Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao
2013-01-01
Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.
Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen
2011-04-01
Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.
To Identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode and fungal disease resistance traits, a series of interspecific cotton (Gossypium spp.) chromosome substitution (CS) lines were used in this study. The CS lines were developed in ...
Ulloa, M; Wang, C; Saha, S; Hutmacher, R B; Stelly, D M; Jenkins, J N; Burke, J; Roberts, P A
2016-04-01
Chromosome substitution (CS) lines in plants are a powerful genetic resource for analyzing the contribution of chromosome segments to phenotypic variance. In this study, a series of interspecific cotton (Gossypium spp.) CS lines were used to identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode or fungal disease resistance traits. The CS lines were developed in the G. hirsutum L. TM-1 background with chromosome or chromosome segment substitutions from G. barbadense L. Pima 3-79 or G. tomentosum. Root-knot nematode (Meloidogyne incognita) and fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) (races 1 and 4) resistance alleles and quantitative trait loci (QTL) previously placed on cotton chromosomes using SSR markers in two interspecific recombinant inbred line populations were chosen for testing. Phenotypic responses of increased resistance or susceptibility in controlled inoculation and infested field assays confirmed the resistance QTLs, based on substitution with the positive or negative allele for resistance. Lines CS-B22Lo, CS-B04, and CS-B18 showed high resistance to nematode root-galling, confirming QTLs on chromosomes 4 and 22 (long arm) with resistance alleles from Pima 3-79. Line CS-B16 had less fusarium race 1-induced vascular root staining and higher percent survival than the TM-1 parent, confirming a major resistance QTL on chromosome 16. Lines CS-B(17-11) and CS-B17 had high fusarium race 4 vascular symptoms and low survival due to susceptible alleles introgressed from Pima 3-79, confirming the localization on chromosome 17 of an identified QTL with resistance alleles from TM1 and other resistant lines. Analyses validated regions on chromosomes 11, 16, and 17 harboring nematode and fusarium wilt resistance genes and demonstrated the value of CS lines as both a germplasm resource for breeding programs and as a powerful genetic analysis tool for determining QTL effects for disease
2011-09-29
...] Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton AGENCY... our determination that a cotton line developed by Syngenta Biotechnology, Inc., designated as event... submitted by Syngenta Biotechnology, Inc., in its petition for a determination of nonregulated status, our...
International Nuclear Information System (INIS)
Sarwar, G.
2007-01-01
Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)
Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei
2017-08-30
RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.
Directory of Open Access Journals (Sweden)
Haonan Zhang
Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.
Use of radiation induction to improve new cotton lines resistant to Heliothis armigera
Energy Technology Data Exchange (ETDEWEB)
Hormchan, P [Dept. of Entomology, Faculty of Agriculture, Kasetsart Univ., Bangkok (Thailand); Wongpiyasatid, A [Dept. of Applied and Isotopes Faculty fo Science, Kasetsart Univ., Bangkok (Thailand)
1996-12-01
Ratchada 1 (R{sub 1}) seeds irradiated with 300 gray of gamma rays in order to obtain new cotton lines resistant to the American bollworm with high yield and good quality were compared with Srisamrong 2 (SR{sub 1}) and Ratchada 1 (R{sub 1}), the present recommended varieties to the farmers. The experiments were conducted under both laboratory and field conditions for 3 consecutive years and 2 new lines, A P{sub 1} and A P{sub 2} in M{sub 5} with the required attribute, were finally selected. In the lab, after feeding 2 nd instar bollworm larvae with young leaves of tested lines and the controls the increased weight, larval length, pupal weight of new lines were found to be better than those of SR{sub 2} and R{sub 1} including % gossypol and flavonoids, the substances being expected to give antibiotic effect to the insects. Physical aberration was also noticed in A P{sub 1}. As of the field condition, with the similar amount of bollworm numbers, the 10 fresh boll weight, lint weight, seed weight, % lint, micronaire fibre strength, and fibre length were found to be higher and better than those of both controls as well. However, further tests in large scale of farmers` field a period of time will have to be undertaken to ascertain the result
At-line cotton color measurements by portable color spectrophotometers
As a result of reports of cotton bales that had significant color changes from their initial Uster® High Volume Instrument (HVI™) color measurements, a program was implemented to measure cotton fiber color (Rd, +b) at-line in remote locations (warehouse, mill, etc.). The measurement of cotton fiber...
Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.
He, S P; Sun, J L; Du, X M
2011-10-03
Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.
Directory of Open Access Journals (Sweden)
Raquel Sampaio Oliveira
2016-02-01
Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.
de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F
2016-01-01
Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.
de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.
2016-01-01
Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081
Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D
2016-09-01
Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.
Kemerait, Robert C.
2009-01-01
Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787
Induced mutation of new cotton lines tolerant to verticillium wilt with improved characters
International Nuclear Information System (INIS)
Rastegary, G.; Hoseiny Neghad, Z.
1998-01-01
Induction of mutation for genetic variation has been used in crop improvement for many years. The mutant lines can be used either directly or as a new genetic source in cross breeding. In cotton 'eleven' and 'two' mutant varieties as new genetic sources have been evolved directly and indirectly, respectively. One of the major obstacles in cotton production in northern region of Iran, Gorgan and Gonbad (where they are known as the main cultivation area of this crop), is the presence of verticillium wilt fungal disease. Since this fungus is soil-born, and can not be controlled chemically, the most efficient way of combating against the disease is to breed for the tolerance/resistance of the species. For this purpose, a mutation breeding technique was applied using gamma radiation as mutagen. The seeds of four varieties (Shirpan, Tashkand, Bakhtegan, and Sahel) were irradiated after reaching a proper absorbed humidity. The radiation doses of 150 to 350 Gy were applied and the seeds were cultivated in two different locations (Varamin and Kordkuy) as M1 generation. The cotton balls of each individual healthy plant was harvested to attain the seeds of M2 rows. In M2, the plants with different degrees of tolerance to the disease were compared to the selected parents (taking into consideration that the soil was contaminated). The good yielding lines with different level of tolerance were taken up to the 5th generation, yielding 70 lines of superior qualitative and quantitative traits. (author)
Fitness of Bt-resistant cabbage loopers on Bt cotton plants.
Tetreau, Guillaume; Wang, Ran; Wang, Ping
2017-10-01
Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Effect of chitosan on resist printing of cotton fabrics with reactive dyes
African Journals Online (AJOL)
The concentration of chitosan, types of resist agent, curing temperature and curing time were varied to determine their effects on resist-printed cotton fabrics. An optimal chitosan concentration of 1.6% resulted in the greatest resist effect on printed cotton fabrics. For mixtures, a 6:4 ratio of citric acid : chitosan and an 8:2 ...
Inheritance of resistance to Colletotrichum gossypii var. cephalosporioides in cotton
Directory of Open Access Journals (Sweden)
Mansuêmia Alves Couto de Oliveira
2010-01-01
Full Text Available The objective of this study was to analyze the inheritance of the resistance to cotton ramulosis. For thispurpose, two groups of lines with contrasting performance for the evaluated trait were crossed. The disease-susceptibleparents were Delta Opal, CNPA 999 and CNPA 2161, and those with resistance BRS Facual, CNPA 2043 and CNPA 2984,resulting in nine crosses, always of one resistant and one susceptible parent, totalizing 42 treatments. The experiment was setup in a randomized complete block design with three replications. It was verified that the genetic control of ramulosisresistance is predominantly oligogenic, and the number of genes involved depends on the parents that participate in eachcross, due to the possibility of differential loci fixation. Evidence of partial dominance in the sense of increasing diseaseresistance was found, but there were also indications that dominance is not unidirectional.
Role of secondary metabolites biosynthesis in resistance to cotton ...
African Journals Online (AJOL)
use
2011-12-12
Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.
TEST OF COTTON LINES WITH DROUGHT TOLERANT INTERCROPPED WITH MAIZE
Directory of Open Access Journals (Sweden)
Kadarwati F.T.
2017-12-01
Full Text Available The distribution of cotton cultivation is mostly located in the sub-optimal land due to competition with the field crop. The cotton cultivation in Indonesia is always done through intercropping with pulses. This research aims to test the suitability of cotton lines with drought-tolerant intercropped with maize. The research is conducted in February to August 2016 at Asembagus Experimental Garden, Situbondo. Planting materials used in this research are 6 lines and 2 varieties of drought-tolerant cotton consist of strain 03001/9, 03008/24, 03008/25, 03017/13, 06062/3, 06063/3, kanesia 10 and kanesia 14. The research prepared by the draft randomized group with three replications. The observation parameter consists of plant height, canopy width, number of generative branches, number of fruits, fruits weight, the yield of seed cotton, and corn dry results. The research result shows that the strain 03017/13 and 03008/24 have the highest consecutive acceptance of IDR 17,860,681 and IDR 17,520,879, the increase in revenue compared to monoculture is IDR 6,278,473 and IDR 5,668,191, seed cotton production amounted to 2470.01 kg/ha and 2329.72 kg/ha, maize production amounted to 2001.54 kg/ha and 2112.74 kg/ha, LER 1.68 and 1.60, number of harvested fruit of 12.66 and 11.76 fruits/plant, fruit weight of 4.05 and 4.17 g/fruit.
