORS RESPONSIBLE FOR ERRORS IN ...

    Osondu

    2013-01-11

    Jan 11, 2013 ... management and clients are the main factors responsible for them. However, the collective .... planning/programming, stress, repetitive tasks. (Shelton, 1999) ... concurrent working control, communications) and global factors ...

  9. Mobilisation, politics, investment and constant adaptation: lessons from the Australian health-promotion response to HIV.

    Brown, Graham; O'Donnell, Daryl; Crooks, Levinia; Lake, Rob

    2014-04-01

    The Australian response to HIV oversaw one of the most rapid and sustained changes in community behaviour in Australia's health-promotion history. The combined action of communities of gay men, sex workers, people who inject drugs, people living with HIV and clinicians working in partnership with government, public health and research has been recognised for many years as highly successful in minimising the HIV epidemic. This article will show how the Australian HIV partnership response moved from a crisis response to a constant and continuously adapting response, with challenges in sustaining the partnership. Drawing on key themes, lessons for broader health promotion are identified. The Australian HIV response has shown that a partnership that is engaged, politically active, adaptive and resourced to work across multiple social, structural, behavioural and health-service levels can reduce the transmission and impact of HIV. The experience of the response to HIV, including its successes and failures, has lessons applicable across health promotion. This includes the need to harness community mobilisation and action; sustain participation, investment and leadership across the partnership; commit to social, political and structural approaches; and build and use evidence from multiple sources to continuously adapt and evolve. So what? The Australian HIV response was one of the first health issues to have the Ottawa Charter embedded from the beginning, and has many lessons to offer broader health promotion and common challenges. As a profession and a movement, health promotion needs to engage with the interactions and synergies across the promotion of health, learn from our evidence, and resist the siloing of our responses.

  10. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather

    2018-01-01

    regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....

  11. Investigation into promotion/disincentive factors and proposal of support policy in implementation of risk assessment

    Nagasaka, Akihiko; Tomizawa, Norio

    2012-01-01

    The implementation of risk assessment (RA) has been mandated effort in business place of the type of industry that must elect a safe hygiene manager by the enforcement of the revised Occupational Safety and Health Act of April, 2006. However, it is guessed that some problems are still left unfinished in many business places to promote RA effectively. In this study, at first the authors investigated promotion factors and disincentive factors when implementing RA by literature survey. As the result, factors to show as follows were classified in some categories such as participation of the top, the organization which promotes RA, the use of the existing safety activity, matching of RA technique and work, etc. unlike conventional safety activity to learn from a disaster, infiltrating significance of RA to prevent a risk enough, letting a worker engaged in work participate in RA. Next, the authors performed the visit investigation for 8 business places and extracted a new promotion factors to show as follows. incorporating RA in usual duties, utilizing results of RA effectively. In reference to above promotion factors, the authors examined a policy to implement RA smoothly. (author)

  12. Motivating factors for small and midsized businesses to implement worksite health promotion.

    Witt, Laurel B; Olsen, Delane; Ablah, Elizabeth

    2013-11-01

    This study explores the decision-making process, including motivating factors, for small and midsized businesses in the Midwest to implement health promotion initiatives. This a replication of a study conducted in the Pacific Northwest. Semistructured qualitative interviews were conducted with key informants from 12 Midwestern metropolitan employers with fewer than 1,000 employees. Informants were interviewed regarding their companies' policies and practices around workplace health promotion programming adoption and valuation. Workplace health promotion adoption at these small and midsized businesses was motivated by three goals: to lower health care costs, to address human relations objectives, and to improve productivity. Low upfront cost was the most frequently considered criterion in choosing which workplace health promotion program to offer. Barriers to implementation included lack of employee buy-in, prohibitive costs, and personnel or time constraints. Aids to implementation included employee buy-in and affordability. This study suggests that cost considerations predominate in the workplace health promotion decision-making process at small to midsized businesses. Furthermore, employee buy-in cannot be underestimated as a factor in successful program implementation or longevity. Employees, along with executives and human resources management, must be appropriately targeted by health promotion practitioners in workplace health promotion efforts.

  13. Regulation of cardiac microRNAs by serum response factor

    Wei Jeanne Y

    2011-02-01

    Full Text Available Abstract Serum response factor (SRF regulates certain microRNAs that play a role in cardiac and skeletal muscle development. However, the role of SRF in the regulation of microRNA expression and microRNA biogenesis in cardiac hypertrophy has not been well established. In this report, we employed two distinct transgenic mouse models to study the impact of SRF on cardiac microRNA expression and microRNA biogenesis. Cardiac-specific overexpression of SRF (SRF-Tg led to altered expression of a number of microRNAs. Interestingly, downregulation of miR-1, miR-133a and upregulation of miR-21 occurred by 7 days of age in these mice, long before the onset of cardiac hypertrophy, suggesting that SRF overexpression impacted the expression of microRNAs which contribute to cardiac hypertrophy. Reducing cardiac SRF level using the antisense-SRF transgenic approach (Anti-SRF-Tg resulted in the expression of miR-1, miR-133a and miR-21 in the opposite direction. Furthermore, we observed that SRF regulates microRNA biogenesis, specifically the transcription of pri-microRNA, thereby affecting the mature microRNA level. The mir-21 promoter sequence is conserved among mouse, rat and human; one SRF binding site was found to be in the mir-21 proximal promoter region of all three species. The mir-21 gene is regulated by SRF and its cofactors, including myocardin and p49/Strap. Our study demonstrates that the downregulation of miR-1, miR-133a, and upregulation of miR-21 can be reversed by one single upstream regulator, SRF. These results may help to develop novel therapeutic interventions targeting microRNA biogenesis.

  14. The mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway.

    Angela C Poole

    2010-04-01

    Full Text Available Loss-of-function mutations in the PINK1 or parkin genes result in recessive heritable forms of parkinsonism. Genetic studies of Drosophila orthologs of PINK1 and parkin indicate that PINK1, a mitochondrially targeted serine/threonine kinase, acts upstream of Parkin, a cytosolic ubiquitin-protein ligase, to promote mitochondrial fragmentation, although the molecular mechanisms by which the PINK1/Parkin pathway promotes mitochondrial fragmentation are unknown. We tested the hypothesis that PINK1 and Parkin promote mitochondrial fragmentation by targeting core components of the mitochondrial morphogenesis machinery for ubiquitination. We report that the steady-state abundance of the mitochondrial fusion-promoting factor Mitofusin (dMfn is inversely correlated with the activity of PINK1 and Parkin in Drosophila. We further report that dMfn is ubiquitinated in a PINK1- and Parkin-dependent fashion and that dMfn co-immunoprecipitates with Parkin. By contrast, perturbations of PINK1 or Parkin did not influence the steady-state abundance of the mitochondrial fission-promoting factor Drp1 or the mitochondrial fusion-promoting factor Opa1, or the subcellular distribution of Drp1. Our findings suggest that dMfn is a direct substrate of the PINK1/Parkin pathway and that the mitochondrial morphological alterations and tissue degeneration phenotypes that derive from mutations in PINK1 and parkin result at least in part from reduced ubiquitin-mediated turnover of dMfn.

  15. Consumer responses to promotional tools in hotels: A case study of Chinese consumers

    Ma, Jenny Wei-Chen; Mohsen, Marwa Gad

    2016-01-01

    The rapid growth of the Chinese tourism has stimulated competition within tourism-related industries, such as the hospitality industry. The purpose of this study is to examine the Chinese consumer reaction to different promotional tools used by hotels in China and, thus, to provide a deeper understanding for marketers of how to use sales promotion effectively to generate appropriate consumer responses. An experimental survey was administered yielding a total sample of 319 Chinese customers, w...

  16. Factors Responsible for Domestic Water Contamination | Idika ...

    This study was therefore designed to identify the factors that influenced domestic water contamination in our rural communities and recommend some intervention measures that can reduce this high morbidity and mortality due to diarrhoeal diseases in Nigeria. Water samples from the water sources serving six rural ...

  17. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  18. Transforming the culture of surgical education: promoting teacher identity through human factors training.

    Cahan, Mitchell A; Starr, Susan; Larkin, Anne C; Litwin, Demetrius E M; Sullivan, Kate M; Quirk, Mark E

    2011-07-01

    Promoting a culture of teaching may encourage students to choose a surgical career. Teaching in a human factors (HF) curriculum, the nontechnical skills of surgery, is associated with surgeons' stronger identity as teachers and with clinical students' improved perception of surgery and satisfaction with the clerkship experience. To describe the effects of an HF curriculum on teaching culture in surgery. Surgeons and educators developed an HF curriculum including communication, teamwork, and work-life balance. Teacher identity, student interest in a surgical career, student perception of the HF curriculum, and teaching awards. Ninety-two of 123 faculty and residents in a single program (75% of total) completed a survey on teacher identity. Fifteen of the participants were teachers of HF. Teachers of HF scored higher than control participants on the total score for teacher identity (P < .001) and for subcategories of global teacher identity (P = .001), intrinsic satisfaction (P = .001), skills and knowledge (P = .006), belonging to a group of teachers (P < .001), feeling a responsibility to teach (P = .008), receiving rewards (P =.01), and HF (P = .02). Third-year clerks indicated that they were more likely to select surgery as their career after the clerkship and rated the curriculum higher when it was taught by surgeons than when taught by educators. Of the teaching awards presented to surgeons during HF years, 100% of those awarded to attending physicians and 80% of those awarded to residents went to teachers of HF. Curricular focus on HF can strengthen teacher identity, improve teacher evaluations, and promote surgery as a career choice.

  19. Factors that promote or hinder young disabled people in work participation: a systematic review.

    Achterberg, T J; Wind, H; de Boer, A G E M; Frings-Dresen, M H W

    2009-06-01

    The aim of this systematic review was to study factors which promote or hinder young disabled people entering the labor market. We systematically searched PubMed (by means of MESH and text words), EMBASE, PsycINFO, Web of Science and CINAHL for studies regarding (1) disabled patients diagnosed before the age of 18 years and (2) factors of work participation. Out of 1,268 retrieved studies and 28 extended studies from references and four from experts, ten articles were included. Promoting factors are male gender, high educational level, age at survey, low depression scores, high dispositional optimism and high psychosocial functioning. Female and low educational level gives high odds of unemployment just like low IQ, inpatient treatment during follow up, epilepsy, motor impairment, wheelchair dependency, functional limitations, co-morbidity, physical disability and chronic health conditions combined with mental retardation. High dose cranial radiotherapy, type of cancer, and age of diagnosis also interfered with employment. Of the promoting factors, education appeared to be important, and several physical obstructions were found to be hindering factors. The last mentioned factors can be influenced in contrast to for instance age and gender. However, to optimize work participation of this group of young disabled it is important to know the promoting or hindering influence for employment.

  20. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  1. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-01-01

    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  2. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-03-18

    The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Support for the Development of Technological Innovations: Promoting Responsible Social Uses.

    Legault, Georges A; Verchère, Céline; Patenaude, Johane

    2018-04-01

    How can technological development, economic development, and the claims from society be reconciled? How should responsible innovation be promoted? The "responsible social uses" approach proposed here was devised with these considerations in view. In this article, a support procedure for promoting responsible social uses (RSU) is set out and presented. First, the context in which this procedure emerged, which incorporates features of both the user-experience approach and that of ethical acceptability in technological development, is specified. Next, the characteristic features of the procedure are presented, that is, its purpose, fundamental orientation, and component parts as experimented by partners. Third, the RSU approach is compared with other support approaches and considered in term of how each approach assumes responsible innovation. Briefly, the RSU procedure is a way of addressing the issue of responsible innovation through an effective integration of social concerns.

  4. Factors influencing societal response of nanotechnology : an expert stakeholder analysis

    Gupta, N.; Fischer, A.R.H.; Lans, van der, I.A.; Frewer, L.J.

    2012-01-01

    Nanotechnology can be described as an emerging technology and, as has been the case with other emerging technologies such as genetic modification, different socio-psychological factors will potentially influence societal responses to its development and application. These factors will play an important role in how nanotechnology is developed and commercialised. This article aims to identify expert opinion on factors influencing societal response to applications of nanotechnology. Structured i...

  5. Factors influencing societal response of nanotechnology: an expert stakeholder analysis

    Gupta, Nidhi; Fischer, Arnout R. H.; van der Lans, Ivo A.; Frewer, Lynn J.

    2012-01-01

    Nanotechnology can be described as an emerging technology and, as has been the case with other emerging technologies such as genetic modification, different socio-psychological factors will potentially influence societal responses to its development and application. These factors will play an important role in how nanotechnology is developed and commercialised. This article aims to identify expert opinion on factors influencing societal response to applications of nanotechnology. Structured i...

  6. [Factors related to awareness on tobacco advertisement and promotion among adults in six cities in China].

    Yang, Yan; Wu, Xi; Li, Qiang; Jiao, Shu-fang; Li, Xun; Li, Xin-jian; Zhu, Guo-ping; Du, Lin; Zhao, Jian-hua; Jiang, Yuan; Feng, Guo-ze

    2009-04-01

    To know the situation of tobacco advertisement, promotions and related factors in six cities in China. 4815 adults (above 18 years), selected form Beijing, Shanghai, Shenyang, Changsha, Guangzhou and Yinchuan through probability proportionate sampling and simple random sampling, were investigated through questionnaires. The most commonly reported channels that smokers noticed tobacco advertisements were billboards (35.6%) and television (34.4%). The most commonly reported tobacco promotional activities that were noticed by smokers were free gifts when buying cigarettes (23.1%) and free samples of cigarettes (13.9%). Smokers in Changsha were more likely to report noticing tobacco advertisement on billboards (chi2 = 562.474, P advertisement and promotion. It was universal to see tobacco advertisement and promotions in cities in China but the laws and regulations about tobacco-control were not uniformly executed in different cities. It is necessary to perfect and uniform related laws and regulations.

  7. Features of cryptic promoters and their varied reliance on bromodomain-containing factors.

    Samantha G Pattenden

    Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.

  8. Transcriptional intermediary factor 1γ binds to the anaphase-promoting complex/cyclosome and promotes mitosis

    Sedgwick, G.G.; Townsend, K.; Martin, A.

    2013-01-01

    The anaphase-promoting complex/cyclosome (APC/C) is an ubiquitin ligase that functions during mitosis. Here we identify the transcriptional regulator, transcriptional intermediary factor 1γ, TIF1γ, as an APC/C-interacting protein that regulates APC/C function. TIF1γ is not a substrate for APC....../C-dependent ubiquitylation but instead, associates specifically with the APC/C holoenzyme and Cdc20 to affect APC/C activity and progression through mitosis. RNA interference studies indicate that TIF1γ knockdown results in a specific reduction in APC/C ubiquitin ligase activity, the stabilization of APC/C substrates......, and an increase in the time taken for cells to progress through mitosis from nuclear envelope breakdown to anaphase. TIF1γ knockdown cells are also characterized by the inappropriate presence of cyclin A at metaphase, and an increase in the number of cells that fail to undergo metaphase-to-anaphase transition...

  9. The Toll-like receptor 5 ligand flagellin promotes asthma by priming allergic responses to indoor allergens.

    Wilson, Rhonda H; Maruoka, Shuichiro; Whitehead, Gregory S; Foley, Julie F; Flake, Gordon P; Sever, Michelle L; Zeldin, Darryl C; Kraft, Monica; Garantziotis, Stavros; Nakano, Hideki; Cook, Donald N

    2012-11-01

    Allergic asthma is a complex disease characterized by eosinophilic pulmonary inflammation, mucus production and reversible airway obstruction. Exposure to indoor allergens is a risk factor for asthma, but this disease is also associated with high household levels of total and particularly Gram-negative bacteria. The ability of bacterial products to act as adjuvants suggests they might promote asthma by priming allergic sensitization to inhaled allergens. In support of this idea, house dust extracts (HDEs) can activate antigen-presenting dendritic cells (DCs) in vitro and promote allergic sensitization to inhaled innocuous proteins in vivo. It is unknown which microbial products provide most of the adjuvant activity in HDEs. A screen for adjuvant activity of microbial products revealed that the bacterial protein flagellin (FLA) stimulated strong allergic airway responses to an innocuous inhaled protein, ovalbumin (OVA). Moreover, Toll-like receptor 5 (TLR5), the mammalian receptor for FLA, was required for priming strong allergic responses to natural indoor allergens present in HDEs. In addition, individuals with asthma have higher serum levels of FLA-specific antibodies as compared to nonasthmatic individuals. Together, these findings suggest that household FLA promotes the development of allergic asthma by TLR5-dependent priming of allergic responses to indoor allergens.

  10. Relational factors in psychopathological responses to childbirth.

    Cigoli, Vittorio; Gilli, Gabriella; Saita, Emanuela

    2006-06-01

    Childbirth can represent for women the time of greatest vulnerability experience, often associated with being out of control, loneliness or sadness. One hundred and sixty women who had 'normal' births were assessed within 48 hours on potential predictive measures and at 3-6 months post-partum for PTSD. Symptoms of depression, anxiety, perceived and desired support by family members, friends, medical personnel were also assessed. t-Test and chi-square were used to analyze, differences between 'risk group' and 'non-risk group'. Few women (1.25%) showed questionnaire responses suggesting clinically significant levels on PTSD; other women (28.75%) reported clinically significant symptoms for at least one subscale. Being at the first delivery experience, together with perceptions of low levels of support from family members and medical personnel, were found to be related to experience of post-traumatic stress symptoms. Anxiety for the child and previous depression are also related to such symptoms. Moreover, anxiety and depression are related to a difficult recognition of the support received, as well as to the desire for more support, in the care of the newborn, from medical professionals.

  11. The Belief that Alcohol Use Is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents

    Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.

    2011-01-01

    This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40…

  12. Factors that Promote or Hinder Young Disabled People in Work Participation: A Systematic Review

    Achterberg, T. J.; Wind, H.; de Boer, A. G. E. M.; Frings-Dresen, M. H. W.

    2009-01-01

    Introduction The aim of this systematic review was to study factors which promote or hinder young disabled people entering the labor market. Methods We systematically searched PubMed (by means of MESH and text words), EMBASE, PsycINFO, Web of Science and CINAHL for studies regarding (1) disabled

  13. Factors promoting staying at work in people with chronic nonspecific musculoskeletal pain : a systematic review

    de Vries, H.J.; Reneman, M.F.; Groothoff, J.W.; Geertzen, J.H.B.; Brouwer, S.

    2012-01-01

    Purpose: To identify determinants for staying at work (SAW) in workers with chronic musculoskeletal pain (CMP). Method: A systematic review of factors that promote SAW in workers with CMP. We searched the databases of PubMed, EMBASE, PsycInfo, CINAHL and the Cochrane Library. We included studies

  14. Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines

    Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan

    2006-01-01

    ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown

  15. Community Violence Exposure and Adolescent Delinquency: Examining a Spectrum of Promotive Factors

    Chen, Pan; Voisin, Dexter R.; Jacobson, Kristen C.

    2016-01-01

    This study examined whether promotive factors (future expectations, family warmth, school attachment, and neighborhood cohesion) moderated relationships between community violence exposure and youth delinquency. Analyses were conducted using N = 2,980 sixth to eighth graders (M[subscript age] = 12.48; 41.1% males) from a racially, ethnically, and…

  16. Analysis of the parsley chalcone-synthase promoter in response to different light qualities

    Merkle, T.; Frohnmeyer, H.; Schulze-Lefert, P.; Dangl, J.L.; Hahlbrock, K.; Schaefer, E.

    1994-01-01

    We examined the chalcone synthase (chs) promoter from parsley [Petroselinum crispum Miller (A.W. Hill)] for the existence of separate promoter elements responsible for transcriptional activation of the chs gene by UV-B and by blue light. A combination of in-vivo foot-printing in parsley cells and light-induced transient expression assays with different chs promoter constructs in parsley protoplasts was used. Dark controls and blue-light-irradiated cells gave identical in-vivo footprints on the chs promoter. Pre-irradiation with blue light prior to a UV-B-light pulse is known to cause a shift in the timing of UV-B-light-induced increase in chs transcription rates. This shift was also manifested on the DNA template, since UV-B-light-induced in-vivo footprints in cells pretreated with blue light were detected earlier than in cells which had been irradiated with a UV-B-light pulse only. Although there was a clear shift in the timing of footprint appearance, the patterns of foot printing did not change. Light-induced transient-expression assays revealed that the shortest tested chs promoter which retained any light responsiveness, was sufficient for mediating both induction by UV light and the blue-light-mediated kinetic shift. These findings argue against a spatial separation of UV-B- and blue-light-responsive elements on the chs promoter. We interpret these data by postulating that the signal transduction pathways originating from the excitation of UV-B- and blue-light receptors merge at the chs promoter, or somewhere between light perception and protein-DNA interaction. (author)

  17. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  18. The "Balance Intervention" for Promoting Caloric Compensatory Behaviours in Response to Overeating: A Formative Evaluation

    Wammes, Birgitte; Breedveld, Boudewijn; Kremers, Stef; Brug, Johannes

    2006-01-01

    To help people prevent weight gain, the Netherlands Nutrition Centre initiated the "balance intervention", which promotes moderation of food intake and/or increased physical activity in response to occasions of overeating. The aim of this study was to determine whether intervention materials were appreciated, encouraged information…

  19. Course Development in Socially Responsible Advertising and Promotion: An Interdisciplinary and Stakeholder Approach

    Hyllegard, Karen H.; Ogle, Jennifer Paff; Rudd, Nancy A.; Littrell, Mary A.; Bickle, Marianne

    2012-01-01

    This paper describes a course development project designed to address the obligation of consumer goods companies to engage in socially responsible advertising and promotion. Course development was informed by stakeholder theory. Videotaped interviews with 46 stakeholder representatives were integrated into the course, providing students with an…

  20. 75 FR 42362 - Responsibility of Applicants for Promoting Objectivity in Research for Which Public Health...

    2010-07-21

    ... Department of Health and Human Services (HHS or the Department), including the HHS Public Health Service (PHS... DEPARTMENT OF HEALTH AND HUMAN SERVICES 42 CFR Part 50 45 CFR Part 94 [Docket Number NIH-2010-0001] RIN 0925-AA53 Responsibility of Applicants for Promoting Objectivity in Research for Which Public...

  1. Counteracting Educational Injustice with Applied Critical Leadership: Culturally Responsive Practices Promoting Sustainable Change

    Santamaría, Lorri J.; Santamaría, Andrés P.

    2015-01-01

    This contribution considers educational leadership practice to promote and sustain diversity. Comparative case studies are presented featuring educational leaders in the United States and New Zealand who counter injustice in their practice. The leaders' leadership practices responsive to the diversity presented in their schools offer…

  2. Consumer responses to promoted tweets sent by brands and political parties

    Boerman, S.C.; Kruikemeier, S.

    2016-01-01

    This study aims to understand how consumers respond to social media advertising (SMA) by focusing on promoted tweets sent by brands and political parties, and examines persuasion knowledge as underlying mechanism of these responses. Two online experiments with between-subjects designs, comparing the

  3. Low LET radiation-induced telomerase catalytic subunit promoter activation is mediated by nuclear factor Kappa B

    Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.

    2003-01-01

    Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span

  4. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    Pellissier, Loïc; Wisz, Mary S.; Strandberg, Beate

    2014-01-01

    on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy...... height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were......Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based...

  5. [The relationship between adolescent body size and health promoting behavior and biochemical indicator factors].

    Chen, Hsiu-Chih; Chen, Hsing-Mei; Chen, Min-Li; Chiang, Chih-Ming; Chen, Mei-Yen

    2012-06-01

    Tainan City has the third highest prevalence of junior high school student obesity of all administrative districts in Taiwan. School nurses play an important role in promoting student health. Understanding the factors that significantly impact student weight is critical to designing effective student health promotion programs. This study explored the relationships between health promotion behavior and serum biomarker variables and body size. Researchers used a cross-sectional descriptive study design and stratified cluster random sampling. Subjects were 7th graders who received an in-school health checkup with blood test at 41 public junior high schools in Tainan City between July 2010 and May 2011. Research instruments included the adolescent health promotion (AHP) scale, serum biochemical profile and BMI (body mass index). Obtained data were analyzed using descriptive and inferential statistics. Of the 726 students who participated in this study, 22.2% were underweight and 23.8% were overweight or obese. Higher AHP scores correlated with better biomarkers and body size. Multivariate analysis found factors that increased the risk of being overweight included: being male, having a father with a relatively low level of education, playing video games frequently, and doing little or no exercise (odds ratio = 1.93, 1.75, 1.07, 1.04, respectively). Participants with relatively healthy behaviors had better biomarkers and a lower risk of being overweight. Findings can support the development of evidence-based school programs to promote student health.

  6. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)

    2015-08-14

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.

  7. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    Sawada, Keigo; Takedachi, Masahide; Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki; Lee, Chun Man; Okura, Hanayuki; Matsuyama, Akifumi; Kitamura, Masahiro; Murakami, Shinya

    2015-01-01

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation

  8. Segmenting and targeting American university students to promote responsible alcohol use: a case for applying social marketing principles.

    Deshpande, Sameer; Rundle-Thiele, Sharyn

    2011-10-01

    The current study contributes to the social marketing literature in the American university binge-drinking context in three innovative ways. First, it profiles drinking segments by "values" and "expectancies" sought from behaviors. Second, the study compares segment values and expectancies of two competing behaviors, that is, binge drinking and participation in alternative activities. Third, the study compares the influence of a variety of factors on both behaviors in each segment. Finally, based on these findings and feedback from eight university alcohol prevention experts, appropriate strategies to promote responsible alcohol use for each segment are proposed.

  9. Exercise promotes the expression of brain derived neurotrophic factor (BDNF) through the action of the ketone body β-hydroxybutyrate.

    Sleiman, Sama F; Henry, Jeffrey; Al-Haddad, Rami; El Hayek, Lauretta; Abou Haidar, Edwina; Stringer, Thomas; Ulja, Devyani; Karuppagounder, Saravanan S; Holson, Edward B; Ratan, Rajiv R; Ninan, Ipe; Chao, Moses V

    2016-06-02

    Exercise induces beneficial responses in the brain, which is accompanied by an increase in BDNF, a trophic factor associated with cognitive improvement and the alleviation of depression and anxiety. However, the exact mechanisms whereby physical exercise produces an induction in brain Bdnf gene expression are not well understood. While pharmacological doses of HDAC inhibitors exert positive effects on Bdnf gene transcription, the inhibitors represent small molecules that do not occur in vivo. Here, we report that an endogenous molecule released after exercise is capable of inducing key promoters of the Mus musculus Bdnf gene. The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. We have discovered that the action of β-hydroxybutyrate is specifically upon HDAC2 and HDAC3, which act upon selective Bdnf promoters. Moreover, the effects upon hippocampal Bdnf expression were observed after direct ventricular application of β-hydroxybutyrate. Electrophysiological measurements indicate that β-hydroxybutyrate causes an increase in neurotransmitter release, which is dependent upon the TrkB receptor. These results reveal an endogenous mechanism to explain how physical exercise leads to the induction of BDNF.

  10. Pancreatic endoplasmic reticulum kinase activation promotes medulloblastoma cell migration and invasion through induction of vascular endothelial growth factor A.

    Stephanie Jamison

    Full Text Available Evidence is accumulating that activation of the pancreatic endoplasmic reticulum kinase (PERK in response to endoplasmic reticulum (ER stress adapts tumor cells to the tumor microenvironment and enhances tumor angiogenesis by inducing vascular endothelial growth factor A (VEGF-A. Recent studies suggest that VEGF-A can act directly on certain tumor cell types in an autocrine manner, via binding to VEGF receptor 2 (VEGFR2, to promote tumor cell migration and invasion. Although several reports show that PERK activation increases VEGF-A expression in medulloblastoma, the most common solid malignancy of childhood, the role that either PERK or VEGF-A plays in medulloblastoma remains elusive. In this study, we mimicked the moderate enhancement of PERK activity observed in tumor patients using a genetic approach and a pharmacologic approach, and found that moderate activation of PERK signaling facilitated medulloblastoma cell migration and invasion and increased the production of VEGF-A. Moreover, using the VEGFR2 inhibitor SU5416 and the VEGF-A neutralizing antibody to block VEGF-A/VEGFR2 signaling, our results suggested that tumor cell-derived VEGF-A promoted medulloblastoma cell migration and invasion through VEGFR2 signaling, and that both VEGF-A and VEGFR2 were required for the promoting effects of PERK activation on medulloblastoma cell migration and invasion. Thus, these findings suggest that moderate PERK activation promotes medulloblastoma cell migration and invasion through enhancement of VEGF-A/VEGFR2 signaling.

  11. Enhanceosomes as integrators of hypoxia inducible factor (HIF) and other transcription factors in the hypoxic transcriptional response.

    Pawlus, Matthew R; Hu, Cheng-Jun

    2013-09-01

    Hypoxia is a prevalent attribute of the solid tumor microenvironment that promotes the expression of genes through posttranslational modifications and stabilization of alpha subunits (HIF1α and HIF2α) of hypoxia-inducible factors (HIFs). Despite significant similarities, HIF1 (HIF1α/ARNT) and HIF2 (HIF2α/ARNT) activate common as well as unique target genes and exhibit different functions in cancer biology. More surprisingly, accumulating data indicates that the HIF1- and/or HIF2-mediated hypoxia responses can be oncogenic as well as tumor suppressive. While the role of HIF in the hypoxia response is well established, recent data support the concept that HIF is necessary, but not sufficient for the hypoxic response. Other transcription factors that are activated by hypoxia are also required for the HIF-mediated hypoxia response. HIFs, other transcription factors, co-factors and RNA poll II recruited by HIF and other transcription factors form multifactorial enhanceosome complexes on the promoters of HIF target genes to activate hypoxia inducible genes. Importantly, HIF1 or HIF2 requires distinct partners in activating HIF1 or HIF2 target genes. Because HIF enhanceosome formation is required for the gene activation and distinct functions of HIF1 and HIF2 in tumor biology, disruption of the HIF1 or HIF2 specific enhanceosome complex may prove to be a beneficial strategy in tumor treatment in which tumor growth is specifically dependent upon HIF1 or HIF2 activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. A Study of Predictive Factors Affecting Health: Promoting Behaviors of North Korean Adolescent Refugees.

    Noh, Jin-Won; Yun, Hyo-Young; Park, Hyunchun; Yu, Shi-Eun

    2015-09-01

    The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Statistically significant differences were found in religion (t=2.30, pKorea (t=2.02, preligion (t=2.17, preligion (t=4.21, pKorea (t=2.04, pNorth Korean adolescent refugees.

  13. Ribosomal elongation factor 4 promotes cell death associated with lethal stress.

    Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin

    2014-12-09

    Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has

  14. Characterization of a Cytokinin Response Factor in Arabidopsis thaliana

    Ketelsen, Bernd

    2012-01-01

    The papers of this thesis are not available in Munin: 1. Bernd Ketelsen, Rainer Schwacke, Kirsten Krause and Karsten Fischer: 'Transcriptional activation by Cytokinin Response Factor 5 is governed by an acidic Cterminus containing two conserved domains' (manuscript) 2. Bernd Ketelsen, Stian Olsen, Kirsten Krause and Karsten Fischer: 'Cytokinin responsive factor 5 (CRF5) is involved in root development, hormonal crosstalk and sugar metabolism in Arabidopsis thaliana' (manuscript) 3. Bernd K...

  15. Policies for Promotion of Electric Vehicles and Factors Influencing Consumers’ Purchasing Decisions of Low Emission Vehicles

    Matjaz Knez

    2017-06-01

    Full Text Available Recently different studies of green transport have become interesting for policy makers,car manufacturers, customers and energy suppliers. Many stakeholders from the publicand private sectors are investing a lot of effort to identify consumer behaviour for futureimprovements in development of green products and effective strategies, which couldaccelerate the transition to sustainable future. This paper presents the effects of electricvehicle promotional policies and customer preferences about alternative fuel vehicles.This study has shown that the electric vehicle promotional policies adopted in Sloveniahave been unsuccessful, as the share of first-time registered electric vehicles in 2013 wasbelow 1%. For different segments of people whose opinions about low emission vehiclesdiffer, different measures must be adopted. When designing promotional policies focusmust be on the most relevant factors such as the total vehicle price and fuel economy.

  16. Risk factors for discordant immune response among HIV-infected ...

    Risk factors for discordant immune response among HIV-infected patients initiating antiretroviral therapy: A retrospective cohort study. ... Multivariate logistic regression models were used to estimate adjusted odds ratios (AORs) to determine associations between discordant immune response and clinical and demographic ...

  17. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    Pellissier, Loïc; Wisz, Mary S; Strandberg, Beate; Damgaard, Christian

    2014-01-01

    Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were not phylogenetically conserved. Species richness also decreased with increasing levels of nitrogen and glyphosate. Our results suggest that predicting the cumulative effects of agrochemicals is more complex than anticipated due to their distinct selection of traits that may or may not be conserved phylogenetically. Precautionary efforts to mitigate drift of agricultural chemicals into semi-natural habitats are warranted to prevent unforeseeable biodiversity shifts. (paper)

  18. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. The common risk factor approach: a rational basis for promoting oral health.

    Sheiham, A; Watt, R G

    2000-12-01

    Conventional oral health education is not effective nor efficient. Many oral health programmes are developed and implemented in isolation from other health programmes. This often leads, at best to a duplication of effort, or worse, conflicting messages being delivered to the public. In addition, oral health programmes tend to concentrate on individual behaviour change and largely ignore the influence of socio-political factors as the key determinants of health. Based upon the general principles of health promotion this paper presents a rationale for an alternative approach for oral health policy. The common risk factor approach addresses risk factors common to many chronic conditions within the context of the wider socio-environmental milieu. Oral health is determined by diet, hygiene, smoking, alcohol use, stress and trauma. As these causes are common to a number of other chronic diseases, adopting a collaborative approach is more rational than one that is disease specific. The common risk factor approach can be implemented in a variety of ways. Food policy development and the Health Promoting Schools initiative are used as examples of effective ways of promoting oral health.

  20. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  1. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  2. Structural changes and cellular localization of resuscitation-promoting factor in environmental isolates of Micrococcus luteus.

    Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S

    2010-02-01

    Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.

  3. Transcription Factor SmWRKY1 Positively Promotes the Biosynthesis of Tanshinones in Salvia miltiorrhiza

    Wenzhi Cao

    2018-04-01

    Full Text Available Tanshinones, one group of bioactive diterpenes, were widely used in the treatment of cardiovascular diseases. WRKYs play important roles in plant metabolism, but their regulation mechanism in Salvia miltiorrhiza remains elusive. In this study, one WRKY transcription factor SmWRKY1 was isolated and functionally characterized from S. miltiorrhiza. Multiple sequence alignment and phylogenetic tree analysis showed SmWRKY1 shared high homology with other plant WRKYs such as CrWRKY1. SmWRKY1 was found predominantly expressed in leaves and stems, and was responsive to salicylic acid (SA, methyl jasmonate (MeJA, and nitric oxide (NO treatment. Subcellular localization analysis found that SmWRKY1 was localized in the nucleus. Over-expression of SmWRKY1 significantly elevated the transcripts of genes coding for enzymes in the MEP pathway especially 1-deoxy-D-xylulose-5-phosphate synthase (SmDXS and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (SmDXR, resulted in over fivefold increase in tanshinones production in transgenic lines (up to 13.7 mg/g DW compared with the control lines. A dual-luciferase (Dual-LUC assay showed that SmWRKY1 can positively regulate SmDXR expression by binding to its promoter. Our work revealed that SmWRKY1 participated in the regulation of tanshinones biosynthesis and acted as a positive regulator through activating SmDXR in the MEP pathway, thus provided a new insight to further explore the regulation mechanism of tanshinones biosynthesis.

  4. Mechano growth factor, a splice variant of IGF-1, promotes neurogenesis in the aging mouse brain.

    Tang, Jason J; Podratz, Jewel L; Lange, Miranda; Scrable, Heidi J; Jang, Mi-Hyeon; Windebank, Anthony J

    2017-07-07

    Mechano growth factor (MGF) is a splice variant of IGF-1 first described in skeletal muscle. MGF induces muscle cell proliferation in response to muscle stress and injury. In control mice we found endogenous expression of MGF in neurogenic areas of the brain and these levels declined with age. To better understand the role of MGF in the brain, we used transgenic mice that constitutively overexpressed MGF from birth. MGF overexpression significantly increased the number of BrdU+ proliferative cells in the dentate gyrus (DG) of the hippocampus and subventricular zone (SVG). Although MGF overexpression increased the overall rate of adult hippocampal neurogenesis at the proliferation stage it did not alter the distribution of neurons at post-mitotic maturation stages. We then used the lac-operon system to conditionally overexpress MGF in the mouse brain beginning at 1, 3 and 12 months with histological and behavioral observation at 24 months of age. With conditional overexpression there was an increase of BrdU+ proliferating cells and BrdU+ differentiated mature neurons in the olfactory bulbs at 24 months when overexpression was induced from 1 and 3 months of age but not when started at 12 months. This was associated with preserved olfactory function. In vitro, MGF increased the size and number of neurospheres harvested from SVZ-derived neural stem cells (NSCs). These findings indicate that MGF overexpression increases the number of neural progenitor cells and promotes neurogenesis but does not alter the distribution of adult newborn neurons at post-mitotic stages. Maintaining youthful levels of MGF may be important in reversing age-related neuronal loss and brain dysfunction.

  5. Factors affecting the runoff response of watersheds to precipitation

    DROZDOVÁ, Martina

    2013-01-01

    This bachelor thesis is focused on the factors that affect the drainage basin of the response. It contains a literature review, which deals with the hydrological cycle characteristics of precipitation, surface runoff and flood and erosion protection. The aim of the work is to evaluate the factors that adversely affect the runoff from the catchment.

  6. Factors influencing societal response of nanotechnology : an expert stakeholder analysis

    Gupta, N.; Fischer, A.R.H.; Lans, van der I.A.; Frewer, L.J.

    2012-01-01

    Nanotechnology can be described as an emerging technology and, as has been the case with other emerging technologies such as genetic modification, different socio-psychological factors will potentially influence societal responses to its development and application. These factors will play an

  7. Improving health promotion through central rating of interventions: the need for Responsive Guidance.

    Kok, Maarten Olivier; Bal, Roland; Roelofs, Caspar David; Schuit, Albertine Jantine

    2017-11-23

    beneficial, the evidence based-inspired ERS approach is too limited to guide both intervention development and the improvement of health promotion in practice. To better contribute to improving health promotion, a more reflexive and responsive guidance approach is required, namely one which stimulates the improvement of different intervention aspects, provides targeted recommendations to practitioners and provides feedback to those who develop and rate interventions.

  8. Macrophage CGI-58 Attenuates Inflammatory Responsiveness via Promotion of PPARγ Signaling

    Dan Yang

    2016-02-01

    Full Text Available Background/Aims: Comparative gene identification-58 (CGI-58, an adipose triglyceride lipase (ATGL coactivator, strongly promotes ATGL-mediated triglyceride (TG catabolism. Beyond its function in promoting lipolysis, other features of CGI-58 have been proposed. Here, we investigated the role of CGI-58 in the regulation of inflammatory responsiveness in macrophages. Methods: Macrophage-specific GCI-58 transgenic mice (TG and wild type mice (WT were fed a high fat diet (HFD, and RAW264.7 cells were treated with lipopolysaccharide (LPS. The peroxisome proliferator-activated receptor (PPAR signaling was detected. The inflammatory responsiveness and mitochondrial function were examined. Results: TG mice showed lower serum levels of proinflammatory cytokines and better mitochondrial function in macrophages compared with WT control. Knockdown of CGI-58 in RAW264.7 cells aggravated LPS-induced inflammation and mitochondrial dysfunction. CGI-58 overexpression and silencing in macrophages induced and inhibited PPARγ expression and activity, respectively. Most importantly, the PPARγ-specific agonist rosiglitazone significantly suppressed inflammation and mitochondrial dysfunction induced by CGI-58 deficiency. Furthermore, knockdown of PPARγ in macrophages significantly dampened the role of CGI-58 in suppression of inflammation and mitochondrial dysfunction. Interestingly, CGI-58 inhibited histone deacetylation and the recruitment of histone deacetylase (HDAC to the PPARγ promoter. Finally, ATGL deficiency did not affect inflammatory responsiveness and PPARγ signaling in macrophages. Conclusion: These results demonstrate that macrophage CGI-58 enhances PPARγ signaling and thus suppresses inflammatory responsiveness and mitochondrial dysfunction.

  9. Impact of Environmental Factors on Bacteriocin Promoter Activity in Gut-Derived Lactobacillus salivarius.

    Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D

    2015-11-01

    Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. Brain-derived neurotrophic factor promoter methylation and cortical thickness in recurrent major depressive disorder.

    Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo

    2016-02-15

    Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the groups. The right medial orbitofrontal, right lingual, right lateral occipital, left lateral orbitofrontal, left pars triangularis, and left lingual cortices were thinner in patients with MDD than in healthy controls. Among the MDD group, right pericalcarine, right medical orbitofrontal, right rostral middle frontal, right postcentral, right inferior temporal, right cuneus, right precuneus, left frontal pole, left superior frontal, left superior temporal, left rostral middle frontal and left lingual cortices had inverse correlations with methylation of BDNF promoters. Higher levels of BDNF promoter methylation may be closely associated with the reduced cortical thickness among patients with MDD. Serum BDNF levels were significantly lower in MDD, and showed an inverse relationship with BDNF methylation only in healthy controls. Particularly the prefrontal and occipital cortices seem to indicate key regions in which BDNF methylation has a significant effect on structure.

  11. PARRISE, Promoting Attainment of Responsible Research and Innovation in Science Education, FP7 : Rethinking science, rethinking education

    Knippels, M.C.P.J.; van Dam, F.W.

    The PARRISE (Promoting Attainment of Responsible Research & Innovation in Science Education) project aims at introducing the concept of Responsible Research and Innovation in primary and secondary education. It does so by combining inquiry-based learning and citizenship education with

  12. Natural killer cells promote early CD8 T cell responses against cytomegalovirus.

    Scott H Robbins

    2007-08-01

    Full Text Available Understanding the mechanisms that help promote protective immune responses to pathogens is a major challenge in biomedical research and an important goal for the design of innovative therapeutic or vaccination strategies. While natural killer (NK cells can directly contribute to the control of viral replication, whether, and how, they may help orchestrate global antiviral defense is largely unknown. To address this question, we took advantage of the well-defined molecular interactions involved in the recognition of mouse cytomegalovirus (MCMV by NK cells. By using congenic or mutant mice and wild-type versus genetically engineered viruses, we examined the consequences on antiviral CD8 T cell responses of specific defects in the ability of the NK cells to control MCMV. This system allowed us to demonstrate, to our knowledge for the first time, that NK cells accelerate CD8 T cell responses against a viral infection in vivo. Moreover, we identify the underlying mechanism as the ability of NK cells to limit IFN-alpha/beta production to levels not immunosuppressive to the host. This is achieved through the early control of cytomegalovirus, which dramatically reduces the activation of plasmacytoid dendritic cells (pDCs for cytokine production, preserves the conventional dendritic cell (cDC compartment, and accelerates antiviral CD8 T cell responses. Conversely, exogenous IFN-alpha administration in resistant animals ablates cDCs and delays CD8 T cell activation in the face of NK cell control of viral replication. Collectively, our data demonstrate that the ability of NK cells to respond very early to cytomegalovirus infection critically contributes to balance the intensity of other innate immune responses, which dampens early immunopathology and promotes optimal initiation of antiviral CD8 T cell responses. Thus, the extent to which NK cell responses benefit the host goes beyond their direct antiviral effects and extends to the prevention of innate

  13. Brain-Derived Neurotrophic Factor Elevates Activating Transcription Factor 4 (ATF4 in Neurons and Promotes ATF4-Dependent Induction of Sesn2

    Jin Liu

    2018-03-01

    Full Text Available Activating transcription factor 4 (ATF4 plays important physiologic roles in the brain including regulation of learning and memory as well as neuronal survival and death. Yet, outside of translational regulation by the eIF2α-dependent stress response pathway, there is little information about how its levels are controlled in neurons. Here, we show that brain-derived neurotrophic factor (BDNF promotes a rapid and sustained increase in neuronal ATF4 transcripts and protein levels. This increase is dependent on tropomyosin receptor kinase (TrkB signaling, but independent of levels of phosphorylated eIF2α. The elevation in ATF4 protein occurs both in nuclei and processes. Transcriptome analysis revealed that ATF4 mediates BDNF-promoted induction of Sesn2 which encodes Sestrin2, a protector against oxidative and genotoxic stresses and a mTor complex 1 inhibitor. In contrast, BDNF-elevated ATF4 did not affect expression of a number of other known ATF4 targets including several with pro-apoptotic activity. The capacity of BDNF to elevate neuronal ATF4 may thus represent a means to maintain this transcription factor at levels that provide neuroprotection and optimal brain function without risk of triggering neurodegeneration.

  14. ABFs, a family of ABA-responsive element binding factors.

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  15. The vaccine adjuvant alum promotes IL-10 production that suppresses Th1 responses.

    Oleszycka, Ewa; McCluskey, Sean; Sharp, Fiona A; Muñoz-Wolf, Natalia; Hams, Emily; Gorman, Aoife L; Fallon, Padraic G; Lavelle, Ed C

    2018-04-01

    The effectiveness of many vaccines licensed for clinical use relates to the induction of neutralising antibodies, facilitated by the inclusion of vaccine adjuvants, particularly alum. However, the ability of alum to preferentially promote humoral rather than cellular, particularly Th1-type responses, is not well understood. We demonstrate that alum activates immunosuppressive mechanisms following vaccination, which limit its capacity to induce Th1 responses. One of the key cytokines limiting excessive immune responses is IL-10. Injection of alum primed draining lymph node cells for enhanced IL-10 secretion ex vivo. Moreover, at the site of injection, macrophages and dendritic cells were key sources of IL-10 expression. Alum strongly enhanced the transcription and secretion of IL-10 by macrophages and dendritic cells. The absence of IL-10 signalling did not compromise alum-induced cell infiltration into the site of injection, but resulted in enhanced antigen-specific Th1 responses after vaccination. In contrast to its decisive regulatory role in regulating Th1 responses, there was no significant change in antigen-specific IgG1 antibody production following vaccination with alum in IL-10-deficient mice. Overall, these findings indicate that injection of alum promotes IL-10, which can block Th1 responses and may explain the poor efficacy of alum as an adjuvant for inducing protective Th1 immunity. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Assessment of seismic design response factors of concrete wall buildings

    Mwafy, Aman

    2011-03-01

    To verify the seismic design response factors of high-rise buildings, five reference structures, varying in height from 20- to 60-stories, were selected and designed according to modern design codes to represent a wide range of concrete wall structures. Verified fiber-based analytical models for inelastic simulation were developed, considering the geometric nonlinearity and material inelasticity of the structural members. The ground motion uncertainty was accounted for by employing 20 earthquake records representing two seismic scenarios, consistent with the latest understanding of the tectonic setting and seismicity of the selected reference region (UAE). A large number of Inelastic Pushover Analyses (IPAs) and Incremental Dynamic Collapse Analyses (IDCAs) were deployed for the reference structures to estimate the seismic design response factors. It is concluded that the factors adopted by the design code are adequately conservative. The results of this systematic assessment of seismic design response factors apply to a wide variety of contemporary concrete wall buildings with various characteristics.

  17. The work ability continuum : Epidemiological studies of factors promoting sustainable work ability

    Lindberg, Per

    2006-01-01

    For the individual, the workplace and society, there would be considerable gains if the number of people suffering from physical and mental disorders could be reduced. The overall aim of this thesis was to identify determinants for future work ability among gainfully employed women and men, with special reference to promotive factors at work. Work ability is in this thesis defined as the ability to work with respect to demands at work on health and physical and mental reso...

  18. Exploring Environmental Factors in Nursing Workplaces That Promote Psychological Resilience: Constructing a Unified Theoretical Model

    Cusack, Lynette; Smith, Morgan; Hegney, Desley; Rees, Clare S.; Breen, Lauren J.; Witt, Regina R.; Rogers, Cath; Williams, Allison; Cross, Wendy; Cheung, Kin

    2016-01-01

    Building nurses' resilience to complex and stressful practice environments is necessary to keep skilled nurses in the workplace and ensuring safe patient care. A unified theoretical framework titled Health Services Workplace Environmental Resilience Model (HSWERM), is presented to explain the environmental factors in the workplace that promote nurses' resilience. The framework builds on a previously-published theoretical model of individual resilience, which identified the key constructs of p...

  19. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    Nahyun Choi

    2018-02-01

    Full Text Available Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs. We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif ligand 1 (CXCL1, platelet-derived endothelial cell growth factor (PD-ECGF, and platelet-derived growth factor-C (PDGF-C. Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2 phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration.

  20. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    Choi, Nahyun; Shin, Soyoung; Song, Sun U.; Sung, Jong-Hyuk

    2018-01-01

    Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration. PMID:29495622

  1. Seismic analysis response factors and design margins of piping systems

    Shieh, L.C.; Tsai, N.C.; Yang, M.S.; Wong, W.L.

    1985-01-01

    The objective of the simplified methods project of the Seismic Safety Margins Research Program is to develop a simplified seismic risk methodology for general use. The goal is to reduce seismic PRA costs to roughly 60 man-months over a 6 to 8 month period, without compromising the quality of the product. To achieve the goal, it is necessary to simplify the calculational procedure of the seismic response. The response factor approach serves this purpose. The response factor relates the median level response to the design data. Through a literature survey, we identified the various seismic analysis methods adopted in the U.S. nuclear industry for the piping system. A series of seismic response calculations was performed. The response factors and their variabilities for each method of analysis were computed. A sensitivity study of the effect of piping damping, in-structure response spectra envelop method, and analysis method was conducted. In addition, design margins, which relate the best-estimate response to the design data, are also presented

  2. Erythropoiesis in Malaria Infections and Factors Modifying the Erythropoietic Response

    Vrushali A. Pathak

    2016-01-01

    Full Text Available Anemia is the primary clinical manifestation of malarial infections and is responsible for the substantial rate of morbidity. The pathophysiology discussed till now catalogued several causes for malarial anemia among which ineffective erythropoiesis being remarkable one occurs silently in the bone marrow. A systematic literature search was performed and summarized information on erythropoietic response upon malaria infection and the factors responsible for the same. This review summarizes the clinical and experimental studies on patients, mouse models, and in vitro cell cultures reporting erythropoietic changes upon malaria infection as well as factors accountable for the same. Inadequate erythropoietic response during malaria infection may be the collective effect of various mediators generated by host immune response as well as parasite metabolites. The interplay between various modulators causing the pathophysiology needs to be explored further. Globin gene expression profiling upon malaria infection should also be looked into as abnormal production of globin chains could be a possible contributor to ineffective erythropoiesis.

  3. B Cells Promote Th1- Skewed NKT Cell Response by CD1d-TCR Interaction.

    Shin, Jung Hoon; Park, Se-Ho

    2013-10-01

    CD1d expressing dendritic cells (DCs) are good glyco-lipid antigen presenting cells for NKT cells. However, resting B cells are very weak stimulators for NKT cells. Although α-galactosylceramide (α-GalCer) loaded B cells can activate NKT cells, it is not well defined whether B cells interfere NKT cell stimulating activity of DCs. Unexpectedly, we found in this study that B cells can promote Th1-skewed NKT cell response, which means a increased level of IFN-γ by NKT cells, concomitant with a decreased level of IL-4, in the circumstance of co-culture of DCs and B Cells. Remarkably, the response promoted by B cells was dependent on CD1d expression of B cells.

  4. Promoting the rights and responsibilities of children: a South Australian example.

    George, Emma; Schmidt, Casey; Vella, Grace; McDonagh, Imelda

    2017-03-01

    In 2014, the Parafield Gardens Children's Centre for Early Childhood Development and Parenting was recognised as a Global Peace School - Early Years (GPSEY). During the recognition process, a project promoting the rights and responsibilities of children and families was facilitated. Partnering with children and families in decision making was a project priority. Young children had an active role in decision making. Through age-appropriate activities and discussions, children and families developed deeper understanding of child rights, peace building, global awareness and social inclusion. Educational staff were supported to enhance this child rights focus. A GPSEY recognition celebration acknowledged child rights and the community's cultural diversity. The outcome of GPSEY recognition is significant but the process that fostered community ownership, participation and social inclusion is worth noting. Involving children in decision making and development promotes their rights and responsibilities; this can make a positive difference for children locally, and globally.

  5. Supporting parent-child interactions: music therapy as an intervention for promoting mutually responsive orientation.

    Pasiali, Varvara

    2012-01-01

    Music therapists working with families address relationship and interpersonal communication issues. Few controlled studies exist in the literature but a growing body of documented practice is emerging. This study makes a contribution by documenting how music therapy supports mutuality and reciprocity in parent-child interactions. This study investigated mutually responsive orientation (MRO) behaviors of young children (aged 3-5) and their family members during music therapy. Participants were 4 families with low income and history of maternal depression as common risk factors. Data were collected by videotaping sessions, creating field notes and analytic memos, conducting parent interviews and reviewing parent journals. A cross-case analysis using MRO theory as a conceptualizing framework was used for the purpose of data reduction. Greeting and farewell rituals, and the flexibility of music-based therapeutic applications facilitated development of coordinated routines. Therapist's actions (e.g., encouraging and modeling musical interactions) and bidirectional parent-child actions (e.g., joint attention, turn-taking, being playful) facilitated harmonious communication. Behaviors promoting mutual cooperation were evident when adults attempted to scaffold a child's participation or when children sought comfort from parents, engaged in social referencing and made requests that shaped the direction of the session. The novelty of musical tasks captivated attention, increasing impulse inhibition. Parent actions (e.g., finding delight in watching their child participate, acting silly) and parent-child interactions (e.g., play exploration, shared excitement, cuddling) contributed to positive emotional ambiance. Music therapy assisted development of MRO within parent-child dyads by providing opportunities to rehearse adaptive ways of connecting with each other. Results of this study may serve as an archetypal model guiding clinical treatment planning.

  6. Id1 suppresses anti-tumour immune responses and promotes tumour progression by impairing myeloid cell maturation.

    Papaspyridonos, Marianna; Matei, Irina; Huang, Yujie; do Rosario Andre, Maria; Brazier-Mitouart, Helene; Waite, Janelle C; Chan, April S; Kalter, Julie; Ramos, Ilyssa; Wu, Qi; Williams, Caitlin; Wolchok, Jedd D; Chapman, Paul B; Peinado, Hector; Anandasabapathy, Niroshana; Ocean, Allyson J; Kaplan, Rosandra N; Greenfield, Jeffrey P; Bromberg, Jacqueline; Skokos, Dimitris; Lyden, David

    2015-04-29

    A central mechanism of tumour progression and metastasis involves the generation of an immunosuppressive 'macroenvironment' mediated in part through tumour-secreted factors. Here we demonstrate that upregulation of the Inhibitor of Differentiation 1 (Id1), in response to tumour-derived factors, such as TGFβ, is responsible for the switch from dendritic cell (DC) differentiation to myeloid-derived suppressor cell expansion during tumour progression. Genetic inactivation of Id1 largely corrects the myeloid imbalance, whereas Id1 overexpression in the absence of tumour-derived factors re-creates it. Id1 overexpression leads to systemic immunosuppression by downregulation of key molecules involved in DC differentiation and suppression of CD8 T-cell proliferation, thus promoting primary tumour growth and metastatic progression. Furthermore, advanced melanoma patients have increased plasma TGFβ levels and express higher levels of ID1 in myeloid peripheral blood cells. This study reveals a critical role for Id1 in suppressing the anti-tumour immune response during tumour progression and metastasis.

  7. World Alliance for Risk Factor Surveillance White Paper on Surveillance and Health Promotion

    Stefano Campostrini

    2015-02-01

    Full Text Available This is not a research paper on risk factor surveillance. It is an effort by a key group of researchers and practitioners of risk factor surveillance to define the current state of the art and to identify the key issues involved in the current practice of behavioral risk factor surveillance. Those of us who are the principal authors have worked and carried out research in this area for some three decades. As a result of a series of global meetings beginning in 1999 and continuing every two years since then, a collective working group of the International Union of Health Promotion and Education (IUHPE was formed under the name World Alliance of Risk Factor Surveillance (WARFS. Under this banner the organization sought to write a comprehensive statement on the importance of surveillance to health promotion and public health. This paper, which has been revised and reviewed by established peers in the field, is the result. It provides the reader with a clear summary of the major issues that need to be considered by any and all seeking to carry out behavioral risk factor surveillance.

  8. Inter-organizational relationships: promoters and restrictive factors in the formation of cooperation network

    Marcos Antonio Gaspar

    2014-04-01

    Full Text Available The present paper had as aim to identify factors of inter-organizational relationships which promotes and restricts the formation of companies’ cooperation network, from two levels of analysis (organizational and inter-organizational. To achieve this goal, it was developed a descriptive-qualitative study, with prospecting for primary and secondary data on a cooperation network. The universe was composed by 41 participating companies associated to the analyzed network. The sampling procedure was for researcher’s accessibility and convenience. As a result, it was identified that the network is guided by goals of cooperation among the participating companies, in addition to representing the sector and provide services in the interests of the associates. The main factors influencing the formation of the network were: business center, marketing and training; but only training has been achieved satisfactorily. The business center and marketing factors have not yet been fully developed, being both identified as restrictive factors.

  9. Differential growth responses of Brachypodium distachyon genotypes to inoculation with plant growth promoting rhizobacteria.

    do Amaral, Fernanda P; Pankievicz, Vânia C S; Arisi, Ana Carolina M; de Souza, Emanuel M; Pedrosa, Fabio; Stacey, Gary

    2016-04-01

    Plant growth promoting rhizobacteria (PGPR) can associate and enhance the growth of important crop grasses. However, in most cases, the molecular mechanisms responsible for growth promotion are not known. Such research could benefit by the adoption of a grass model species that showed a positive response to bacterial inoculation and was amenable to genetic and molecular research methods. In this work we inoculated different genotypes of the model grass Brachypodium distachyon with two, well-characterized PGPR bacteria, Azospirillum brasilense and Herbaspirillum seropedicae, and evaluated the growth response. Plants were grown in soil under no nitrogen or with low nitrogen (i.e., 0.5 mM KNO3). A variety of growth parameters (e.g., shoot height, root length, number of lateral roots, fresh and dry weight) were measured 35 days after inoculation. The data indicate that plant genotype plays a very important role in determining the plant response to PGPR inoculation. A positive growth response was observed with only four genotypes grown under no nitrogen and three genotypes tested under low nitrogen. However, in contrast, relatively good root colonization was seen with most genotypes, as measured by drop plate counting and direct, microscopic examination of roots. In particular, the endophytic bacteria H. seropedicae showed strong epiphytic and endophytic colonization of roots.

  10. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  11. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  12. Regulation of mRNA Levels by Decay-Promoting Introns that Recruit the Exosome Specificity Factor Mmi1

    Cornelia Kilchert

    2015-12-01

    Full Text Available In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation.

  13. The TLR5 ligand flagellin promotes asthma by priming allergic responses to indoor allergens

    Wilson, Rhonda H.; Maruoka, Shuichiro; Whitehead, Gregory S.; Foley, Julie F.; Flake, Gordon P.; Sever, Michelle L.; Zeldin, Darryl C.; Kraft, Monica; Garantziotis, Stavros; Nakano, Hideki; Cook, Donald N.

    2012-01-01

    Allergic asthma is a complex disease characterized by eosinophilic pulmonary inflammation, mucus production and reversible airway obstruction 1 . Exposure to indoor allergens is a clear risk factor for asthma, but this disease is also associated with high household levels of total and Gram-negative bacteria 2 . The ability of bacterial products to act as adjuvants 3 suggests they might promote asthma by priming allergic sensitization to inhaled allergens. In support of this idea, house dust e...

  14. Health Promotion Behavior of Chinese International Students in Korea Including Acculturation Factors: A Structural Equation Model.

    Kim, Sun Jung; Yoo, Il Young

    2016-03-01

    The purpose of this study was to explain the health promotion behavior of Chinese international students in Korea using a structural equation model including acculturation factors. A survey using self-administered questionnaires was employed. Data were collected from 272 Chinese students who have resided in Korea for longer than 6 months. The data were analyzed using structural equation modeling. The p value of final model is .31. The fitness parameters of the final model such as goodness of fit index, adjusted goodness of fit index, normed fit index, non-normed fit index, and comparative fit index were more than .95. Root mean square of residual and root mean square error of approximation also met the criteria. Self-esteem, perceived health status, acculturative stress and acculturation level had direct effects on health promotion behavior of the participants and the model explained 30.0% of variance. The Chinese students in Korea with higher self-esteem, perceived health status, acculturation level, and lower acculturative stress reported higher health promotion behavior. The findings can be applied to develop health promotion strategies for this population. Copyright © 2016. Published by Elsevier B.V.

  15. MiR-32 promotes gastric carcinoma tumorigenesis by targeting Kruppel-like factor 4

    Yan, Chao [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China); Yu, Jianchun, E-mail: yu_jchpumch@163.com [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China); Liu, Yuqin [Cell Culture Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100005 (China); Kang, Weiming; Ma, Zhiqiang; Zhou, Li [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China)

    2015-11-27

    Gastric cancer (GC) is a prevalent malignant cancer worldwide and is highly lethal because of its fast growth. Currently, the clinical therapy options for GC remain limited. MiR-32 has been reported as an oncogenic microRNA in many cancers, but its role in GC is unclear. Here, we found that miR-32 was overexpressed in GC tissues compared with adjacent normal tissue, and miR-32 was higher in GC patients' plasma compared with healthy individuals. Furthermore, we have identified miR-32 to be oncogenic, by promoting gastric cell proliferation, migration and invasion. We also identified Kruppel-like factor 4 (KLF4) as a direct target of miR-32. Knockdown of KLF4 promoted proliferation, migration and invasion of GC cells. We conclude that miR-32 promotes GC cell proliferation, migration and invasion by targeting KLF4, suggesting that the miR-32-KLF4 pathway may be useful in clinical diagnosis and therapeutics. - Highlights: • miR-32 was overexpression in GC tissues than adjacent normal tissue. • miR-32 was higher in GC patients' plasma compared with healthy people. • miR-32 promotes GC cell proliferation, migration and invasion by targeting KLF4.

  16. The AP-1 Transcription Factor c-Jun Promotes Arthritis by Regulating Cyclooxygenase-2 and Arginase-1 Expression in Macrophages.

    Hannemann, Nicole; Jordan, Jutta; Paul, Sushmita; Reid, Stephen; Baenkler, Hanns-Wolf; Sonnewald, Sophia; Bäuerle, Tobias; Vera, Julio; Schett, Georg; Bozec, Aline

    2017-05-01

    Activation of proinflammatory macrophages is associated with the inflammatory state of rheumatoid arthritis. Their polarization and activation are controlled by transcription factors such as NF-κB and the AP-1 transcription factor member c-Fos. Surprisingly, little is known about the role of the AP-1 transcription factor c-Jun in macrophage activation. In this study, we show that mRNA and protein levels of c-Jun are increased in macrophages following pro- or anti-inflammatory stimulations. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment cluster analyses of microarray data using wild-type and c-Jun-deleted macrophages highlight the central function of c-Jun in macrophages, in particular for immune responses, IL production, and hypoxia pathways. Mice deficient for c-Jun in macrophages show an amelioration of inflammation and bone destruction in the serum-induced arthritis model. In vivo and in vitro gene profiling, together with chromatin immunoprecipitation analysis of macrophages, revealed direct activation of the proinflammatory factor cyclooxygenase-2 and indirect inhibition of the anti-inflammatory factor arginase-1 by c-Jun. Thus, c-Jun regulates the activation state of macrophages and promotes arthritis via differentially regulating cyclooxygenase-2 and arginase-1 levels. Copyright © 2017 by The American Association of Immunologists, Inc.

  17. Promoting social responsibility for health: health impact assessment and healthy public policy at the community level.

    Mittelmark, M B

    2001-09-01

    The 1997 Jakarta Declaration on Health Promotion into the 21st Century called for new responses to address the emerging threats to health. The declaration placed a high priority on promoting social responsibility for health, and it identified equity-focused health impact assessment as a high priority for action. This theme was among the foci at the 2000 Fifth Global Conference on Health Promotion held in Mexico. This paper, which is an abbreviation of a technical report prepared for the Mexico conference, advances arguments for focusing on health impact assessment at the local level. Health impact assessment identifies negative health impacts that call for policy responses, and identifies and encourages practices and policies that promote health. Health impact assessment may be highly technical and require sophisticated technology and expertise. But it can also be a simple, highly practical process, accessible to ordinary people, and one that helps a community come to grips with local circumstances that need changing for better health. To illustrate the possibilities, this paper presents a case study, the People Assessing Their Health (PATH) project from Eastern Nova Scotia, Canada. It places ordinary citizens, rather than community elites, at the very heart of local decision-making. Evidence from PATH demonstrates that low technology health impact assessment, done by and for local people, can shift thinking beyond the illness problems of individuals. It can bring into consideration, instead, how programmes and policies support or weaken community health, and illuminate a community's capacity to improve local circumstances for better health. This stands in contrast to evidence that highly technological approaches to community-level health impact assessment can be self-defeating. Further development of simple, people-centred, low technology approaches to health impact assessment at the local level is called for.

  18. Convergence Improvement of Response Matrix Method with Large Discontinuity Factors

    Yamamoto, Akio

    2003-01-01

    In the response matrix method, a numerical divergence problem has been reported when extremely small or large discontinuity factors are utilized in the calculations. In this paper, an alternative response matrix formulation to solve the divergence problem is discussed, and properties of iteration matrixes are investigated through eigenvalue analyses. In the conventional response matrix formulation, partial currents between adjacent nodes are assumed to be discontinuous, and outgoing partial currents are converted into incoming partial currents by the discontinuity factor matrix. Namely, the partial currents of the homogeneous system (i.e., homogeneous partial currents) are treated in the conventional response matrix formulation. In this approach, the spectral radius of an iteration matrix for the partial currents may exceed unity when an extremely small or large discontinuity factor is used. Contrary to this, an alternative response matrix formulation using heterogeneous partial currents is discussed in this paper. In the latter approach, partial currents are assumed to be continuous between adjacent nodes, and discontinuity factors are directly considered in the coefficients of a response matrix. From the eigenvalue analysis of the iteration matrix for the one-group, one-dimensional problem, the spectral radius for the heterogeneous partial current formulation does not exceed unity even if an extremely small or large discontinuity factor is used in the calculation; numerical stability of the alternative formulation is superior to the conventional one. The numerical stability of the heterogeneous partial current formulation is also confirmed by the two-dimensional light water reactor core analysis. Since the heterogeneous partial current formulation does not require any approximation, the converged solution exactly reproduces the reference solution when the discontinuity factors are directly derived from the reference calculation

  19. Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor

    Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank

    2006-01-01

    Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology

  20. Assumptions of Corporate Social Responsibility as Competitiveness Factor

    Zaneta Simanaviciene

    2017-09-01

    Full Text Available The purpose of this study was to examine the assumptions of corporate social responsibility (CSR as competitiveness factor in economic downturn. Findings indicate that factors affecting the quality of the micro-economic business environment, i.e., the sophistication of enterprise’s strategy and management processes, the quality of the human capital resources, the increase of product / service demand, the development of related and supporting sectors and the efficiency of natural resources, and competitive capacities of enterprise impact competitiveness at a micro-level. The outcomes suggest that the implementation of CSR elements, i.e., economic, environmental and social responsibilities, gives good opportunities to increase business competitiveness.

  1. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  2. An engineered tale-transcription factor rescues transcription of factor VII impaired by promoter mutations and enhances its endogenous expression in hepatocytes.

    Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo

    2016-06-24

    Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.

  3. Cell-cell adhesion mediated by binding of membrane-anchored transforming growth factor α to epidermal growth factor receptors promotes cell proliferation

    Anklesaria, P.; Greenberger, J.S.; Teixido, J.; Laiho, M.; Massague, J.; Pierce, J.H.

    1990-01-01

    The precursor for transforming growth factor α, pro-TGF-α, is a cell surface glycoprotein that can establish contact with epidermal growth factor (EGF) receptors on adjacent cells. To examine whether the pro-TGF-α/EGF receptor pair can simultaneously mediate cell adhesion and promote cell proliferation, the authors have expressed pro-TGF-α in a bone marrow stromal cell line labeled with [ 35 S] cysteine. Expression of pro-TGF-α allows these cells to support long-term attachment of an EGF/interleukin-3-dependent hematopoietic progenitor cell line that expresses EGF receptors but is unable to adhere to normal stroma. This interaction is inhibited by soluble EGF receptor ligands. Further, the hematopoietic progenitor cells replicate their DNA while they are attached to the stromal cell layer and become foci of sustained cell proliferation. Thus, pro-TGF-α and the EGF receptor can function as mediators of intercellular adhesion and this interaction may promote a mitogenic response. They propose the term juxtacrine to designate this form of stimulation between adjacent cells

  4. Sucralose Promotes Food Intake through NPY and a Neuronal Fasting Response.

    Wang, Qiao-Ping; Lin, Yong Qi; Zhang, Lei; Wilson, Yana A; Oyston, Lisa J; Cotterell, James; Qi, Yue; Khuong, Thang M; Bakhshi, Noman; Planchenault, Yoann; Browman, Duncan T; Lau, Man Tat; Cole, Tiffany A; Wong, Adam C N; Simpson, Stephen J; Cole, Adam R; Penninger, Josef M; Herzog, Herbert; Neely, G Gregory

    2016-07-12

    Non-nutritive sweeteners like sucralose are consumed by billions of people. While animal and human studies have demonstrated a link between synthetic sweetener consumption and metabolic dysregulation, the mechanisms responsible remain unknown. Here we use a diet supplemented with sucralose to investigate the long-term effects of sweet/energy imbalance. In flies, chronic sweet/energy imbalance promoted hyperactivity, insomnia, glucose intolerance, enhanced sweet taste perception, and a sustained increase in food and calories consumed, effects that are reversed upon sucralose removal. Mechanistically, this response was mapped to the ancient insulin, catecholamine, and NPF/NPY systems and the energy sensor AMPK, which together comprise a novel neuronal starvation response pathway. Interestingly, chronic sweet/energy imbalance promoted increased food intake in mammals as well, and this also occurs through an NPY-dependent mechanism. Together, our data show that chronic consumption of a sweet/energy imbalanced diet triggers a conserved neuronal fasting response and increases the motivation to eat. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma

    Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.

    2016-01-01

    Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).

  6. Tumor necrosis factor blockers influence macrophage responses to Mycobacterium tuberculosis

    HARRIS, JAMES; HARRIS, JAMES

    2008-01-01

    PUBLISHED umor necrosis factor (TNF)?? is a proinflammatory cytokine that mediates inflammation in response to various pathogens, including Mycobacterium tuberculosis, but is also a key factor in the pathogenesis of rheumatoid arthritis and other autoimmune diseases. Three TNF???suppressing drugs have been approved to treat selected autoimmune diseases; 2 are monoclonal antibodies against TNF?? (adalimumab and infliximab), and the other is a soluble TNF receptor/Fc fusion protein (etanerce...

  7. RNA helicase HEL-1 promotes longevity by specifically activating DAF-16/FOXO transcription factor signaling in Caenorhabditis elegans

    Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V.

    2015-01-01

    The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740

  8. Promoting Supplier Diversity in Public Procurement: A Further Step in Responsible Supply Chain

    Carol Cravero

    2018-01-01

    Full Text Available Public procurement refers to the purchasing of goods, services and works by governments and public authorities. Given the difficulty in defining a common core of social considerations applicable to the generality of public contracts, this paper aims at proposing a distinction between two categories of social objectives: on the one hand, the promotion of work standards and fundamental human rights as a hard core, and on the other hand, the promotion of inclusion and supplier diversity as a further step of the social-oriented approach. This concerns not only the mere procurement process but also the entire supply chain, leading to distinguish between the basic responsible supply chain involving the respect of internationally recognised human and labour rights, and the pro-active responsible supply chain promoting inclusion and supplier diversity. Based on this distinction, this paper analyses if basic working conditions and fundamental rights can be generally taken into account in public procurement. Implications of this assumption affect different levels of the procurement process and policy: from policy considerations to tender design, from economic efficiency matters to monitoring issues.

  9. Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

    Wang Xiaoqin

    2005-10-01

    Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

  10. FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease

    Ho-Chang Kuo

    2015-01-01

    Full Text Available Kawasaki disease (KD is characterized by pediatric systemic vasculitis of an unknown cause. The low affinity immunoglobulin gamma Fc region receptor II-a (FCGR2A gene was reported to be involved in the susceptibility of KD. DNA methylation is one of the epigenetic mechanisms that control gene expression; thus, we hypothesized that methylation status of CpG islands in FCGR2A promoter associates with the susceptibility and therapeutic outcomes of Kawasaki disease. In this study, 36 KD patients and 24 healthy subjects from out-patient clinic were recruited. Eleven potential methylation sites within the targeted promoter region of FCGR2A were selected for investigation. We marked the eleven methylation sites from A to K. Our results indicated that methylation at the CpG sites G, H, and J associated with the risk of KD. CpG sites B, C, E, F, H, J, and K were found to associate with the outcomes of IVIG treatment. In addition, CpG sites G, J, and K were predicted as transcription factors binding sites for NF-kB, Myc-Max, and SP2, respectively. Our study reported a significant association among the promoter methylation of FCGR2A, susceptibility of KD, and the therapeutic outcomes of IVIG treatment. The methylation levels of CpG sites of FCGR2A gene promoter should be an important marker for optimizing IVIG therapy.