Seed protein electrophoresis for identification of fine fibre cotton line in Gossypium hirsutum L
International Nuclear Information System (INIS)
Gao Guoqiang; Lv Tiexin; Su Xuehe; Liu Xiaoyong; Wu Defang; Zhu Doubei
2003-01-01
Gel electrophoresis was conducted to test seed ethanol resolvable protein in cotton. 13 lines were used, including a fine fibre cotton line (98301) in G. hirsutum L., 4 varieties in G. barbadense L. and 8 varieties in G. hirsutum L.. In results of the 98301 line, Zhongmiansuo 12 and Shiyuan 321, no different protein electro-phoresis band pattern was shown among different seeds belong to the same variety, respectively. In comparison among the 98301 seeds sampled from seven different growth sets in Shandong province, their protein band patterns were the same. On the gel plate, three special bands were distinctive to all the varieties in G. hirsutum L. and other three special bands were distinctive to all the varieties in G. barbadense L.. The three characteristic bands of G. hirsutum L. appeared in the protein band pattern of the 98301 line. It showed that the seed protein composition of the line was inclined to G. hirsutum L. mainly. And, a characteristic band of G. Barbadense L. in the band pattern of the 98301 line proved that the fine fibre cotton line derived from a hybrid between G. barbadense and G. hirsutum L.. The 98301 line was easily distinguished from other varieties in G. hirsutum L. by its distinctive band, i.e. band No.1, and another island cotton band, i.e. band No.10
Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.
Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab
2015-09-17
Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.
Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.
Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-08-01
Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Wang, W; Zhang, M; Chen, H D; Cai, X X; Xu, M L; Lei, K Y; Niu, J H; Deng, L; Liu, J; Ge, Z J; Yu, S X; Wang, B H
2016-10-06
In this study, a methylation-sensitive amplification polymorphism analysis system was used to analyze DNA methylation level in three cotton accessions. Two disease-sensitive near-isogenic lines, PD94042 and IL41, and one disease-resistant Gossypium mustelinum accession were exposed to Verticillium wilt, to investigate molecular disease resistance mechanisms in cotton. We observed multiple different DNA methylation types across the three accessions following Verticillium wilt exposure. These included hypomethylation, hypermethylation, and other patterns. In general, the global DNA methylation level was significantly increased in the disease-resistant accession G. mustelinum following disease exposure. In contrast, there was no significant difference in the disease-sensitive accession PD94042, and a significant decrease was observed in IL41. Our results suggest that disease-resistant cotton might employ a mechanism to increase methylation level in response to disease stress. The differing methylation patterns, together with the increase in global DNA methylation level, might play important roles in tolerance to Verticillium wilt in cotton. Through cloning and analysis of differently methylated DNA sequences, we were also able to identify several genes that may contribute to disease resistance in cotton. Our results revealed the effect of DNA methylation on cotton disease resistance, and also identified genes that played important roles, which may shed light on the future cotton disease-resistant molecular breeding.
Inheritance of resistance to cotton blue disease Herança da resistência do algodoeiro à doença-azul
Directory of Open Access Journals (Sweden)
Osmério Pupim Junior
2008-05-01
Full Text Available The objective of this work was to determine the inheritance of cotton blue disease resistance by cotton plants. Populations derived from the CD 401 and Delta Opal resistant varieties were evaluated, through a greenhouse test with artificial inoculation by viruliferous aphids. Cotton blue disease resistance is conditioned by one dominant gene, both in CD 401 and Delta Opal varieties.O objetivo deste trabalho foi determinar a herança da resistência do algodoeiro à doença-azul. Populações derivadas das variedades resistentes CD 401 e Delta Opal foram avaliadas em casa de vegetação, por meio da inoculação de pulgões virulíferos. A resistência à doença-azul do algodoeiro é condicionada por um gene dominante, tanto em 'DC 401' quanto em 'Delta Opal'.
Identification of resistance to Aspergillus flavus infection in cotton germplasm
Natural resistance of in cottonseed to Aspergillus flavus infection has not been explored to date. A green fluorescent protein (GFP) expressing -70 strain was used to assess the resistance of seed from thirty five35 cotton varieties including representatives from Gossypium arboreum, G. barbadense, a...
He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming
2011-01-01
The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.
Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.
Directory of Open Access Journals (Sweden)
Liping Ke
Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.
Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun
2013-01-01
Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305
Li, Xiaogang; Liu, Biao; Wang, Xingxiang; Han, Zhengmin; Cui, Jinjie; Luo, Junyu
2012-03-01
Impacts on soil invertebrates are an important aspect of environmental risk assessment and post-release monitoring of transgenic insect-resistant plants. The purpose of this study was to research and survey the effects of transgenic insect-resistant cottons that had been planted over 10 years on the abundance and community structure of soil invertebrates under field conditions. During 3 consecutive years (2006-2008), eight common taxa (orders) of soil invertebrates belonging to the phylum Arthropoda were investigated in two different transgenic cotton fields and one non-transgenic cotton field (control). Each year, soil samples were taken at four different growth stages of cotton (seedling, budding, boll forming and boll opening). Animals were extracted from the samples using the improved Tullgren method, counted and determined to the order level. The diversity of the soil fauna communities in the different fields was compared using the Simpson's, Shannon's diversity indices and evenness index. The results showed a significant sampling time variation in the abundance of soil invertebrates monitored in the different fields. However, no difference in soil invertebrate abundance was found between the transgenic cotton fields and the control field. Both sampling time and cotton treatment had a significant effect on the Simpson's, Shannon's diversity indices and evenness index. They were higher in the transgenic fields than the control field at the growth stages of cotton. Long-term cultivation of transgenic insect-resistant cottons had no significant effect on the abundance of soil invertebrates. Collembola, Acarina and Araneae could act as the indicators of soil invertebrate in this region to monitor the environmental impacts of transgenic plants in the future. This journal is © The Royal Society of Chemistry 2012
Carbonari, Caio A; Latorre, Débora O; Gomes, Giovanna L G C; Velini, Edivaldo D; Owens, Daniel K; Pan, Zhiqiang; Dayan, Franck E
2016-04-01
Insertion of the gene encoding phosphinothricin acetyltransferase (PAT) has resulted in cotton plants resistant to the herbicide glufosinate. However, the lower expression and commensurate reduction in PAT activity is a key factor in the low level of injury observed in the WideStrike(®) cotton and relatively high level of resistance observed in LibertyLink(®) cotton. LibertyLink(®) cotton cultivars are engineered for glufosinate resistance by overexpressing the bar gene that encodes phosphinothricin acetyltransferase (PAT), whereas the insect-resistant WideStrike(®) cultivars were obtained using the similar pat gene as a selectable marker. The latter cultivars carry some level of resistance to glufosinate which enticed certain farmers to select this herbicide for weed control with WideStrike(®) cotton. The potency of glufosinate on conventional FM 993, insect-resistant FM 975WS, and glufosinate-resistant IMACD 6001LL cotton cultivars was evaluated and contrasted to the relative levels of PAT expression and activity. Conventional cotton was sensitive to glufosinate. The single copy of the pat gene present in the insect-resistant cultivar resulted in very low RNA expression of the gene and undetectable PAT activity in in vitro assays. Nonetheless, the presence of this gene provided a good level of resistance to glufosinate in terms of visual injury and effect on photosynthetic electron transport. The injury is proportional to the amount of ammonia accumulation. The strong promoter associated with bar expression in the glufosinate-resistant cultivar led to high RNA expression levels and PAT activity which protected this cultivar from glufosinate injury. While the insect-resistant cultivar demonstrated a good level of resistance to glufosinate, its safety margin is lower than that of the glufosinate-resistant cultivar. Therefore, farmers should be extremely careful in using glufosinate on cultivars not expressly designed and commercialized as resistant to this
Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines
Directory of Open Access Journals (Sweden)
Allah BAKHSH
2012-11-01
Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.
Optimizing Organophosphorus Fire Resistant Finish for Cotton Fabric Using Box-Behnken Design
International Nuclear Information System (INIS)
Sohail, Y.; Parag, B.; Nemeshwaree, B.; Giorgio, R.