  11. A systems biology perspective on the role of WRKY transcription factors in drought responses in plants.

    Tripathi, Prateek; Rabara, Roel C; Rushton, Paul J

    2014-02-01

    Drought is one of the major challenges affecting crop productivity and yield. However, water stress responses are notoriously multigenic and quantitative with strong environmental effects on phenotypes. It is also clear that water stress often does not occur alone under field conditions but rather in conjunction with other abiotic stresses such as high temperature and high light intensities. A multidisciplinary approach with successful integration of a whole range of -omics technologies will not only define the system, but also provide new gene targets for both transgenic approaches and marker-assisted selection. Transcription factors are major players in water stress signaling and some constitute major hubs in the signaling webs. The main transcription factors in this network include MYB, bHLH, bZIP, ERF, NAC, and WRKY transcription factors. The role of WRKY transcription factors in abiotic stress signaling networks is just becoming apparent and systems biology approaches are starting to define their places in the signaling network. Using systems biology approaches, there are now many transcriptomic analyses and promoter analyses that concern WRKY transcription factors. In addition, reports on nuclear proteomics have identified WRKY proteins that are up-regulated at the protein level by water stress. Interactomics has started to identify different classes of WRKY-interacting proteins. What are often lacking are connections between metabolomics, WRKY transcription factors, promoters, biosynthetic pathways, fluxes and downstream responses. As more levels of the system are characterized, a more detailed understanding of the roles of WRKY transcription factors in drought responses in crops will be obtained.

  12. Factors promoting resident deaths at aged care facilities in Japan: a review.

    Sugimoto, Kentaro; Ogata, Yasuko; Kashiwagi, Masayo

    2018-03-01

    Due to an increasingly ageing population, the Japanese government has promoted elderly deaths in aged care facilities. However, existing facilities were not designed to provide resident end-of-life care and the proportion of aged care facility deaths is currently less than 10%. Consequently, the present review evaluated the factors that promote aged care facility resident deaths in Japan from individual- and facility-level perspectives to exploring factors associated with increased resident deaths. To achieve this, MEDLINE, CINAHL, Web of Science and Ichushi databases were searched on 23 January 2016. Influential factors were reviewed for two healthcare services (insourcing and outsourcing facilities) as well as external healthcare agencies operating outside facilities. Of the original 2324 studies retrieved, 42 were included in analysis. Of these studies, five focused on insourcing, two on outsourcing, seven on external agencies and observed facility/agency-level factors. The other 28 studies identified individual-level factors related to death in aged care facilities. The present review found that at both facility and individual levels, in-facility resident deaths were associated with healthcare service provision, confirmation of resident/family end-of-life care preference and staff education. Additionally, while outsourcing facilities did not require employment of physicians/nursing staff to accommodate resident death, these facilities required visits by physicians and nursing staff from external healthcare agencies as well as residents' healthcare input. This review also found few studies examining outsourcing facilities. The number of healthcare outsourcing facilities is rapidly increasing as a result of the Japanese government's new tax incentives. Consequently, there may be an increase in elderly deaths in outsourcing healthcare facilities. Accordingly, it is necessary to identify the factors associated with residents' deaths at outsourcing facilities.

  13. How can stakeholders promote environmental and social responsibility in the shipping industry?

    Parviainen, Tuuli; Lehikoinen, Annukka; Kuikka, Sakari

    2017-01-01

    The highly globalized and competitive nature of the shipping industry poses serious governance challenges. Recently, the use of voluntary measures, such as corporate social responsibility (CSR) initiatives, has been explored in terms of moving towards environmentally and socially responsible...... as well as safe shipping industry practices. Limited attention has been paid on the role of stakeholders such as consumers, employees, NGOs, and academia in pressuring the shipping industry towards greater environmental and social responsibility. Here, by applying stakeholder theory and drawing...... of multi-stakeholder pressure and action to promote the adoption of CSR activities, support the transparency, legitimacy, and enforcement of the practices, as well as widen the scope and focus of CSR initiatives and practices by focusing on a broad range of social and environmental issues. Finally...

  14. Genome wide analysis of stress responsive WRKY transcription factors in Arabidopsis thaliana

    Shaiq Sultan

    2016-04-01

    Full Text Available WRKY transcription factors are a class of DNA-binding proteins that bind with a specific sequence C/TTGACT/C known as W-Box found in promoters of genes which are regulated by these WRKYs. From previous studies, 43 different stress responsive WRKY transcription factors in Arabidopsis thaliana, identified and then categorized in three groups viz., abiotic, biotic and both of these stresses. A comprehensive genome wide analysis including chromosomal localization, gene structure analysis, multiple sequence alignment, phylogenetic analysis and promoter analysis of these WRKY genes was carried out in this study to determine the functional homology in Arabidopsis. This analysis led to the classification of these WRKY family members into 3 major groups and subgroups and showed evolutionary relationship among these groups on the base of their functional WRKY domain, chromosomal localization and intron/exon structure. The proposed groups of these stress responsive WRKY genes and annotation based on their position on chromosomes can also be explored to determine their functional homology in other plant species in relation to different stresses. The result of the present study provides indispensable genomic information for the stress responsive WRKY transcription factors in Arabidopsis and will pave the way to explain the precise role of various AtWRKYs in plant growth and development under stressed conditions.

  15. Auxin Response Factors (ARFs are potential mediators of auxin action in tomato response to biotic and abiotic stress (Solanum lycopersicum.

    Sarah Bouzroud

    Full Text Available Survival biomass production and crop yield are heavily constrained by a wide range of environmental stresses. Several phytohormones among which abscisic acid (ABA, ethylene and salicylic acid (SA are known to mediate plant responses to these stresses. By contrast, the role of the plant hormone auxin in stress responses remains so far poorly studied. Auxin controls many aspects of plant growth and development, and Auxin Response Factors play a key role in the transcriptional activation or repression of auxin-responsive genes through direct binding to their promoters. As a mean to gain more insight on auxin involvement in a set of biotic and abiotic stress responses in tomato, the present study uncovers the expression pattern of SlARF genes in tomato plants subjected to biotic and abiotic stresses. In silico mining of the RNAseq data available through the public TomExpress web platform, identified several SlARFs as responsive to various pathogen infections induced by bacteria and viruses. Accordingly, sequence analysis revealed that 5' regulatory regions of these SlARFs are enriched in biotic and abiotic stress-responsive cis-elements. Moreover, quantitative qPCR expression analysis revealed that many SlARFs were differentially expressed in tomato leaves and roots under salt, drought and flooding stress conditions. Further pointing to the putative role of SlARFs in stress responses, quantitative qPCR expression studies identified some miRNA precursors as potentially involved in the regulation of their SlARF target genes in roots exposed to salt and drought stresses. These data suggest an active regulation of SlARFs at the post-transcriptional level under stress conditions. Based on the substantial change in the transcript accumulation of several SlARF genes, the data presented in this work strongly support the involvement of auxin in stress responses thus enabling to identify a set of candidate SlARFs as potential mediators of biotic and abiotic

  16. Factors involved in nurses' responses to burnout: a grounded theory study

    Nikravesh Mansoure

    2004-11-01

    Full Text Available Abstract Background Intense and long-standing problems in burn centers in Tehran have led nurses to burnout. This phenomenon has provoked serious responses and has put the nurses, patients and the organization under pressure. The challenge for managers and nurse executives is to understand the factors which would reduce or increase the nurses' responses to burnout and develop delivery systems that promote positive adaptation and facilitate quality care. This study, as a part of more extensive research, aims to explore and describe the nurses' perceptions of the factors affecting their responses to burnout. Methods Grounded theory was used as the method. Thirty- eight participants were recruited. Data were generated by unstructured interviews and 21 sessions of participant observations. Constant comparison was used for data analysis. Results Nurses' and patients' personal characteristics and social support influenced nurses' responses to burnout. Personal characteristics of the nurses and patients, especially when interacting, had a more powerful effect. They altered emotional, attitudinal, behavioral and organizational responses to burnout and determined the kind of caring behavior. Social support had a palliative effect and altered emotional responses and some aspects of attitudinal responses. Conclusions The powerful effect of positive personal characteristics and its sensitivity to long standing and intense organizational pressures suggests approaches to executing stress reduction programs and refreshing the nurses' morale by giving more importance to ethical aspects of caring. Moreover, regarding palliative effect of social support and its importance for the nurses' wellbeing, nurse executives are responsible for promoting a work environment that supports nurses and motivates them.

  17. The ABA receptor PYL8 promotes lateral root growth by enhancing MYB77-dependent transcription of auxin-responsive genes.

    Zhao, Yang; Xing, Lu; Wang, Xingang; Hou, Yueh-Ju; Gao, Jinghui; Wang, Pengcheng; Duan, Cheng-Guo; Zhu, Xiaohong; Zhu, Jian-Kang

    2014-06-03

    The phytohormone abscisic acid (ABA) regulates plant growth, development, and abiotic stress responses. ABA signaling is mediated by a group of receptors known as the PYR1/PYL/RCAR family, which includes the pyrabactin resistance 1-like protein PYL8. Under stress conditions, ABA signaling activates SnRK2 protein kinases to inhibit lateral root growth after emergence from the primary root. However, even in the case of persistent stress, lateral root growth eventually recovers from inhibition. We showed that PYL8 is required for the recovery of lateral root growth, following inhibition by ABA. PYL8 directly interacted with the transcription factors MYB77, MYB44, and MYB73. The interaction of PYL8 and MYB77 increased the binding of MYB77 to its target MBSI motif in the promoters of multiple auxin-responsive genes. Compared to wild-type seedlings, the lateral root growth of pyl8 mutant seedlings and myb77 mutant seedlings was more sensitive to inhibition by ABA. The recovery of lateral root growth was delayed in pyl8 mutant seedlings in the presence of ABA, and the defect was rescued by exposing pyl8 mutant seedlings to the auxin IAA (3-indoleacetic acid). Thus, PYL8 promotes lateral root growth independently of the core ABA-SnRK2 signaling pathway by enhancing the activities of MYB77 and its paralogs, MYB44 and MYB73, to augment auxin signaling. Copyright © 2014, American Association for the Advancement of Science.

  18. Fibroblast growth factor-2-induced host stroma reaction during initial tumor growth promotes progression of mouse melanoma via vascular endothelial growth factor A-dependent neovascularization.

    Tsunoda, Satoshi; Nakamura, Toshiyuki; Sakurai, Hiroaki; Saiki, Ikuo

    2007-04-01

    Fibroblast growth factor (FGF)-2 has been considered to play a critical role in neovascularization in several tumors; however, its precise role in tumor progression is not fully understood. In the present study, we have characterized the role of FGF-2 in B16-BL6 mouse melanoma cells, focusing on effects during the initial phase of tumor growth. FGF-2 was injected at the tumor inoculation site of dorsal skin during the initial phase. FGF-2 induced marked tumor growth and lymph node metastasis. This was well correlated with an increase in neovascularization in the host stroma. FGF-2 also recruited inflammatory and mesenchymal cells in host stroma. Marked tumor growth, pulmonary metastasis and intensive neovascularization in tumor parenchyma were also observed after a single injection of FGF-2 into the footpad inoculation site. In contrast, repeated injections of FGF-2 at a site remote from the footpad tumor were ineffective in promoting tumor growth and metastasis. These promoting activities of FGF-2 were blocked by local injections of a glucocorticoid hormone, suggesting that host inflammatory responses induced by FGF-2 are associated with FGF-2-induced tumor progression. In addition, although FGF-2 did not promote cellular proliferation and vascular endothelial growth factor A (VEGFA) mRNA expression in B16-BL6 cells in vitro, FGF-2 induced VEGFA expression in host stroma rather than tumor tissue, and local injections of a neutralizing antibody against VEGFA inhibited these activities of FGF-2 in vivo. These results indicate that abundant FGF-2 during the initial phase of tumor growth induces VEGFA-dependent intensive neovascularization in host stroma, and supports marked tumor growth and metastasis.

  19. Understanding the factors which promote registered nurses' intent to stay in emergency and critical care areas.

    Van Osch, Mary; Scarborough, Kathy; Crowe, Sarah; Wolff, Angela C; Reimer-Kirkham, Sheryl

    2018-03-01

    To explore the influential factors and strategies that promote an experienced nurse's intent to stay in their emergency or critical care area. Turnover among registered nurses (herein referred to as nurses) working in specialty areas of practice can result in a range of negative outcomes. The retention of specialty nurses at the unit level has important implications for hospital and health systems. These implications include lost knowledge and experience which may in turn impact staff performance levels, patient outcomes, hiring, orientating, development of clinical competence and other aspects of organizational performance. This qualitative study used an interpretive descriptive design to understand nurses' perceptions of the current factors and strategies that promote them staying in emergency or critical care settings for two or more years. Focus groups were conducted with 13 emergency and critical care nurses. Data analysis involved thematic analysis that evolved from codes to categories to themes. Four themes were identified: leadership, interprofessional relationships, job fit and practice environment. In addition, the ideas of feeling valued, respected and acknowledged were woven throughout. Factors often associated with nurse attrition such as burnout and job stresses were not emphasised by the respondents in our study as critical to their intent to stay in their area of practice. This study has highlighted positive aspects that motivate nurses to stay in their specialty areas. To ensure quality care for patients, retention of experienced emergency and critical care nurses is essential to maintaining specialty expertise in these practice settings. © 2017 John Wiley & Sons Ltd.

  20. Exploring Environmental Factors in Nursing Workplaces That Promote Psychological Resilience: Constructing a Unified Theoretical Model.

    Cusack, Lynette; Smith, Morgan; Hegney, Desley; Rees, Clare S; Breen, Lauren J; Witt, Regina R; Rogers, Cath; Williams, Allison; Cross, Wendy; Cheung, Kin

    2016-01-01

    Building nurses' resilience to complex and stressful practice environments is necessary to keep skilled nurses in the workplace and ensuring safe patient care. A unified theoretical framework titled Health Services Workplace Environmental Resilience Model (HSWERM), is presented to explain the environmental factors in the workplace that promote nurses' resilience. The framework builds on a previously-published theoretical model of individual resilience, which identified the key constructs of psychological resilience as self-efficacy, coping and mindfulness, but did not examine environmental factors in the workplace that promote nurses' resilience. This unified theoretical framework was developed using a literary synthesis drawing on data from international studies and literature reviews on the nursing workforce in hospitals. The most frequent workplace environmental factors were identified, extracted and clustered in alignment with key constructs for psychological resilience. Six major organizational concepts emerged that related to a positive resilience-building workplace and formed the foundation of the theoretical model. Three concepts related to nursing staff support (professional, practice, personal) and three related to nursing staff development (professional, practice, personal) within the workplace environment. The unified theoretical model incorporates these concepts within the workplace context, linking to the nurse, and then impacting on personal resilience and workplace outcomes, and its use has the potential to increase staff retention and quality of patient care.

  1. Increased Tumor Necrosis Factor (TNF)-α and Its Promoter Polymorphisms Correlate with Disease Progression and Higher Susceptibility towards Vitiligo

    Laddha, Naresh C.; Dwivedi, Mitesh; Begum, Rasheedunnisa

    2012-01-01

    Abstract Tumor Necrosis Factor (TNF)-α, is a paracrine inhibitor of melanocytes, which plays a critical role in the pathogenesis of several autoimmune diseases including vitiligo, as abnormal immune responses have frequently been observed in vitiligo patients. Moreover, vitiligo patients show higher lesion levels of TNF-α. Genetic polymorphisms in the promoter region of TNF-α are involved in the regulation of its expression. The present study explores TNF-α promoter polymorphisms and correlates them with TNF-α transcript and protein levels in vitiligo patients and controls of Gujarat along with its effect on disease onset and progression. PCR-RFLP technique was used for genotyping of these polymorphisms in 977 vitiligo patients and 990 controls. TNF-α transcript and protein levels were measured by Real time PCR and ELISA respectively. The genotype and allele frequencies for the investigated polymorphisms were significantly associated with vitiligo patients. The study revealed significant increase in TNF-α transcript and protein levels in vitiligo patients compared to controls. In particular, haplotypes: AATCC, AACCT, AGTCT, GATCT, GATCC and AGCCT were found to increase the TNF-α levels in vitiligo patients. Analysis of TNF-α levels based on the gender and disease progression suggests that female patients and patients with active vitiligo had higher levels of TNF-α. Also, the TNF-α levels were high in patients with generalized vitiligo as compared to localized vitiligo. Age of onset analysis of the disease suggests that the haplotypes: AACAT, AACCT, AATCC and AATCT had a profound effect in the early onset of the disease. Moreover, the analysis suggests that female patients had an early onset of vitiligo. Overall, our results suggest that TNF-α promoter polymorphisms may be genetic risk factors for susceptibility and progression of the disease. The up-regulation of TNF-α transcript and protein levels in individuals with susceptible haplotypes advocates

  2. Key factors driving corporate social responsibility of Vietnamese firms

    Kabir, Mohammed Rezaul; Thai Minh, H.

    2016-01-01

    We examine the impact of firm, corporate governance and managerial characteristics on the corporate social responsibility (CSR) activities of Vietnamese listed firms. Our results show that export-oriented firms engage in more CSR activities. As for corporate governance factors, we observe that

  3. Analysis of Factors Responsible for Low Utilization of Mechanical ...

    The study is concerned with identifying the problems of low utilization of plant and equipment by the indigenous building construction firms in Nigeria. The methodology involved the use of a well structured questionnaire complemented with an oral interview. The results revealed that (15) factors were responsible for low ...

  4. Physiological response of carnation to radiation and some other factors

    Abdel - Baky, M.M.

    1986-01-01

    This study was carried out to investigate the physiological response of carnation plant (Dianthus caryophyllus c v. William sim) to gamma rays irradiation and some other factors namely: gibberellic acid and alar (B - 9 or daminozide) as growth regulators and potassium and boron as nutrients. The obtained results would be summarized

  5. Factors Responsible for Students' Involvement in Internet Fraud as ...

    Internet fraud is one of the most rapidly increasing forms of cybercrime. It has become rampant among students generally because they make use of different Internet devices in schools. The purpose of this study was to examine the factors responsible for students' involvement in Internet fraud as expressed by tertiary ...

  6. Chenodeoxycholic acid stimulated fibroblast growth factor 19 response

    Borup, C; Wildt, S; Rumessen, J J

    2017-01-01

    BACKGROUND: Bile acid diarrhoea is underdiagnosed and better diagnostic tests are needed. Fasting serum fibroblast growth factor-19 (FGF19) has insufficient diagnostic value, but this may be improved by stimulation. AIM: To explore if an impaired FGF19 response identifies primary bile acid...

  7. Fibrinolytic response to tumor necrosis factor in healthy subjects

    van der Poll, T.; Levi, M. [=Marcel M.; Büller, H. R.; van Deventer, S. J.; de Boer, J. P.; Hack, C. E.; ten Cate, J. W.

    1991-01-01

    Tumor necrosis factor (TNF) may be involved in the disturbance of the procoagulant-fibrinolytic balance in septicemia, leading to microvascular thrombosis. To assess the dynamics of the fibrinolytic response to TNF in humans, we performed a crossover saline-controlled study in six healthy men,

  8. gender and school types as factors responsible for job stress

    Emeka Egbochuku

    public Universities should be looked into so that all factors responsible for stress might be .... universities in Malaysia, university academic staffs faced more problems .... adjustment with different coping styles. .... in college students: The role of rumination and stress. ... International Journal of Stress Management, 8, 285–29.

  9. Bayes Factor Covariance Testing in Item Response Models.

    Fox, Jean-Paul; Mulder, Joris; Sinharay, Sandip

    2017-12-01

    Two marginal one-parameter item response theory models are introduced, by integrating out the latent variable or random item parameter. It is shown that both marginal response models are multivariate (probit) models with a compound symmetry covariance structure. Several common hypotheses concerning the underlying covariance structure are evaluated using (fractional) Bayes factor tests. The support for a unidimensional factor (i.e., assumption of local independence) and differential item functioning are evaluated by testing the covariance components. The posterior distribution of common covariance components is obtained in closed form by transforming latent responses with an orthogonal (Helmert) matrix. This posterior distribution is defined as a shifted-inverse-gamma, thereby introducing a default prior and a balanced prior distribution. Based on that, an MCMC algorithm is described to estimate all model parameters and to compute (fractional) Bayes factor tests. Simulation studies are used to show that the (fractional) Bayes factor tests have good properties for testing the underlying covariance structure of binary response data. The method is illustrated with two real data studies.

  10. E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor

    Hiebert, S.W.; Lipp, M.; Nevins, J.R.

    1989-01-01

    E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription

  11. Factors associated with physical activity promotion by allied and other non-medical health professionals: A systematic review.

    Crisford, Paul; Winzenberg, Tania; Venn, Alison; Schultz, Martin; Aitken, Dawn; Cleland, Verity

    2018-05-21

    To identify factors associated with non-medical health professionals' engagement in physical activity (PA) promotion. Five electronic databases were searched for studies including practising health professionals (excluding medical doctors), a PA promotion practice measure, a test of association between potential influencing factors and PA promotion practice, and written in English. Two researchers independently screened studies and extracted data. Extracted data were synthesized in a tabular format with a narrative summary (thematic analysis). Thirty studies involving 7734 non-medical health professionals were included. Self-efficacy in PA promotion, positive beliefs in the benefits of PA, assessing patients' PA, and PA promotion training were the main factors associated with engaging in PA promotion. Lack of remuneration was not associated. Common study limitations included a lack of information on non-responders, data collection by survey only and limited reliability or validity testing of measurements. There are common factors influencing PA promotion, but the absence of studies from some health professions, limitations related to study measures, and the lack of randomised controlled intervention trials highlights the need for further research. The factors identified may prove useful for guiding the development of strategies to encourage greater engagement in PA promotion by health professionals. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Endoglin negatively regulates transforming growth factor beta1-induced profibrotic responses in intestinal fibroblasts.

    Burke, J P

    2012-02-01

    BACKGROUND: Fibroblasts isolated from strictures in Crohn\\'s disease (CD) exhibit reduced responsiveness to stimulation with transforming growth factor (TGF) beta1. TGF-beta1, acting through the smad pathway, is critical to fibroblast-mediated intestinal fibrosis. The membrane glycoprotein, endoglin, is a negative regulator of TGF-beta1. METHODS: Intestinal fibroblasts were cultured from seromuscular biopsies of patients undergoing intestinal resection for CD strictures or from control patients. Endoglin expression was assessed using confocal microscopy, flow cytometry and western blot. The effect of small interfering (si) RNA-mediated knockdown and plasmid-mediated overexpression of endoglin on fibroblast responsiveness to TGF-beta1 was assessed by examining smad phosphorylation, smad binding element (SBE) promoter activity, connective tissue growth factor (CTGF) expression and ability to contract collagen. RESULTS: Crohn\\'s stricture fibroblasts expressed increased constitutive cell-surface and whole-cell endoglin relative to control cells. Endoglin co-localized with filamentous actin. Fibroblasts treated with siRNA directed against endoglin exhibited enhanced TGF-beta1-mediated smad-3 phosphorylation, and collagen contraction. Cells transfected with an endoglin plasmid did not respond to TGF-beta1 by exhibiting SBE promoter activity or producing CTGF. CONCLUSION: Fibroblasts from strictures in CD express increased constitutive endoglin. Endoglin is a negative regulator of TGF-beta1 signalling in the intestinal fibroblast, modulating smad-3 phosphorylation, SBE promoter activity, CTGF production and collagen contraction.

  13. Instructive role of the vascular niche in promoting tumour growth and tissue repair by angiocrine factors.

    Butler, Jason M; Kobayashi, Hideki; Rafii, Shahin

    2010-02-01

    The precise mechanisms whereby anti-angiogenesis therapy blocks tumour growth or causes vascular toxicity are unknown. We propose that endothelial cells establish a vascular niche that promotes tumour growth and tissue repair not only by delivering nutrients and O2 but also through an 'angiocrine' mechanism by producing stem and progenitor cell-active trophogens. Identification of endothelial-derived instructive angiocrine factors will allow direct tumour targeting, while diminishing the unwanted side effects associated with the use of anti-angiogenic agents.

  14. Dynamics of ethylene production in response to compatible Nod factor

    Reid, Dugald; Liu, Huijun; Kelly, Simon

    2018-01-01

    Establishment of symbiotic nitrogen-fixation in legumes is regulated by the plant hormone ethylene, but it has remained unclear whether and how its biosynthesis is regulated by the symbiotic pathway. We established a sensitive ethylene detection system for Lotus japonicus and found that ethylene...... production increased as early as six hours after inoculation with Mesorhizobium loti. This ethylene response was dependent on Nod factor production by compatible rhizobia. Analyses of nodulation mutants showed that perception of Nod factor was required for ethylene emission, while downstream transcription...... factors including CYCLOPS, NIN and ERN1 were not required for this response. Activation of the nodulation signalling pathway in spontaneously nodulating mutants was also sufficient to elevate ethylene production. Ethylene signalling is controlled by EIN2, which is duplicated in L. japonicus. We obtained...

  15. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  16. Factors Predicting the Physical Activity Behavior of Female Adolescents: A Test of the Health Promotion Model

    Hashem Mohamadian

    2014-01-01

    Full Text Available ObjectivesPhysical activity behavior begins to decline during adolescence and continues to decrease throughout young adulthood. This study aims to explain factors that influence physical activity behavior in a sample of female adolescents using a health promotion model framework.MethodsThis cross-sectional survey was used to explore physical activity behavior among a sample of female adolescents. Participants completed measures of physical activity, perceived self-efficacy, self-esteem, social support, perceived barriers, and perceived affect. Interactions among the variables were examined using path analysis within a covariance modeling framework.ResultsThe final model accounted for an R2 value of 0.52 for physical activity and offered a good model-data fit. The results indicated that physical activity was predicted by self-esteem (β=0.46, p<0.001, perceived self-efficacy (β=0.40, p<0.001, social support (β=0.24, p<0.001, perceived barriers (β=-0.19, p<0.001, and perceived affect (β=0.17, p<0.001.ConclusionsThe findings of this study showed that the health promotion model was useful to predict physical activity behavior among the Iranian female adolescents. Information related to the predictors of physical activity behavior will help researchers plan more tailored culturally relevant health promotion interventions for this population.

  17. B Cells Promote Th1- Skewed NKT Cell Response by CD1d-TCR Interaction

    Shin, Jung Hoon; Park, Se-Ho

    2013-01-01

    CD1d expressing dendritic cells (DCs) are good glyco-lipid antigen presenting cells for NKT cells. However, resting B cells are very weak stimulators for NKT cells. Although ?-galactosylceramide (?-GalCer) loaded B cells can activate NKT cells, it is not well defined whether B cells interfere NKT cell stimulating activity of DCs. Unexpectedly, we found in this study that B cells can promote Th1-skewed NKT cell response, which means a increased level of IFN-? by NKT cells, concomitant with a d...

  18. The wake-promoting hypocretin/orexin neurons change their response to noradrenaline after sleep deprivation.

    Grivel, Jeremy; Cvetkovic, Vesna; Bayer, Laurence; Machard, Danièle; Tobler, Irene; Mühlethaler, Michel; Serafin, Mauro

    2005-04-20

    Sleep deprivation is accompanied by the progressive development of an irresistible need to sleep, a phenomenon whose mechanism has remained elusive. Here, we identified for the first time a reflection of that phenomenon in vitro by showing that, after a short 2 h period of total sleep deprivation, the action of noradrenaline on the wake-promoting hypocretin/orexin neurons changes from an excitation to an inhibition. We propose that such a conspicuous modification of responsiveness should contribute to the growing sleepiness that accompanies sleep deprivation.

  19. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  20. Price promotions on healthier compared with less healthy foods: a hierarchical regression analysis of the impact on sales and social patterning of responses to promotions in Great Britain.

    Nakamura, Ryota; Suhrcke, Marc; Jebb, Susan A; Pechey, Rachel; Almiron-Roig, Eva; Marteau, Theresa M

    2015-04-01

    There is a growing concern, but limited evidence, that price promotions contribute to a poor diet and the social patterning of diet-related disease. We examined the following questions: 1) Are less-healthy foods more likely to be promoted than healthier foods? 2) Are consumers more responsive to promotions on less-healthy products? 3) Are there socioeconomic differences in food purchases in response to price promotions? With the use of hierarchical regression, we analyzed data on purchases of 11,323 products within 135 food and beverage categories from 26,986 households in Great Britain during 2010. Major supermarkets operated the same price promotions in all branches. The number of stores that offered price promotions on each product for each week was used to measure the frequency of price promotions. We assessed the healthiness of each product by using a nutrient profiling (NP) model. A total of 6788 products (60%) were in healthier categories and 4535 products (40%) were in less-healthy categories. There was no significant gap in the frequency of promotion by the healthiness of products neither within nor between categories. However, after we controlled for the reference price, price discount rate, and brand-specific effects, the sales uplift arising from price promotions was larger in less-healthy than in healthier categories; a 1-SD point increase in the category mean NP score, implying the category becomes less healthy, was associated with an additional 7.7-percentage point increase in sales (from 27.3% to 35.0%; P sales uplift from promotions was larger for higher-socioeconomic status (SES) groups than for lower ones (34.6% for the high-SES group, 28.1% for the middle-SES group, and 23.1% for the low-SES group). Finally, there was no significant SES gap in the absolute volume of purchases of less-healthy foods made on promotion. Attempts to limit promotions on less-healthy foods could improve the population diet but would be unlikely to reduce health

  1. Serious, Minor, and Non-Delinquents in Early Adolescence: The Impact of Cumulative Risk and Promotive Factors. The TRAILS Study

    van der Laan, Andre M.; Veenstra, Rene; Bogaerts, Stefan; Verhulst, Frank C.; Ormel, Johan

    2010-01-01

    This study uses a social-ecological approach to the development of delinquency. The authors emphasize that a balance between eliminating risk and enhancing protection across domains is essential in reducing problems and promoting competence. The cumulative risk and promotive effects of temperament, family and school factors in preadolescence were…

  2. The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses.

    Takahama, Michihiro; Fukuda, Mitsunori; Ohbayashi, Norihiko; Kozaki, Tatsuya; Misawa, Takuma; Okamoto, Toru; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya

    2017-09-19

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5), in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING), the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses

    Michihiro Takahama

    2017-09-01

    Full Text Available Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5, in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING, the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis.

  4. Health Promoting Life Style and Its Related Factors in Female Adolescents

    Nahid Golmakani

    2013-07-01

    Full Text Available   Background and Aim: One of the main strategies for keeping health is having healthy life style. Due to important role of adolescent health in community health promotion, this study aimed to determine health promoting life style in female adolescents of high schools and its associated factors in Mashhad, Iran. Methods: This cross- sectional study was conducted on 810 girls ranging in ages from 14to 18 years old, who were studying in high schools and selected using cluster sampling from in Mashhad, Iran in 2013. They completed questionnaires of demographic data and Adolescent Health Promoting AH scale. Data were analyzed by statistical tests of Mann-Whitney U, Kruskal-Wallis, Freedman, Wilcoxon, Spearman correlation coefficient and General linear model. Results: The mean age of subjects was 15.51±0.98 and the mean score of life style was 63.92±12.01. The highest score of life style subscales was allocated to the “spiritual growth or life-appreciation (77.66±15.56 and the least to the physical and sport activities (51.66±22.49. There was a significant relationship between the life style score of adolescents with parents educational level (mother P=0.024, father P=0.014. However no significant relationship was found between adolescents' life style and their residential area and also parents' job. Among different dimension of life style, the highest correlation was seen between spiritual growth score and life style total score (p=0.01. Conclusion: Based on the findings, it is necessary to prioritize implementing of health-related educational programs in order to changing and modification of unhealthy life style related factors, with focus on sport activities as well as health and nutrition. Also it is needed to provide special facilities to select healthy living behaviors among Female adolescents.

  5. Factors influencing societal response of nanotechnology: an expert stakeholder analysis

    Gupta, Nidhi, E-mail: nidhi.gupta@wur.nl; Fischer, Arnout R. H., E-mail: arnout.fischer@wur.nl; Lans, Ivo A. van der, E-mail: Ivo.vanderLans@wur.nl [Wageningen University, Marketing and Consumer Behaviour Group (Netherlands); Frewer, Lynn J., E-mail: lynn.frewer@newcastle.ac.uk [Newcastle University, School of Agriculture, Food and Rural Development (United Kingdom)

    2012-05-15

    Nanotechnology can be described as an emerging technology and, as has been the case with other emerging technologies such as genetic modification, different socio-psychological factors will potentially influence societal responses to its development and application. These factors will play an important role in how nanotechnology is developed and commercialised. This article aims to identify expert opinion on factors influencing societal response to applications of nanotechnology. Structured interviews with experts on nanotechnology from North West Europe were conducted using repertory grid methodology in conjunction with generalized Procrustes analysis to examine the psychological constructs underlying societal uptake of 15 key applications of nanotechnology drawn from different areas (e.g. medicine, agriculture and environment, chemical, food, military, sports, and cosmetics). Based on expert judgement, the main factors influencing societal response to different applications of nanotechnology will be the extent to which applications are perceived to be beneficial, useful, and necessary, and how 'real' and physically close to the end-user these applications are perceived to be by the public.

  6. Factors influencing societal response of nanotechnology: an expert stakeholder analysis

    Gupta, Nidhi; Fischer, Arnout R. H.; Lans, Ivo A. van der; Frewer, Lynn J.

    2012-01-01

    Nanotechnology can be described as an emerging technology and, as has been the case with other emerging technologies such as genetic modification, different socio-psychological factors will potentially influence societal responses to its development and application. These factors will play an important role in how nanotechnology is developed and commercialised. This article aims to identify expert opinion on factors influencing societal response to applications of nanotechnology. Structured interviews with experts on nanotechnology from North West Europe were conducted using repertory grid methodology in conjunction with generalized Procrustes analysis to examine the psychological constructs underlying societal uptake of 15 key applications of nanotechnology drawn from different areas (e.g. medicine, agriculture and environment, chemical, food, military, sports, and cosmetics). Based on expert judgement, the main factors influencing societal response to different applications of nanotechnology will be the extent to which applications are perceived to be beneficial, useful, and necessary, and how 'real' and physically close to the end-user these applications are perceived to be by the public.

  7. Factors influencing societal response of nanotechnology: an expert stakeholder analysis

    Gupta, Nidhi; Fischer, Arnout R. H.; van der Lans, Ivo A.; Frewer, Lynn J.

    2012-05-01

    Nanotechnology can be described as an emerging technology and, as has been the case with other emerging technologies such as genetic modification, different socio-psychological factors will potentially influence societal responses to its development and application. These factors will play an important role in how nanotechnology is developed and commercialised. This article aims to identify expert opinion on factors influencing societal response to applications of nanotechnology. Structured interviews with experts on nanotechnology from North West Europe were conducted using repertory grid methodology in conjunction with generalized Procrustes analysis to examine the psychological constructs underlying societal uptake of 15 key applications of nanotechnology drawn from different areas (e.g. medicine, agriculture and environment, chemical, food, military, sports, and cosmetics). Based on expert judgement, the main factors influencing societal response to different applications of nanotechnology will be the extent to which applications are perceived to be beneficial, useful, and necessary, and how 'real' and physically close to the end-user these applications are perceived to be by the public.

  8. Synthetic Promoters and Transcription Factors for Heterologous Protein Expression in Saccharomyces cerevisiae

    Fabian Machens

    2017-10-01

    Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.

  9. Functional Characterization of TaSnRK2.8 Promoter in Response to Abiotic Stresses by Deletion Analysis in Transgenic Arabidopsis

    Hongying Zhang

    2017-07-01

    Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.

  10. Tick saliva inhibits dendritic cell migration, maturation and function, while promoting development of Th2 responses

    Skallová, Anna; Iezzi, G.; Ampenberger, F.; Kopf, M.; Kopecký, Jan

    2008-01-01

    Roč. 180, č. 9 (2008), s. 6186-9192 ISSN 0022-1767 R&D Projects: GA ČR GA524/05/0811; GA MŠk(CZ) LC06009 Institutional research plan: CEZ:AV0Z60220518 Keywords : dendritic cell * tick saliva * Th2 * immune responses Subject RIV: EC - Immunology Impact factor: 6.000, year: 2008

  11. Behavioral Counseling to Promote a Healthful Diet and Physical Activity for CVD Prevention in Adults with Risk Factors

    Understanding Task Force Recommendations Behavioral Counseling to Promote a Healthful Diet and Physical Activity for Cardiovascular Disease Prevention in Adults with Cardiovascular Risk Factors The U.S. Preventive ...