2016-01-01
N-methylol dimethyl phosphono propionamide (MDPA) is one of the most utilized fire resistant (FR) finishes for cotton fabrics, utilized as part of a formulation with trimethylol melamine (TMM) to acquire better crosslinking and enhanced FR properties. The system parameters of the finishing treatment were upgraded for better FR properties and low mechanical loss to the fabric by the response surface methodology utilizing Box-Behnken statistical designed experimental strategy. The impacts of concentration on the cotton fabric’s properties (fire resistance and mechanical properties) were assessed with the regression equations. The optimum conditions by predicting the FR reagents focusing intact mechanical properties of the fabric were additionally studied. It was found that the parameters of crosslinking agents in the FR formulation have a prime role in the general FR properties of the cotton fabrics. The R-squared estimations of the considerable number of responses were above 92%, demonstrating the level of relationship between the predicted values by the Box-Behnken frameworks and the real test results.
Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng
2016-06-15
Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.
Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J
2017-03-01
An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.
Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng
2017-12-01
Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Jennifer L Williams
Full Text Available Fitness costs of resistance to Bacillus thuringiensis (Bt crops occur in the absence of Bt toxins, when individuals with resistance alleles are less fit than individuals without resistance alleles. As costs of Bt resistance are common, refuges of non-Bt host plants can delay resistance not only by providing susceptible individuals to mate with resistant individuals, but also by selecting against resistance. Because costs typically vary across host plants, refuges with host plants that magnify costs or make them less recessive could enhance resistance management. Limited understanding of the physiological mechanisms causing fitness costs, however, hampers attempts to increase costs. In several major cotton pests including pink bollworm (Pectinophora gossypiella, resistance to Cry1Ac cotton is associated with mutations altering cadherin proteins that bind this toxin in susceptible larvae. Here we report that the concentration of gossypol, a cotton defensive chemical, was higher in pink bollworm larvae with cadherin resistance alleles than in larvae lacking such alleles. Adding gossypol to the larval diet decreased larval weight and survival, and increased the fitness cost affecting larval growth, but not survival. Across cadherin genotypes, the cost affecting larval growth increased as the gossypol concentration of larvae increased. These results suggest that increased accumulation of plant defensive chemicals may contribute to fitness costs associated with resistance to Bt toxins.
Directory of Open Access Journals (Sweden)
B. T. Santos
2016-11-01
Full Text Available This study aimed to evaluate the potential of essential oils of rosemary (Rosmarinus officinalis, baccharis (Baccharis trimera, lemon grass (Cymbopogon citratus, basil (Ocimum basilicum and eucalyptus (Corymbia citriodora in inducing resistance in cotton plants against C. gossypii var. cephalosporioides. The inductive effect of the essential oils was evaluated in plants growing in pots in the environment, which were treated with 1% essential oil at 47 days of age. 24 hours after elicitor treatment the plants were inoculated with a suspension of 1.5 x 105 conidia mL-1 of C. gossypii var. cephalosporioides. Five evaluations were performed disease and calculated the area under the disease progress curve. All essential oils showed potential for inducing resistance against cotton C. gossypii var. cephalosporioides.
TRACTION RESISTANCE IN CHITOSAN TREATED COTTON
Directory of Open Access Journals (Sweden)
LOX Wouter
2015-05-01
Full Text Available Nowadays natural products interest has increased. However, when some products are included on textile fibers, they have no affinity and need some binders or other kind of auxiliaries to improve the yeld of the process, and some of them are not so natural as the product which are binding and consequently the “bio” definition is missed as some of them can be considered as highly pollutant. Chitosan is a common used bonding agent for cotton. It improves the antimicrobial and antifungal activity, improves wound healing and is a non-toxic bonding agent. The biopolymer used in this work is chitosan, which is a deacetylated derivative of chitin. These properties depend on the amount of deacetylation (DD and the Molecular weight (MW. Along with these improving properties, as it requires some acid pH to ve solved the treatment with chitosan can have some decreasing mechanical properties. The aim of that paper is to evaluate the change in breaking force of the treated samples and a change in elongation of those samples. It compared different amounts of concentration of chitosan with non treated cotton. The traction resistance test were performed on a dynamometer. The test was conducted according to the UNE EN ISO 13934-1 standard.
Using and development of multi adversity resistance system in cotton
Directory of Open Access Journals (Sweden)
Metin Durmuş ÇETİN
2014-12-01
Full Text Available The basic approach in plant breeding, make it possible to show the full genetic potential of plant. This methods also protect the health of plant growth over the period, by increasing resistance to diseases and pests is expected to provide. For this purpose, by Bird in 1963, with the name of multi adversity resistance has been initiated in cotton breeding and for many years as a result of the work carried out important varieties and germplasm have been developed. Nowadays, those using for varieties resistant to stress factors such as heat and drought are evaluated. And successful results are obtained.
Gamma ray induced diversity in restorer line of cotton (Gossypium Hirsutum)
International Nuclear Information System (INIS)
Mehetre, S.S.; Patil, V.R.; Surana, P.P.
2000-01-01
Looking to the limitation of very few restorers available in cotton a diversification of available restorer line was undertaken by gamma irradiation. The four hundred individual plants selected from individual M 2 families were crossed with CMS lines. Out of which 12 plants restored fertility in CMS lines and their F 1 's with CMS produced more heterotic hybrids than their checks (control). The results indicated that sufficient variability can be induced with the help of gamma rays and the diversification of restorers is possible within a short period with simultaneous improvement in either one or two characters. (author)
The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.
Directory of Open Access Journals (Sweden)
Peng Wan
Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.
Directory of Open Access Journals (Sweden)
Iftikhar Ali Khan
2016-02-01
Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.
Carter, William W.
1982-01-01
The degree of resistance by a cotton plant to Meloidogyne incognita is affected by soil temperature, particularly in moderately resistant cultivars, The total number of nematodes in the resistant and moderately resistant rools at 35 C was equal to, or greater than, the number in susceptible roots at 20, 25, or 30 C. A shift in numbers to developing and egg-bearing forms of nematodes in the susceptible cultivar as tentperature increased indicates development was affected by temperature rather ...
Jiang, B G; Kong, F L; Zhang, Q Y; Yang, F X; Jiang, R Q
2000-01-01
Data from a set of 5-location and 2-year experiments on 10 representative historical cotton varieties and the data of Huang-Huai Regional Cotton Trials from 1973 to 1996 were analyzed to estimate the effects of genetic improvement in agronomy properties, disease resistance and stability of cotton in Huang-Huai Region in China. The results indicated that a great genetic progress of earliness and disease resistance had been achieved by breeding programs since 1950's. The maturity was shortened 3-5 days; The rate of preforst yield was increased about 7 percentages. The problem of resistance to Fususium wilt has been solved and the resistance to Verticillum wilt was improving. Some progress in stability of cotton varieties also has been achieved by breeding programs since 1950.
Suppressing Resistance to Bt Cotton with Sterile Insect Releases
Energy Technology Data Exchange (ETDEWEB)
Tabashnik, B E [Department of Entomology, University of Arizona, Tucson, AZ (United States); Sisterson, M S [USDA-ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA (United States); Ellsworth, P C [Department of Entomology, University of Arizona, Maricopa Agricultural Center, Maricopa, AZ (United States)
2011-01-15
Genetically engineered crops that produce insecticidal toxins from Bacillus thuringiensis (Bt) are grown widely for pest control. However, insect adaptation can reduce the toxins' efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to provide susceptible insects to mate with resistant insects. Variable farmer compliance is one of the limitations of this approach. Here we report the benefits of an alternative strategy where sterile insects are released to mate with resistant insects and refuges are scarce or absent. Computer simulations show that this approach works in principle against pests with recessive or dominant inheritance of resistance. During a largescale, four-year field deployment of this strategy in Arizona, resistance of pink bollworm (Pectinophora gossypiella) to Bt cotton did not increase. A multitactic eradication program that included the release of sterile moths reduced pink bollworm abundance by >99%, while eliminating insecticide sprays against this key invasive pest. (author)
Directory of Open Access Journals (Sweden)
Halappa Banakar
2016-12-01
Full Text Available The cotton leafhopper (Amrasca biguttula biguttula Ishida is considered to be an alarming insect pest causing both quantitative and qualitative loss in cotton. In situ bioassay studies were done and the role of detoxifying enzymes in conferring resistance to neonicotinoid groups of insecticides in low (MUD, medium (DVG, high (HVR and very high (GLB pesticide usage areas of Karnataka were determined. Bioassay studies showed that imidacloprid, thiamethoxam, acetamiprid, thiacloprid and clothianidin registered varying levels of resistance for all the locations studied. The resistance ratio was high in imidacloprid (3.35, 8.57, 9.15 and 12.27 fold respectively and the lowest in dinoferuran (1.86, 5.13, 6.71 and 9.88 fold respectively. Furthermore, the enzyme activity ratio (glutathione-S-transferase was relatively greater, and corresponded to the higher LC50 values of neonicotinoids for very high, high, medium and low pesticide usage areas. Our study suggested that the higher activity of the detoxifying enzyme in the resistance population of cotton leafhopper apparently has a significant role in endowing resistance to neonicotinoid groups of insecticides. However, this study recommends using neonicotinoids in cotton growing areas with caution.