  12. GTPase ROP2 binds and promotes activation of target of rapamycin, TOR, in response to auxin.

    Schepetilnikov, Mikhail; Makarian, Joelle; Srour, Ola; Geldreich, Angèle; Yang, Zhenbiao; Chicher, Johana; Hammann, Philippe; Ryabova, Lyubov A

    2017-04-03

    Target of rapamycin (TOR) promotes reinitiation at upstream ORFs (uORFs) in genes that play important roles in stem cell regulation and organogenesis in plants. Here, we report that the small GTPase ROP2, if activated by the phytohormone auxin, promotes activation of TOR, and thus translation reinitiation of uORF-containing mRNAs. Plants with high levels of active ROP2, including those expressing constitutively active ROP2 (CA-ROP2), contain high levels of active TOR ROP2 physically interacts with and, when GTP-bound, activates TOR in vitro TOR activation in response to auxin is abolished in ROP-deficient rop2 rop6 ROP4 RNAi plants. GFP-TOR can associate with endosome-like structures in ROP2-overexpressing plants, indicating that endosomes mediate ROP2 effects on TOR activation. CA-ROP2 is efficient in loading uORF-containing mRNAs onto polysomes and stimulates translation in protoplasts, and both processes are sensitive to TOR inhibitor AZD-8055. TOR inactivation abolishes ROP2 regulation of translation reinitiation, but not its effects on cytoskeleton or intracellular trafficking. These findings imply a mode of translation control whereby, as an upstream effector of TOR, ROP2 coordinates TOR function in translation reinitiation pathways in response to auxin. © 2017 The Authors.

  13. Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses.

    Pépin, Geneviève; Nejad, Charlotte; Ferrand, Jonathan; Thomas, Belinda J; Stunden, H James; Sanij, Elaine; Foo, Chwan-Hong; Stewart, Cameron R; Cain, Jason E; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P

    2017-10-03

    Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1) by low-dose camptothecin (CPT) can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS) detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40) large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development. IMPORTANCE Recent studies suggest that low-dose DNA-damaging compounds traditionally used in cancer therapy can have opposite effects on antiviral responses, either suppressing (with the example of CPT) or potentiating (with the example of doxorubicin) them. Our work demonstrates that the minor DNA damage promoted by low-dose CPT can also trigger strong antiviral responses, dependent on the presence of viral oncogenes. Taken together, these results call for caution in the therapeutic use of low-dose chemotherapy agents to modulate antiviral responses in humans. Copyright © 2017 Pépin et al.

  14. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  15. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  16. Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities

    Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse

    2016-01-01

    Background Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. Objectives The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. Design A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. Results The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. Conclusions The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people. PMID:26787421

  17. Cow placenta extract promotes murine hair growth through enhancing the insulin - like growth factor-1

    Dongliang Zhang

    2011-01-01

    Full Text Available Background: Hair loss is seen as an irreversible process. Most research concentrates on how to elongate the anagen, reduce the negative factors of obstructing hair growth and improve the hair number and size. Aim: In our experiment, we tried to prove that the cow placenta extract can promote hair growth by elongating hair shaft and increasing hair follicle number. Materials and Methods: Cow placenta extract (CPE, water and minoxidil applied separately on the back of depilated B57CL/6 mice for the case, negative and positive control respectively. We checked the proliferation of cells which are resident in hair sheath, and the expression of a few growth factors which stimulate hair growth. Results: Result shows that placenta extract more efficiently accelerates cell division and growth factor expression, by raising the insulin-like growth factor (IGF-1 mRNA and protein level to increase HF size and hair length. Conclusions: The extract is not a purified product; so, it is less effective than minoxidil, which is approved by the US FDA for the treatment of male pattern baldness. If refinement is done, the placenta extract would be a good candidate medicine for hair loss.

  18. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong, E-mail: yelihong@nankai.edu.cn [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  19. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-01-01

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells

  20. Extracellular matrix organization modulates fibroblast growth and growth factor responsiveness.

    Nakagawa, S; Pawelek, P; Grinnell, F

    1989-06-01

    To learn more about the relationship between extracellular matrix organization, cell shape, and cell growth control, we studied DNA synthesis by fibroblasts in collagen gels that were either attached to culture dishes or floating in culture medium during gel contraction. After 4 days of contraction, the collagen density (initially 1.5 mg/ml) reached 22 mg/ml in attached gels and 55 mg/ml in floating gels. After contraction, attached collagen gels were well organized; collagen fibrils were aligned in the plane of cell spreading; and fibroblasts had an elongated, bipolar morphology. Floating collagen gels, however, were unorganized; collagen fibrils were arranged randomly; and fibroblasts had a stellate morphology. DNA synthesis by fibroblasts in contracted collagen gels was suppressed if the gels were floating in medium but not if the gels were attached, and inhibition was independent of the extent of gel contraction. Therefore, growth of fibroblasts in contracted collagen gels could be regulated by differences in extracellular matrix organization and cell shape independently of extracellular matrix density. We also compared the responses of fibroblasts in contracted collagen gels and monolayer culture to peptide growth factors including fibroblast growth factor, platelet-derived growth factor, transforming growth factor-beta, and interleukin 1. Cells in floating collagen gels were generally unresponsive to any of the growth factors. Cells in attached collagen gels and monolayer culture were affected similarly by fibroblast growth factor but not by the others. Our results indicate that extracellular matrix organization influenced not only cell growth, but also fibroblast responsiveness to peptide growth factors.

  1. Identification, Validation and Utilization of Novel Nematode-Responsive Root-Specific Promoters in Arabidopsis for Inducing Host-Delivered RNAi Mediated Root-Knot Nematode Resistance

    Atul Kakrana

    2017-12-01

    Full Text Available The root-knot nematode (RKN, Meloidogyne incognita, is an obligate, sedentary endoparasite that infects a large number of crops and severely affects productivity. The commonly used nematode control strategies have their own limitations. Of late, RNA interference (RNAi has become a popular approach for the development of nematode resistance in plants. Transgenic crops capable of expressing dsRNAs, specifically in roots for disrupting the parasitic process, offer an effective and efficient means of producing resistant crops. We identified nematode-responsive and root-specific (NRRS promoters by using microarray data from the public domain and known conserved cis-elements. A set of 51 NRRS genes was identified which was narrowed down further on the basis of presence of cis-elements combined with minimal expression in the absence of nematode infection. The comparative analysis of promoters from the enriched NRRS set, along with earlier reported nematode-responsive genes, led to the identification of specific cis-elements. The promoters of two candidate genes were used to generate transgenic plants harboring promoter GUS constructs and tested in planta against nematodes. Both promoters showed preferential expression upon nematode infection, exclusively in the root in one and galls in the other. One of these NRRS promoters was used to drive the expression of splicing factor, a nematode-specific gene, for generating host-delivered RNAi-mediated nematode-resistant plants. Transgenic lines expressing dsRNA of splicing factor under the NRRS promoter exhibited upto a 32% reduction in number of galls compared to control plants.

  2. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  3. Adaptive growth factor delivery from a polyelectrolyte coating promotes synergistic bone tissue repair and reconstruction

    Shah, Nisarg J.; Hyder, Md. Nasim; Quadir, Mohiuddin A.; Dorval Courchesne, Noémie-Manuelle; Seeherman, Howard J.; Nevins, Myron; Spector, Myron; Hammond, Paula T.

    2014-01-01

    Traumatic wounds and congenital defects that require large-scale bone tissue repair have few successful clinical therapies, particularly for craniomaxillofacial defects. Although bioactive materials have demonstrated alternative approaches to tissue repair, an optimized materials system for reproducible, safe, and targeted repair remains elusive. We hypothesized that controlled, rapid bone formation in large, critical-size defects could be induced by simultaneously delivering multiple biological growth factors to the site of the wound. Here, we report an approach for bone repair using a polyelectrolye multilayer coating carrying as little as 200 ng of bone morphogenetic protein-2 and platelet-derived growth factor-BB that were eluted over readily adapted time scales to induce rapid bone repair. Based on electrostatic interactions between the polymer multilayers and growth factors alone, we sustained mitogenic and osteogenic signals with these growth factors in an easily tunable and controlled manner to direct endogenous cell function. To prove the role of this adaptive release system, we applied the polyelectrolyte coating on a well-studied biodegradable poly(lactic-co-glycolic acid) support membrane. The released growth factors directed cellular processes to induce bone repair in a critical-size rat calvaria model. The released growth factors promoted local bone formation that bridged a critical-size defect in the calvaria as early as 2 wk after implantation. Mature, mechanically competent bone regenerated the native calvaria form. Such an approach could be clinically useful and has significant benefits as a synthetic, off-the-shelf, cell-free option for bone tissue repair and restoration. PMID:25136093

  4. Appeals to consumer responsibility and improving structural conditions as means to promote sustainable consumer behavior

    Thøgersen, John

    for their acts or (b) structural conditions determined by governments? In field experiments with large samples of ordinary consumers, the behavioral effects of perceptions of responsibility/personal moral norms and of altering an important structural condition are quantified by measuring a relevant behavior......-developed public transit service. The results suggest that there is often more to gain from changing structural conditions to be more facilitating for the desired behavior than from a campaign targeting consumer feelings of responsibility.......Environmental policy-makers increasingly emphasize consumers' responsibility for environmental side effects of their acts, but is this justified? This paper investigates which is the most important limiting factor for sustainable consumption: (a) the extent to which consumers assume responsibility...

  5. Biogastronomy: Factors that determine the biological response to meal ingestion.

    Pribic, T; Azpiroz, F

    2018-02-02

    The biological response to a meal includes physiological changes, primarily related to the digestive process, and a sensory experience, involving sensations related to the homeostatic control of food consumption, eg, satiety and fullness, with a hedonic dimension, ie associated with changes in digestive well-being and mood. The responses to a meal include a series of events before, during and after ingestion. While much attention has been paid to the events before and during ingestion, relatively little is known about the postprandial sensations, which are key to the gastronomical experience. The aim of this narrative review is to provide a comprehensive overview and to define the framework to investigate the factors that determine the postprandial experience. Based on a series of proof-of-concept studies and related information, we propose that the biological responses to a meal depend on the characteristics of the meal, primarily its palatability and composition, and the responsiveness of the guest, which may be influenced by multiple previous and concurrent conditioning factors. This information provides the scientific backbone to the development of personalized gastronomy. © 2018 John Wiley & Sons Ltd.

  6. Performance related factors are the main determinants of the von Willebrand factor response to exhaustive physical exercise.

    van Loon, Janine E; Sonneveld, Michelle A H; Praet, Stephan F E; de Maat, Moniek P M; Leebeek, Frank W G

    2014-01-01

    Physical stress triggers the endothelium to release von Willebrand Factor (VWF) from the Weibel Palade bodies. Since VWF is a risk factor for arterial thrombosis, it is of great interest to discover determinants of VWF response to physical stress. We aimed to determine the main mediators of the VWF increase by exhaustive physical exercise. 105 healthy individuals (18-35 years) were included in this study. Each participant performed an incremental exhaustive exercise test on a cycle ergometer. Respiratory gas exchange measurements were obtained while cardiac function was continuously monitored. Blood was collected at baseline and directly after exhaustion. VWF antigen (VWF:Ag) levels, VWF collagen binding (VWF:CB) levels, ADAMTS13 activity and common variations in Syntaxin Binding Protein-5 (STXBP5, rs1039084 and rs9399599), Syntaxin-2 (STX2, rs7978987) and VWF (promoter, rs7965413) were determined. The median VWF:Ag level at baseline was 0.94 IU/mL [IQR 0.8-1.1] and increased with 47% [IQR 25-73] after exhaustive exercise to a median maximum VWF:Ag of 1.38 IU/mL [IQR 1.1-1.8] (pexercise (median increase 43% and 12%, both pexercise (females 1.2 IU/mL; males 1.7 IU/mL, p = 0.001), which was associated by a difference in performance. Genetic variations in STXBP5, STX2 and the VWF promoter were not associated with VWF:Ag levels at baseline nor with the VWF:Ag increase. VWF:Ag levels strongly increase upon exhaustive exercise and this increase is strongly determined by physical fitness level and the intensity of the exercise, while there is no clear effect of genetic variation in STXBP5, STX2 and the VWF promoter.

  7. Ranking low, feeling high: How hierarchical position and experienced power promote prosocial behavior in response to procedural justice.

    van Dijke, Marius; De Cremer, David; Langendijk, Gerben; Anderson, Cameron

    2018-02-01

    Research shows that power can lead to prosocial behavior by facilitating the behavioral expression of dispositional prosocial motivation. However, it is not clear how power may facilitate responses to contextual factors that promote prosocial motivation. Integrating fairness heuristic theory and the situated focus theory of power, we argue that in particular, organization members in lower (vs. higher) hierarchical positions who simultaneously experience a high (vs. low) sense of power respond with prosocial behavior to 1 important antecedent of prosocial motivation, that is, the enactment of procedural justice. The results from a multisource survey among employees and their leaders from various organizations (Study 1) and an experiment using a public goods dilemma (Study 2) support this prediction. Three subsequent experiments (Studies 3-5) show that this effect is mediated by perceptions of authority trustworthiness. Taken together, this research (a) helps resolve the debate regarding whether power promotes or undermines prosocial behavior, (b) demonstrates that hierarchical position and the sense of power can have very different effects on processes that are vital to the functioning of an organization, and (c) helps solve ambiguity regarding the roles of hierarchical position and power in fairness heuristic theory. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  8. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...

  9. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  10. Chlamydia infection across host species boundaries promotes distinct sets of transcribed anti-apoptotic factors.

    Joshua eMessinger

    2015-12-01

    Full Text Available Chlamydiae, obligate intracellular bacteria, cause significant human and veterinary associated diseases. Having emerged an estimated 700-million years ago, these bacteria have twice adapted to humans as a host species, causing sexually transmitted infection (C. trachomatis and respiratory associated disease (C. pneumoniae. The principle mechanism of host cell defense against these intracellular bacteria is the induction of cell death via apoptosis. However, in the arms race of co-evolution, Chlamydiae have developed mechanisms to promote cell viability and inhibit cell death. Herein we examine the impact of Chlamydiae infection across multiple host species on transcription of anti-apoptotic genes. We found mostly distinct patterns of gene expression (Mcl1 and cIAPs elicited by each pathogen-host pair indicating Chlamydiae infection across host species boundaries does not induce a universally shared host response. Understanding species specific host-pathogen interactions is paramount to deciphering how potential pathogens become emerging diseases.

  11. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Zhichun Zhang

    Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  12. The Arabidopsis Transcription Factor MYB112 Promotes Anthocyanin Formation during Salinity and under High Light Stress.

    Lotkowska, Magda E; Tohge, Takayuki; Fernie, Alisdair R; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-11-01

    MYB transcription factors (TFs) are important regulators of flavonoid biosynthesis in plants. Here, we report MYB112 as a formerly unknown regulator of anthocyanin accumulation in Arabidopsis (Arabidopsis thaliana). Expression profiling after chemically induced overexpression of MYB112 identified 28 up- and 28 down-regulated genes 5 h after inducer treatment, including MYB7 and MYB32, which are both induced. In addition, upon extended induction, MYB112 also positively affects the expression of PRODUCTION OF ANTHOCYANIN PIGMENT1, a key TF of anthocyanin biosynthesis, but acts negatively toward MYB12 and MYB111, which both control flavonol biosynthesis. MYB112 binds to an 8-bp DNA fragment containing the core sequence (A/T/G)(A/C)CC(A/T)(A/G/T)(A/C)(T/C). By electrophoretic mobility shift assay and chromatin immunoprecipitation coupled to quantitative polymerase chain reaction, we show that MYB112 binds in vitro and in vivo to MYB7 and MYB32 promoters, revealing them as direct downstream target genes. We further show that MYB112 expression is up-regulated by salinity and high light stress, environmental parameters that both require the MYB112 TF for anthocyanin accumulation under these stresses. In contrast to several other MYB TFs affecting anthocyanin biosynthesis, MYB112 expression is not controlled by nitrogen limitation or an excess of carbon. Thus, MYB112 constitutes a regulator that promotes anthocyanin accumulation under abiotic stress conditions. © 2015 American Society of Plant Biologists. All Rights Reserved.

  13. Leukemia inhibitory factor promote trophoblast invasion via urokinase-type plasminogen activator receptor in preeclampsia.

    Zheng, Qin; Dai, Kuixing; Cui, Xinyuan; Yu, Ming; Yang, Xuesong; Yan, Bin; Liu, Shuai; Yan, Qiu

    2016-05-01

    Preeclampsia is a pregnancy-related syndrome which can cause perinatal mortality and morbidity. Inadequate invasion by trophoblast cells may lead to poor perfusion of the placenta, even result in preeclampsia. Understanding the molecular mechanisms underlying placentation facilitates the better intervention of preeclampsia. Urokinase-type plasminogen activator receptor (uPAR) is involved in the physiological and pathological processes. Leukemia inhibitory factor (LIF) is an important regulator in the establishment of pregnancy. However, the expression of uPAR in preeclamptic patients and its relationship with LIF remains unclear. In the current study, we found that the level of uPAR was relatively lower in the placentas from preeclamptic patients as compared with normal pregnant women. LIF promoted trophoblast cell outgrowth by upregulating uPAR in an explants culture, and LIF also enhanced migration and invasion potential through uPAR in trophoblast JAR and JEG-3 cell lines, and with increased gelatinolytic activities of matrix metalloproteinase 2 (MMP-2). The effect of LIF and uPAR on trophoblast migration and invasion was mediated by PI3K/AKT signaling pathway. Our data indicates the roles of LIF in promoting trophoblast migration and invasion through uPAR and suggest that abnormal expression of uPAR might be associated with the etiology of preeclampsia. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  14. The Platelet Aggregation-Inducing Factor Aggrus/Podoplanin Promotes Pulmonary Metastasis

    Kunita, Akiko; Kashima, Takeshi G.; Morishita, Yasuyuki; Fukayama, Masashi; Kato, Yukinari; Tsuruo, Takashi; Fujita, Naoya

    2007-01-01

    Tumor cell-induced platelet aggregation has been reported to facilitate hematogenous metastasis. Aggrus/podoplanin is a platelet aggregation-inducing factor that is up-regulated in a number of human cancers and has been implicated in tumor progression. We studied herein the role of Aggrus in tumor growth, metastasis, and survival in vivo. Aggrus expression in Chinese hamster ovary cells promoted pulmonary metastasis in both an experimental and a spontaneous mouse model. No differences in the size of metastatic foci or in primary tumor growth were found in either set of mice. Aggrus-expressing cells, which were covered with platelets, arrested in the lung microvasculature 30 minutes after injection. In addition, lung metastasis resulting from Aggrus expression decreased the survival of the mice. By generating several Aggrus point mutants, we revealed that point mutation at the platelet aggregation-stimulating domain of Aggrus (Thr34 and Thr52) obliterated both platelet aggregation and metastasis. Furthermore, administration of aspirin to mice reduced the number of metastatic foci. These results indicate that Aggrus contributes to the establishment of metastasis by promoting platelet aggregation without affecting subsequent growth. Thus, Aggrus could serve as an ideal therapeutic target for drug development to block metastasis. PMID:17392172

  15. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-01-01

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX

  16. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....

  17. Snakebite Prognostic Factors: Leading Factors of Weak Therapeutic Response Following Snakebite Envenomation

    Bita Dadpour

    2012-12-01

    Full Text Available Background: The goal of antivenom administration for snake-bitten patients is to achieve therapeutic response (initial control, which means reversal of the venom-induced effects through neutralizing the venom. The aim of this study was to identify snakebite prognostic factors of weak therapeutic response prior to antivenom administration. Methods: This was a retrospective study of patients with viperidae snakebite envenomation who were admitted to Mashhad Toxicology Centre during 2007-2011. Demographic features, clinical manifestations and snakebite severity score (SSS were collected prior to antivenom administration. Total number of antivenom vials administered to achieve therapeutic response and duration of hospitalization were also recorded. Potential factors in snakebite prognosis were analyzed by comparing in two groups of achieving therapeutic response with less than 5 vials and over 5 to calculate odds ratio.  Results: Total of 108 patients (male/female: 85/23 with mean (SD age of 34.5 (17.0 were studied. The most common manifestations included fang marks (100%, pain (100%, ecchymosis (89%, swelling (83%, blister formation (48% and thrombocytopenia (25%. In univariate analysis, thrombocytopenia (P=0.01, spontaneous bleeding (P=0.02, coagulopathic disturbances (P=0.007, swelling (P=0.003, progressive swelling (P=0.005, ecchymosis (P=0.05 and respiratory distress (P= 0.05 were significantly correlated to weak therapeutic response. Swelling and spontaneous bleeding were the strongest snakebite prognostic factors, as respectively they put the patients at 12.4 and 10.4 fold risks for difficult achievement of therapeutic response. Conclusions: In snakebite, some clinical manifestations in the first hours of admission and prior to antivenom administration are associated with weak therapeutic response. Identifying these prognostic factors, can assist health care providers to better estimate the patient’s needs and predict the final

  18. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  19. Upland cotton gene GhFPF1 confers promotion of flowering time and shade-avoidance responses in Arabidopsis thaliana.

    Xiaoyan Wang

    Full Text Available Extensive studies on floral transition in model species have revealed a network of regulatory interactions between proteins that transduce and integrate developmental and environmental signals to promote or inhibit the transition to flowering. Previous studies indicated FLOWERING PROMOTING FACTOR 1 (FPF1 gene was involved in the promotion of flowering, but the molecular mechanism was still unclear. Here, FPF1 homologous sequences were screened from diploid Gossypium raimondii L. (D-genome, n = 13 and Gossypium arboreum L. genome (A-genome, n = 13 databases. Orthologous genes from the two species were compared, suggesting that distinctions at nucleic acid and amino acid levels were not equivalent because of codon degeneracy. Six FPF1 homologous genes were identified from the cultivated allotetraploid Gossypium hirsutum L. (AD-genome, n = 26. Analysis of relative transcripts of the six genes in different tissues revealed that this gene family displayed strong tissue-specific expression. GhFPF1, encoding a 12.0-kDa protein (Accession No: KC832319 exerted more transcripts in floral apices of short-season cotton, hinting that it could be involved in floral regulation. Significantly activated APETALA 1 and suppressed FLOWERING LOCUS C expression were induced by over-expression of GhFPF1 in the Arabidopsis Columbia-0 ecotype. In addition, transgenic Arabidopsis displayed a constitutive shade-avoiding phenotype that is characterized by long hypocotyls and petioles, reduced chlorophyll content, and early flowering. We propose that GhFPF1 may be involved in flowering time control and shade-avoidance responses.

  20. Hepatic leukemia factor promotes resistance to cell death: Implications for therapeutics and chronotherapy

    Waters, Katrina M.; Sontag, Ryan L.; Weber, Thomas J.

    2013-01-01

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional program encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation. - Highlights: ► Circadian-dependent physiological variation impacts therapeutic efficacy. ► Hepatic leukemia factor inhibits cell death and is a candidate circadian factor. ► Hepatic leukemia factor anti-death program is conserved in murine and human cells. ► Transcriptomics indicates the anti-death program results from a systems response

  1. Hepatic leukemia factor promotes resistance to cell death: Implications for therapeutics and chronotherapy

    Waters, Katrina M. [Computational Biology and Bioinformatics, Pacific Northwest National Laboratory, Richland, WA 99354 (United States); Sontag, Ryan L. [Systems Toxicology Groups, Pacific Northwest National Laboratory, Richland, WA 99354 (United States); Weber, Thomas J., E-mail: Thomas.Weber@pnl.gov [Systems Toxicology Groups, Pacific Northwest National Laboratory, Richland, WA 99354 (United States)

    2013-04-15

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional program encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation. - Highlights: ► Circadian-dependent physiological variation impacts therapeutic efficacy. ► Hepatic leukemia factor inhibits cell death and is a candidate circadian factor. ► Hepatic leukemia factor anti-death program is conserved in murine and human cells. ► Transcriptomics indicates the anti-death program results from a systems response.

  2. Forkhead Box M1 Is Regulated by Heat Shock Factor 1 and Promotes Glioma Cells Survival under Heat Shock Stress*

    Dai, Bingbing; Gong, Aihua; Jing, Zhitao; Aldape, Kenneth D.; Kang, Shin-Hyuk; Sawaya, Raymond; Huang, Suyun

    2013-01-01

    The forkhead box M1 (FoxM1) is a key transcription factor regulating multiple aspects of cell biology. Prior studies have shown that FoxM1 is overexpressed in a variety of human tumors, including brain tumor, and plays a critical role in cancer development and progression. In this study we found that FoxM1 was up-regulated by heat shock factor 1 (HSF1) under heat shock stress condition in multiple cell lines. Knockdown of HSF1 with HSF1 siRNA or inhibition of HSF1 with a HSF1 inhibitor abrogated heat shock-induced expression of FoxM1. Genetic deletion of HSF1 in mouse embryo fibroblast cells also abolished heat shock stress-induced FoxM1 expression. Moreover, we showed that HSF1 directly bound to FoxM1 promoter and increased FoxM1 promoter activity. Furthermore, we demonstrated that FoxM1 was required for the G2-M phase progression through regulating Cdc2, Cdc20, and Cdc25B under a mild heat shock stress but enhanced cell survival under lethal heat shock stress condition. Finally, in human glioblastoma specimens, FoxM1 overexpression correlated with elevated HSF1 expression. Our results indicate that FoxM1 is regulated by HSF1 and is critical for HSF1-mediated heat shock response. We demonstrated a novel mechanism of stress resistance controlled by HSF1 and a new HSF-FoxM1 connection that mediates cellular thermotolerance. PMID:23192351

  3. The Belief that Alcohol Use is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents

    Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.

    2011-01-01

    This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year. PMID:23519434

  4. The Belief that Alcohol Use is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents.

    Henry, Kimberly L; Shtivelband, Annette; Comello, Maria Leonora G; Slater, Michael D

    2011-08-01

    This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year.

  5. Interleukin-Driven Insulin-Like Growth Factor Promotes Prostatic Inflammatory Hyperplasia

    Hahn, Alana M.; Myers, Jason D.; McFarland, Eliza K.; Lee, Sanghee

    2014-01-01

    Prostatic inflammation is of considerable importance to urologic research because of its association with benign prostatic hyperplasia and prostate cancer. However, the mechanisms by which inflammation leads to proliferation and growth remain obscure. Here, we show that insulin-like growth factors (IGFs), previously known as critical developmental growth factors during prostate organogenesis, are induced by inflammation as part of the proliferative recovery to inflammation. Using genetic models and in vivo IGF receptor blockade, we demonstrate that the hyperplastic response to inflammation depends on interleukin-1–driven IGF signaling. We show that human prostatic hyperplasia is associated with IGF pathway activation specifically localized to foci of inflammation. This demonstrates that mechanisms of inflammation-induced epithelial proliferation and hyperplasia involve the induction of developmental growth factors, further establishing a link between inflammatory and developmental signals and providing a mechanistic basis for the management of proliferative diseases by IGF pathway modulation. PMID:25292180

  6. Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing

    Zhang, Yong; Yu, Guoyu; Xiang, Yang; Wu, Jianbo; Jiang, Ping; Lee, Wenhui; Zhang, Yun

    2010-01-01

    Research highlights: → Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. → Bm-TFF2 suppresses cell apoptosis. → Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.

  7. Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing

    Zhang, Yong [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Yu, Guoyu [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Department of Biochemistry, Kunming Medical College, Kunming, Yunnan 650032 (China); Xiang, Yang [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Wu, Jianbo [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Jiang, Ping [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Lee, Wenhui [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Zhang, Yun, E-mail: zhangy@mail.kiz.ac.cn [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)

    2010-07-30

    Research highlights: {yields} Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. {yields} Bm-TFF2 suppresses cell apoptosis. {yields} Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.

  8. Uric acid promotes vascular stiffness, maladaptive inflammatory responses and proteinuria in western diet fed mice.

    Aroor, Annayya R; Jia, Guanghong; Habibi, Javad; Sun, Zhe; Ramirez-Perez, Francisco I; Brady, Barron; Chen, Dongqing; Martinez-Lemus, Luis A; Manrique, Camila; Nistala, Ravi; Whaley-Connell, Adam T; Demarco, Vincent G; Meininger, Gerald A; Sowers, James R

    2017-09-01

    Aortic vascular stiffness has been implicated in the development of cardiovascular disease (CVD) and chronic kidney disease (CKD) in obese individuals. However, the mechanism promoting these adverse effects are unclear. In this context, promotion of obesity through consumption of a western diet (WD) high in fat and fructose leads to excess circulating uric acid. There is accumulating data implicating elevated uric acid in the promotion of CVD and CKD. Accordingly, we hypothesized that xanthine oxidase(XO) inhibition with allopurinol would prevent a rise in vascular stiffness and proteinuria in a translationally relevant model of WD-induced obesity. Four-week-old C57BL6/J male mice were fed a WD with excess fat (46%) and fructose (17.5%) with or without allopurinol (125mg/L in drinking water) for 16weeks. Aortic endothelial and extracellular matrix/vascular smooth muscle stiffness was evaluated by atomic force microscopy. Aortic XO activity, 3-nitrotyrosine (3-NT) and aortic endothelial sodium channel (EnNaC) expression were evaluated along with aortic expression of inflammatory markers. In the kidney, expression of toll like receptor 4 (TLR4) and fibronectin were assessed along with evaluation of proteinuria. XO inhibition significantly attenuated WD-induced increases in plasma uric acid, vascular XO activity and oxidative stress, in concert with reductions in proteinuria. Further, XO inhibition prevented WD-induced increases in aortic EnNaC expression and associated endothelial and subendothelial stiffness. XO inhibition also reduced vascular pro-inflammatory and maladaptive immune responses induced by consumption of a WD. XO inhibition also decreased WD-induced increases in renal TLR4 and fibronectin that associated proteinuria. Consumption of a WD leads to elevations in plasma uric acid, increased vascular XO activity, oxidative stress, vascular stiffness, and proteinuria all of which are attenuated with allopurinol administration. Copyright © 2017 Elsevier Inc

  9. Transparency in authors' contributions and responsibilities to promote integrity in scientific publication.

    McNutt, Marcia K; Bradford, Monica; Drazen, Jeffrey M; Hanson, Brooks; Howard, Bob; Jamieson, Kathleen Hall; Kiermer, Véronique; Marcus, Emilie; Pope, Barbara Kline; Schekman, Randy; Swaminathan, Sowmya; Stang, Peter J; Verma, Inder M

    2018-03-13

    In keeping with the growing movement in scientific publishing toward transparency in data and methods, we propose changes to journal authorship policies and procedures to provide insight into which author is responsible for which contributions, better assurance that the list is complete, and clearly articulated standards to justify earning authorship credit. To accomplish these goals, we recommend that journals adopt common and transparent standards for authorship, outline responsibilities for corresponding authors, adopt the Contributor Roles Taxonomy (CRediT) (docs.casrai.org/CRediT) methodology for attributing contributions, include this information in article metadata, and require authors to use the ORCID persistent digital identifier (https://orcid.org). Additionally, we recommend that universities and research institutions articulate expectations about author roles and responsibilities to provide a point of common understanding for discussion of authorship across research teams. Furthermore, we propose that funding agencies adopt the ORCID identifier and accept the CRediT taxonomy. We encourage scientific societies to further authorship transparency by signing on to these recommendations and promoting them through their meetings and publications programs. Copyright © 2018 the Author(s). Published by PNAS.

  10. Maize response to inoculation with strains of plant growth-promoting bactéria

    Janaína Dartora

    Full Text Available ABSTRACT The aim of this study was to evaluate the response of maize to inoculation with strains of plant growth-promoting bacteria (PGPB in two cultivation years. The experiment was set in a randomized block design with four replicates in two cultivation years (2012/13 and 2013/14. The treatments consisted of PGPB inoculation: control (without N and without inoculation; 30 kg of N ha-1 at sowing (N1; 160 kg of N ha-1 (N1 + 130 kg of N ha-1 as top-dressing; N1 + A. brasilense, Ab-V5; N1 + A. brasilense, HM053; N1 + Azospirillum sp. L26; N1 + Azospirillum sp. L27; N1 + Enhydrobacter sp. 4331; N1 + Rhizobium sp. 8121. Basal stem diameter, plant height, leaf area, shoot dry matter and yield were evaluated. The strain of Rhizobium sp. 8121and the isolate Azospirillum sp. L26 associated with 30 kg of N ha-1 at sowing promoted yields equivalent to that of the N fertilization of 160 kg ha-1, demonstrating the potential to be used in the inoculation of maize seeds.

  11. Differential oxidative and antioxidative response of duckweed Lemna minor toward plant growth promoting/inhibiting bacteria.

    Ishizawa, Hidehiro; Kuroda, Masashi; Morikawa, Masaaki; Ike, Michihiko

    2017-09-01

    Bacteria colonizing the plant rhizosphere are believed to positively or negatively affect the host plant productivity. This feature has inspired researchers to engineer such interactions to enhance crop production. However, it remains to be elucidated whether rhizobacteria influences plant oxidative stress vis-a-vis other environmental stressors, and whether such influence is associated with their growth promoting/inhibiting ability. In this study, two plant growth-promoting bacteria (PGPB) and two plant growth-inhibiting bacteria (PGIB) were separately inoculated into axenic duckweed (Lemna minor) culture under laboratory conditions for 4 and 8 days in order to investigate their effects on plant oxidative stress and antioxidant activities. As previously characterized, the inoculation of PGPB and PGIB strains accelerated and reduced the growth of L. minor, respectively. After 4 and 8 days of cultivation, compared to the PGPB strains, the PGIB strains induced larger amounts of O 2 •- , H 2 O 2 , and malondialdehyde (MDA) in duckweed, although all bacterial strains consistently increased O 2 •- content by two times more than that in the aseptic control plants. Activities of five antioxidant enzymes were also elevated by the inoculation of PGIB, confirming the severe oxidative stress condition in plants. These results suggest that the surface attached bacteria affect differently on host oxidative stress and its response, which degree correlates negatively to their effects on plant growth. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Optimising women's diets. An examination of factors that promote healthy eating and reduce the likelihood of unhealthy eating.

    Williams, Lauren K; Thornton, Lukar; Crawford, David

    2012-08-01

    The majority of nutrition promotion research that has examined the determinants of unhealthy or healthy dietary behaviours has focused on factors that promote consumption of these foods, rather than factors that may both promote healthy eating and buffer or protect consumption of unhealthy foods. The purpose of this paper is to identify factors that both promote healthy eating and also reduce the likelihood of eating unhealthily amongst women. A community sample of 1013 Australian women participated in a cross-sectional self-report survey that assessed factors associated with diet and obesity. Multiple logistic regressions were used to examine the associations between a range of individual, social and environmental factors and aspects of both healthy and unhealthy eating, whilst controlling for key covariates. Results indicated that women with high self efficacy for healthy eating, taste preferences for fruit and vegetables, family support for healthy eating and the absence of perceived barriers to healthy eating (time and cost) were more likely to consume components of a healthy diet and less likely to consume components of a unhealthy diet. Optimal benefits in overall diet quality amongst women may be achieved by targeting factors associated with both healthy and unhealthy eating in nutrition promotion efforts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Oral treatment with enrofloxacin early in life promotes Th2-mediated immune response in mice.

    Strzępa, Anna; Majewska-Szczepanik, Monika; Kowalczyk, Paulina; Woźniak, Dorota; Motyl, Sylwia; Szczepanik, Marian

    2016-02-01

    Th2 lymphocytes play a crucial role in the development of allergy. These pathologies are caused by coordinated production of the cytokines IL-4, IL-5 and IL-13 that regulate the activity of eosinophils, basophils and B cells. According to the 'hygiene hypothesis', the reduced exposure to microorganisms favors allergy occurrence. The advances in medicine in the field of infection therapy promoted an increasing application of antibiotics which, apart from eliminating pathogens, also partially eliminate the microbiota. Epicutaneous (EC) immunization with ovalbumin (OVA) followed by OVA challenge was used to study the influence of partial gut flora depletion by oral treatment with enrofloxacin on type-2 immune response. Current work describes the influence of enrofloxacin application on anti-OVA antibody production and cytokine synthesis in young and adult mice. Immune response in adult mice is less sensitive to modification of natural gut flora. We observed that enrofloxacin treatment of adult mice leads to significant decrease of anti-OVA IgG2a production while synthesis of anti-OVA IgE was not changed. The production of type-1 (IFN-γ), type-2 (IL-4, IL-5, IL-10, IL-13) and Th17-associated (IL-17A) cytokines was inhibited. On the other hand, treatment of young mice with enrofloxacin significantly upregulates the production of anti-OVA IgE and inhibits the secretion of anti-OVA IgG2a antibodies. Additionally, treatment with enrofloxacin early in life prior to OVA immunization results in increased production of type-2 (IL-4, IL-10 and IL-13) cytokines. Our results clearly indicate that the immune system is more vulnerable to decreased bacterial exposure early in life that may promote development of allergy. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  14. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  15. Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

    Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra

    2013-01-01

    Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this

  16. Regulation of the CD56 promoter and its association with proliferation, anti-apoptosis and clinical factors in multiple myeloma

    Damgaard, Tina; Knudsen, Lene M; Dahl, Inger Marie S

    2009-01-01

    the regulation of the CD56 promoter in relation to typical clinical factors. We used qPCR and FACS to measure the expression levels of CD56, and potential regulatory factors in patients with MM and related these with MM progression/prognosis. The transcription factors BTBD3, Pax5, RUNX1 and MMSET were positively...... associated with CD56 expression, as was CYCLIN D1, which is involved in disease progression, anti-apoptosis and proliferation. RUNX1 was negatively associated with the survival of stem-cell transplanted patients. Our findings propose four potential activators of the CD56 promoter and for CD56 to be involved...