The improvement of cotton plant in mutation breeding dry climate areas at NTB
International Nuclear Information System (INIS)
Lilik Harsanti
2015-01-01
The opportunity of cotton plant to become a major crop in Indonesia is widely opened due to its extensive adaptability, productivity, efficiency of nutrient intake, and relatively resistant against pests and plant diseases. Generally, cotton plant is an important industrial crop in textile manufacture. Cotton plant has been known and planted for a long time ago by the local farmer, especially at Java, NTB and NTT. Plant mutation breeding have the mutant lines genetic for plant. The mutant lines of cotton plant, which originally come from embryogenic tissue culture (embryo axis, NIAB-999), were irradiated with dose of 20 Gy. Gamma Chamber 4000-A with source of 60 Cobalt was used for the irradiation treatment. The experiments were done at Citayam by designed by randomized Block design with five replications. Both of mutant lines were planted in the plot with size of 8 × 7 m 2 and 10 × 100 cm of spacing. Kanesia 15 variety was used as a control. The parameters observed were the days of maturity, plant height, number of generative branches, number of fruit/plant, weight of 100 cotton boll per plot. As the results, CN 2A has the biggest productivity, shown by the weight of the cotton fiber per plot, which is 447.510 kg compared to Kanesia 15 and NIAB 999 is control national and control mother. (author)
Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C
2016-08-01
Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso
2016-10-01
The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.
Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents
International Nuclear Information System (INIS)
Baloch, M.J.; Baloch, Q.B.
2005-01-01
Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)
Directory of Open Access Journals (Sweden)
Ruijuan Li
Full Text Available Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.. An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747, resistant (BARBREN-713, and hypersensitive (LONREN-1 genotypes of cotton (Gossypium hirsutum L. with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.
Inheritance and segregation of exogenous genes in transgenic cotton
Indian Academy of Sciences (India)
Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...
Directory of Open Access Journals (Sweden)
Nan-Yang Li
2018-02-01
Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.
Analyses of Fusarium wilt race 3 resistance in Upland cotton (Gossypium hirsutum L.).
Abdullaev, Alisher A; Salakhutdinov, Ilkhom B; Egamberdiev, Sharof Sh; Kuryazov, Zarif; Glukhova, Ludmila A; Adilova, Azoda T; Rizaeva, Sofiya M; Ulloa, Mauricio; Abdurakhmonov, Ibrokhim Y
2015-06-01
Fusarium wilt [Fusarium oxysporum f.sp. vasinfectum (FOV) Atk. Sny & Hans] represents a serious threat to cotton (Gossypium spp.) production. For the last few decades, the FOV pathogen has become a significant problem in Uzbekistan causing severe wilt disease and yield losses of G. hirsutum L. cultivars. We present the first genetic analyses of FOV race 3 resistance on Uzbek Cotton Germplasm with a series of field and greenhouse artificial inoculation-evaluations and inheritance studies. The field experiments were conducted in two different sites: the experimental station in Zangiota region-Environment (Env) 1 and the Institute of Cotton Breeding (Env-2, Tashkent province). The Env-1 was known to be free of FOV while the Env-2 was known to be a heavily FOV infested soil. In both (Env-1 and Env-2) of these sites, field soil was inoculated with FOV race 3. F2 and an F3 Upland populations ("Mebane B1" × "11970") were observed with a large phenotypic variance for plant survival and FOV disease severity within populations and among control or check Upland accessions. Wilt symptoms among studied F2 individuals and F3 families significantly differed depending on test type and evaluation site. Distribution of Mendelian rations of susceptible (S) and resistant (R) phenotypes were 1S:1R field Env-1 and 3S:1R field Env-2 in the F2 population, and 1S:3R greenhouse site in the F3 population. The different segregation distribution of the Uzbek populations may be explained by differences in FOV inoculum level and environmental conditions during assays. However, genetic analysis indicated a recessive single gene action under high inoculum levels or disease pressure for FOV race 3 resistance. Uzbek germplasm may be more susceptible than expected to FOV race 3, and sources of resistance to FOV may be limited under the FOV inoculum levels present in highly-infested fields making the breeding process more complex.
Muthusamy, Annamalai; Jayabalan, Narayanasamy
2013-01-01
The present work describes the influence of gamma irradiation (GR), ethyl methane sulphonate (EMS) and sodium azide (SA) treatment on yield and protein content of selected mutant lines of cotton. Seeds of MCU 5 and MCU 11 were exposed to gamma rays (GR), ethyl methane sulphonate (EMS) and sodium azide (SA). Lower dose of gamma irradiation (100-500 Gy), 10-50 mM EMS and SA at lower concentration effectively influences in improving the yield and protein content. Significant increase in yield (258.9 g plant(-1)) and protein content (18.63 mg g(-1) d. wt.) as compared to parental lines was noted in M2 generations. During the subsequent field trials, number of mutant lines varied morphologically in terms of yield as well as biochemical characters such as protein. The selected mutant lines were bred true to their characters in M3 and M4 generations. The significant increase in protein content and profiles of the mutant lines with range of 10.21-18.63 mg g(-1). The SDS-PAGE analysis of mutant lines revealed 9 distinct bands of different intensities with range of 26-81 kDa. The difference in intensity of bands was more (41, 50 and 58 kDa) in the mutant lines obtained from in vitro mutation than in vivo mutation. Significance of such stimulation in protein content correlated with yielding ability of the mutant lines of cotton in terms of seed weight per plant. The results confirm that in cotton it is possible to enhance the both yield and biochemical characters by in vivo and in vitro mutagenic treatments.
Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A
2017-12-10
Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected
International Nuclear Information System (INIS)
Dong, H.; Li, Z.; Zhang, D.; Li, W.; Tang, W.
2004-01-01
Cresotic acid (3-hydroxy-4-methylbenzoic acid) was proved be active in controlling wilt diseases of melon and cotton plants grown in the house. Soil drench with 200-1000 ppm cresotic acid induced 62-77 %, 69-79 % and 50-60 % protection against Fusarium oxysporum f.sp melonis (FOM) in melon, Fusarium oxysporum f.sp vasinfectum (FOV) and Verticillium dahliae in cotton, respectively. Since no inhibitory effect of cresotic acid on mycelial growth of these three fungual pathogens was observed in vitro, it is suggested that control of these wilt diseases with cresotic acid resulted from induced resistance. Cresotic acid induced resistance in melon plants not only against race 0, race 1, race 2 and race 1,2, but also against a mixture of these four races of FOM, suggesting a non-race- specific resistance. Level of induced resistance by cresotic acid against FOM depended on inoculum pressure applied to melon plants. At 25 day after inoculation with FOM, percentage protection induced by cresotic acid under low inoculum pressure retained a level of 51 %, while under high inoculum pressure percentage protection decreased to only 10 %. High concentrations of cresotic acid significantly reduced plant growth. Reduction in fresh weight of melon (36-51%) and cotton (42-71%) was obtained with 500-1000 ppm cresotic acid, while only less than 8% reduction occurred with 100-200 ppm. (author)
Falck-Zepeda, Jose; Horna, Daniela; Smale, Melinda
2007-01-01
"Cotton is the largest source of export receipts of several West African countries. Statistics however show a decreasing tendency in cotton yields and an increasing tendency in pesticide use. Under this circumstances there appear to be potential payoffs from the use of biotechnology products in the farming systems of the region. In this study we estimate different scenarios for the potential deployment of insect resistant cotton in selected countries in West Africa (WA). We use an economic su...