  17. Program to Promote Personal and Social Responsibility in the Secondary Classroom

    Miguel A. Carbonero

    2017-05-01

    Full Text Available The performance of school children has been studied by considering partial relationships between several personal variables such as the link between cognition and motivation. However, contextual variables, such as a child’s willingness to accept social responsibility, also influence students’ social and academic performance. Thus, students with greater responsibility have a better attitude toward their studies, resulting in higher academic achievement. This 2-year study aims to reveal to what extent an intervention program affects student performance and is based on the Theory of Positive Action among young people proposed by Don Hellison and the Theory of Reasoned Action by Fishbein and Ajzen. The program focuses on positive influences on social and personal responsibility, taking into consideration parental styles, gender, and academic performance. The program was a part of the educational curricula in participating schools and it targeted four main areas: (a teaching units using academic texts about social responsibility, (b student training in mediation processes, (c teacher training, and (d family training and involvement. A total of 271 students took part from first and second year of Secondary Education (12–14 years old. The experimental group was made up of 132 students while the remaining 139 formed the control group. All participants completed the Assessment Scale of Social Responsibility Attitudes in Secondary Education and the Parent–Adolescent Communication Scale. Results show that students in the experimental group performed significantly better than those in the control group. Additionally, the issue of social responsibility seems to be related to commitment, self-discipline and perseverance. Regarding gender, males appear to score higher in the factor for well-mannered, friendly and tidy. Finally, a positive relationship has been identified between social responsibility attitudes and parenting with an open communicational

  18. Program to Promote Personal and Social Responsibility in the Secondary Classroom.

    Carbonero, Miguel A; Martín-Antón, Luis J; Otero, Lourdes; Monsalvo, Eugenio

    2017-01-01

    The performance of school children has been studied by considering partial relationships between several personal variables such as the link between cognition and motivation. However, contextual variables, such as a child's willingness to accept social responsibility, also influence students' social and academic performance. Thus, students with greater responsibility have a better attitude toward their studies, resulting in higher academic achievement. This 2-year study aims to reveal to what extent an intervention program affects student performance and is based on the Theory of Positive Action among young people proposed by Don Hellison and the Theory of Reasoned Action by Fishbein and Ajzen. The program focuses on positive influences on social and personal responsibility, taking into consideration parental styles, gender, and academic performance. The program was a part of the educational curricula in participating schools and it targeted four main areas: (a) teaching units using academic texts about social responsibility, (b) student training in mediation processes, (c) teacher training, and (d) family training and involvement. A total of 271 students took part from first and second year of Secondary Education (12-14 years old). The experimental group was made up of 132 students while the remaining 139 formed the control group. All participants completed the Assessment Scale of Social Responsibility Attitudes in Secondary Education and the Parent-Adolescent Communication Scale. Results show that students in the experimental group performed significantly better than those in the control group. Additionally, the issue of social responsibility seems to be related to commitment, self-discipline and perseverance. Regarding gender, males appear to score higher in the factor for well-mannered, friendly and tidy. Finally, a positive relationship has been identified between social responsibility attitudes and parenting with an open communicational style. This paper

  19. The wake-promoting drug modafinil stimulates specific hypothalamic circuits to promote adaptive stress responses in an animal model of PTSD.

    Cohen, S; Ifergane, G; Vainer, E; Matar, M A; Kaplan, Z; Zohar, J; Mathé, A A; Cohen, H

    2016-10-11

    Pharmacotherapeutic intervention during traumatic memory consolidation has been suggested to alleviate or even prevent the development of posttraumatic stress disorder (PTSD). We recently reported that, in a controlled, prospective animal model, depriving rats of sleep following stress exposure prevents the development of a PTSD-like phenotype. Here, we report that administering the wake-promoting drug modafinil to rats in the aftermath of a stressogenic experience has a similar prophylactic effect, as it significantly reduces the prevalence of PTSD-like phenotype. Moreover, we show that the therapeutic value of modafinil appears to stem from its ability to stimulate a specific circuit within the hypothalamus, which ties together the neuropeptide Y, the orexin system and the HPA axis, to promote adaptive stress responses. The study not only confirms the value of sleep prevention and identifies the mechanism of action of a potential prophylactic treatment after traumatic exposure, but also contributes to understanding mechanisms underlying the shift towards adaptive behavioral response.

  20. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  1. Key Response Planning Factors for the Aftermath of Nuclear Terrorism

    Buddemeier, B R; Dillon, M B

    2009-01-21

    Despite hundreds of above-ground nuclear tests and data gathered from Hiroshima and Nagasaki, the effects of a ground-level, low-yield nuclear detonation in a modern urban environment are still the subject of considerable scientific debate. Extensive review of nuclear weapon effects studies and discussions with nuclear weapon effects experts from various federal agencies, national laboratories, and technical organizations have identified key issues and bounded some of the unknowns required to support response planning for a low-yield, ground-level nuclear detonation in a modern U.S. city. This study, which is focused primarily upon the hazards posed by radioactive fallout, used detailed fallout predictions from the advanced suite of three-dimensional (3-D) meteorology and plume/fallout models developed at Lawrence Livermore National Laboratory (LLNL), including extensive global Key Response Planning Factors for the Aftermath of Nuclear Terrorism geographical and real-time meteorological databases to support model calculations. This 3-D modeling system provides detailed simulations that account for complex meteorology and terrain effects. The results of initial modeling and analysis were presented to federal, state, and local working groups to obtain critical, broad-based review and feedback on strategy and messaging. This effort involved a diverse set of communities, including New York City, National Capitol Regions, Charlotte, Houston, Portland, and Los Angeles. The largest potential for reducing casualties during the post-detonation response phase comes from reducing exposure to fallout radiation. This can be accomplished through early, adequate sheltering followed by informed, delayed evacuation.B The response challenges to a nuclear detonation must be solved through multiple approaches of public education, planning, and rapid response actions. Because the successful response will require extensive coordination of a large number of organizations, supplemented by

  2. Jasmonate-responsive transcription factors regulating plant secondary metabolism.

    Zhou, Meiliang; Memelink, Johan

    2016-01-01

    Plants produce a large variety of secondary metabolites including alkaloids, glucosinolates, terpenoids and phenylpropanoids. These compounds play key roles in plant-environment interactions and many of them have pharmacological activity in humans. Jasmonates (JAs) are plant hormones which induce biosynthesis of many secondary metabolites. JAs-responsive transcription factors (TFs) that regulate the JAs-induced accumulation of secondary metabolites belong to different families including AP2/ERF, bHLH, MYB and WRKY. Here, we give an overview of the types and functions of TFs that have been identified in JAs-induced secondary metabolite biosynthesis, and highlight their similarities and differences in regulating various biosynthetic pathways. We review major recent developments regarding JAs-responsive TFs mediating secondary metabolite biosynthesis, and provide suggestions for further studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Factors Promoting Tubal Ligation in Females Presenting to Tertiary Care Centers

    Hammad Ali Qazi

    2009-09-01

    Full Text Available Objective: Despite development of new contraceptive methods, sterilization remained the most widely used method. Our objective was to determine the factors contributing to decision making for tubal ligation in females.Materials and methods: A cross sectional study was conducted in Jinnah Post graduate Medical Centre (JPMC between March - November 2008. About 505 Females using contraceptive measures were consecutively included. Those having any severe debilitating disease and unfamiliar with “urdu” language were excluded. Three trained co researchers conducted structured interviews to determine the frequency and factors associated with tubal ligation.Results: The final multiple logistic regression showed illiteracy [AOR 2.91 95% CI 1.53-5.53], number of children < 3 [AOR 6.15 95% CI 2.61-14.50], age of women < 30 [AOR 0.12 95% CI 0.06-0.22] years and information gained through health worker [AOR 3.04 95% CI 1.60-5.80] to be statistically significant.Conclusion: This highlights tubal ligation was more common in uneducated women of age > 35 years having <3 children. The most common means of promoting tubal ligation was information gained through health workers.

  4. Factors promoting a successful return to work: from an employer and employee perspective.

    Jakobsen, Klara; Lillefjell, Monica

    2014-01-01

    Efforts have been made to explain the inability to return to work (RTW) due to employees' chronic musculoskeletal pain. Knowledge of factors facilitating the RTW process is however still limited. Based on the experiences of employees and employers, this study aims to identify factors promoting a successful return process for persons with chronic musculoskeletal pain. The findings from interviews, involving six employees with musculoskeletal pain, and five employers with various work experience, were analysed by Giorgi's phenomenological analysis through four stages. The major themes underlying the employees' comments for a successful RTW were identifying and mobilizing their personal resources, adapting a balanced daily life, and requiring a positive dialogue with family and their employer, while the employers underlined the need for a helpful adjustment at work and how they wanted to become more involved in the rehabilitation process. In conclusion our findings underline the need for extended collaboration between the employees, employer, and rehabilitation staff, and should encourage occupational therapists to direct even more of their expertise towards the situation at the workplace.

  5. Health Promotion Behavior of Chinese International Students in Korea Including Acculturation Factors: A Structural Equation Model

    Sun Jung Kim, RN, PhD

    2016-03-01

    Conlcusions: The Chinese students in Korea with higher self-esteem, perceived health status, acculturation level, and lower acculturative stress reported higher health promotion behavior. The findings can be applied to develop health promotion strategies for this population.

  6. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  7. Dual responsive promoters to target therapeutic gene expression to radiation-resistant hypoxic tumor cells

    Chadderton, Naomi; Cowen, Rachel L.; Sheppard, Freda C.D.; Robinson, Suzanne; Greco, Olga; Scott, Simon D.; Stratford, Ian J.; Patterson, Adam V.; Williams, Kaye J.

    2005-01-01

    Purpose: Tumor hypoxia is unequivocally linked to poor radiotherapy outcome. This study aimed to identify enhancer sequences that respond maximally to a combination of radiation and hypoxia for use in genetic radiotherapy approaches. Methods and materials: The influence of radiation (5 Gy) and hypoxia (1% O 2 ) on reporter-gene expression driven by hypoxia (HRE) and radiation (Egr-1) responsive elements was evaluated in tumor cells grown as monolayers or multicellular spheroids. Hypoxia-inducible factor-1α (HIF-1α) and HIF-2α protein expression was monitored in parallel. Results: Of the sequences tested, an HRE from the phosphoglycerate kinase-1 gene (PGK-18[5+]) was maximally induced in response to hypoxia plus radiation in all 5 cell lines tested. The additional radiation treatment afforded a significant increase in the induction of PGK-18[5+] compared with hypoxia alone in 3 cell lines. HIF-1α/2α were induced by radiation but combined hypoxia/radiation treatment did not yield a further increase. The dual responsive nature of HREs was maintained when spheroids were irradiated after delivery of HRE constructs in a replication-deficient adenovirus. Conclusions: Hypoxia-responsive enhancer element sequences are dually responsive to combined radiation and hypoxic treatment. Their use in genetic radiotherapy in vivo could maximize expression in the most radio-resistant population at the time of radiation and also exploit microenvironmental changes after radiotherapy to yield additional switch-on

  8. Performance related factors are the main determinants of the von Willebrand factor response to exhaustive physical exercise.

    Janine E van Loon

    Full Text Available Physical stress triggers the endothelium to release von Willebrand Factor (VWF from the Weibel Palade bodies. Since VWF is a risk factor for arterial thrombosis, it is of great interest to discover determinants of VWF response to physical stress. We aimed to determine the main mediators of the VWF increase by exhaustive physical exercise.105 healthy individuals (18-35 years were included in this study. Each participant performed an incremental exhaustive exercise test on a cycle ergometer. Respiratory gas exchange measurements were obtained while cardiac function was continuously monitored. Blood was collected at baseline and directly after exhaustion. VWF antigen (VWF:Ag levels, VWF collagen binding (VWF:CB levels, ADAMTS13 activity and common variations in Syntaxin Binding Protein-5 (STXBP5, rs1039084 and rs9399599, Syntaxin-2 (STX2, rs7978987 and VWF (promoter, rs7965413 were determined.The median VWF:Ag level at baseline was 0.94 IU/mL [IQR 0.8-1.1] and increased with 47% [IQR 25-73] after exhaustive exercise to a median maximum VWF:Ag of 1.38 IU/mL [IQR 1.1-1.8] (p<0.0001. VWF:CB levels and ADAMTS13 activity both also increased after exhaustive exercise (median increase 43% and 12%, both p<0.0001. The strongest determinants of the VWF:Ag level increase are performance related (p<0.0001. We observed a gender difference in VWF:Ag response to exercise (females 1.2 IU/mL; males 1.7 IU/mL, p = 0.001, which was associated by a difference in performance. Genetic variations in STXBP5, STX2 and the VWF promoter were not associated with VWF:Ag levels at baseline nor with the VWF:Ag increase.VWF:Ag levels strongly increase upon exhaustive exercise and this increase is strongly determined by physical fitness level and the intensity of the exercise, while there is no clear effect of genetic variation in STXBP5, STX2 and the VWF promoter.

  9. [The role of workplace health promotion in the concept of corporate social responsibility].

    Wojtaszczyk, Patrycja

    2008-01-01

    Workplace health promotion (WHP) is an idea that was conceived over 25 years ago. At its very core is the wellbeing of employees. The development and dissemination of this notion, as well as the implementation of its basic principles have always been challenged by various theories and practices derived from the field of human resources management. The corporate social responsibility (CSR) is one of such new concepts promulgated within the European Union Based on the literature review, especially European Commission documents, articles retrieved in the EBSCO database, guidelines and guidebooks published by the CSR Forum, other NGOs active in the field, and the publications of the Nofer Institute of Occupational Medicine, the author makes an attempt to compare these two ideas and discuss the coherence between their assumptions. The primary hypothesis was that WHP is an element of CSR. The comparison between CSR and WHP concepts confirm a hypothesis that the latter is an element of the former, which means that activities aimed at taking care of health and well-being of employees contribute to the creation of a socially responsible company. It indicates that the implementation of both ideas requires multidisciplinary and holistic approach. In addition, the role of social dialog and workers' participation in the company management are strongly emphasized.

  10. Spliceosome SNRNP200 Promotes Viral RNA Sensing and IRF3 Activation of Antiviral Response.

    Nicolas Tremblay

    2016-07-01

    Full Text Available Spliceosomal SNRNP200 is a Ski2-like RNA helicase that is associated with retinitis pigmentosa 33 (RP33. Here we found that SNRNP200 promotes viral RNA sensing and IRF3 activation through the ability of its amino-terminal Sec63 domain (Sec63-1 to bind RNA and to interact with TBK1. We show that SNRNP200 relocalizes into TBK1-containing cytoplasmic structures upon infection, in contrast to the RP33-associated S1087L mutant, which is also unable to rescue antiviral response of SNRNP200 knockdown cells. This functional rescue correlates with the Sec63-1-mediated binding of viral RNA. The hindered IFN-β production of knockdown cells was further confirmed in peripheral blood cells of RP33 patients bearing missense mutation in SNRNP200 upon infection with Sendai virus (SeV. This work identifies a novel immunoregulatory role of the spliceosomal SNRNP200 helicase as an RNA sensor and TBK1 adaptor for the activation of IRF3-mediated antiviral innate response.

  11. Rachycentron canadum (cobia) lectin promoted mitogenic response in mice BALB/c splenocytes.

    Coriolano, M C; de Melo, C M L; Santos, A J G; Pereira, V R A; Coelho, L C B B

    2012-12-01

    The mitogenic lectins are invaluable tools to study the biochemical changes associated with lymphocyte activation and proliferation of various immune cells. Rachycentron canadum lectin (RcaL) was detected and purified from serum of cobia fish. The aim of this study was to evaluate the proliferative response and cytokine production in splenocytes of mice in vitro stimulated with RcaL lectin; Canavalia ensiformis lectin (Con A) was used as positive control. A high proliferation index was induced by RcaL in relation to control cells. Furthermore, RcaL induced higher IL-2 and IL-6 production in relation to control. The cell viability was 90% in splenocytes treated with RcaL lectin, but RcaL promoted significant late apoptosis after 24 and 48 h in relation to control. RcaL induced proliferative responses suggesting that this lectin can be used as a mitogenic agent in immunostimulatory assays. © 2012 The Authors. Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd.

  12. SP-transcription factors are involved in basal MVP promoter activity and its stimulation by HDAC inhibitors.

    Steiner, Elisabeth; Holzmann, Klaus; Pirker, Christine; Elbling, Leonilla; Micksche, Michael; Berger, Walter

    2004-04-23

    The major vault protein (MVP) has been implicated in multidrug resistance, cellular transport, and malignant transformation. In this study we aimed to identify crucial MVP promoter elements that regulate MVP expression. By mutation as well as deletion analysis a conserved proximal GC-box element was demonstrated to be essential for basal human MVP promoter transactivation. Binding of Sp-family transcription factors but not AP2 to this element in vitro and in vivo was shown by EMSA and ChIP assays, respectively. Inhibition of GC-box binding by a dominant-negative Sp1-variant and by mithramycin A distinctly attenuated MVP promoter activity. In Sp-null Drosophila cells, the silent human MVP promoter was transactivated by several human Sp-family members. In human cells the MVP promoter was potently stimulated by the histone deacetylase (HDAC) inhibitors butyrate (NaB) and trichostatin A (TSA), resulting in enhanced MVP expression. This stimulation was substantially decreased by mutation of the single GC-box and by application of mithramycin A. Treatment with HDAC inhibitors led to a distinct decrease of Sp1 but increase of Sp3 binding in vivo to the respective promoter sequence as demonstrated by ChIP assays. Summarising, this study identifies variations in Sp-transcription factor binding to a single proximal GC-box element as critical for basal MVP promoter activation and its stimulation by HDAC inhibitors.

  13. Regulation of bitter taste responses by tumor necrosis factor.

    Feng, Pu; Jyotaki, Masafumi; Kim, Agnes; Chai, Jinghua; Simon, Nirvine; Zhou, Minliang; Bachmanov, Alexander A; Huang, Liquan; Wang, Hong

    2015-10-01

    Inflammatory cytokines are important regulators of metabolism and food intake. Over production of inflammatory cytokines during bacterial and viral infections leads to anorexia and reduced food intake. However, it remains unclear whether any inflammatory cytokines are involved in the regulation of taste reception, the sensory mechanism governing food intake. Previously, we showed that tumor necrosis factor (TNF), a potent proinflammatory cytokine, is preferentially expressed in a subset of taste bud cells. The level of TNF in taste cells can be further induced by inflammatory stimuli. To investigate whether TNF plays a role in regulating taste responses, in this study, we performed taste behavioral tests and gustatory nerve recordings in TNF knockout mice. Behavioral tests showed that TNF-deficient mice are significantly less sensitive to the bitter compound quinine than wild-type mice, while their responses to sweet, umami, salty, and sour compounds are comparable to those of wild-type controls. Furthermore, nerve recording experiments showed that the chorda tympani nerve in TNF knockout mice is much less responsive to bitter compounds than that in wild-type mice. Chorda tympani nerve responses to sweet, umami, salty, and sour compounds are similar between TNF knockout and wild-type mice, consistent with the results from behavioral tests. We further showed that taste bud cells express the two known TNF receptors TNFR1 and TNFR2 and, therefore, are potential targets of TNF. Together, our results suggest that TNF signaling preferentially modulates bitter taste responses. This mechanism may contribute to taste dysfunction, particularly taste distortion, associated with infections and some chronic inflammatory diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Class and compassion: socioeconomic factors predict responses to suffering.

    Stellar, Jennifer E; Manzo, Vida M; Kraus, Michael W; Keltner, Dacher

    2012-06-01

    Previous research indicates that lower-class individuals experience elevated negative emotions as compared with their upper-class counterparts. We examine how the environments of lower-class individuals can also promote greater compassionate responding-that is, concern for the suffering or well-being of others. In the present research, we investigate class-based differences in dispositional compassion and its activation in situations wherein others are suffering. Across studies, relative to their upper-class counterparts, lower-class individuals reported elevated dispositional compassion (Study 1), as well as greater self-reported compassion during a compassion-inducing video (Study 2) and for another person during a social interaction (Study 3). Lower-class individuals also exhibited heart rate deceleration-a physiological response associated with orienting to the social environment and engaging with others-during the compassion-inducing video (Study 2). We discuss a potential mechanism of class-based influences on compassion, whereby lower-class individuals' are more attuned to others' distress, relative to their upper-class counterparts.

  15. Connective tissue growth factor/CCN2-null mouse embryonic fibroblasts retain intact transforming growth factorresponsiveness

    Mori, Yasuji; Hinchcliff, Monique; Wu, Minghua; Warner-Blankenship, Matthew; Lyons, Karen M.; Varga, John

    2008-01-01

    Background: The matricellular protein connective tissue growth factor (CCN2) has been implicated in pathological fibrosis, but its physiologic role remains elusive. In vitro, transforming growth factor-β (TGF-β) induces CCN2 expression in mesenchymal cells. Because CCN2 can enhance profibrotic responses elicited by TGF-β, it has been proposed that CCN2 functions as an essential downstream signaling mediator for TGF-β. To explore this notion, we characterized TGF-β-induced activation of fibroblasts from CCN2-null (CCN2 -/- ) mouse embryos. Methods: The regulation of CCN2 expression was examined in vivo in a model of fibrosis induced by bleomycin. Cellular TGF-β signal transduction and regulation of collagen gene expression were examined in CCN2 -/- MEFs by immunohistochemistry, Northern, Western and RT-PCR analysis, immunocytochemistry and transient transfection assays. Results: Bleomycin-induced skin fibrosis in the mouse was associated with substantial CCN2 up-regulation in lesional fibroblasts. Whereas in vitro proliferation rate of CCN2 -/- MEFs was markedly reduced compared to wild type MEFs, TGF-β-induced activation of the Smad pathways, including Smad2 phosphorylation, Smad2/3 and Smad4 nuclear accumulation and Smad-dependent transcriptional responses, were unaffected by loss of CCN2. The stimulation of COL1A2 and fibronectin mRNA expression and promoter activity, and of corresponding protein levels, showed comparable time and dose-response in wild type and CCN2 -/- MEFs, whereas stimulation of alpha smooth muscle actin and myofibroblast transdifferentiation showed subtle impairment in MEFs lacking CCN2. Conclusion: Whereas endogenous CCN2 plays a role in regulation of proliferation and TGF-β-induced myofibroblast transdifferentiation, it appears to be dispensable for Smad-dependent stimulation of collagen and extracellular matrix synthesis in murine embryonic fibroblasts

  16. Contemplative/emotion training reduces negative emotional behavior and promotes prosocial responses.

    Kemeny, Margaret E; Foltz, Carol; Cavanagh, James F; Cullen, Margaret; Giese-Davis, Janine; Jennings, Patricia; Rosenberg, Erika L; Gillath, Omri; Shaver, Phillip R; Wallace, B Alan; Ekman, Paul

    2012-04-01

    Contemplative practices are believed to alleviate psychological problems, cultivate prosocial behavior and promote self-awareness. In addition, psychological science has developed tools and models for understanding the mind and promoting well-being. Additional effort is needed to combine frameworks and techniques from these traditions to improve emotional experience and socioemotional behavior. An 8-week intensive (42 hr) meditation/emotion regulation training intervention was designed by experts in contemplative traditions and emotion science to reduce "destructive enactment of emotions" and enhance prosocial responses. Participants were 82 healthy female schoolteachers who were randomly assigned to a training group or a wait-list control group, and assessed preassessment, postassessment, and 5 months after training completion. Assessments included self-reports and experimental tasks to capture changes in emotional behavior. The training group reported reduced trait negative affect, rumination, depression, and anxiety, and increased trait positive affect and mindfulness compared to the control group. On a series of behavioral tasks, the training increased recognition of emotions in others (Micro-Expression Training Tool), protected trainees from some of the psychophysiological effects of an experimental threat to self (Trier Social Stress Test; TSST), appeared to activate cognitive networks associated with compassion (lexical decision procedure), and affected hostile behavior in the Marital Interaction Task. Most effects at postassessment that were examined at follow-up were maintained (excluding positive affect, TSST rumination, and respiratory sinus arrhythmia recovery). Findings suggest that increased awareness of mental processes can influence emotional behavior, and they support the benefit of integrating contemplative theories/practices with psychological models and methods of emotion regulation. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

  17. Growth promotion of Lactuca sativa in response to volatile organic compounds emitted from diverse bacterial species.

    Fincheira, Paola; Venthur, Herbert; Mutis, Ana; Parada, Maribel; Quiroz, Andrés

    2016-12-01

    Agrochemicals are currently used in horticulture to increase crop production. Nevertheless, their indiscriminate use is a relevant issue for environmental and legal aspects. Alternative tools for reducing fertilizers and synthetic phytohormones are being investigated, such as the use of volatile organic compounds (VOCs) as growth inducers. Some soil bacteria, such as Pseudomonas and Bacillus, stimulate Arabidopsis and tobacco growth by releasing VOCs, but their effects on vegetables have not been investigated. Lactuca sativa was used as model vegetable to investigate bacterial VOCs as growth inducers. We selected 10 bacteria strains, belonging to Bacillus, Staphylococcus and Serratia genera that are able to produce 3-hydroxy-2-butanone (acetoin), a compound with proven growth promoting activity. Two-day old-seedlings of L. sativa were exposed to VOCs emitted by the selected bacteria grown in different media cultures for 7 days. The results showed that the VOCs released from the bacteria elicited an increase in the number of lateral roots, dry weight, root growth and shoot length, depending on the media used. Three Bacillus strains, BCT53, BCT9 and BCT4, were selected according to its their growth inducing capacity. The BCT9 strain elicited the greatest increases in dry weight and primary root length when L. sativa seedlings were subjected to a 10-day experiment. Finally, because acetoin only stimulated root growth, we suggest that other volatiles could be responsible for the growth promotion of L. sativa. In conclusion, our results strongly suggest that bacteria volatiles can be used as growth-inducers as alternative or complementary strategies for application in horticulture species. Copyright © 2016 Elsevier GmbH. All rights reserved.

  18. Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter

    Surleen Kaur

    2016-03-01

    Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP

  19. Identification and Expression Profiling of the Auxin Response Factors in Dendrobium officinale under Abiotic Stresses.

    Chen, Zhehao; Yuan, Ye; Fu, Di; Shen, Chenjia; Yang, Yanjun

    2017-05-04

    Auxin response factor (ARF) proteins play roles in plant responses to diverse environmental stresses by binding specifically to the auxin response element in the promoters of target genes. Using our latest public Dendrobium transcriptomes, a comprehensive characterization and analysis of 14 DnARF genes were performed. Three selected DnARFs , including DnARF1 , DnARF4 , and DnARF6 , were confirmed to be nuclear proteins according to their transient expression in epidermal cells of Nicotiana benthamiana leaves. Furthermore, the transcription activation abilities of DnARF1 , DnARF4 , and DnARF6 were tested in a yeast system. Our data showed that DnARF6 is a transcriptional activator in Dendrobium officinale . To uncover the basic information of DnARF gene responses to abiotic stresses, we analyzed their expression patterns under various hormones and abiotic treatments. Based on our data, several hormones and significant stress responsive DnARF genes have been identified. Since auxin and ARF genes have been identified in many plant species, our data is imperative to reveal the function of ARF mediated auxin signaling in the adaptation to the challenging Dendrobium environment.

  20. Do Hostile School Environments Promote Social Deviance by Shaping Neural Responses to Social Exclusion?

    Schriber, Roberta A; Rogers, Christina R; Ferrer, Emilio; Conger, Rand D; Robins, Richard W; Hastings, Paul D; Guyer, Amanda E

    2018-03-01

    The present study examined adolescents' neural responses to social exclusion as a mediator of past exposure to a hostile school environment (HSE) and later social deviance, and whether family connectedness buffered these associations. Participants (166 Mexican-origin adolescents, 54.4% female) reported on their HSE exposure and family connectedness across Grades 9-11. Six months later, neural responses to social exclusion were measured. Finally, social deviance was self-reported in Grades 9 and 12. The HSE-social deviance link was mediated by greater reactivity to social deviance in subgenual anterior cingulate cortex, a region from the social pain network also implicated in social susceptibility. However, youths with stronger family bonds were protected from this neurobiologically mediated path. These findings suggest a complex interplay of risk and protective factors that impact adolescent behavior through the brain. © 2018 Society for Research on Adolescence.

  1. Improving health promotion through central rating of interventions: the need for Responsive Guidance.

    Kok, Maarten Olivier; Bal, Roland; Roelofs, Caspar David; Schuit, Albertine Jantine

    2017-01-01

    In several countries, attempts are made to improve health promotion by centrally rating the effectiveness of health promotion interventions. The Dutch Effectiveness Rating System (ERS) for health promotion interventions is an improvement-oriented approach in which multi-disciplinary expert

  2. Salicylic Acid Suppresses Jasmonic Acid Signaling Downstream of SCFCOI1-JAZ by Targeting GCC Promoter Motifs via Transcription Factor ORA59[C][W][OA

    Van der Does, Dieuwertje; Leon-Reyes, Antonio; Koornneef, Annemart; Van Verk, Marcel C.; Rodenburg, Nicole; Pauwels, Laurens; Goossens, Alain; Körbes, Ana P.; Memelink, Johan; Ritsema, Tita; Van Wees, Saskia C.M.; Pieterse, Corné M.J.

    2013-01-01

    Antagonism between the defense hormones salicylic acid (SA) and jasmonic acid (JA) plays a central role in the modulation of the plant immune signaling network, but the molecular mechanisms underlying this phenomenon are largely unknown. Here, we demonstrate that suppression of the JA pathway by SA functions downstream of the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCFCOI1, which targets JASMONATE ZIM-domain transcriptional repressor proteins (JAZs) for proteasome-mediated degradation. In addition, neither the stability nor the JA-induced degradation of JAZs was affected by SA. In silico promoter analysis of the SA/JA crosstalk transcriptome revealed that the 1-kb promoter regions of JA-responsive genes that are suppressed by SA are significantly enriched in the JA-responsive GCC-box motifs. Using GCC:GUS lines carrying four copies of the GCC-box fused to the β-glucuronidase reporter gene, we showed that the GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Using plants overexpressing the GCC-box binding APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factors ERF1 or ORA59, we found that SA strongly reduces the accumulation of ORA59 but not that of ERF1. Collectively, these data indicate that the SA pathway inhibits JA signaling downstream of the SCFCOI1-JAZ complex by targeting GCC-box motifs in JA-responsive promoters via a negative effect on the transcriptional activator ORA59. PMID:23435661

  3. Salicylic acid suppresses jasmonic acid signaling downstream of SCFCOI1-JAZ by targeting GCC promoter motifs via transcription factor ORA59.

    Van der Does, Dieuwertje; Leon-Reyes, Antonio; Koornneef, Annemart; Van Verk, Marcel C; Rodenburg, Nicole; Pauwels, Laurens; Goossens, Alain; Körbes, Ana P; Memelink, Johan; Ritsema, Tita; Van Wees, Saskia C M; Pieterse, Corné M J

    2013-02-01

    Antagonism between the defense hormones salicylic acid (SA) and jasmonic acid (JA) plays a central role in the modulation of the plant immune signaling network, but the molecular mechanisms underlying this phenomenon are largely unknown. Here, we demonstrate that suppression of the JA pathway by SA functions downstream of the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCF(COI1), which targets JASMONATE ZIM-domain transcriptional repressor proteins (JAZs) for proteasome-mediated degradation. In addition, neither the stability nor the JA-induced degradation of JAZs was affected by SA. In silico promoter analysis of the SA/JA crosstalk transcriptome revealed that the 1-kb promoter regions of JA-responsive genes that are suppressed by SA are significantly enriched in the JA-responsive GCC-box motifs. Using GCC:GUS lines carrying four copies of the GCC-box fused to the β-glucuronidase reporter gene, we showed that the GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Using plants overexpressing the GCC-box binding APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factors ERF1 or ORA59, we found that SA strongly reduces the accumulation of ORA59 but not that of ERF1. Collectively, these data indicate that the SA pathway inhibits JA signaling downstream of the SCF(COI1)-JAZ complex by targeting GCC-box motifs in JA-responsive promoters via a negative effect on the transcriptional activator ORA59.

  4. Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.

    Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun

    2015-12-01

    Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  5. Computational prediction and experimental verification of HVA1-like abscisic acid responsive promoters in rice (Oryza sativa).

    Ross, Christian; Shen, Qingxi J

    2006-09-01

    Abscisic acid (ABA) is one of the central plant hormones, responsible for controlling both maturation and germination in seeds, as well as mediating adaptive responses to desiccation, injury, and pathogen infection in vegetative tissues. Thorough analyses of two barley genes, HVA1 and HVA22, indicate that their response to ABA relies on the interaction of two cis-acting elements in their promoters, an ABA response element (ABRE) and a coupling element (CE). Together, they form an ABA response promoter complex (ABRC). Comparison of promoters of barley HVA1 and it rice orthologue indicates that the structures and sequences of their ABRCs are highly similar. Prediction of ABA responsive genes in the rice genome is then tractable to a bioinformatics approach based on the structures of the well-defined barley ABRCs. Here we describe a model developed based on the consensus, inter-element spacing and orientations of experimentally determined ABREs and CEs. Our search of the rice promoter database for promoters that fit the model has generated a partial list of genes in rice that have a high likelihood of being involved in the ABA signaling network. The ABA inducibility of some of the rice genes identified was validated with quantitative reverse transcription PCR (QPCR). By limiting our input data to known enhancer modules and experimentally derived rules, we have generated a high confidence subset of ABA-regulated genes. The results suggest that the pathways by which cereals respond to biotic and abiotic stresses overlap significantly, and that regulation is not confined to the level transcription. The large fraction of putative regulatory genes carrying HVA1-like enhancer modules in their promoters suggests the ABA signal enters at multiple points into a complex regulatory network that remains largely unmapped.

  6. The Transcription Factor c-Maf Promotes the Differentiation of Follicular Helper T Cells

    Fabienne Andris

    2017-04-01

    Full Text Available Follicular helper T cells (Tfh have been identified as the primary cell subpopulation regulating B cell responses in germinal centers, thus supporting high-affinity antibody production. Among the transcription factors orchestrating Tfh cell differentiation and function, the role played by the proto-oncogene c-Maf remains poorly characterized. We report herein that selective loss of c-Maf expression in the T cell compartment results in defective development of Tfh cells in response to both antigen/adjuvant vaccinations and commensal intestinal bacteria. Accordingly, c-Maf expression in T cells was essential for the development and high-affinity antibody secretion in vaccinated animals. c-Maf was expressed early, concomitantly to BCL6, in Tfh cell precursors and found to regulate Tfh fate in a cell-autonomous fashion. Altogether, our findings reveal a novel, non-redundant, function for c-Maf in the differentiation of Tfh cells and the regulation of humoral immune responses to T-cell-dependent antigens.

  7. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  8. Increasing the effectiveness of messages promoting responsible undergraduate drinking: tailoring to personality and matching to context.

    York, Valerie K; Brannon, Laura A; Miller, Megan M

    2012-01-01

    This study addressed the serious problem of college student binge drinking by identifying factors that improve the effectiveness of messages encouraging responsible drinking presented through a website simulation. We tested schema matching (i.e., whether the message matches the person's self-schema type or not) and two types of context matching (i.e., whether the message matches the topic or values of the message context) to determine their relative influence on the effectiveness of the message. We expected that messages matched to any of these factors would be more effective than messages not matched. Schema matching reduced intentions to drink while staying in/home, but topic matching reduced intentions to drink when going out, suggesting that different factors are important for messages targeting drinking behavior in different locations. Significant interactions between topic matching and value matching on message evaluation variables indicated that the message should not match the message context too closely. That is, there appears to be a matching threshold: Increasing the number of factors the message matches does not increase message effectiveness, possibly because it makes the message too redundant with the surrounding content.

  9. The Murine Factor H-Related Protein FHR-B Promotes Complement Activation

    Marcell Cserhalmi

    2017-09-01

    Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.