Wang, Chen; He, Xiaowen; Li, Yuzhen; Wang, Lijun; Guo, Xulei; Guo, Xingqi
2017-11-02
Fusarium wilt is one of the most serious diseases affecting cotton. However, the pathogenesis and mechanism by which Fusarium oxysporum overcomes plant defence responses are unclear. Here, a new group D mitogen-activated protein kinase (MAPK) gene, GhMPK20, was identified and functionally analysed in cotton. GhMPK20 expression was significantly induced by F. oxysporum. Virus-induced gene silencing (VIGS) of GhMPK20 in cotton increased the tolerance to F. oxysporum, whereas ectopic GhMPK20 overexpression in Nicotiana benthamiana reduced F. oxysporum resistance via disruption of the salicylic acid (SA)-mediated defence pathway. More importantly, an F. oxysporum-induced MAPK cascade pathway composed of GhMKK4, GhMPK20 and GhWRKY40 was identified. VIGS of GhMKK4 and GhWRKY40 also enhanced F. oxysporum resistance in cotton, and the function of GhMKK4-GhMPK20 was shown to be essential for F. oxysporum-induced GhWRKY40 expression. Together, our results indicate that the GhMKK4-GhMPK20-GhWRKY40 cascade in cotton plays an important role in the pathogenesis of F. oxysporum. This research broadens our knowledge of the negative role of the MAPK cascade in disease resistance in cotton and provides an important scientific basis for the formulation of Fusarium wilt prevention strategies. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Sorgatto, Rodrigo J; Bernardi, Oderlei; Omoto, Celso
2015-02-01
In Brazil, Spodoptera frugiperda (J. E. Smith) and Chrysodeixis includens (Walker) are important cotton pests and target of control of Bollgard II (Cry1Ac/Cry2Ab2) and WideStrike (Cry1Ac/Cry1F) cotton technologies. To subsidize an insect resistance management program, we conducted laboratory studies to evaluate the toxicity of these Bt cotton plants throughout larval development of S. frugiperda and C. includens. In bioassays with leaf disc, the efficacy of both Bt cotton plants against neonates was >80% for S. frugiperda and 100% for C. includens. However, S. frugiperda larvae that survived on Bt cotton had >76% of growth inhibition and stunting. In bioassays with S. frugiperda and C. includens larvae fed on non-Bt near-isoline during different time period (from 3 to 18 d) and then transferred to Bollgard II or WideStrike leaves showed that larval susceptibility decreased as larval age increased. For Bollgard II cotton, in all S. frugiperda instars, there were larvae that reached the pupal and adult stages. In contrast, on WideStrike cotton, a few larvae in fifth and sixth instar completed the biological cycle. For C. includens, some larvae in sixth instar originated adults in both Bt cotton plants. In conclusion, Bollgard II and WideStrike cotton technologies showed high efficacy against neonates of S. frugiperda and C. includens. However, the mortality of these species decreases as larval age increase, allowing insect survival in a possible seed mixture environment and favoring the resistance evolution. © The Author 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Genetic diversity in upland cotton for cotton leaf curl virus disease, earliness and fiber quality
International Nuclear Information System (INIS)
Saeed, F.; Farooq, J.; Mahmood, A.; Hussain, T.
2014-01-01
In Pakistan during last two decades the major factor limiting cotton production is cotton leaf curl virus disease (CLCuD). For estimation of genetic diversity regarding CLCuD tolerance, fiber quality and some yield contributing traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like days taken to 1 square and days taken to 1 flower had positive correlation with each other and both these traits also showed their positive association with ginning out turn. The negative significant correlation of CLCuD was obtained with monopodial branches, sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st cluster 1 only showed reasonable values for days to 1 square and flower, sympodia per plant, ginning out turn, staple length and fiber fineness and the genotypes in cluster 5 showed promising values for the traits like cotton leaf curl virus, ginning out turn and fiber fineness. The genotypes in cluster 1 and 5 may be combined to obtain desirable traits related to earliness and better disease tolerance. Scatter plot and tree diagrams demonstrated sufficient diversity among the cotton accessions for various traits and some extent of association between various clusters. It is concluded that diversity among the genotypes could be utilized for the development of CLCuD resistant lines with increased seed
Wu, Jianyong; Zhang, Meng; Zhang, Bingbing; Zhang, Xuexian; Guo, Liping; Qi, Tingxiang; Wang, Hailin; Zhang, Jinfa; Xing, Chaozhu
2017-06-08
Cytoplasmic male sterility (CMS) conferred by the cytoplasm from Gossypium harknessii (D2) is an important system for hybrid seed production in Upland cotton (G. hirsutum). The male sterility of CMS-D2 (i.e., A line) can be restored to fertility by a restorer (i.e., R line) carrying the restorer gene Rf1 transferred from the D2 nuclear genome. However, the molecular mechanisms of CMS-D2 and its restoration are poorly understood. In this study, a genome-wide comparative transcriptome analysis was performed to identify differentially expressed genes (DEGs) in flower buds among the isogenic fertile R line and sterile A line derived from a backcross population (BC 8 F 1 ) and the recurrent parent, i.e., the maintainer (B line). A total of 1464 DEGs were identified among the three isogenic lines, and the Rf1-carrying Chr_D05 and its homeologous Chr_A05 had more DEGs than other chromosomes. The results of GO and KEGG enrichment analysis showed differences in circadian rhythm between the fertile and sterile lines. Eleven DEGs were selected for validation using qRT-PCR, confirming the accuracy of the RNA-seq results. Through genome-wide comparative transcriptome analysis, the differential expression profiles of CMS-D2 and its maintainer and restorer lines in Upland cotton were identified. Our results provide an important foundation for further studies into the molecular mechanisms of the interactions between the restorer gene Rf1 and the CMS-D2 cytoplasm.
Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.
Directory of Open Access Journals (Sweden)
Yun Chen
Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.
Directory of Open Access Journals (Sweden)
Haonan Zhang
Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins have been planted widely to control insect pests, yet evolution of resistance by the pests can reduce the benefits of this approach. Recessive mutations in the extracellular domain of toxin-binding cadherin proteins that confer resistance to Bt toxin Cry1Ac by disrupting toxin binding have been reported previously in three major lepidopteran pests, including the cotton bollworm, Helicoverpa armigera. Here we report a novel allele from cotton bollworm with a deletion in the intracellular domain of cadherin that is genetically linked with non-recessive resistance to Cry1Ac. We discovered this allele in each of three field-selected populations we screened from northern China where Bt cotton producing Cry1Ac has been grown intensively. We expressed four types of cadherin alleles in heterologous cell cultures: susceptible, resistant with the intracellular domain mutation, and two complementary chimeric alleles with and without the mutation. Cells transfected with each of the four cadherin alleles bound Cry1Ac and were killed by Cry1Ac. However, relative to cells transfected with either the susceptible allele or the chimeric allele lacking the intracellular domain mutation, cells transfected with the resistant allele or the chimeric allele containing the intracellular domain mutation were less susceptible to Cry1Ac. These results suggest that the intracellular domain of cadherin is involved in post-binding events that affect toxicity of Cry1Ac. This evidence is consistent with the vital role of the intracellular region of cadherin proposed by the cell signaling model of the mode of action of Bt toxins. Considered together with previously reported data, the results suggest that both pore formation and cell signaling pathways contribute to the efficacy of Bt toxins.
Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton
International Nuclear Information System (INIS)
Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.
2017-01-01
Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)
Heterosis and correlation in interspecific and intraspecific hybrids of cotton.
Munir, S; Hussain, S B; Manzoor, H; Quereshi, M K; Zubair, M; Nouman, W; Shehzad, A N; Rasul, S; Manzoor, S A
2016-06-24
Interspecific and intraspecific hybrids show varying degrees of heterosis for yield and yield components. Yield-component traits have complex genetic relationships with each other. To determine the relationship of yield-component traits and fiber traits with seed cotton yield, six lines (Bt. CIM-599, CIM-573, MNH-786, CIM-554, BH-167, and GIZA-7) and three test lines (MNH-886, V4, and CIM-557) were crossed in a line x tester mating design. Heterosis was observed for seed cotton yield, fiber traits, and for other yield-component traits. Heterosis in interspecific hybrids for seed cotton yield was more prominent than in intraspecific hybrids. The interspecific hybrid Giza-7 x MNH-886 had the highest heterosis (114.77), while among intraspecific hybrids, CIM-554 x CIM-557 had the highest heterosis (61.29) for seed cotton yield. A major trait contributing to seed cotton yield was bolls/plant followed by boll weight. Correlation studies revealed that bolls/plant, boll weight, lint weight/boll, lint index, seed index, lint/seed, staple length, and staple strength were significantly and positively associated with seed cotton yield. Selection based on boll weight, boll number, lint weight/boll, and lint index will be helpful for improving cotton seed yield.
Directory of Open Access Journals (Sweden)
Michael G. Patterson
2013-01-01
Full Text Available A three year field experiment was conducted to evaluate the role of soil inversion, cover crops and spring tillage methods for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. Main plots were two soil inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. Subplots were three cover treatments: crimson clover, cereal rye or none (i.e., winter fallow; and the sub subplots were four secondary spring tillage methods: disking followed by (fb cultivator (DCU, disking fb chisel plow (DCH, disking fb disking (DD and no tillage (NT. Averaged over years and soil inversion, the crimson clover produced maximum cover biomass (4390 kg ha−1 fb cereal rye (3698 kg ha−1 and winter fallow (777 kg ha−1. Two weeks after planting (WAP and before the postemergence (POST application, Palmer amaranth WR and BR density were two- and four-times less, respectively, in IT than NIT. Further, Palmer amaranth WR and BR density were reduced two-fold following crimson clover and cereal rye than following winter fallow at 2 WAP. Without IT, early season Palmer amaranth densities were 40% less following DCU, DCH and DD, when compared with IT. Following IT, no spring tillage method improved Palmer amaranth control. The timely application of glufosinate + S-metolachlor POST tank mixture greatly improved Palmer amaranth control in both IT and NIT systems. The highest cotton yields were obtained with DD following cereal rye (2251 kg ha−1, DD following crimson clover (2213 kg ha−1 and DD following winter fallow (2153 kg ha−1. On average, IT cotton yields (2133 kg ha−1 were 21% higher than NIT (1766 kg ha−1. Therefore, from an integrated weed management standpoint, an occasional fall IT could greatly reduce Palmer amaranth emergence on farms highly infested with glyphosate-resistant Palmer amaranth. In addition, a cereal rye or crimson clover cover crop can effectively reduce early season Palmer
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang
2017-04-04
Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.
Cotton (Gossypium hirsutum L.).
Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia
2015-01-01
Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Thwarting one of cotton's nemeses
International Nuclear Information System (INIS)
Senft, D.
1991-01-01
There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system
Zhang, D J; Liu, J X; Lu, Z Y; Li, C L; Comada, E; Yang, M S
2015-07-27
Poplar-cotton agro-ecosystems are the main agricultural planting modes of cotton fields in China. With increasing acres devoted to transgenic insect-resistant poplar and transgenic insect-resistant cotton, studies examining the effects of transgenic plants on target and non-target insects become increasingly important. We systematically surveyed populations of both target pests and non-target insects for 4 different combinations of poplar-cotton eco-systems over 3 years. Transgenic Bt cotton strongly resisted the target insects Fall webworm moth [Hyphantria cunea (Drury)], Sylepta derogata Fabrieius, and American bollworm (Heliothis armigera), but no clear impact on non-target insect cotton aphids (Aphis gossypii). Importantly, intercrops containing transgenic Pb29 poplar significantly increased the inhibitory effects of Bt cotton on Fall webworm moth in ecosystem IV. Highly resistant Pb29 poplar reduced populations of the target pests Grnsonoma minutara Hubner and non-target insect poplar leaf aphid (Chaitophorus po-pulialbae), while Fall webworm moth populations were unaffected. We determined the effects of Bt toxin from transgenic poplar and cotton on target and non-target pests in different ecosystems of cotton-poplar intercrops and identified the synergistic effects of such combinations toward both target and non-target insects.
Duan, Manli; Gu, Jie; Wang, Xiaojuan; Li, Yang; Zhang, Sheqi; Yin, Yanan; Zhang, Ranran
2018-01-01
Genetically modified (GM) cotton production generates a large yield of stalks and their disposal is difficult. In order to study the feasibility of using GM cotton stalks for composting and the changes that occur in antibiotic resistance genes (ARGs) during composting, we supplemented pig manure with GM or non-GM cotton stalks during composting and we compared their effects on the absolute abundances (AA) of intI1, intI2, and ARGs under the two treatments. The compost was mature after processing based on the germination index and C/N ratio. After composting, the AAs of ARGs, intI1, and intI2 were reduced by 41.7% and 45.0% in the non-GM and GM treatments, respectively. The ARG profiles were affected significantly by temperature and ammonia nitrogen. In addition, excluding tetC, GM cotton stalks had no significant effects on ARGs, intI1, and intI2 compared with the non-GM treatment (p composting with livestock manure, and the AAs of ARGs can be reduced. Furthermore, the results of this study provide a theoretical basis for the harmless utilization of GM cotton stalks. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
مریم قربانی
2015-05-01
Full Text Available This research was conducted to determine the effect of heat-treatment with raw cotton seed oil on decay resistance and dimensional stability of beech according to EN113 and ASTM-D1037 standards respectively. The heat treatment with raw cotton seed oil was carried out in the cylinder at the temperatures of 130 and 170oC for 30 and 60 minutes. Oil uptake, density, volumetric swelling, water absorption and weight loss exposed to decay were measured. Oil uptake at 30 and 60 min were determined 10.5 and 13.3 Kg/cm3 respectively. Oil-heat treated samples at 30min and 130°C indicated the maximum density with 87.7% increase. According to results, oil-heat treatment improved water repellency and dimensional stability. Water absorption in 130°C and 60 minutes decreased 76% in comparison with control. Decay resistance of oil soaked samples for 60minutes was 80.2% more than control samples. Oil-heat treatment compared with oil treatment improved decay resistance, this effect was significant at 30 min. The temperature rise of oil–heat treatment at 30 minutes improved decay resistance, but the improvement under same level of temperature with increase time was not significant.
Superamphiphobic cotton fabrics with enhanced stability
Energy Technology Data Exchange (ETDEWEB)
Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)
2015-11-30
Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.
Flavonoid biosynthesis controls fiber color in naturally colored cotton
Directory of Open Access Journals (Sweden)
Hai-Feng Liu
2018-04-01
Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.
Chen, Xuewei; Li, Fen; Chen, Anqi; Ma, Kangsheng; Liang, Pingzhuo; Liu, Ying; Song, Dunlun; Gao, Xiwu
2017-09-01
Aphis gossypii Glover is a destructive pest of numerous crops throughout the world. Although the expansion of Bt cotton cultivation has helped to control some insect pests, the damage from cotton aphids has not been mitigated. The evolution of aphid resistance to imidacloprid has made its chemical control more difficult since its introduction in 1991. Field populations of A. gossypii that were collected from different transgenic (Bt) cotton planting areas of China in 2014 developed different levels of resistance to imidacloprid. The IMI_R strain has developed high resistance to imidacloprid with the resistance ratio >1200-fold. Compared with the susceptible IMI_S strain, the IMI_R strain also developed a high level cross resistance to sulfoxaflor and acetamiprid. The limited synergism with either PBO or DEF suggests that resistance may be due to the site mutation of molecular target rather than to enhanced detoxification. Three target-site mutations within the nicotinic acetylcholine receptor (nAChR) β1 subunit were detected in the IMI_R strain. The R81T mutation has been reported to be responsible for imidacloprid resistance in A. gossypii and M. persicae. Both V62I and K264E were first detected in A. gossypii. These point mutations are also present in field populations, suggesting that they play a role in the resistance to imidacloprid. Furthermore, the expression level of transcripts encoding β1 subunit was decreased significantly in the IMI_R strain compared with the IMI_S strain, suggesting that both point mutations and the down-regulation of nAChR β1 subunit expression may be involved in the resistance mechanism for imidacloprid in A. gossypii. These results should be useful for the management of imidacloprid-resistant cotton aphids in Bt cotton fields in China. Copyright © 2016 Elsevier B.V. All rights reserved.
Osteen, Craig; Suguiyama, Luis
This report examines the economic implications of losing chlordimeform use on cotton and considers chlordimeform's role in managing the resistance of bollworms and tobacco budworms to synthetic pyrethroids. It estimates changes in prices, production, acreage, consumer expenditures, aggregate producer returns, regional crop effects, and returns to…
Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding
Directory of Open Access Journals (Sweden)
Jehan
2017-11-01
Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.
DEFF Research Database (Denmark)
Rajasundaram, Dhivyaa; Runavot, Jean-Luc; Guo, Xiaoyuan
2014-01-01
cotton fibers, which are of both biological and industrial importance. To this end, we attempted to study cotton fiber characteristics together with glycan arrays using regression based approaches. Taking advantage of the comprehensive microarray polymer profiling technique (CoMPP), 32 cotton lines from...... different cotton species were studied. The glycan array was generated by sequential extraction of cell wall polysaccharides from mature cotton fibers and screening samples against eleven extensively characterized cell wall probes. Also, phenotypic characteristics of cotton fibers such as length, strength...