  10. Resilience-promoting factors in war-exposed adolescents: an epidemiologic study.

    Fayyad, John; Cordahi-Tabet, C; Yeretzian, J; Salamoun, M; Najm, C; Karam, E G

    2017-02-01

    Studies of war-exposed children have not investigated a comprehensive array of resilience-promoting factors, nor representative samples of children and adolescents. A representative sample of N = 710 adolescents was randomly selected from communities recently exposed to war. All those who had experienced war trauma were administered questionnaires measuring war exposure, family violence, availability of leisure activities, school-related problems, interpersonal and peer problems, socialization, daily routine problems, displacement, availability of parental supervision and contact and medical needs as well as coping skills related to religious coping, denial, self-control, avoidance and problem solving. Mental health was measured by the Strengths and Difficulties Questionnaire (SDQ) and the Child-Revised Impact of Events Scale (CRIES). Resilient adolescents were defined as those who experienced war trauma, but did not manifest any symptoms on the SDQ or CRIES. Resilience was related to being male, using problem-solving techniques, having leisure activities, and having parents who spent time with their adolescents and who supported them with school work. Interventions designed for war-traumatized youth must build individual coping skills of children and adolescents, yet at the same time target parents and teachers in an integrated manner.

  11. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  12. Granulocyte Macrophage Colony-Stimulating Factor-Activated Eosinophils Promote Interleukin-23 Driven Chronic Colitis

    Griseri, Thibault; Arnold, Isabelle C.; Pearson, Claire; Krausgruber, Thomas; Schiering, Chris; Franchini, Fanny; Schulthess, Julie; McKenzie, Brent S.; Crocker, Paul R.; Powrie, Fiona

    2015-01-01

    Summary The role of intestinal eosinophils in immune homeostasis is enigmatic and the molecular signals that drive them from protective to tissue damaging are unknown. Most commonly associated with Th2 cell-mediated diseases, we describe a role for eosinophils as crucial effectors of the interleukin-23 (IL-23)-granulocyte macrophage colony-stimulating factor (GM-CSF) axis in colitis. Chronic intestinal inflammation was characterized by increased bone marrow eosinopoiesis and accumulation of activated intestinal eosinophils. IL-5 blockade or eosinophil depletion ameliorated colitis, implicating eosinophils in disease pathogenesis. GM-CSF was a potent activator of eosinophil effector functions and intestinal accumulation, and GM-CSF blockade inhibited chronic colitis. By contrast neutrophil accumulation was GM-CSF independent and dispensable for colitis. In addition to TNF secretion, release of eosinophil peroxidase promoted colitis identifying direct tissue-toxic mechanisms. Thus, eosinophils are key perpetrators of chronic inflammation and tissue damage in IL-23-mediated immune diseases and it suggests the GM-CSF-eosinophil axis as an attractive therapeutic target. PMID:26200014

  13. Stat6 Promotes Intestinal Tumorigenesis in a Mouse Model of Adenomatous Polyposis by Expansion of MDSCs and Inhibition of Cytotoxic CD8 Response.

    Jayakumar, Asha; Bothwell, Alfred L M

    2017-08-01

    Intestinal tumorigenesis in the ApcMin/+ model is initiated by aberrant activation of Wnt pathway. Increased IL-4 expression in human colorectal cancer tissue and growth of colon cancer cell lines implied that IL-4-induced Stat6-mediated tumorigenic signaling likely contributes to intestinal tumor progression in ApcMin/+ mice. Stat6 also appears to promote expansion of myeloid-derived suppressor cells (MDSCs) cells. MDSCs promote polyp formation in the ApcMin/+ model. Hence, Stat6 could have a broad role in coordinating both polyp cell proliferation and MDSC expansion. We found that IL-4-induced Stat6-mediated proliferation of intestinal epithelial cells is augmented by platelet-derived growth factor-BB, a tumor-promoting growth factor. To determine whether polyp progression in ApcMin/+ mice is dependent on Stat6 signaling, we disrupted Stat6 in this model. Total polyps in the small intestine were fewer in ApcMin/+ mice lacking Stat6. Furthermore, proliferation of polyp epithelial cells was reduced, indicating that Stat6 in part controlled polyp formation. Stat6 also promoted expansion of MDSCs in the spleen and lamina propria of ApcMin/+ mice, implying regulation of antitumor T-cell response. More CD8 cells and reduced PD-1 expression on CD4 cells correlated with reduced polyps. In addition, a strong CD8-mediated cytotoxic response led to killing of tumor cells in Stat6-deficient ApcMin/+ mice. Therefore, these findings show that Stat6 has an oncogenic role in intestinal tumorigenesis by promoting polyp cell proliferation and immunosuppressive mediators, and preventing an active cytotoxic process. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Assessment of clusters of transcription factor binding sites in relationship to human promoter, CpG islands and gene expression

    Sakaki Yoshiyuki

    2004-02-01

    Full Text Available Abstract Background Gene expression is regulated mainly by transcription factors (TFs that interact with regulatory cis-elements on DNA sequences. To identify functional regulatory elements, computer searching can predict TF binding sites (TFBS using position weight matrices (PWMs that represent positional base frequencies of collected experimentally determined TFBS. A disadvantage of this approach is the large output of results for genomic DNA. One strategy to identify genuine TFBS is to utilize local concentrations of predicted TFBS. It is unclear whether there is a general tendency for TFBS to cluster at promoter regions, although this is the case for certain TFBS. Also unclear is the identification of TFs that have TFBS concentrated in promoters and to what level this occurs. This study hopes to answer some of these questions. Results We developed the cluster score measure to evaluate the correlation between predicted TFBS clusters and promoter sequences for each PWM. Non-promoter sequences were used as a control. Using the cluster score, we identified a PWM group called PWM-PCP, in which TFBS clusters positively correlate with promoters, and another PWM group called PWM-NCP, in which TFBS clusters negatively correlate with promoters. The PWM-PCP group comprises 47% of the 199 vertebrate PWMs, while the PWM-NCP group occupied 11 percent. After reducing the effect of CpG islands (CGI against the clusters using partial correlation coefficients among three properties (promoter, CGI and predicted TFBS cluster, we identified two PWM groups including those strongly correlated with CGI and those not correlated with CGI. Conclusion Not all PWMs predict TFBS correlated with human promoter sequences. Two main PWM groups were identified: (1 those that show TFBS clustered in promoters associated with CGI, and (2 those that show TFBS clustered in promoters independent of CGI. Assessment of PWM matches will allow more positive interpretation of TFBS in

  15. Promoting resuscitation of viable but nonculturable cells of Vibrio harveyi by a resuscitation-promoting factor-like protein YeaZ.

    Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X

    2017-02-01

    To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4  CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5  CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.

  16. Glucose impairs tamoxifen responsiveness modulating connective tissue growth factor in breast cancer cells.

    Ambrosio, Maria Rosaria; D'Esposito, Vittoria; Costa, Valerio; Liguoro, Domenico; Collina, Francesca; Cantile, Monica; Prevete, Nella; Passaro, Carmela; Mosca, Giusy; De Laurentiis, Michelino; Di Bonito, Maurizio; Botti, Gerardo; Franco, Renato; Beguinot, Francesco; Ciccodicola, Alfredo; Formisano, Pietro

    2017-12-12

    Type 2 diabetes and obesity are negative prognostic factors in patients with breast cancer (BC). We found that sensitivity to tamoxifen was reduced by 2-fold by 25 mM glucose (High Glucose; HG) compared to 5.5 mM glucose (Low Glucose; LG) in MCF7 BC cells. Shifting from HG to LG ameliorated MCF7 cell responsiveness to tamoxifen. RNA-Sequencing of MCF7 BC cells revealed that cell cycle-related genes were mainly affected by glucose. Connective Tissue Growth Factor (CTGF) was identified as a glucose-induced modulator of cell sensitivity to tamoxifen. Co-culturing MCF7 cells with human adipocytes exposed to HG, enhanced CTGF mRNA levels and reduced tamoxifen responsiveness of BC cells. Inhibition of adipocyte-released IL8 reverted these effects. Interestingly, CTGF immuno-detection in bioptic specimens from women with estrogen receptor positive (ER + ) BC correlated with hormone therapy resistance, distant metastases, reduced overall and disease-free survival. Thus, glucose affects tamoxifen responsiveness directly modulating CTGF in BC cells, and indirectly promoting IL8 release by adipocytes.

  17. Identification, isolation and expression analysis of auxin response factor (ARF) genes in Solanum lycopersicum.

    Wu, Jian; Wang, Feiyan; Cheng, Lin; Kong, Fuling; Peng, Zhen; Liu, Songyu; Yu, Xiaolin; Lu, Gang

    2011-11-01

    Auxin response factors (ARFs) encode transcriptional factors that bind specifically to the TGTCTC-containing auxin response elements found in the promoters of primary/early auxin response genes that regulate plant development. In this study, investigation of the tomato genome revealed 21 putative functional ARF genes (SlARFs), a number comparable to that found in Arabidopsis (23) and rice (25). The full cDNA sequences of 15 novel SlARFs were isolated and delineated by sequencing of PCR products. A comprehensive genome-wide analysis of this gene family is presented, including the gene structures, chromosome locations, phylogeny, and conserved motifs. In addition, a comparative analysis between ARF family genes in tomato and maize was performed. A phylogenetic tree generated from alignments of the full-length protein sequences of 21 OsARFs, 23 AtARFs, 31 ZmARFs, and 21 SlARFs revealed that these ARFs were clustered into four major groups. However, we could not find homologous genes in rice, maize, or tomato with AtARF12-15 and AtARF20-23. The expression patterns of tomato ARF genes were analyzed by quantitative real-time PCR. Our comparative analysis will help to define possible functions for many of these newly isolated ARF-family genes in plant development.

  18. The Predictive Factors of the Promotion of Physical Activity by Air Force Squadron Commanders

    Whelan, Dana

    2001-01-01

    This research examined the relationship between beliefs about physical activity, physical activity levels, age and the promotional practices for physical activity employed by Air Force squadron commanders...

  19. The ethylene response factor AtERF4 negatively regulates the iron deficiency response in Arabidopsis thaliana.

    Wei Liu

    Full Text Available Iron (Fe deficiency is one of many conditions that can seriously damage crops. Low levels of photosynthesis can lead to the degradation of chlorophyll content and impaired respiration in affected plants, which together cause poor growth and reduce quality. Although ethylene plays an important role in responses to Fe deficiency, a limited number of studies have been carried out on ethylene response factor (ERFs as components of plant regulation mechanisms. Thus, this study aimed to investigate the role of AtERF4 in plant responses to Fe deficiency. Results collected when Arabidopsis thaliana was grown under Fe deficient conditions as well as in the presence of 1-aminocyclopropane-1-carboxylic acid (ACC revealed that leaf chlorosis did not occur over short timescales and that chloroplast structural integrity was retained. At the same time, expression of the chlorophyll degradation-related genes AtPAO and AtCLH1 was inhibited and net H+ root flux was amplified. Our results show that chlorophyll content was enhanced in the mutant erf4, while expression of the chlorophyll degradation gene AtCLH1 was reduced. Ferric reductase activity in roots was also significantly higher in the mutant than in wild type plants, while erf4 caused high levels of expression of the genes AtIRT1 and AtHA2 under Fe deficient conditions. We also utilized yeast one-hybrid technology in this study to determine that AtERF4 binds directly to the AtCLH1 and AtITR1 promoter. Observations show that transient over-expression of AtERF4 resulted in rapid chlorophyll degradation in the leaves of Nicotiana tabacum and the up-regulation of gene AtCLH1 expression. In summary, AtERF4 plays an important role as a negative regulator of Fe deficiency responses, we hypothesize that AtERF4 may exert a balancing effect on plants subject to nutrition stress.

  20. Insulin and insulin-like growth factor receptors and responses

    Roth, R.A.; Steele-Perkins, G.; Hari, J.; Stover, C.; Pierce, S.; Turner, J.; Edman, J.C.; Rutter, W.J.

    1988-01-01

    Insulin is a member of a family of structurally related hormones with diverse physiological functions. In humans, the best-characterized members of this family include insulin, insulin-like growth factor (IGF)-I, and IGF-II. Each of these three polypeptide hormones has its own distinct receptor. The structures of each of these receptors have now been deduced from analyses of isolated cDNA clones. To study further the responses mediated through these three different receptors, the authors have been studying cells expressing the proteins encoded by these three cDNAs. The isolated cDNAs have been transfected into Chinese hamster ovary (CHO) cells, and the resulting transfected cell lines have been characterized as to the ligand-binding activities and signal-transducing activities of the expressed proteins

  1. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes.

    Xiao, Yun-yi; Chen, Jian-ye; Kuang, Jiang-fei; Shan, Wei; Xie, Hui; Jiang, Yue-ming; Lu, Wang-jin

    2013-05-01

    The involvement of ethylene response factor (ERF) transcription factor (TF) in the transcriptional regulation of ethylene biosynthesis genes during fruit ripening remains largely unclear. In this study, 15 ERF genes, designated as MaERF1-MaERF15, were isolated and characterized from banana fruit. These MaERFs were classified into seven of the 12 known ERF families. Subcellular localization showed that MaERF proteins of five different subfamilies preferentially localized to the nucleus. The 15 MaERF genes displayed differential expression patterns and levels in peel and pulp of banana fruit, in association with four different ripening treatments caused by natural, ethylene-induced, 1-methylcyclopropene (1-MCP)-delayed, and combined 1-MCP and ethylene treatments. MaERF9 was upregulated while MaERF11 was downregulated in peel and pulp of banana fruit during ripening or after treatment with ethylene. Furthermore, yeast-one hybrid (Y1H) and transient expression assays showed that the potential repressor MaERF11 bound to MaACS1 and MaACO1 promoters to suppress their activities and that MaERF9 activated MaACO1 promoter activity. Interestingly, protein-protein interaction analysis revealed that MaERF9 and -11 physically interacted with MaACO1. Taken together, these results suggest that MaERFs are involved in banana fruit ripening via transcriptional regulation of or interaction with ethylene biosynthesis genes.

  2. [Examination of factors for promoting cooperation using documents between occupational health physicians and psychiatrists].

    Okawara, Makoto; Kajiki, Shigeyuki; Kusumoto, Akira; Fujino, Yoshihisa; Shinkai, Takahiro; Morimoto, Hideki; Hino, Yoshiyuki; Yamashita, Satoshi; Hattori, Michihiro; Mori, Koji

    2018-02-01

    suggests that there are factors impeding the cooperation between the occupational health physicians and psychiatrists. When an occupational health physician writes a request form, cooperation with psychiatrists may be promoted by enriching the request form contents and by including the representation of the occupational health physician's position and the intended purpose of the provided information by paying attention to the volume of sentences.

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  4. [Promotion of Mental Health - Technologies for Care: emotional involvement, rteception, co-responsibility and autonomy].

    Jorge, Maria Salete Bessa; Pinto, Diego Muniz; Quinderé, Paulo Henrique Dias; Pinto, Antonio Germane Alves; Sousa, Fernando Sérgio Pereira de; Cavalcante, Cinthia Mendonça

    2011-07-01

    Healthcare relations serve as efficient devices for the promotion of mental health and the development of comprehensive practices. This study seeks to analyze the measures that make mental healthcare possible in the daily operations of a Psychosocial Healthcare Center (CAPS). It is qualitative research adopting a critical and reflexive approach conducted in CAPS in the municipality of Sobral in the State of Ceará. Complying with regulations, the study was submitted for analysis by the Committee for Ethics in Research adhering to norms for research involving human beings. For data gathering, conducted between May and July 2008, semi-structured and systematic observation interview techniques were used. The research subjects involved 20 people, distributed into three groups: group I (mental health workers-8); group II (users-7) and group III (relatives of users-5). The material was organized and analyzed using principles of critical hermeneutics. According to the results, in the daily operations of CAPS, the relations of care and its devices (reception, emotional involvement, co-responsibility and autonomy) make the transversal adaptation of psychosocial practices possible. The dialogues were derived from meetings of mental health workers, users and relatives in their quest for healthcare solutions.

  5. The Stringent Response Induced by Phosphate Limitation Promotes Purine Salvage in Agrobacterium fabrum.

    Sivapragasam, Smitha; Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2017-10-31

    Agrobacterium fabrum induces tumor growth in susceptible plant species. The upregulation of virulence genes that occurs when the bacterium senses plant-derived compounds is enhanced by acidic pH and limiting inorganic phosphate. Nutrient starvation may also trigger the stringent response, and purine salvage is among the pathways expected to be favored under such conditions. We show here that phosphate limitation induces the stringent response, as evidenced by production of (p)ppGpp, and that the xdhCSML operon encoding the purine salvage enzyme xanthine dehydrogenase is upregulated ∼15-fold. The xdhCSML operon is under control of the TetR family transcription factor XdhR; direct binding of ppGpp to XdhR attenuates DNA binding, and the enhanced xdhCSML expression correlates with increased cellular levels of (p)ppGpp. Xanthine dehydrogenase may also divert purines away from salvage pathways to form urate, the ligand for the transcription factor PecS, which in the plant pathogen Dickeya dadantii is a key regulator of virulence gene expression. However, urate levels remain low under conditions that produce increased levels of xdhCSML expression, and neither acidic pH nor limiting phosphate results in induction of genes under control of PecS. Instead, expression of such genes is induced only by externally supplemented urate. Taken together, our data indicate that purine salvage is favored during the stringent response induced by phosphate starvation, suggesting that control of this pathway may constitute a novel approach to modulating virulence. Because bacterial purine catabolism appears to be unaffected, as evidenced by the absence of urate accumulation, we further propose that the PecS regulon is induced by only host-derived urate.

  6. Chronic social isolation suppresses proplastic response and promotes proapoptotic signalling in prefrontal cortex of Wistar rats.

    Djordjevic, Ana; Adzic, Miroslav; Djordjevic, Jelena; Radojcic, Marija B

    2010-08-15

    Successful adaptation to stress involves synergized actions of glucocorticoids and catecholamines at several levels of the CNS, including the prefrontal cortex (PFC). Inside the PFC, hormonal signals trigger concerted actions of transcriptional factors, such as glucocorticoid receptor (GR) and nuclear factor kappa B (NFkappaB), culminating in a balanced, proadaptive expression of their common genes, such as proplastic NCAM and/or apoptotic Bax and Bcl-2. In the present study, we hypothesized that chronic stress may compromise the balance between GR and NFkappaB signals and lead to an altered/maladaptive expression of their cognate genes in the PFC. Our results obtained with Wistar rats exposed to chronic social isolation indicated alterations of the GR relative to the NFkappaB, in favor of the GR, in both the cytoplasmic and the nuclear compartments of the PFC. Although these alterations did not affect the induction of proplastic NCAM gene, they decreased the NCAM sialylation necessary for plastic response and caused marked relocation of the mitochondrial membrane antiapoptotic Bcl-2 protein to its cytoplasmic form. Moreover, the compromised PSA-NCAM plastic response found under chronic stress was sustained after exposure of animals to the subsequent acute stress, whereas the proapoptotic signals were further emphasized. It is concluded that chronic social isolation of Wistar animals leads to a maladaptive response of the PFC, considering the diminishment of its plastic potential and potentiating of apoptosis. Such conditions in the PFC are likely to compromise its ability to interact with other CNS structures, such as the hippocampus, which is necessary for successful adaptation to stress. (c) 2010 Wiley-Liss, Inc.

  7. Placental Growth Factor Contributes to Liver Inflammation, Angiogenesis, Fibrosis in Mice by Promoting Hepatic Macrophage Recruitment and Activation

    Xi Li

    2017-07-01

    Full Text Available Placental growth factor (PlGF, a member of the vascular endothelial growth factor (VEGF family, mediates wound healing and inflammatory responses, exerting an effect on liver fibrosis and angiogenesis; however, the precise mechanism remains unclear. The aims of this study are to identify the role of PlGF in liver inflammation and fibrosis induced by bile duct ligation (BDL in mice and to reveal the underlying molecular mechanism. PlGF small interfering RNA (siRNA or non-targeting control siRNA was injected by tail vein starting 2 days after BDL. Liver inflammation, fibrosis, angiogenesis, macrophage infiltration, and hepatic stellate cells (HSCs activation were examined. Our results showed that PlGF was highly expressed in fibrotic livers and mainly distributed in activated HSCs and macrophages. Furthermore, PlGF silencing strongly reduced the severity of liver inflammation and fibrosis, and inhibited the activation of HSCs. Remarkably, PlGF silencing also attenuated BDL-induced hepatic angiogenesis, as evidenced by attenuated liver endothelial cell markers CD31 and von Willebrand factor immunostaining and genes or protein expression. Interestingly, these pathological ameliorations by PlGF silencing were due to a marked reduction in the numbers of intrahepatic F4/80+, CD68+, and Ly6C+ cell populations, which were reflected by a lower expression of these macrophage marker molecules in fibrotic livers. In addition, knockdown of PlGF by siRNA inhibited macrophages activation and substantially suppressed the expression of pro-inflammatory cytokines and chemokines in fibrotic livers. Mechanistically, evaluation of cultured RAW 264.7 cells revealed that VEGF receptor 1 (VEGFR1 mainly involved in mediating the role of PlGF in macrophages recruitment and activation, since using VEGFR1 neutralizing antibody blocking PlGF/VEGFR1 signaling axis significantly inhibited macrophages migration and inflammatory responses. Together, these findings indicate

  8. Fibroblast and T cells conditioned media induce maturation dendritic cell and promote T helper immune response

    Masoumeh Asadi

    2012-06-01

    Full Text Available Dendritic cells (DCs induce pathogen-specific T cell responses. We comprehensively studied the effects of addition of maturation stimulus, fibroblasts (fibroblast conditioned medium, PHA activated T cells (T cell conditioned medium, and mixture of fibroblast & PHA activated T cells (FCM-TCCM conditioned media on maturation of DCs. Monocytes were cultured with GM-CSF and IL-4 for five days. Maturation factors included MCM and TNF-α as control group. FCM and TCCM, or FCM-TCCM supernatant were considered as the treatment group. Tumor antigens were added at day five. Matured DCs were harvested at day seven. Phenotypic and functional analyses were carried out using anti (CD14, CD80, CD86, CD83 and HLA-DR monoclonal antibodies. Phagocytic activity, mixed lymphocyte reaction (MLR and cytokine production were also evaluated. At the end of culturing period, significantly fully matured DCs with large amount cytoplasm and copious dendritic projections were found in the presence of MCM, TNF-α with or without FCM, TCCM, FCM as well as TCCM. Flow cytometric analysis revealed that expression of CD14 decreased in particular in treated DCs, at the 5th day and expression of CD80, CD86 and HLA-DR was higher when FCM, TCCM, FCM plus TCCM were added to maturation factor. This study demonstrated that DCs matured with these methods had optimum function in comparison with either factor alone.

  9. Isolation, Expression, and Promoter Analysis of GbWRKY2: A Novel Transcription Factor Gene from Ginkgo biloba

    Yong-Ling Liao

    2015-01-01

    Full Text Available WRKY transcription factor is involved in multiple life activities including plant growth and development as well as biotic and abiotic responses. We identified 28 WRKY genes from transcriptome data of Ginkgo biloba according to conserved WRKY domains and zinc finger structure and selected three WRKY genes, which are GbWRKY2, GbWRKY16, and GbWRKY21, for expression pattern analysis. GbWRKY2 was preferentially expressed in flowers and strongly induced by methyl jasmonate. Here, we cloned the full-length cDNA and genomic DNA of GbWRKY2. The full-length cDNA of GbWRKY2 was 1,713 bp containing a 1,014 bp open reading frame encoding a polypeptide of 337 amino acids. The GbWRKY2 genomic DNA had one intron and two exons. The deduced GbWRKY2 contained one WRKY domain and one zinc finger motif. GbWRKY2 was classified into Group II WRKYs. Southern blot analysis revealed that GbWRKY2 was a single copy gene in G. biloba. Many cis-acting elements related to hormone and stress responses were identified in the 1,363 bp-length 5′-flanking sequence of GbWRKY2, including W-box, ABRE-motif, MYBCOREs, and PYRIMIDINE-boxes, revealing the molecular mechanism of upregulated expression of GbWRKY2 by hormone and stress treatments. Further functional characterizations in transiently transformed tobacco leaves allowed us to identify the region that can be considered as the minimal promoter.

  10. Transient B cell depletion or improved transgene expression by codon optimization promote tolerance to factor VIII in gene therapy.

    Brandon K Sack

    Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.

  11. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  12. Platelets promote osteosarcoma cell growth through activation of the platelet-derived growth factor receptor-Akt signaling axis

    Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-hara, Tomoko; Fujita, Naoya

    2014-01-01

    The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the pro...

  13. Ethical responsibility of the nursing educator in the promotion of the quality of life of university students

    Tatiana González-Noguera

    2018-01-01

    Full Text Available The central interest of this document is to reflect on the ethical responsibility of the nursing educator in the promotion of the health and quality of life of university students, taking into account that nursing is considered a profession that benefits the people which has a close relationship with. To promote a good health in students is a task that implies ethical duties for society, institutions of higher education, of health and essentially for nursing. A nursing professsional is indispensable to produce changes in the lifestyles of the students through the rights and ethical duties that emanate from dignity and that is essential in the education of the youngest. As university educators we must accept the responsibility of promoting healthy lifestyles that protect the health of students and therefore the quality of life of them as future integral professionals.

  14. Promotion of seminomatous tumors by targeted overexpression of glial cell line-derived neurotrophic factor in mouse testis

    Meng, X.; de rooij, D. G.; Westerdahl, K.; Saarma, M.; Sariola, H.

    2001-01-01

    We show with transgenic mice that targeted overexpression of glial cell line-derived neurotrophic factor (GDNF) in undifferentiated spermatogonia promotes malignant testicular tumors, which express germ-cell markers. The tumors are invasive and contain aneuploid cells, but no distant metastases have

  15. Exploring Factors That Promote Online Learning Experiences and Academic Self-Concept of Minority High School Students

    Kumi-Yeboah, Alex; Dogbey, James; Yuan, Guangji

    2018-01-01

    The rapid growth of online education at the K-12 level in recent years presents the need to explore issues that influence the academic experiences of students choosing this method of learning. In this study, we examined factors that promote/hinder the learning experiences and academic self-concept of minority students attending an online high…

  16. Stigmatization and Promotive Factors in Relation to Psychological Health and Life Satisfaction of Adolescents in Planned Lesbian Families

    van Gelderen, Loes; Gartrell, Nanette N.; Bos, Henny M. W.; Hermanns, Jo M. A.

    2013-01-01

    The aim of this study was to investigate whether stigmatization was associated with psychological adjustment in adolescents from planned lesbian families and, if so, to examine whether individual and interpersonal promotive factors influenced this association. Seventy-eight adolescents (39 girls, 39 boys; mean age = 17.05 years) completed an…

  17. Induction of insulin and islet amyloid polypeptide production in pancreatic islet glucagonoma cells by insulin promoter factor 1

    Serup, P; Jensen, J; Andersen, F G

    1996-01-01

    Insulin promoter factor 1 (IPF1), a member of the homeodomain protein family, serves an early role in pancreas formation, as evidenced by the lack of pancreas formation in mice carrying a targeted disruption of the IPF1 gene [Jonsson, J., Carlsson, L., Edlund, T. & Edlund, H. (1994) Nature (London...

  18. Factors associated with the implementation of community-based peer-led health promotion programs: A scoping review.

    Lorthios-Guilledroit, Agathe; Richard, Lucie; Filiatrault, Johanne

    2018-06-01

    Peer education is growing in popularity as a useful health promotion strategy. However, optimal conditions for implementing peer-led health promotion programs (HPPs) remain unclear. This scoping review aimed to describe factors that can influence implementation of peer-led HPPs targeting adult populations. Five databases were searched using the keywords "health promotion/prevention", "implementation", "peers", and related terms. Studies were included if they reported at least one factor associated with the implementation of community-based peer-led HPPs. Fifty-five studies were selected for the analysis. The method known as "best fit framework synthesis" was used to analyze the factors identified in the selected papers. Many factors included in existing implementation conceptual frameworks were deemed applicable to peer-led HPPs. However, other factors related to individuals, programs, and implementation context also emerged from the analysis. Based on this synthesis, an adapted theoretical framework was elaborated, grounded in a complex adaptive system perspective and specifying potential mechanisms through which factors may influence implementation of community-based peer-led HPPs. Further research is needed to test the theoretical framework against empirical data. Findings from this scoping review increase our knowledge of the optimal conditions for implementing peer-led HPPs and thereby maximizing the benefits of such programs. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. How to control self-promotion among performance-oriented employees : The roles of task clarity and personalized responsibility

    Molleman, Eric; Emans, Ben; Turusbekova, Nonna

    2012-01-01

    Purpose - The purpose of this study is to analyze the relationship between the performance orientation of employees and self-promotion in the form of overstating one's performance. It is hypothesized that this relationship depends on task clarity and personalized responsibility.

  20. Growth Response and Tolerance to Heavy Metals of two Swamp Species inoculated with a Plant Growth-Promoting Rhizobacteria

    Rodriguez-Dorantes, A.; Labra-Cardon, D.; Guerrero-Zuniga, A.; Montes-Villafan, S.

    2009-01-01

    Due to the sensitivity and the sequestration ability of the microbial communities to heavy metals, microbes have been used for bioremediation. Recently the application of plant growth-promoting rhizobacteria (PGPR) for the bioremediation of this kind of contaminants has been done. This study evaluated the growth response and the tolerance to heavy metals of two swamp species. (Author)

  1. Identifying functional transcription factor binding sites in yeast by considering their positional preference in the promoters.

    Fu-Jou Lai

    Full Text Available Transcription factor binding site (TFBS identification plays an important role in deciphering gene regulatory codes. With comprehensive knowledge of TFBSs, one can understand molecular mechanisms of gene regulation. In the recent decades, various computational approaches have been proposed to predict TFBSs in the genome. The TFBS dataset of a TF generated by each algorithm is a ranked list of predicted TFBSs of that TF, where top ranked TFBSs are statistically significant ones. However, whether these statistically significant TFBSs are functional (i.e. biologically relevant is still unknown. Here we develop a post-processor, called the functional propensity calculator (FPC, to assign a functional propensity to each TFBS in the existing computationally predicted TFBS datasets. It is known that functional TFBSs reveal strong positional preference towards the transcriptional start site (TSS. This motivates us to take TFBS position relative to the TSS as the key idea in building our FPC. Based on our calculated functional propensities, the TFBSs of a TF in the original TFBS dataset could be reordered, where top ranked TFBSs are now the ones with high functional propensities. To validate the biological significance of our results, we perform three published statistical tests to assess the enrichment of Gene Ontology (GO terms, the enrichment of physical protein-protein interactions, and the tendency of being co-expressed. The top ranked TFBSs in our reordered TFBS dataset outperform the top ranked TFBSs in the original TFBS dataset, justifying the effectiveness of our post-processor in extracting functional TFBSs from the original TFBS dataset. More importantly, assigning functional propensities to putative TFBSs enables biologists to easily identify which TFBSs in the promoter of interest are likely to be biologically relevant and are good candidates to do further detailed experimental investigation. The FPC is implemented as a web tool at http://santiago.ee.ncku.edu.tw/FPC/.

  2. Tobacco use and exposure to tobacco promoting and restraining factors among adolescents in a developing country.

    Doku, D; Koivusilta, L; Raisamo, S; Rimpelä, A

    2012-08-01

    With a long history of tobacco cultivation, adolescents in Ghana are at relatively high risk of the emerging tobacco epidemic in developing countries. This study explored exposure to tobacco promoting/restraining factors and their associations with smoking and tawa (traditional smokeless tobacco) use among 13-18-year-old Ghanaians. School-based representative data were collected in 2008 (n = 1165). Prevalence rates of tobacco use, smoking and tawa use were 9.1% (11.5% boys and 6.4% girls), 6.6% (8.0% boys and 4.7% girls) and 5.7% (7.3% boys and 3.9% girls), respectively. Four percent of the respondents attended schools without a smoking ban, 66% had been taught about the harmful effects of smoking in the current school year, and 53% had been exposed to tobacco advertising. Fifty-three percent of adolescents who had tried to purchase tobacco products were not refused because of their age. Multivariate analyses found that attendance at a school where smoking was allowed, not having been taught about the harmful effects of smoking, exposure to tobacco advertising and parental smoking were positively associated with tobacco use, and knowledge that smoking is harmful to health and difficult to quit were negatively associated with tobacco use. Both smoking and tawa use were relatively low among Ghanaian adolescents. Exposure to tobacco advertising was high. There is no tobacco legislation in Ghana, but societal norms or cultural values seem to restrict smoking in schools and access to tobacco products. Copyright © 2012 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  3. Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors.

    Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J

    2016-01-01

    The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.

  4. Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2

    Ning Song

    2016-01-01

    Full Text Available Background/Aims: The aggressive manner of ovarian cancer (OVC cells accounts for the majority of its lethality. Recently, we have shown that placental growth factor (PLGF promotes metastases of OVC cells through miR-543-regulated MMP7. In the current study, we analyzed the effects of PLGF on another cell invasion associated protein, ZEB2, in OVC cells. Methods: The PLGF and ZEB2 levels in OVC tissues were compared to the paired adjacent non-tumor ovary tissue. We modified ZEB2 levels in OVC cells, and examined its effects on PLGF mRNA and protein levels by RT-qPCR and by Western blot, respectively. We also modified PLGF levels in OVC cells, and examined its effects on ZEB2 mRNA and protein levels by RT-qPCR and by Western blot, respectively. Then, we examined the cell invasiveness in PLGF-modified OVC cells in a transwell cell invasion assay. Finally, we used specific signal pathway inhibitors to treat PLGF-modified OVC cells and examined the effects on ZEB2 activation. Results: PLGF and ZEB2 levels were both significantly increased in OVC tissues, compared to the paired adjacent non-tumor ovary tissue. The PLGF and ZEB2 levels were strongly correlated. ZEB2 modification did not alter PLGF levels. Overexpression of PLGF in OVC cells significantly increased ZEB2 levels and cell invasiveness, while PLGF depletion in OVC cells significantly decreased ZEB2 levels and cell invasiveness. Application of a specific MAPK-p38 inhibitor, but not application of specific inhibitors for MAPK-p42/p44, PI3k/Akt, or JNK signaling pathways, to PLGF-overexpressing OVC cells substantially abolished the PLGF-induced ZEB2 activation. Conclusion: PLGF enhances OVC cell invasion through MAPK-p38-dependent activation of ZEB2.

  5. Factors impacting on menstrual hygiene and their implications for health promotion.

    Lahme, Anne Mutunda; Stern, Ruth; Cooper, Diane

    2018-03-01

    In the lives of women, puberty is marked by the onset of menarche. From this stage onwards until menopause, reproductive health and menstrual hygiene are important aspects of women's lives. In Zambia's Western Province, the natural process of menstruation is a taboo and dealt with secretly. Information and knowledge about menstruation and menstrual hygiene among adolescent girls is inadequate. This paper explores the factors influencing the understanding, experiences and practices of menstrual hygiene among adolescent girls in Mongu District, Western Province of Zambia. An explorative study design was used by means of six focus group discussions conducted with 51 respondents, aged 13-20 years, from three secondary schools. Their age at menarche was 11-15. For data analysis thematic content analysis was used. The paper shows that the girls suffer from poor menstrual hygiene, originating from lack of knowledge, culture and tradition, and socio-economic and environmental constraints, leading to inconveniences, humiliation and stress. This leads to reduced school attendance and poor academic performance, or even drop outs, and ultimately infringes upon the girls' human rights. To address these shortcomings, a 'super setting approach' is recommended, in which a Health Promoting School could improve the girls' individual and group needs, and a community setting which would address the broader socio-economic, cultural and environmental conditions. This would enable creating a supportive environment for the girls to manage their periods. To successfully utilize the approach, all stakeholders (parents, teachers, children, governments and communities) should cooperate to generate context-specific solutions for creating safe menstrual care, and better and dignified conditions for adolescent girls. Therefore, this calls for comprehensive, strident advocacy for policy changes at national level, and mediation and involvement at community level.