Evaluation of the Impact of Genetically Modified Cotton After 20 Years of Cultivation in Mexico
Directory of Open Access Journals (Sweden)
Martha G. Rocha-Munive
2018-06-01
Full Text Available For more than 20 years cotton has been the most widely sown genetically modified (GM crop in Mexico. Its cultivation has fulfilled all requirements and has gone through the different regulatory stages. During the last 20 years, both research-institutions and biotech-companies have generated scientific and technical information regarding GM cotton cultivation in Mexico. In this work, we collected data in order to analyze the environmental and agronomic effects of the use of GM cotton in Mexico. In 1996, the introduction of Bt cotton made it possible to reactivate this crop, which in previous years was greatly reduced due to pest problems, production costs and environmental concerns. Bt cotton is a widely accepted tool for cotton producers and has proven to be efficient for the control of lepidopteran pests. The economic benefits of its use are variable, and depend on factors such as the international cotton-prices and other costs associated with its inputs. So far, the management strategies used to prevent development of insect resistance to GM cotton has been successful, and there are no reports of insect resistance development to Bt cotton in Mexico. In addition, no effects have been observed on non-target organisms. For herbicide tolerant cotton, the prevention of herbicide resistance has also been successful since unlike other countries, the onset of resistance weeds is still slow, apparently due to cultural practices and rotation of different herbicides. Environmental benefits have been achieved with a reduction in chemical insecticide applications and the subsequent decrease in primary pest populations, so that the inclusion of other technologies—e.g., use of non-Bt cotton- can be explored. Nevertheless, control measures need to be implemented during transport of the bolls and fiber to prevent dispersal of volunteer plants and subsequent gene flow to wild relatives distributed outside the GM cotton growing areas. It is still necessary to
Possible accuracy of the Cotton-Mouton polarimetry in a sheared toroidal plasma conversion
International Nuclear Information System (INIS)
Kravtsov, Y.A.; Chrzanowski, J.
2011-01-01
The Cotton-Mouton effect in the sheared plasma with helical magnetic lines is studied, using the equation for the complex amplitude ratio (CAR). A simple model for helical magnetic lines in plasma of toroidal configuration is suggested. Equation for CAR is solved perturbatively, treating the shear angle variations as a small perturbation, caused by the spiral form of the magnetic lines. It is shown that the uncertainty of the polarization measurements in the toroidal plasma with a spiral form of the magnetic lines does not exceed 1.0-2.0%, which determines the limiting accuracy of the Cotton-Mouton polarimetry. It is furthermore pointed out that the method of a priori subtraction of the '' sheared '' term may significantly improve the accuracy of the Cotton-Mouton polarimetry. (authors)
Chen, Yu; Wang, Yingying; Wang, Kai; Zhu, Xiefei; Guo, Wangzhen; Zhang, Tianzhen; Zhou, Baoliang
2014-05-01
We report the first complete set of alien addition lines of G. hirsutum . The characterized lines can be used to introduce valuable traits from G. australe into cultivated cotton. Gossypium australe is a diploid wild cotton species (2n = 26, GG) native to Australia that possesses valuable characteristics unavailable in the cultivated cotton gene pool, such as delayed pigment gland morphogenesis in the seed and resistances to pests and diseases. However, it is very difficult to directly transfer favorable traits into cultivated cotton through conventional gene recombination due to the absence of pairing and crossover between chromosomes of G. australe and Gossypium hirsutum (2n = 52, AADD). To enhance the transfer of favorable genes from wild species into cultivated cotton, we developed a set of hirsutum-australe monosomic alien chromosome addition lines (MAAL) using a combination of morphological survey, microsatellite marker-assisted selection, and molecular cytogenetic analysis. The amphidiploid (2n = 78, AADDGG) of G. australe and G. hirsutum was consecutively backcrossed with upland cotton to develop alien addition lines of individual G. australe chromosomes in G. hirsutum. From these backcross progeny, we generated the first complete set of chromosome addition lines in cotton; 11 of 13 lines are monosomic additions, and chromosomes 7G(a) and 13G(a) are multiple additions. MAALs of 1G(a) and 11G(a) were the first to be isolated. The chromosome addition lines can be employed as bridges for the transfer of desired genes from G. australe into G. hirsutum, as well as for gene assignment, isolation of chromosome-specific probes, flow sorting and microdissection of chromosome, development of chromosome-specific ''paints'' for fluorochrome-labeled DNA fragments, physical mapping, and selective isolation and mapping of cDNAs for a particular G. australe chromosome.
Development of Elite BPH-Resistant Wide-Spectrum Restorer Lines for Three and Two Line Hybrid Rice.
Fan, Fengfeng; Li, Nengwu; Chen, Yunping; Liu, Xingdan; Sun, Heng; Wang, Jie; He, Guangcun; Zhu, Yingguo; Li, Shaoqing
2017-01-01
Hybrid rice has contributed significantly to the world food security. Breeding of elite high-yield, strong-resistant broad-spectrum restorer line is an important strategy for hybrid rice in commercial breeding programs. Here, we developed three elite brown planthopper (BPH)-resistant wide-spectrum restorer lines by pyramiding big-panicle gene Gn8.1 , BPH-resistant genes Bph6 and Bph9 , fertility restorer genes Rf3, Rf4, Rf5 , and Rf6 through molecular marker assisted selection. Resistance analysis revealed that the newly developed restorer lines showed stronger BPH-resistance than any of the single-gene donor parent Luoyang-6 and Luoyang-9. Moreover, the three new restorer lines had broad spectrum recovery capabilities for Honglian CMS, Wild abortive CMS and two-line GMS sterile lines, and higher grain yields than that of the recurrent parent 9,311 under nature field conditions. Importantly, the hybrid crosses also showed good performance for grain yield and BPH-resistance. Thus, the development of elite BPH-resistant wide-spectrum restorer lines has a promising future for breeding of broad spectrum BPH-resistant high-yield varieties.
Directory of Open Access Journals (Sweden)
Francisco das Chagas Vidal Neto
2005-02-01
Full Text Available Este trabalho teve como objetivo avaliar os efeitos de três características morfológicas mutantes de linhagens de algodoeiro herbáceo (Gossypium hirsutum L. r. latifolium Hutch., isoladas ou combinadas no mesmo genótipo, como fonte de resistência ao bicudo, Anthonomus grandis Boheman, 1843 (Coleoptera, Curculionidae. O experimento foi conduzido em campo, sob infestação natural, com delineamento de blocos ao acaso e arranjo fatorial 2´3 com um tratamento adicional, com quatro repetições. Em teste com chance de escolha, a característica bráctea frego foi a que apresentou maior redução no dano de oviposição pelo bicudo (34,71%, em relação ao equivalente normal. A folha "okra" reduziu o dano apenas quando associada à bráctea frego (40%. A combinação das três características mutantes na mesma planta proporcionou a menor porcentagem de botões com dano de oviposição (23,13%.This work aimed to evaluate the effects of three morphological mutants of upland cotton lines (Gossypium hirsutm L. r. latifolium Hutch., isolated or in combination in the same cotton genotype, as a source of resistance to boll weevil, Anthonomus grandis Boheman, 1843 (Coleoptera, Curculionidae. The experiment was carried out in the field, under natural infestation, with a completely randomized block design arranged in a factorial 2´3 plus an additional treatment, with four replications. In a multiple choice test, the character mutant frego bract presented the higher reduction on boll weevil oviposition damage (34.71%, in relation to the normal equivalent. The okra leaf reduced the boll weevil damage only when associated with frego bract (40%. The combination of the three mutant characters in the same plant presented the least square percent with oviposition damage (23.13%.
Radiation resistant lining material
International Nuclear Information System (INIS)
Ouchi, Koki; Okagawa, Seigo; Tamaki, Hidehiro.
1990-01-01
Rigidity, viscoelasticity, flexibility, radiation resistance, leaching resistance, rust-proofness, endurance, etc. are required for the lining materials to wall surfaces and floor surfaces of facilities used under the effect of radiation rays and for the inner surface protection of vessels for radioactive wastes. The present invention provides radiation resistant lining material capable of satisfying such various requirements in a well-balanced manner. That is, the material contains (A) 100 parts by weight of rapidly curing cement, (B) 50 to 300 % by weight of aggregate, and (C) 80 to 120 parts by weight of polymer emulsion. As the specific example, the ingredient (A) is commercially available under the trade name of Jet Cement. The aggregate of the ingredient (B) has preferably from about 0.6 to 0.2 mm of size and is made of material, preferably, silicon or iron grains. As the ingredient (C), acrylic resin emulsion is preferred. As a result of example, these ingredient constitutions can satisfy each of the required performance described above. (I.S.)
Diversity of arthropod community in transgenic poplar-cotton ecosystems.
Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S
2015-12-02
Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.
International Nuclear Information System (INIS)
Baloch, M.H.; Kumbher, M.B.; Jatoi, W.A.
2008-01-01
Combining abilities of cotton varieties were evaluated using a line x tester design with eight lines and 4 testers. Good performance combination was found between the varieties CRIS-134 and BH-147. The former was a good candidate for fibre length improvement and the latter, a good parent for yield improvement. The specific combining ability suggested that both additive and dominant genes controlled the characters. Hybrid performance per se may be used to predict the parental performance for specific combining ability and thus for hybrid crop development. (author)
Directory of Open Access Journals (Sweden)
Fok, M.