  6. Lymphotoxin β receptor activation promotes bladder cancer in a nuclear factor-κB-dependent manner.

    Shen, Mo; Duan, Xiuzhi; Zhou, Ping; Zhou, Wu; Wu, Xiuling; Xu, Siqi; Chen, Yuhua; Tao, Zhihua

    2015-02-01

    Bladder cancer (BCa) is the most common tumor of the urinary system. Chronic inflammation in the papillary urothelial neoplasm of low malignant potential (PUNLMP)may contribute to carcinogenesis, including that of BCa, via poorly understood mechanisms. In this study, we show that the lymphotoxin β receptor (LTβR) is upregulated in BCa via activation of the canonical and non-canonical nuclear factor-κB (NF-κB) pathways. The mRNA expression of LTβR in 81 BCa, 10 chronic cystitis and 23 healthy bladder mucosa tissues was investigated by reverse transcription-fluorescent quantitative polymerase chain reaction (RT-FQ-PCR), and protein expression was studied in 73 BCa, 30 cystitis and 15 healthy paraffin-embedded tissue sections by immunohistochemistry. Both LTβR mRNA and protein were upregulated in BCa and cystitis compared to the healthy group (P<0.05). The mRNA level of the downstream NF-κB canonical pathway p65 gene and of the non-canonical pathway RelB gene were higher in the BCa and cystitis groups compared to the healthy one. The level of phosphorylated p65 (p-p65) protein of the canonical NF-κB pathway and that of p52, a protein of the non-canonical NF-κB pathway, were also higher in the BCa and cystitis group compared to the healthy group. The levels of these proteins significantly correlated to the pathological grade, clinical stage and lymph node metastasis of BCa patients (P<0.05). In addition, there was a positive correlation between LTβR and NF-κB pathway proteins. Thus, LTβR signaling may be involved in promoting BCa through the NF-κB pathway, and which may represent the molecular link between inflammation and BCa.

  7. Perspectives in the use of tannins as alternative to antimicrobial growth promoter factors in poultry

    Leandro M Redondo

    2014-03-01

    Full Text Available Antibiotics have been included in the formulation of feed for livestock production for more than 40 years as a strategy to improve feed conversion rates and to reduce costs. The use of antimicrobials as growth-promoting factors (AGP in sub-therapeutic doses for long periods is particularly favorable to select antimicrobial-resistant microorganisms. In the last years, global concern about development of antimicrobial resistance and transference of resistance genes from animal to human strains has been arising. Removal of AGP from animal diets involves a tremendous pressure on the livestock and poultry farmers, one of the main consequences being a substantial increase in the incidence of infectious diseases with the related increase in the use of antibiotics for therapy and, concomitantly, economic cost. Therefore, alternatives to AGP are urgently needed. The challenge is to implement new alternatives without affecting the production performances of livestock and also avoiding the increase of antimicrobial resistant microorganisms. Plant extracts and purified derived substances are showing promising results for food animal production, either from their efficacy as well as from an economical point of view. Tannins are plant derived compounds that are being successfully used as additives in feed poultry to control diseases and to improve animal performance. Successful use of any of these extracts as feed additive must ensure a product of consistent quality in enough quantities to fulfill the actual requirements of the poultry industry. Chestnut (hydrolizable and Quebracho (condennsed tannins are probably the most readily available commercial products that are covering those needs. The present report intends to analyze the available data supporting their use.

  8. Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors

    Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054

  9. Radiation damage of hemopoietic tissue: circulating stem cells and growth factor responses

    Wagemaker, G.

    1997-01-01

    Briefly, evidence in rodents and nonhuman primates demonstrated two types of immature cells to be involved in regeneration following total body irradiation (X-rays). These cell populations can be separated and there is good responses differ. Related to these observations, experimental growth factor therapy has been ineffective at doses larger than 6-7 Gy X-rays and was shown to be optimally effective at the mid-lethal dose of 5 Gy. Consequently, at relatively high doses of radiation, treatment should initially be directed at reconstitution of growth factor responding stem cell subsets rather than at accelerated production of mature blood cells. Following cytotoxic insult to bone marrow, hemopoietic reconstitution is characterized by an increased fraction of stem cells that enters circulation. This might reflect a physiological mechanism to regulate the activities of the scattered bone marrow sites. In experimental studies with nonhuman primates, we showed that the number of circulating immature cells are proportional to those in the bone marrow and can be used for quantitative evaluation of residual stem cells numbers and to monitor the effectiveness of growth factor therapy at the immature cell level. The latter observations enables the design of growth factor treatment schedules for radiation induced myelosuppression in which thrombopenia is reduced and the recovery of immature bone marrow cells is promoted. (N.C.)

  10. Factors that promote success in women enrolled in STEM disciplines in rural North Carolina community colleges

    Kincaid, Shannon D.

    Women have historically been underrepresented in the fields of science, technology, engineering, and math (STEM fields). The underrepresentation of women in STEM may be attributable to a variety of factors. These may include different choices men and women typically make in response to incentives in STEM education. For example, STEM career paths may be less accommodating to people who are less resilient. Another factor may be that there are relatively few female STEM role models. Perhaps strong gender stereotypes discourage women from pursuing STEM education and STEM jobs. The factors that contribute to success and the barriers that impeded success must be identified before any steps can be taken to improve the educational outcomes for women in STEM disciplines. Consequently, relatively little is known about the role of resilience in academically successful adult women in rural community colleges enrolled in STEM disciplines and the mechanisms that underlie the performance deficits that occur as a result of stereotype threat effect. This mixed method study addressed those knowledge gaps by determining: (1) if high resilience is positively correlated to high grade point average for women enrolled in STEM disciplines in rural community colleges in North Carolina, and (2) if stereotype threat effect is a risk factor for these women. Quantitative data were collected by using "The Resilience Scale" (Wagnild & Young, 1987) and through examination of grade point average of students from Datatel data management software. Qualitative data were collected through semi-structured focus group interviews. Findings from this study indicate high resilience is positively correlated to high grade point average for women enrolled in STEM disciplines in rural community colleges in North Carolina, and stereotype threat effect was a risk factor for low-scoring women (i.e. those women who reported resilience scores less than 121 and grade point averages lower than 2.70) and was not a

  11. Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis.

    Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi

    2017-01-29

    Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Identification of TNF-α-responsive promoters and enhancers in the intestinal epithelial cell model Caco-2

    Boyd, Mette; Coskun, Mehmet; Lilje, Berit

    2014-01-01

    The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....

  13. Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

    Kazi Md Kamrul Huda

    Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible

  14. A generalized linear factor model approach to the hierarchical framework for responses and response times.

    Molenaar, Dylan; Tuerlinckx, Francis; van der Maas, Han L J

    2015-05-01

    We show how the hierarchical model for responses and response times as developed by van der Linden (2007), Fox, Klein Entink, and van der Linden (2007), Klein Entink, Fox, and van der Linden (2009), and Glas and van der Linden (2010) can be simplified to a generalized linear factor model with only the mild restriction that there is no hierarchical model at the item side. This result is valuable as it enables all well-developed modelling tools and extensions that come with these methods. We show that the restriction we impose on the hierarchical model does not influence parameter recovery under realistic circumstances. In addition, we present two illustrative real data analyses to demonstrate the practical benefits of our approach. © 2014 The British Psychological Society.

  15. Lettuce and rhizosphere microbiome responses to growth promoting Pseudomonas species under field conditions

    Cipriano, M.A.P.; Lupatini, M.; Santos, L.; Silva, M. da; Roesch, L.F.W.; Destefano, S.; Freitas, S.; Kuramae, E.E.

    2016-01-01

    Plant growth promoting rhizobacteria (PGPR) are well described and recommended for several crops worldwide. However, one of the most common problems in PGPR research is the difficulty in obtaining reproducible results. Furthermore, few studies have evaluated plant growth promotion and soil microbial

  16. NECAP 4.1: NASA's Energy Cost Analysis Program thermal response factor routine

    Weise, M. R.

    1982-08-01

    A thermal response factor is described and calculation sequences and flowcharts for RESFAC2 are provided. RESFAC is used by NASA's (NECAP) to calculate hourly heat transfer coefficients (thermal response factors) for each unique delayed surface. NECAP uses these response factors to compute each spaces' hourly heat gain/loss.

  17. Uncovering the Mechanisms Responsible for Why Language Learning May Promote Healthy Cognitive Aging

    Mark Antoniou

    2017-12-01

    Full Text Available One of the great challenges facing humankind in the 21st century is preserving healthy brain function in our aging population. Individuals over 60 are the fastest growing age group in the world, and by 2050, it is estimated that the number of people over the age of 60 will triple. The typical aging process involves cognitive decline related to brain atrophy, especially in frontal brain areas and regions that subserve declarative memory, loss of synaptic connections, and the emergence of neuropathological symptoms associated with dementia. The disease-state of this age-related cognitive decline is Alzheimer’s disease and other dementias, which may cause older adults to lose their independence and rely on others to live safely, burdening family members and health care systems in the process. However, there are two lines of research that offer hope to those seeking to promote healthy cognitive aging. First, it has been observed that lifestyle variables such as cognitive leisure activities can moderate the risk of Alzheimer’s disease, which has led to the development of plasticity-based interventions for older adults designed to protect against the adverse effects of cognitive decline. Second, there is evidence that lifelong bilingualism acts as a safeguard in preserving healthy brain function, possibly delaying the incidence of dementia by several years. In previous work, we have suggested that foreign language learning programs aimed at older populations are an optimal solution for building cognitive reserve because language learning engages an extensive brain network that is known to overlap with the regions negatively affected by the aging process. Here, we will outline potential future lines of research that may uncover the mechanism responsible for the emergence of language learning related brain advantages, such as language typology, bi- vs. multi-lingualism, age of acquisition, and the elements that are likely to result in the largest

  18. Long Rest Interval Promotes Durable Testosterone Responses in High-Intensity Bench Press.

    Scudese, Estevão; Simão, Roberto; Senna, Gilmar; Vingren, Jakob L; Willardson, Jeffrey M; Baffi, Matheus; Miranda, Humberto

    2016-05-01

    The purpose of this study was to examine the influence of rest period duration (1 vs. 3 minute between sets) on acute hormone responses to a high-intensity and equal volume bench press workout. Ten resistance-trained men (25.2 ± 5.6 years; 78.2 ± 5.7 kg; 176.7 ± 5.4 cm; bench press relative strength: 1.3 ± 0.1 kg per kilogram of body mass) performed 2 bench press workouts separated by 1 week. Each workout consisted of 5 sets of 3 repetitions performed at 85% of 1 repetition maximum, with either 1- or 3-minute rest between sets. Circulating concentrations of total testosterone (TT), free testosterone (FT), cortisol (C), testosterone/cortisol ratio (TT/C), and growth hormone (GH) were measured at preworkout (PRE), and immediately (T0), 15 minutes (T15), and 30 minutes (T30) postworkout. Rating of perceived exertion was recorded before and after each set. For TT, both rest lengths enhanced all postexercise verifications (T0, T15, and T30) compared with PRE, with 1 minute showing decreases on T15 and T30 compared with T0. For FT, both 1- and 3-minute rest protocols triggered augmentations on distinct postexercise moments (T0 and T15 for 1 minute; T15 and T30 for 3-minute) compared with PRE. The C values did not change throughout any postexercise verification for either rests. The TT/C ratio was significantly elevated for both rests in all postexercise moments compared with PRE. Finally, GH values did not change for both rest lengths. In conclusion, although both short and long rest periods enhanced acute testosterone values, the longer rest promoted a long-lasting elevation for both TT and FT.

  19. Uncovering the Mechanisms Responsible for Why Language Learning May Promote Healthy Cognitive Aging

    Antoniou, Mark; Wright, Sarah M.

    2017-01-01

    One of the great challenges facing humankind in the 21st century is preserving healthy brain function in our aging population. Individuals over 60 are the fastest growing age group in the world, and by 2050, it is estimated that the number of people over the age of 60 will triple. The typical aging process involves cognitive decline related to brain atrophy, especially in frontal brain areas and regions that subserve declarative memory, loss of synaptic connections, and the emergence of neuropathological symptoms associated with dementia. The disease-state of this age-related cognitive decline is Alzheimer’s disease and other dementias, which may cause older adults to lose their independence and rely on others to live safely, burdening family members and health care systems in the process. However, there are two lines of research that offer hope to those seeking to promote healthy cognitive aging. First, it has been observed that lifestyle variables such as cognitive leisure activities can moderate the risk of Alzheimer’s disease, which has led to the development of plasticity-based interventions for older adults designed to protect against the adverse effects of cognitive decline. Second, there is evidence that lifelong bilingualism acts as a safeguard in preserving healthy brain function, possibly delaying the incidence of dementia by several years. In previous work, we have suggested that foreign language learning programs aimed at older populations are an optimal solution for building cognitive reserve because language learning engages an extensive brain network that is known to overlap with the regions negatively affected by the aging process. Here, we will outline potential future lines of research that may uncover the mechanism responsible for the emergence of language learning related brain advantages, such as language typology, bi- vs. multi-lingualism, age of acquisition, and the elements that are likely to result in the largest gains. PMID:29326636

  20. Vulnerable Family Meetings: A Way of Promoting Team Working in GPs’ Everyday Responses to Child Maltreatment?

    Jenny Woodman

    2014-08-01

    Full Text Available This study uses observations of team meetings and interviews with 17 primary care professionals in four GP practices in England to generate hypotheses about how “vulnerable family” team meetings might support responses by GPs to maltreatment-related concerns and joint working with other professionals. These meetings are also called “safeguarding meetings”. The study found that vulnerable family meetings were used as a way of monitoring children or young people and their families and supporting risk assessment by information gathering. Four factors facilitated the meetings: meaningful information flow into the meetings from other agencies, systematic ways of identifying cases for discussion, limiting attendance to core members of the primary care team and locating the meeting as part of routine clinical practice. Our results generate hypotheses about a model of care that can be tested for effectiveness in terms of service measures, child and family outcomes, and as a potential mechanism for other professionals to engage and support GPs in their everyday responses to vulnerable and maltreated children. The potential for adverse as well as beneficial effects should be considered from involving professionals outside the core primary care team (e.g., police, children’s social care, education and mental health services.

  1. HMGB1 Promotes Systemic Lupus Erythematosus by Enhancing Macrophage Inflammatory Response

    Mudan Lu

    2015-01-01

    Full Text Available Background/Purpose. HMGB1, which may act as a proinflammatory mediator, has been proposed to contribute to the pathogenesis of multiple chronic inflammatory and autoimmune diseases including systemic lupus erythematosus (SLE; however, the precise mechanism of HMGB1 in the pathogenic process of SLE remains obscure. Method. The expression of HMGB1 was measured by ELISA and western blot. The ELISA was also applied to detect proinflammatory cytokines levels. Furthermore, nephritic pathology was evaluated by H&E staining of renal tissues. Results. In this study, we found that HMGB1 levels were significantly increased and correlated with SLE disease activity in both clinical patients and murine model. Furthermore, gain- and loss-of-function analysis showed that HMGB1 exacerbated the severity of SLE. Of note, the HMGB1 levels were found to be associated with the levels of proinflammatory cytokines such as TNF-α and IL-6 in SLE patients. Further study demonstrated that increased HMGB1 expression deteriorated the severity of SLE via enhancing macrophage inflammatory response. Moreover, we found that receptor of advanced glycation end products played a critical role in HMGB1-mediated macrophage inflammatory response. Conclusion. These findings suggested that HMGB1 might be a risk factor for SLE, and manipulation of HMGB1 signaling might provide a therapeutic strategy for SLE.

  2. EPA Participates in Energy Roundtable with States, Tribes, Businesses and Environmental Groups to Enhance Coordination and Promote Responsible Domestic Production of Oil and Gas Resources

    EPA News Release: EPA Participates in Energy Roundtable with States, Tribes, Businesses and Environmental Groups to Enhance Coordination and Promote Responsible Domestic Production of Oil and Gas Resources

  3. Factors promoting health-related quality of life in people with rheumatic diseases: a 12 month longitudinal study

    2011-01-01

    Background Rheumatic diseases have a significant adverse impact on the individual from physical, mental and social aspects, resulting in a low health-related quality of life (HRQL). There is a lack of longitudinal studies on HRQL in people with rheumatic diseases that focus on factors promoting HRQL instead of risk factors. The aim of this study was to investigate the associations between suggested health promoting factors at baseline and outcome in HRQL at a 12 month follow-up in people with rheumatic diseases. Methods A longitudinal cohort study was conducted in 185 individuals with rheumatic diseases with questionnaires one week and 12 months after rehabilitation in a Swedish rheumatology clinic. HRQL was assessed by SF-36 together with suggested health factors. The associations between SF-36 subscales and the health factors were analysed by multivariable logistic regressions. Results Factors predicting better outcome in HRQL in one or several SF-36 subscales were being younger or middle-aged, feeling painless, having good sleep structure, feeling rested after sleep, performing low effort of exercise more than twice per week, having strong sense of coherence (SOC), emotional support and practical assistance, higher educational level and work capacity. The most important factors were having strong SOC, feeling rested after sleep, having work capacity, being younger or middle-aged, and having good sleep structure. Conclusions This study identified several factors that promoted a good outcome in HRQL to people with rheumatic diseases. These health factors could be important to address in clinical work with rheumatic diseases in order to optimise treatment strategies. PMID:21599884

  4. Stat6 Promotes Intestinal Tumorigenesis in a Mouse Model of Adenomatous Polyposis by Expansion of MDSCs and Inhibition of Cytotoxic CD8 Response

    Asha Jayakumar

    2017-08-01

    Full Text Available Intestinal tumorigenesis in the ApcMin/+ model is initiated by aberrant activation of Wnt pathway. Increased IL-4 expression in human colorectal cancer tissue and growth of colon cancer cell lines implied that IL-4–induced Stat6-mediated tumorigenic signaling likely contributes to intestinal tumor progression in ApcMin/+ mice. Stat6 also appears to promote expansion of myeloid-derived suppressor cells (MDSCs cells. MDSCs promote polyp formation in the ApcMin/+ model. Hence, Stat6 could have a broad role in coordinating both polyp cell proliferation and MDSC expansion. We found that IL-4–induced Stat6-mediated proliferation of intestinal epithelial cells is augmented by platelet-derived growth factor–BB, a tumor-promoting growth factor. To determine whether polyp progression in ApcMin/+ mice is dependent on Stat6 signaling, we disrupted Stat6 in this model. Total polyps in the small intestine were fewer in ApcMin/+ mice lacking Stat6. Furthermore, proliferation of polyp epithelial cells was reduced, indicating that Stat6 in part controlled polyp formation. Stat6 also promoted expansion of MDSCs in the spleen and lamina propria of ApcMin/+ mice, implying regulation of antitumor T-cell response. More CD8 cells and reduced PD-1 expression on CD4 cells correlated with reduced polyps. In addition, a strong CD8-mediated cytotoxic response led to killing of tumor cells in Stat6-deficient ApcMin/+ mice. Therefore, these findings show that Stat6 has an oncogenic role in intestinal tumorigenesis by promoting polyp cell proliferation and immunosuppressive mediators, and preventing an active cytotoxic process.

  5. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Increased expression of hepatocyte nuclear factor 4 alpha transcribed by promoter 2 indicates a poor prognosis in hepatocellular carcinoma

    Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping

    2017-01-01

    Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...

  7. Health promotion behaviors and related factors in end stage renal disease patients treated with continuous ambulatory peritoneal dialysis.

    Wechpradit, Apinya; Thaiyuenwong, Jutiporn; Kanjanabuch, Talerngsak

    2011-09-01

    To present study health promotion behaviors and related factors in end stage renal disease (ESRD) patients treated with continuous ambulatory peritoneal dialysis (CAPD). Questionnaires of Pender to evaluate health promotion behaviors which measure 5 aspects of health-affected behaviors were examined in 90 CAPD patients at dialysis unit of Udornthani Hospital. Results were categorized into 3 groups according to Bloom's scale as follows: high, moderate, and low levels. The data were displayed as ranges or means +/- standard deviation, according to the characteristics of each variable, with a 5% (p cherish health behaviors of the patients.

  8. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

  9. Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

    Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

    2011-01-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  10. Bet Anywhere, Anytime: An Analysis of Internet Sports Bettors' Responses to Gambling Promotions During Sports Broadcasts by Problem Gambling Severity.

    Hing, Nerilee; Russell, Alex Myles Thomas; Lamont, Matthew; Vitartas, Peter

    2017-12-01

    Promotions for online sports betting during televised sports broadcasts are regularly viewed by millions of Australians, raising concerns about their impacts on vulnerable groups including at-risk and problem gamblers. This study examined whether responses to these promotions varied with problem gambling severity amongst 455 Australian Internet sports bettors participating in an online survey. Results indicated that young male Internet sports bettors are especially vulnerable to gambling problems, particularly if they hold positive attitudes to gambling sponsors who embed promotions into sports broadcasts and to the promotional techniques they use and this heightens the risk that alluring messages contribute to excessive gambling. As problem gambling severity increased, so too did recognition that these promotions have impacted negatively on their sports betting behaviour. Because a plethora of sports betting brands and promotions are now heavily integrated into sports coverage, social marketing efforts are needed to offset their persuasive appeal and counter the positive attitudes towards them that appear linked to excessive gambling amongst Internet sports bettors.

  11. Foxn1 Transcription Factor Regulates Wound Healing of Skin through Promoting Epithelial-Mesenchymal Transition.

    Barbara Gawronska-Kozak

    Full Text Available Transcription factors are key molecules that finely tune gene expression in response to injury. We focused on the role of a transcription factor, Foxn1, whose expression is limited to the skin and thymus epithelium. Our previous studies showed that Foxn1 inactivity in nude mice creates a pro-regenerative environment during skin wound healing. To explore the mechanistic role of Foxn1 in the skin wound healing process, we analyzed post-injured skin tissues from Foxn1::Egfp transgenic and C57BL/6 mice with Western Blotting, qRT-PCR, immunofluorescence and flow cytometric assays. Foxn1 expression in non-injured skin localized to the epidermis and hair follicles. Post-injured skin tissues showed an intense Foxn1-eGFP signal at the wound margin and in leading epithelial tongue, where it co-localized with keratin 16, a marker of activated keratinocytes. This data support the concept that suprabasal keratinocytes, expressing Foxn1, are key cells in the process of re-epithelialization. The occurrence of an epithelial-mesenchymal transition (EMT was confirmed by high levels of Snail1 and Mmp-9 expression as well as through co-localization of vimentin/E-cadherin-positive cells in dermis tissue at four days post-wounding. Involvement of Foxn1 in the EMT process was verified by co-localization of Foxn1-eGFP cells with Snail1 in histological sections. Flow cytometric analysis showed the increase of double positive E-cadherin/N-cadherin cells within Foxn1-eGFP population of post-wounded skin cells isolates, which corroborated histological and gene expression analyses. Together, our findings indicate that Foxn1 acts as regulator of the skin wound healing process through engagement in re-epithelization and possible involvement in scar formation due to Foxn1 activity during the EMT process.

  12. Effects of epidermal growth factor receptor kinase inhibition on radiation response in canine osteosarcoma cells.

    Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J

    2016-05-31

    Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of

  13. Surgery as a Double-Edged Sword: A Clinically Feasible Approach to Overcome the Metastasis-Promoting Effects of Surgery by Blunting Stress and Prostaglandin Responses

    Benish, Marganit; Ben-Eliyahu, Shamgar

    2010-01-01

    Surgery remains an essential therapeutic approach for most solid malignancies, including breast cancer. However, surgery also constitutes a risk factor for promotion of pre-existing micrometastases and the initiation of new metastases through several mechanisms, including the release of prostaglandins and stress hormones (e.g., catecholamines and glucocorticoids). However, the perioperative period also presents an opportunity for cell mediated immunity (CMI) and other mechanisms to eradicate or control minimal residual disease, provided that the deleterious effects of surgery are minimized. Here, we discuss the key role of endogenous stress hormones and prostaglandins in promoting the metastatic process through their direct impact on malignant cells, and through their deleterious impact on anti-cancer CMI. We further discuss the effects of anesthetic techniques, the extent of surgery, pain alleviation, and timing within the menstrual cycle with respect to their impact on tumor recurrence and physiological stress responses. Last, we suggest an attractive perioperative drug regimen, based on a combination of a cyclooxygenase (COX)-2 inhibitor and a β-adrenergic blocker, which we found effective in attenuating immune suppression and the metastasis-promoting effects of surgery in several tumor models. This regimen is clinically applicable, and could potentially promote disease free survival in patients operated for breast and other types of cancer

  14. Surgery as a Double-Edged Sword: A Clinically Feasible Approach to Overcome the Metastasis-Promoting Effects of Surgery by Blunting Stress and Prostaglandin Responses

    Benish, Marganit; Ben-Eliyahu, Shamgar, E-mail: shamgar@post.tau.ac.il [Neuroimmunology Research Unit, Department of Psychology, Tel Aviv University, Tel Aviv 69978 (Israel)

    2010-11-24

    Surgery remains an essential therapeutic approach for most solid malignancies, including breast cancer. However, surgery also constitutes a risk factor for promotion of pre-existing micrometastases and the initiation of new metastases through several mechanisms, including the release of prostaglandins and stress hormones (e.g., catecholamines and glucocorticoids). However, the perioperative period also presents an opportunity for cell mediated immunity (CMI) and other mechanisms to eradicate or control minimal residual disease, provided that the deleterious effects of surgery are minimized. Here, we discuss the key role of endogenous stress hormones and prostaglandins in promoting the metastatic process through their direct impact on malignant cells, and through their deleterious impact on anti-cancer CMI. We further discuss the effects of anesthetic techniques, the extent of surgery, pain alleviation, and timing within the menstrual cycle with respect to their impact on tumor recurrence and physiological stress responses. Last, we suggest an attractive perioperative drug regimen, based on a combination of a cyclooxygenase (COX)-2 inhibitor and a β-adrenergic blocker, which we found effective in attenuating immune suppression and the metastasis-promoting effects of surgery in several tumor models. This regimen is clinically applicable, and could potentially promote disease free survival in patients operated for breast and other types of cancer.

  15. The surgeon's perspective: promoting and discouraging factors for choosing a career in surgery as perceived by surgeons.

    Julia C Seelandt

    Full Text Available BACKGROUND: The aim of this study was to identify the factors perceived by surgeons that promote surgery as an attractive or unattractive career choice for today's graduates. In addition, it examined whether the perspectives of surgeons in different professional situations converges. The content of work, contextual work conditions, and calling to this job are discussed in the context of choosing surgery as a career. METHODS: Eight hundred sixty-nine surgeons were asked to answer open-ended questions regarding the factors that promote surgery as an attractive or unattractive career choice for today's graduates. Four hundred ninety-two surgeons participated, and 1,525 statements were analyzed using Mayring's content-analyses method. Chi-square tests were used to analyze the differences among hierarchical positions. RESULTS: With respect to the factors that promote surgery as a profession, 40.8% (209/492 of the surgeons stated that surgery is a calling, 29.1% (149/492 of the surgeons provided at least one argument related to the positive task characteristics, and 12.9% (66/492 of the surgeons provided statements related to the positive contextual factors. With respect to the factors that discourage surgery as a profession, 45.7% (234/492 of the surgeons provided at least one argument related to the discouraging work characteristics, and 67.6% (346/492 of the surgeons provided problematic contextual characteristics. CONCLUSION: This study emphasizes the importance of the calling to surgery as an important factor for choosing surgery as a career. However, the extensive workload, training, and poor work-family balance have been identified as factors that discourage graduates from choosing surgery as a career. The identified positive factors could be used to attract and maintain graduates in surgical disciplines.

  16. The surgeon's perspective: promoting and discouraging factors for choosing a career in surgery as perceived by surgeons.

    Seelandt, Julia C; Kaderli, Reto M; Tschan, Franziska; Businger, Adrian P

    2014-01-01

    The aim of this study was to identify the factors perceived by surgeons that promote surgery as an attractive or unattractive career choice for today's graduates. In addition, it examined whether the perspectives of surgeons in different professional situations converges. The content of work, contextual work conditions, and calling to this job are discussed in the context of choosing surgery as a career. Eight hundred sixty-nine surgeons were asked to answer open-ended questions regarding the factors that promote surgery as an attractive or unattractive career choice for today's graduates. Four hundred ninety-two surgeons participated, and 1,525 statements were analyzed using Mayring's content-analyses method. Chi-square tests were used to analyze the differences among hierarchical positions. With respect to the factors that promote surgery as a profession, 40.8% (209/492) of the surgeons stated that surgery is a calling, 29.1% (149/492) of the surgeons provided at least one argument related to the positive task characteristics, and 12.9% (66/492) of the surgeons provided statements related to the positive contextual factors. With respect to the factors that discourage surgery as a profession, 45.7% (234/492) of the surgeons provided at least one argument related to the discouraging work characteristics, and 67.6% (346/492) of the surgeons provided problematic contextual characteristics. This study emphasizes the importance of the calling to surgery as an important factor for choosing surgery as a career. However, the extensive workload, training, and poor work-family balance have been identified as factors that discourage graduates from choosing surgery as a career. The identified positive factors could be used to attract and maintain graduates in surgical disciplines.

  17. Tumor associated osteoclast-like giant cells promote tumor growth and lymphangiogenesis by secreting vascular endothelial growth factor-C

    Hatano, Yu; Nakahama, Ken-ichi; Isobe, Mitsuaki; Morita, Ikuo

    2014-01-01

    Highlights: • M-CSF and RANKL expressing HeLa cells induced osteoclastogenesis in vitro. • We established OGC-containing tumor model in vivo. • OGC-containing tumor became larger independent of M-CSF or RANKL effect. • VEGF-C secreted from OGCs was a one of candidates for OGC-containing tumor growth. - Abstract: Tumors with osteoclast-like giant cells (OGCs) have been reported in a variety of organs and exert an invasive and prometastatic phenotype, but the functional role of OGCs in the tumor environment has not been fully clarified. We established tumors containing OGCs to clarify the role of OGCs in tumor phenotype. A mixture of HeLa cells expressing macrophage colony-stimulating factor (M-CSF, HeLa-M) and receptor activator of nuclear factor-κB ligand (RANKL, HeLa-R) effectively supported the differentiation of osteoclast-like cells from bone marrow macrophages in vitro. Moreover, a xenograft study showed OGC formation in a tumor composed of HeLa-M and HeLa-R. Surprisingly, the tumors containing OGCs were significantly larger than the tumors without OGCs, although the growth rates were not different in vitro. Histological analysis showed that lymphangiogenesis and macrophage infiltration in the tumor containing OGCs, but not in other tumors were accelerated. According to quantitative PCR analysis, vascular endothelial growth factor (VEGF)-C mRNA expression increased with differentiation of osteoclast-like cells. To investigate whether VEGF-C expression is responsible for tumor growth and macrophage infiltration, HeLa cells overexpressing VEGF-C (HeLa-VC) were established and transplanted into mice. Tumors composed of HeLa-VC mimicked the phenotype of the tumors containing OGCs. Furthermore, the vascular permeability of tumor microvessels also increased in tumors containing OGCs and to some extent in VEGF-C-expressing tumors. These results suggest that macrophage infiltration and vascular permeability are possible mediators in these tumors. These

  18. HTLV-1 Tax upregulates early growth response protein 1 through nuclear factor-κB signaling.

    Huang, Qingsong; Niu, Zhiguo; Han, Jingxian; Liu, Xihong; Lv, Zhuangwei; Li, Huanhuan; Yuan, Lixiang; Li, Xiangping; Sun, Shuming; Wang, Hui; Huang, Xinxiang

    2017-08-01

    Human T cell leukemia virus type 1 (HTLV-1) is a complex retrovirus that causes adult T cell leukemia (ATL) in susceptible individuals. The HTLV-1-encoded oncoprotein Tax induces persistent activation of the nuclear factor-κB (NF-κB) pathway. Early growth response protein 1 (EGR1) is overexpressed in HTLV-1-infected T cell lines and ATL cells. Here, we showed that both Tax expression and HTLV-1 infection promoted EGR1 overexpression. Loss of the NF-κB binding site in the EGR1 promotor or inhibition of NF-κB activation reduced Tax-induced EGR1 upregulation. Tax mutants unable to activate NF-κB induced only slight EGR1 upregulation as compared with wild-type Tax, confirming NF-κB pathway involvement in EGR1 regulation. Tax also directly interacted with the EGR1 protein and increased endogenous EGR1 stability. Elevated EGR1 in turn promoted p65 nuclear translocation and increased NF-κB activation. These results demonstrate a positive feedback loop between EGR1 expression and NF-κB activation in HTLV-1-infected and Tax-expressing cells. Both NF-κB activation and Tax-induced EGR1 stability upregulated EGR1, which in turn enhanced constitutive NF-κB activation and facilitated ATL progression in HTLV-1-infected cells. These findings suggest EGR1 may be an effective anti-ATL therapeutic target.

  19. Near-UV radiation acts as a beneficial factor for physiological responses in cucumber plants.

    Mitani-Sano, Makiko; Tezuka, Takafumi

    2013-11-05

    Effects of near-UV radiation on the growth and physiological activity of cucumber plants were investigated morphologically, physiologically and biochemically using 3-week-old seedlings grown under polyvinyl chloride films featuring transmission either above 290 nm or above 400 nm in growth chambers. The hypocotyl length and leaf area of cucumber seedlings were reduced but the thickness of leaves was enhanced by near-UV radiation, due to increased upper/lower epidermis thickness, palisade parenchyma thickness and volume of palisade parenchyma cells. Photosynthetic and respiratory activities were also promoted by near-UV radiation, associated with general enhancement of physiological/biochemical responses. Particularly, metabolic activities in the photosynthetic system of chloroplasts and the respiratory system of mitochondria were analyzed under the conditions of visible light with and without near-UV radiation. For example, the activities of NAD(P)-dependent enzymes such as glyceraldehyde-3-phosphate dehydrogenase (G3PDH) in chloroplasts and isocitrate dehydrogenase (ICDH) in mitochondria were elevated, along with levels of pyridine nucleotides (nicotinamide coenzymes) [NAD(H) and NADP(H)] and activity of NAD kinase (NADP forming enzyme). Taken together, these data suggest that promotion of cucumber plant growth by near-UV radiation involves activation of carbon and nitrogen metabolism in plants. The findings of this research showed that near-UV radiation reaching the Earth's surface is a beneficial factor for plant growth. Copyright © 2013. Published by Elsevier B.V.

  20. Cancer drug troglitazone stimulates the growth and response of renal cells to hypoxia inducible factors

    Taub, Mary, E-mail: biochtau@buffalo.edu

    2016-03-11

    Troglitazone has been used to suppress the growth of a number of tumors through apoptosis and autophagy. However, previous in vitro studies have employed very high concentrations of troglitazone (≥10{sup −5} M) in order to elicit growth inhibitory effects. In this report, when employing lower concentrations of troglitazone in defined medium, troglitazone was observed to stimulate the growth of primary renal proximal tubule (RPT) cells. Rosiglitazone, like troglitazone, is a thiazolidinedione (TZD) that is known to activate Peroxisome Proliferator Activated Receptor Υ (PPARΥ). Notably, rosiglitazone also stimulates RPT cell growth, as does Υ-linolenic acids, another PPARΥ agonist. The PPARΥ antagonist GW9662 inhibited the growth stimulatory effect of troglitazone. In addition, troglitazone stimulated transcription by a PPAR Response Element/Luciferase construct. These results are consistent with the involvement of PPARΥ as a mediator of the growth stimulatory effect of troglitazone. In a number of tumor cells, the expression of hypoxia inducible factor (HIF) is increased, promoting the expression of HIF inducible genes, and vascularization. Troglitazone was observed to stimulate transcription by a HIF/luciferase construct. These observations indicate that troglitazone not only promotes growth, also the survival of RPT cells under conditions of hypoxia. - Highlights: • Troglitazone and rosiglitazone stimulate renal proximal tubule cell growth. • Troglitazone and linolenic acid stimulate growth via PPARϒ. • Linolenic acid stimulates growth in the presence of fatty acid free serum albumin. • Rosiglitazone stimulates transcription by a HRE luciferase construct.

  1. Cancer drug troglitazone stimulates the growth and response of renal cells to hypoxia inducible factors

    Taub, Mary

    2016-01-01

    Troglitazone has been used to suppress the growth of a number of tumors through apoptosis and autophagy. However, previous in vitro studies have employed very high concentrations of troglitazone (≥10"−"5 M) in order to elicit growth inhibitory effects. In this report, when employing lower concentrations of troglitazone in defined medium, troglitazone was observed to stimulate the growth of primary renal proximal tubule (RPT) cells. Rosiglitazone, like troglitazone, is a thiazolidinedione (TZD) that is known to activate Peroxisome Proliferator Activated Receptor Υ (PPARΥ). Notably, rosiglitazone also stimulates RPT cell growth, as does Υ-linolenic acids, another PPARΥ agonist. The PPARΥ antagonist GW9662 inhibited the growth stimulatory effect of troglitazone. In addition, troglitazone stimulated transcription by a PPAR Response Element/Luciferase construct. These results are consistent with the involvement of PPARΥ as a mediator of the growth stimulatory effect of troglitazone. In a number of tumor cells, the expression of hypoxia inducible factor (HIF) is increased, promoting the expression of HIF inducible genes, and vascularization. Troglitazone was observed to stimulate transcription by a HIF/luciferase construct. These observations indicate that troglitazone not only promotes growth, also the survival of RPT cells under conditions of hypoxia. - Highlights: • Troglitazone and rosiglitazone stimulate renal proximal tubule cell growth. • Troglitazone and linolenic acid stimulate growth via PPARϒ. • Linolenic acid stimulates growth in the presence of fatty acid free serum albumin. • Rosiglitazone stimulates transcription by a HRE luciferase construct.

  2. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  3. Insertion of liver enriched transcription factor hepatocyte nuclear factor-4 (HNF-4) in a vector which contains simian virus (SV40) promoter

    Al-Nbaheen, M.; Pourzand, C.; Tyrrell, R.M.

    2006-01-01

    One way of targeting gene expression in vivo is to control transcription using a tissue-specific regulatory system. Tissue specific promoters or enhancers are in use in transgenic animals and could be utilized in medical for gene therapy. At present the usual method for selection of a tissue-specific promoter is to identify a gene, which is expressed at unusually high level in the target tissue, and then to use the promoter for this gene to drive expression of another therapeutic gene in the target tissue. This approach is logical but does not always lead to high levels of gene expression. A second approach is to investigate the scope for discovery of synthetic specific promoters using a target tissue. The objective of the work described in this paper was to use both approach to design plasmid DNA expression vectors that would carry liver-specific promoter/enhancer linked to reporter gene (i.e. luciferase). Then transfect these vectors to both liver-derived and non-liver cell lines. This is followed by evaluation of the liver-specificity of each construct by measuring the basal level expression of the reporter gene (i.e. luciferase activity) in both cell lines. Hepatocyte nuclear factor-4 (HNF-4) is liver-enriched transcription factor used to design new synthetic enhancers by inserting a tandem array of 1', 3' or 5' repeats of the HNF-4 binding site upstream of the SV40 promoter linked to the luciferase reporter gene within an Epstein-Barr virus (EBV)-based vector, p 706. The results of transfection revealed that unexpectedly the HNF-4 binding sites in these constructs act as a repressor rather than enhancer of the liver-specific expression of the luciferase gene. (author)

  4. Differential response of potato toward inoculation with taxonomically diverse plant growth promoting Rhizobacteria

    Naqqash, Tahir; Hameed, Sohail; Imran, Asma; Hanif, Muhammad Kashif; Majeed, Afshan; van Elsas, Jan Dirk

    2016-01-01

    Rhizosphere engineering with beneficial plant growth promoting bacteria offers great promise for sustainable crop yield. Potato is an important food commodity that needs large inputs of nitrogen and phosphorus fertilizers. To overcome high fertilizer demand (especially nitrogen), five bacteria,

  5. Growth/differentiation factor 15 promotes EGFR signalling, and regulates proliferation and migration in the hippocampus of neonatal and young adult mice.

    Carrillo-García, Carmen; Prochnow, Sebastian; Simeonova, Ina K; Strelau, Jens; Hölzl-Wenig, Gabriele; Mandl, Claudia; Unsicker, Klaus; von Bohlen Und Halbach, Oliver; Ciccolini, Francesca

    2014-02-01

    The activation of epidermal growth factor receptor (EGFR) affects multiple aspects of neural precursor behaviour, including proliferation and migration. Telencephalic precursors acquire EGF responsiveness and upregulate EGFR expression at late stages of development. The events regulating this process and its significance are still unclear. We here show that in the developing and postnatal hippocampus (HP), growth/differentiation factor (GDF) 15 and EGFR are co-expressed in primitive precursors as well as in more differentiated cells. We also provide evidence that GDF15 promotes responsiveness to EGF and EGFR expression in hippocampal precursors through a mechanism that requires active CXC chemokine receptor (CXCR) 4. Besides EGFR expression, GDF15 ablation also leads to decreased proliferation and migration. In particular, lack of GDF15 impairs both processes in the cornu ammonis (CA) 1 and only proliferation in the dentate gyrus (DG). Importantly, migration and proliferation in the mutant HP were altered only perinatally, when EGFR expression was also affected. These data suggest that GDF15 regulates migration and proliferation by promoting EGFR signalling in the perinatal HP and represent a first description of a functional role for GDF15 in the developing telencephalon.

  6. Factors promoting or potentially impeding school success: disparities and state variations for children with special health care needs.

    Bethell, Christina; Forrest, Christopher B; Stumbo, Scott; Gombojav, Narangerel; Carle, Adam; Irwin, Charles E

    2012-04-01

    School success predicts many pathways for health and well-being across the life span. Factors promoting or potentially impeding school success are critical to understand for all children and for children with special health care needs (CSHCN), whose life course trajectories are already impacted by their chronic health problems. The 2007 National Survey of Children's Health was used (1) to estimate national and state prevalence and within and across states disparities in factors promoting school success (engagement, participation, safety) or potentially impeding success (missing school, grade repetition, school identified problems) for all children and CSHCN and (2) to evaluate associations with CSHCN service need complexity and presence of emotional, behavioral or developmental problems (EBD) as well as with school case management policies in states. Among school age children, 60 % experienced all three factors promoting school success (49.3-73.8 % across states), dropping to 51.3 % for CSHCN (39.4-64.7 % across states) and to 36.2 % for the 40 % of all CSHCN who have both more complex service needs and EBD. CSHCN were more likely to experience factors potentially impeding school success. After accounting for child factors, CSHCN living in states requiring case management in schools for children with disabilities were less likely to experience grade repetition (OR 0.65). Within-state disparities between non-CSHCN and CSHCN varied across states. Threats to school success for US children are pervasive and are especially pronounced for CSHCN with more complex needs and EBD. Findings support broad, non-condition specific efforts to promote school success for CSHCN and consideration of state school policies, such as case management.

  7. Lactoferrin promote primary rat osteoblast proliferation and differentiation via up-regulation of insulin-like growth factor-1 expression.

    Hou, Jian-ming; Wu, Man; Lin, Qing-ming; Lin, Fan; Xue, Ying; Lan, Xu-hua; Chen, En-yu; Wang, Mei-li; Yang, Hai-yan; Wang, Feng-xiong

    2014-08-01

    The aim of this study was to explore the effect of lactoferrin (LF) in primary fetal rat osteoblasts proliferation and differentiation and investigate the underlying molecular mechanisms. Primary rat osteoblasts were obtained from the calvarias of neonatal rats. Osteoblasts were treated with LF (0.1-1000 μg/mL), or OSI-906 [a selective inhibitor of insulin-like growth factor 1 (IGF-1) receptor and insulin receptor]. The IGF-1 was then knocked down by small hairpin RNA (shRNA) technology and then was treated with recombinant human IGF-1 or LF. Cell proliferation and differentiation were measured by MTT assay and alkaline phosphatase (ALP) assay, respectively. The expression of IGF-1 and IGF binding protein 2 (IGFBP2) mRNA were analyzed using real-time PCR. LF promotes the proliferation and differentiation of osteoblasts in a certain range (1-100 μg/mL) in time- and dose-dependent manner. The mRNA level of IGF-1 was significantly increased, while the expression of IGFBP2 was suppressed by LF treatment. Knockdown of IGF-1 by shRNA in primary rat osteoblast dramatically decreased the abilities of proliferation and differentiation of osteoblasts and blocked the proliferation and differentiation effect of LF in osteoblasts. OSI906 (5 μM) blocked the mitogenic and differentiation of LF in osteoblasts. Proliferation and differentiation of primary rat osteoblasts in response to LF are mediated in part by stimulating of IGF-1 gene expression and alterations in the gene expression of IGFBP2.

  8. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    Kim, Hyungsae

    2010-10-05

    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  9. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong

    2010-01-01

    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  10. MicroRNA genes preferentially expressed in dendritic cells contain sites for conserved transcription factor binding motifs in their promoters

    Huynen Martijn A

    2011-06-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.

  11. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R.; Smith, Anthony J.; He, Wenxi

    2015-01-01

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs

  12. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)

    2015-03-15

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.

  13. Molecular effects of autoimmune-risk promoter polymorphisms on expression, exon choice, and translational efficiency of interferon regulatory factor 5.

    Clark, Daniel N; Lambert, Jared P; Till, Rodney E; Argueta, Lissenya B; Greenhalgh, Kathryn E; Henrie, Brandon; Bills, Trieste; Hawkley, Tyson F; Roznik, Marinya G; Sloan, Jason M; Mayhew, Vera; Woodland, Loc; Nelson, Eric P; Tsai, Meng-Hsuan; Poole, Brian D

    2014-05-01

    The rs2004640 single nucleotide polymorphism and the CGGGG copy-number variant (rs77571059) are promoter polymorphisms within interferon regulatory factor 5 (IRF5). They have been implicated as susceptibility factors for several autoimmune diseases. IRF5 uses alternative promoter splicing, where any of 4 first exons begin the mRNA. The CGGGG indel is in exon 1A's promoter; the rs2004640 allele creates a splicing recognition site, enabling usage of exon 1B. This study aimed at characterizing alterations in IRF5 mRNA due to these polymorphisms. Cells with risk polymorphisms exhibited ~2-fold higher levels of IRF5 mRNA and protein, but demonstrated no change in mRNA stability. Quantitative PCR demonstrated decreased usage of exons 1C and 1D in cell lines with the risk polymorphisms. RNA folding analysis revealed a hairpin in exon 1B; mutational analysis showed that the hairpin shape decreased translation 5-fold. Although translation of mRNA that uses exon 1B is low due to a hairpin, increased IRF5 mRNA levels in individuals with the rs2004640 risk allele lead to higher overall protein expression. In addition, several new splice variants of IRF5 were sequenced. IRF5's promoter polymorphisms alter first exon usage and increase transcription levels. High levels of IRF5 may bias the immune system toward autoimmunity.

  14. Matrix- and plasma-derived peptides promote tissue-specific injury responses and wound healing in diabetic swine.

    Sheets, Anthony R; Massey, Conner J; Cronk, Stephen M; Iafrati, Mark D; Herman, Ira M

    2016-07-02

    Non-healing wounds are a major global health concern and account for the majority of non-traumatic limb amputations worldwide. However, compared to standard care practices, few advanced therapeutics effectively resolve these injuries stemming from cardiovascular disease, aging, and diabetes-related vasculopathies. While matrix turnover is disrupted in these injuries, debriding enzymes may promote healing by releasing matrix fragments that induce cell migration, proliferation, and morphogenesis, and plasma products may also stimulate these processes. Thus, we created matrix- and plasma-derived peptides, Comb1 and UN3, which induce cellular injury responses in vitro, and accelerate healing in rodent models of non-healing wounds. However, the effects of these peptides in non-healing wounds in diabetes are not known. Here, we interrogated whether these peptides stimulate healing in a diabetic porcine model highly reminiscent of human healing impairments in type 1 and type 2-diabetes. After 3-6 weeks of streptozotocin-induced diabetes, full-thickness wounds were surgically created on the backs of adult female Yorkshire swine under general anesthesia. Comb1 and UN3 peptides or sterile saline (negative control) were administered to wounds daily for 3-7 days. Following sacrifice, wound tissues were harvested, and quantitative histological and immunohistochemical analyses were performed for wound closure, angiogenesis and granulation tissue deposition, along with quantitative molecular analyses of factors critical for angiogenesis, epithelialization, and dermal matrix remodeling. Comb1 and UN3 significantly increase re-epithelialization and angiogenesis in diabetic porcine wounds, compared to saline-treated controls. Additionally, fluorescein-conjugated Comb1 labels keratinocytes, fibroblasts, and vascular endothelial cells in porcine wounds, and Far western blotting reveals these cell populations express multiple fluorescein-Comb1-interacting proteins in vitro. Further

  15. Cytokinin response factors regulate PIN-FORMED auxin transporters

    Šimášková, M.; O'Brien, J.A.; Khan, M.; Van Noorden, G.; Ötvös, K.; Vieten, A.; De Clercq, E.; Van Haperen, J.M.A.; Cuesta, C.; Hoyerová, Klára; Vanneste, S.; Marhavý, P.; Wabnik, K.; Van Breusegem, F.; Nowack, M.; Murphy, A.; Friml, J.; Weijers, D.; Beeckman, T.; Benková, E.

    2015-01-01

    Roč. 6, NOV (2015), s. 8717 ISSN 2041-1723 Institutional support: RVO:61389030 Keywords : ARABIDOPSIS -THALIANA * ROOT-MERISTEM * TRANSCRIPTION FACTORS Subject RIV: ED - Physiology Impact factor: 11.329, year: 2015

  16. Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

    Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien

    2006-01-01

    Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....

  17. Ganoderma lucidum extracts inhibited leukemia WEHI-3 cells in BALB/c mice and promoted an immune response in vivo.

    Chang, Yung-Hsien; Yang, Jai-Sing; Yang, Jiun-Long; Wu, Chang-Lin; Chang, Shu-Jen; Lu, Kung-Wen; Lin, Jen-Jyh; Hsia, Te-Chun; Lin, Yi-Ting; Ho, Chin-Chih; Wood, W Gibson; Chung, Jing-Gung

    2009-12-01

    Ganoderma lucidum (G. lucidum) is a medicinal mushroom having biological effects such as immunomodulation and anti-tumor actions. In China and many other Asian countries, G. lucidum is used as a folk remedy to promote health and longevity. Although many studies have shown that G. lucidum modulates the immune system, including, for example, antigen-presenting cells, natural killer (NK) cells, and the T and B lymphocytes, the effects of G. lucidum on the WEHI-3 leukemic BALB/c mice are unclear. We attempted to determine whether G. lucidum would promote immune responses in BALB/c mice injected with WEHI-3 leukemia cells. The effects of G. lucidum on the survival rate of WEHI-3 leukemia cells injected into BALB/c mice were examined. It increased the percentages of CD3 and CD19, but decreased the percentages of Mac-3 and CD11b markers, suggesting that differentiation of the precursor of T and B cells was promoted but macrophages were inhibited. It decreased the weight of spleens as compared with control mice. It also promoted phagocytosis by macrophage from peripheral blood mononuclear cell (PBMC) and it also promoted natural killer cell activity. It decreased the percentage of leukemia cells in the spleens of mice before they were injected with WEHI-3 cells. Apparently, G. lucidum affects murine leukemia WEHI-3 cells in vivo.

  18. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  19. Characterization of pancreatic transcription factor Pdx-1 binding sites using promoter microarray and serial analysis of chromatin occupancy

    Keller, David M; McWeeney, Shannon; Arsenlis, Athanasios; Drouin, Jacques; Wright, Christopher V E; Wang, Haiyan; Wollheim, Claes; White, Peter; Kaestner, Klaus H; Goodman, Richard H

    2007-01-01

    The homeobox transcription factor Pdx-1 is necessary for pancreas organogenesis and beta cell function, however, most Pdx-1-regulated genes are unknown. To further the understanding of Pdx-1 in beta cell biology, we have characterized its genomic targets in NIT-1 cells, a mouse insulinoma cell line. To identify novel targets, we developed a microarray that includes traditional promoters as well as non-coding conserved elements, micro-RNAs, and elements identified through an unbiased approach ...

  20. The transcription factor Mlc promotes Vibrio cholerae biofilm formation through repression of phosphotransferase system components.

    Pickering, Bradley S; Lopilato, Jane E; Smith, Daniel R; Watnick, Paula I

    2014-07-01

    The phosphoenol phosphotransferase system (PTS) is a multicomponent signal transduction cascade that regulates diverse aspects of bacterial cellular physiology in response to the availability of high-energy sugars in the environment. Many PTS components are repressed at the transcriptional level when the substrates they transport are not available. In Escherichia coli, the transcription factor Mlc (for makes large colonies) represses transcription of the genes encoding enzyme I (EI), histidine protein (HPr), and the glucose-specific enzyme IIBC (EIIBC(Glc)) in defined media that lack PTS substrates. When glucose is present, the unphosphorylated form of EIIBC(Glc) sequesters Mlc to the cell membrane, preventing its interaction with DNA. Very little is known about Vibrio cholerae Mlc. We found that V. cholerae Mlc activates biofilm formation in LB broth but not in defined medium supplemented with either pyruvate or glucose. Therefore, we questioned whether V. cholerae Mlc functions differently than E. coli Mlc. Here we have shown that, like E. coli Mlc, V. cholerae Mlc represses transcription of PTS components in both defined medium and LB broth and that E. coli Mlc is able to rescue the biofilm defect of a V. cholerae Δmlc mutant. Furthermore, we provide evidence that Mlc indirectly activates transcription of the vps genes by repressing expression of EI. Because activation of the vps genes by Mlc occurs under only a subset of the conditions in which repression of PTS components is observed, we conclude that additional inputs present in LB broth are required for activation of vps gene transcription by Mlc. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. ATF1 Modulates the Heat Shock Response by Regulating the Stress-Inducible Heat Shock Factor 1 Transcription Complex

    Takii, Ryosuke; Fujimoto, Mitsuaki; Tan, Ke; Takaki, Eiichi; Hayashida, Naoki; Nakato, Ryuichiro; Shirahige, Katsuhiko

    2014-01-01

    The heat shock response is an evolutionally conserved adaptive response to high temperatures that controls proteostasis capacity and is regulated mainly by an ancient heat shock factor (HSF). However, the regulation of target genes by the stress-inducible HSF1 transcription complex has not yet been examined in detail in mammalian cells. In the present study, we demonstrated that HSF1 interacted with members of the ATF1/CREB family involved in metabolic homeostasis and recruited them on the HSP70 promoter in response to heat shock. The HSF1 transcription complex, including the chromatin-remodeling factor BRG1 and lysine acetyltransferases p300 and CREB-binding protein (CBP), was formed in a manner that was dependent on the phosphorylation of ATF1. ATF1-BRG1 promoted the establishment of an active chromatin state and HSP70 expression during heat shock, whereas ATF1-p300/CBP accelerated the shutdown of HSF1 DNA-binding activity during recovery from acute stress, possibly through the acetylation of HSF1. Furthermore, ATF1 markedly affected the resistance to heat shock. These results revealed the unanticipated complexity of the primitive heat shock response mechanism, which is connected to metabolic adaptation. PMID:25312646

  2. Electronic factors in catalysis: the volcano curve and the effect of promotion in catalytic ammonia synthesis

    Dahl, Søren; Logadottir, Ashildur; Jacobsen, C.J.H.

    2001-01-01

    The activity and selectivity of heterogeneous catalysts are determined by their electronic and structural properties. In many cases, the electronic properties are determined by the choice of both the catalytically active transition metal and promoter elements. Density functional theory is used...

  3. Factors influencing primary health care professionals' physical activity promotion behaviors: A systematic review

    Huijg, J.M.; Gebhardt, W.A.; Verheijden, M.W.; Zouwe, N. van der; Vries, J.D. de; Middelkoop, B.J.C.; Crone, M.R.

    2015-01-01

    Background: Despite the promising findings related to the efficacy of interventions aimed at promoting physical activity (PA) in primary health care (PHC), the translation of these interventions to PHC practice does not always happen as desired. Purpose: To help understand why efficacious PHC-based

  4. Internet Access and Youth of Yakutia Awareness on the Health-Promotion Factor

    Barakhsanova, Elizabeth Afanasyevna; Ignatyev, Vladimir Petrovich; Savvinov, Vasily Mikhaylovich; Olesova, Sargulana Gavrilievna

    2016-01-01

    Thematic justification is determined by the fact that in the conditions of the steady growth of mobile technology the youth accurately does not represent health promotion value when using the Internet at home, at school and other entertainment leisure recreation. With respect thereto this paper is aimed at monitoring general awareness of seniors…

  5. Moderating factors of immediate, gross, and net cross-brand effects of price promotions

    C. Horváth (Csilla); D. Fok (Dennis)

    2013-01-01

    textabstractThis article examines cross-price promotional effects in a dynamic context. Among other things, we investigate whether previously established findings hold when consumer and competitive dynamics are taken into account. Five main influential effects (asymmetric price effect, neighborhood

  6. Lettuce and rhizosphere microbiome responses to growth promoting Pseudomonas species under field conditions.

    Cipriano, Matheus A P; Lupatini, Manoeli; Lopes-Santos, Lucilene; da Silva, Márcio J; Roesch, Luiz F W; Destéfano, Suzete A L; Freitas, Sueli S; Kuramae, Eiko E

    2016-12-01

    Plant growth promoting rhizobacteria are well described and recommended for several crops worldwide. However, one of the most common problems in research into them is the difficulty in obtaining reproducible results. Furthermore, few studies have evaluated plant growth promotion and soil microbial community composition resulting from bacterial inoculation under field conditions. Here we evaluated the effect of 54 Pseudomonas strains on lettuce (Lactuca sativa) growth. The 12 most promising strains were phylogenetically and physiologically characterized for plant growth-promoting traits, including phosphate solubilization, hormone production and antagonism to pathogen compounds, and their effect on plant growth under farm field conditions. Additionally, the impact of beneficial strains on the rhizospheric bacterial community was evaluated for inoculated plants. The strains IAC-RBcr4 and IAC-RBru1, with different plant growth promoting traits, improved lettuce plant biomass yields up to 30%. These two strains also impacted rhizosphere bacterial groups including Isosphaera and Pirellula (phylum Planctomycetes) and Acidothermus, Pseudolabrys and Singusphaera (phylum Actinobacteria). This is the first study to demonstrate consistent results for the effects of Pseudomonas strains on lettuce growth promotion for seedlings and plants grown under tropical field conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Trichomonas vaginalis homolog of macrophage migration inhibitory factor induces prostate cell growth, invasiveness, and inflammatory responses.

    Twu, Olivia; Dessí, Daniele; Vu, Anh; Mercer, Frances; Stevens, Grant C; de Miguel, Natalia; Rappelli, Paola; Cocco, Anna Rita; Clubb, Robert T; Fiori, Pier Luigi; Johnson, Patricia J

    2014-06-03

    The human-infective parasite Trichomonas vaginalis causes the most prevalent nonviral sexually transmitted infection worldwide. Infections in men may result in colonization of the prostate and are correlated with increased risk of aggressive prostate cancer. We have found that T. vaginalis secretes a protein, T. vaginalis macrophage migration inhibitory factor (TvMIF), that is 47% similar to human macrophage migration inhibitory factor (HuMIF), a proinflammatory cytokine. Because HuMIF is reported to be elevated in prostate cancer and inflammation plays an important role in the initiation and progression of cancers, we have explored a role for TvMIF in prostate cancer. Here, we show that TvMIF has tautomerase activity, inhibits macrophage migration, and is proinflammatory. We also demonstrate that TvMIF binds the human CD74 MIF receptor with high affinity, comparable to that of HuMIF, which triggers activation of ERK, Akt, and Bcl-2-associated death promoter phosphorylation at a physiologically relevant concentration (1 ng/mL, 80 pM). TvMIF increases the in vitro growth and invasion through Matrigel of benign and prostate cancer cells. Sera from patients infected with T. vaginalis are reactive to TvMIF, especially in males. The presence of anti-TvMIF antibodies indicates that TvMIF is released by the parasite and elicits host immune responses during infection. Together, these data indicate that chronic T. vaginalis infections may result in TvMIF-driven inflammation and cell proliferation, thus triggering pathways that contribute to the promotion and progression of prostate cancer.

  8. Neurotrophin-3 accelerates wound healing in diabetic mice by promoting a paracrine response in mesenchymal stem cells.

    Shen, Lei; Zeng, Wen; Wu, Yang-Xiao; Hou, Chun-Li; Chen, Wen; Yang, Ming-Can; Li, Li; Zhang, Ya-Fang; Zhu, Chu-Hong

    2013-01-01

    Angiogenesis is a major obstacle for wound healing in patients with diabetic foot wounds. Mesenchymal stem cells (MSCs) have an important function in wound repair, and neurotrophin-3 (NT-3) can promote nerve regeneration and angiogenesis. We investigated the effect of NT-3 on accelerating wound healing in the diabetic foot by improving human bone marrow MSC (hMSC) activation. In vitro, NT-3 significantly promoted VEGF, NGF, and BDNF secretion in hMSCs. NT-3 improved activation of the hMSC conditioned medium, promoted human umbilical vein endothelial cell (HUVEC) proliferation and migration, and significantly improved the closure rate of HUVEC scratches. In addition, we produced nanofiber mesh biological tissue materials through the electrospinning technique using polylactic acid, mixed silk, and collagen. The hMSCs stimulated by NT-3 were implanted into the material. Compared with the control group, the NT-3-stimulated hMSCs in the biological tissue material significantly promoted angiogenesis in the feet of diabetic C57BL/6J mice and accelerated diabetic foot wound healing. These results suggest that NT-3 significantly promotes hMSC secretion of VEGF, NGF, and other vasoactive factors and that it accelerates wound healing by inducing angiogenesis through improved activation of vascular endothelial cells. The hMSCs stimulated by NT-3 can produce materials that accelerate wound healing in the diabetic foot and other ischemic ulcers.

  9. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  10. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  11. Promoting Self-Esteem in Adolescents: The Influence of Wellness Factors

    Myers, Jane E.; Willse, John T.; Villalba, Jose A.

    2011-01-01

    To assess the extent to which holistic wellness factors are predictive of self-esteem, the authors administered the Coopersmith Self-Esteem Inventories, School Form (Coopersmith, 2002), and the Five Factor Wellness Inventory (Myers & Sweeney, 2005a) to 225 adolescents ages 15 to 17 years. Wellness factors (Coping Self, Social Self, and…

  12. Bayes factor covariance testing in item response models

    Fox, J.P.; Mulder, J.; Sinharay, Sandip

    2017-01-01

    Two marginal one-parameter item response theory models are introduced, by integrating out the latent variable or random item parameter. It is shown that both marginal response models are multivariate (probit) models with a compound symmetry covariance structure. Several common hypotheses concerning

  13. Bayes Factor Covariance Testing in Item Response Models

    Fox, Jean-Paul; Mulder, Joris; Sinharay, Sandip

    2017-01-01

    Two marginal one-parameter item response theory models are introduced, by integrating out the latent variable or random item parameter. It is shown that both marginal response models are multivariate (probit) models with a compound symmetry covariance structure. Several common hypotheses concerning

  14. Technology and Teaching: Promoting Active Learning Using Individual Response Technology in Large Introductory Psychology Classes

    Poirier, Christopher R.; Feldman, Robert S.

    2007-01-01

    Individual response technology (IRT), in which students use wireless handsets to communicate real-time responses, permits the recording and display of aggregated student responses during class. In comparison to a traditional class that did not employ IRT, students using IRT performed better on exams and held positive attitudes toward the…

  15. Natural genetic variation in Arabidopsis for responsiveness to plant growth-promoting rhizobacteria

    Wintermans, Paul C A; Bakker, Peter A H M; Pieterse, Corné M J

    The plant growth-promoting rhizobacterium (PGPR) Pseudomonas simiae WCS417r stimulates lateral root formation and increases shoot growth in Arabidopsis thaliana (Arabidopsis). These plant growth-stimulating effects are partly caused by volatile organic compounds (VOCs) produced by the bacterium.

  16. Natural genetic variation in Arabidopsis for responsiveness to plant growth-promoting rhizobacteria

    Wintermans, P.C.A.; Bakker, P.A.H.M.; Pieterse, C.M.J.

    2016-01-01

    The plant growth-promoting rhizobacterium (PGPR) Pseudomonas simiae WCS417r stimulates lateral root formation and increases shoot growth in Arabidopsis thaliana (Arabidopsis). These plant growth-stimulating effects are partly caused by volatile organic compounds (VOCs) produced by the bacterium.

  17. Can Playscapes Promote Early Childhood Inquiry towards Environmentally Responsible Behaviors? An Exploratory Study

    Wight, R. Alan; Kloos, Heidi; Maltbie, Catherine V.; Carr, Victoria W.

    2016-01-01

    This paper investigates young children's exploratory play and inquiry on playscapes: playgrounds specifically designed to connect children with natural environments. Our theoretical framework posits that playscapes combine the benefits of nature and play to promote informal science exploration of natural materials. This, in turn, is expected to…

  18. Community factors to promote parents' quality of child-nurturing life.

    Aoyama, Megumi; Wei, Chang Nian; Chang-nian, Wei; Harada, Koichi; Ueda, Kimiyo; Takano, Miyuki; Ueda, Atsushi

    2013-01-01

    The purpose of this study was to clarify the role of community factors in parents' quality of child-nurturing life (QCNL). We developed a questionnaire to evaluate the degree of QCNL and determine the structural factors related to QCNL as community factors related to parents' QCNL derived from focus group interviews and the Delphi technique. The questionnaire also included the battery of the self-rating depression scale and Tsumori-Inage Infant's Developmental Test. Using the questionnaire, we then conducted a quantitative survey of parents whose children attended nursery schools in Kumamoto Prefecture. Factor analysis, calculation of the mean score and/or ratio to each item, Pearson's correlation coefficient, t test, multiple regression analysis, and covariance structure analysis were performed. The questionnaire we developed consisted of seven items with 75 elements, involving ten elements as community factors. Subjects included 699 parents (mean age 33.6 ± 5.4 years) and 965 children (age range 0-6 years). Factor analysis revealed that community factors consisted of five factors, such as "lifestyle rooted in the ground," "balance of housekeeping and work," "community network," "amenity," and "regeneration of life". These factors may be dominant in a rural area. Finally, we developed a structural model with "community factors," QCNL, QOL, and "child growth" by covariance structural analysis. The analysis revealed that community factors had a positive relation to parents' QCNL (r = 0.81, p < 0.001) and that parental SDS score had a negative relation to parents' QCNL (r = -0.59, p < 0.001). The analysis did show that community factors were positively related to the sound growth of children. The covariance structure analysis revealed that community factors were associated with parents' QCNL, SDS, and "child growth."

  19. Rice homeobox transcription factor HOX1a positively regulates gibberellin responses by directly suppressing EL1.

    Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei

    2011-11-01

    Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.

  20. Promoter hypermethylation of mismatch repair gene hMLH1 predicts the clinical response of malignant astrocytomas to nitrosourea.

    Fukushima, Takao; Katayama, Yoichi; Watanabe, Takao; Yoshino, Atsuo; Ogino, Akiyoshi; Ohta, Takashi; Komine, Chiaki

    2005-02-15

    In certain types of human cancers, transcriptional inactivation of hMLH1 by promoter hypermethylation plays a causal role in the loss of mismatch repair functions that modulate cytotoxic pathways in response to DNA-damaging agents. The aim of the present study was to investigate the role of promoter methylation of the hMLH1 gene in malignant astrocytomas. We examined the hMLH1 promoter methylation in a homogeneous cohort of patients with 41 malignant astrocytomas treated by 1-(4-amino-2-methyl-5-pyrimidinyl)methyl-3-2(2-chloroethyl)-3-nitrosourea chemotherapy in combination with radiation and interferon therapy, and assessed the correlation of such methylation with clinical outcome. hMLH1 promoter methylation was found in 6 (15%) of the 41 newly diagnosed malignant astrocytomas. Hypermethylation of the hMLH1 promoter corresponded closely with a loss of immunohistochemical staining for hMLH1 protein (P = 0.0013). Patients with hMLH1-methylated tumors displayed a greater chance of responding to adjuvant therapy as compared with those with hMLH1-unmethylated tumors (P = 0.0150). The presence of hMLH1 hypermethylation was significantly associated with a longer progression-free survival on both univariate analysis (P = 0.0340) and multivariate analysis (P = 0.0161). The present study identified hMLH1 methylation status as a predictor of the clinical response of malignant astrocytomas to chloroethylnitrosourea-based adjuvant therapy. The findings obtained suggest that determination of the methylation status of hMLH1 could provide a potential basis for designing rational chemotherapeutic strategies, as well as for predicting prognosis.

  1. Targeting artificial transcription factors to the utrophin A promoter: effects on dystrophic pathology and muscle function.

    Lu, Yifan; Tian, Chai; Danialou, Gawiyou; Gilbert, Rénald; Petrof, Basil J; Karpati, George; Nalbantoglu, Josephine

    2008-12-12

    Duchenne muscular dystrophy is caused by a genetic defect in the dystrophin gene. The absence of dystrophin results in muscle fiber necrosis and regeneration, leading to progressive muscle fiber loss. Utrophin is a close analogue of dystrophin. A substantial, ectopic expression of utrophin in the extrasynaptic sarcolemma of dystrophin-deficient muscle fibers can prevent deleterious effects of dystrophin deficiency. An alternative approach for the extrasynaptic up-regulation of utrophin involves the augmentation of utrophin transcription via the endogenous utrophin A promoter using custom-designed transcriptional activator proteins with zinc finger (ZFP) motifs. We tested a panel of custom-designed ZFP for their ability to activate the utrophin A promoter. Expression of one such ZFP efficiently increased, in a time-dependent manner, utrophin transcript and protein levels both in vitro and in vivo. In dystrophic mouse (mdx) muscles, administration of adenoviral vectors expressing this ZFP led to significant enhancement of muscle function with decreased necrosis, restoration of the dystrophin-associated proteins, and improved resistance to eccentric contractions. These studies provide evidence that specifically designed ZFPs can act as strong transcriptional activators of the utrophin A promoter. These may thus serve as attractive therapeutic agents for dystrophin deficiency states such as Duchenne muscular dystrophy.

  2. Sales promotion as a determining factor in the competitive position of the company

    Alavuk Đorđe

    2015-01-01

    Full Text Available Increased competition, globalization, numerous changes in the field of engineering and technology are just some of the changes that accompany modern business conditions. Modern consumers are increasingly demanding. Individuals vary greatly within groups and cultures to which they belong, but also among themselves based on the characteristics that distinguish them. People engaged in marketing have to constantly monitor and measure consumer attitudes so that their needs and desires are fully met. This paper summarizes the sales promotion activities carried out by retail chains. The aim of the activities of sales promotion is to create and maintain long-term relationships with customers and competitive advantage on the market. The research topic is the impact of sales promotion activities on the behavior and attitudes of consumers when choosing a product. The aim of the research is to examine the effects achieved by sales improvement to consumers through the implementation of the competitive positions of the companies. For the purpose of the research the method used was survey research.

  3. How media factors affect audience responses to brand placement

    van Reijmersdal, E.; Smit, E.; Neijens, P.

    2010-01-01

    This study investigates the influence of media factors on brand placement effects in a real-life setting. Although many studies on brand placement have been conducted, insights into context effects on brand placement reactions are scarce. The impact of objective and subjective media context factors

  4. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  5. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  6. Mechanical Responses and Physical Factors of the Fingertip Pulp

    N. Sakai

    2006-01-01

    Full Text Available The images of the mechanical responses were analysed when the fingertip was pressed against a plateau plate, and the influence of the contact angle on the loading pressure and the mechanical responses was investigated. As a result, as the contact angle was smaller, the change ratios due to the loading pressure were significantly larger in the contact length, the contact width and the distortion of lateral-view area. These parameters were thought to be useful in clinical medicine as indices for the degrees of mechanical responses of the fingertip. The length of the central axis and the maximum width of the fingertip were inappropriate as the parameters to represent the mechanical responses of the fingertip. The maximum width of the fingertip scarcely changed. This does not reflect the compressibility of the fingertip, and the fingertip as a whole extended along the central axis and in the vertical direction, and the change was not reflected in the maximum width.

  7. The Impact of Harvesting, Storage and Processing Factors on Health-Promoting Phytochemicals in Berries and Fruits

    Anna Kårlund

    2014-08-01

    Full Text Available Increasing epidemiological and experimental data now emphasize that a diet rich in vegetables and fruits confers many health benefits. Functional products containing elevated levels of bioactive compounds are attracting considerable attention due to their potential to lower the risk of chronic diseases and their associated huge healthcare costs. On a global scale, there is an increasing demand for berries and fruits, since they are natural polyphenol-rich raw material to be incorporated into functional foods, nutraceuticals and pharmaceuticals. This is a major challenge for both industry and horticultural experts, because the content of health-promoting compounds in plants varies widely not only in different plant species, but also between cultivars. The content is also significantly affected by harvesting, storage and processing factors. This review summarizes the recent data and clarifies the main contributors of harvesting time, various storage conditions and post-harvest procedures, such as temperature management, controlled atmosphere, 1-MCP, calcium and plant activators, as ways to influence health-promoting compounds in fruits. Furthermore, the ways processing factors, e.g., enzymatic treatment, pressing, clarification, temperature, pressure and fermentation, can influence the levels of polyphenols and vitamins in berries and soft fruits will be discussed. Finally, strategies for preventing the decline of health-promoting compounds in fruits during long-term storage will be assessed in light of recent scientific progress and modern methods, which preserve the levels of polyphenols, will be highlighted.

  8. Radioprotective effect of hematopoietic growth factor gene therapy regulated by Egr-1 promoter on radiation injury of SCID mice

    Du Nan; Pei Xuetao; Luo Chengji; Su Yongping; Cheng Tianmin

    2002-01-01

    Objective: To explore the radioprotective effect of the expression of hematopoietic growth factors regulated by radio-inducible promoter on radiation injury. Methods: The human FL cDNA and EGFP cDNA were linked together with an internal ribosome e