2011-01-01
Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.
Improving food and agricultural production. Thailand. Breeding for resistance to diseases in cotton
International Nuclear Information System (INIS)
Wallace, T.P.
1992-01-01
This document reports the results of a 20-day mission to Thailand within the framework of the project ''Improving food and agricultural production with nuclear and related technology''. The expert discussed the status of cotton breeding, production practices and problems with personnel of the Department of Agriculture in Bangkok, and travelled to cotton-producing regions of the central and northern areas of the country to discuss current research, pest problems and social factors affecting cotton production
Directory of Open Access Journals (Sweden)
Nacer eBellaloui
2015-03-01
Full Text Available Cotton is an important crop in the world and is a major source of oil for human consumption and cotton meal for livestock. Cottonseed nutrition (seed composition: protein, oil, and minerals determine the quality of seeds. Therefore, maintaining optimum levels of cottonseed nutrition is critical. Physiological and genetic mechanisms controlling the levels of these constituents in cottonseed are still largely unknown. Our previous research conducted under greenhouse conditions showed that seed and leaf nutrition differed between fuzzless and fuzzy seed isolines. Therefore, the objective of this research was to investigate the seed fuzz phenotype (trait effects on seed protein, oil, N, C, S, and minerals in five sets of near-isogenic mutant cotton lines for seed fuzz in a two-year experiment under field condition to evaluate the stability of the effect of the trait on seed nutrition. The isolines (genotypes in each set differ for the seed fuzz trait (fuzzless/linted seed line, N lines, and fuzzy/linted seed line, F lines. Results showed that seed protein was higher in the fuzzy genotype in all sets, but seed oil was higher in fuzzless genotype in all sets. The concentrations of seed Ca and C were higher in all fuzzless genotypes, but N, S, B, Fe, and Zn were higher in most of the fuzzy genotypes. Generally, minerals were higher in leaves of F lines, suggesting the translocation of minerals from leaves to seeds was limited. The research demonstrated that fiber development could be involved in cottonseed composition. This may be due to the involvement of fiber development in carbon and nitrogen metabolism, and the mobility of nutrients from leaves (source to seed (sink. This information is beneficial to breeders to consider fuzzless cottonseed for potential protein and oil use and select for higher oil or higher protein content, and to physiologists to further understand the mobility of minerals to increase the quality of cottonseed nutrition for
The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis
Directory of Open Access Journals (Sweden)
Muhammad Sajjad Ali
2013-07-01
Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.
Incipient resistance of Helicoverpa punctigera to the Cry2Ab Bt toxin in Bollgard II cotton.
Directory of Open Access Journals (Sweden)
Sharon Downes
Full Text Available Combinations of dissimilar insecticidal proteins ("pyramids" within transgenic plants are predicted to delay the evolution of pest resistance for significantly longer than crops expressing a single transgene. Field-evolved resistance to Bacillus thuringiensis (Bt transgenic crops has been reported for first generation, single-toxin varieties and the Cry1 class of proteins. Our five year data set shows a significant exponential increase in the frequency of alleles conferring Cry2Ab resistance in Australian field populations of Helicoverpa punctigera since the adoption of a second generation, two-toxin Bt cotton expressing this insecticidal protein. Furthermore, the frequency of cry2Ab resistance alleles in populations from cropping areas is 8-fold higher than that found for populations from non-cropping regions. This report of field evolved resistance to a protein in a dual-toxin Bt-crop has precisely fulfilled the intended function of monitoring for resistance; namely, to provide an early warning of increases in frequencies that may lead to potential failures of the transgenic technology. Furthermore, it demonstrates that pyramids are not 'bullet proof' and that rapid evolution to Bt toxins in the Cry2 class is possible.
Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.
2011-01-01
Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in
The Virescent Yellow leaf cotton line Seed Accession 30 (SA30) was crossed with four modern parental lines (DP5690, DES119, SG747 and MD51ne) to develop four sets of near isogenic lines (NILs) segregating for green and yellow leaves. Comparisons of these lines were made in the field in a two year re...
Screening of ten advanced chickpea lines for blight and wilt resistance
International Nuclear Information System (INIS)
Jamil, F.F.; Haq, I.; Sarwar, N.; Alam, S.S.; Khan, J.A.; Hanif, M.; Khan, I.A.; Sarwar, M.; Haq, M.A.
2002-01-01
Ten advanced chickpea lines developed at NIAB were screened for resistance to Ascochyta blight and Fusarium wilt diseases in different sets of experiments conducted under controlled environment. Inoculation of plants by spore suspension of virulent strains of Ascochyta rabiei revealed that one line (97313) was resistant tolerant, two lines (97305, 97392) were tolerant, six lines (97306, 97310, 97311, 97303, 97302, 97393) were tolerant/susceptible and one line (97301) was susceptible. Screening of the same lines against Fusarium wilt by water culture method showed that two lines (97301, 97313) were moderately resistant, four lines (97302, 97303, 97306, 97393) were tolerant and the remaining four lines were susceptible. Screening through phytotoxic culture filtrates revealed that two lines (97302, 97313) were less sensitive to culture filtrates of Ascochyta rabiei and Fusarium oxysporum than the resistant check (CM88). These lines were also analyzed spectrophotometrically for peroxidase enzyme activity. Maximum enzyme activity was detected after 48 hours of inoculation with A. rabiei in three lines (97305, 97311, 97313) and resistant check (CM88) while enzyme activity in the remaining lines reached its maximum after 72 hours of inoculation which was comparable to the susceptible check (Pb-1). These studies lead to the conclusion that one line (97313) exhibited resistance against both the diseases and can be used as a source of resistance for further improvement of chickpea germplasm. (author)
International Nuclear Information System (INIS)
Ahmad, S.; Hayat, K.; Ashraf, F.; Sadiq, M.A.
2008-01-01
Cotton leaf-curl virus (CLCu VB. Wala strain) is one of the major biotic constraints of cotton production in Punjab. Development of resistant cotton genotype is the most feasible, economical and effective method to combat this hazardous problem, but so far no resistant genotype has been reported. Therefore, the objective of this study was to compare yield and yield-components and fiber traits of different genotypes/varieties under different plant spacing and nitrogen fertilizer as a management strategy to cope with this viral disease. Field experiment was conducted during 2006-07 to evaluate the effect of genotype, plant spacing and nitrogen fertilizer on cotton. Five genotypes (MNH-786, MNH-789, MNH- 6070, CIM- 496, and BH-160), three plant-spacings (15, 30 and 45 cm) and three nitrogen fertilizer-levels (6.5, 8.6 and 11 bags Urea / ha) were studied. Results showed that significant differences exist for plant height, no. of bolls/m/sup -2/, seed-cotton yield (kg/ha) due to genotype, interaction of genotype with plant spacing and nitrogen fertilizer level. Whereas boll weight, ginning out-turn, staple length and fiber fineness were not affected significantly by the plant spacing and nitrogen fertilizer, the effect due to genotype was significant for these traits. CLCuV infestation varied significantly with genotypes, while all other factors, i.e., plant spacing and nitrogen fertilizers, have non-significant effect. As the major objective of cotton cultivation is production of lint for the country and seed- cotton yield for the farmers, it is noted that genotypes grown in narrow plant-spacing (15 cm) and higher nitrogen fertilizer level (11.0 bags of urea/ha) produced maximum seed-cotton yield under higher CLCu V infestation in case of CIM-496, MNH-789 and BH-I60, while the new strain MNH-6070 gave maximum yield under 30cm plant-spacing and 8.6 bags of urea/ha has the 2.3% CLCu V infestation was observed in this variety. From the present study, it is concluded that
Investigation of antibacterial activity of cotton fabric incorporating nano silver colloid
International Nuclear Information System (INIS)
Ngo Vo Ke Thanh; Nguyen Thi Phuong Phong
2009-01-01
In this work, silver nanoparticles were prepared by polyol process with microwave heating and incorporated on cotton fabric surfaces. The antibacterial performance of the antibacterial cotton fabric was tested for different concentration of nano-sized silver colloid, contact time germs, and washing times. It was found that antibacterial activity increased with the increasing concentration of nano-sized silver colloid. The antibacterial fabric with 758 mg/kg of silver nanoparticles on surface cotton was highly effective in killing test bacteria and had excellent water resisting property.
High levels of resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. We had previously determined that MIC-3 expression played a direct role in suppressing RKN egg...
Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Franco, Octávio L; Falcão, Rosana; Fragoso, Rodrigo R; Mello, Luciane V; dos Santos, Roseane C; Grossi-de-Sá, Maria F
2003-01-01
Anthonomus grandis, the cotton boll weevil, causes severe cotton crop losses in North and South America. Here we demonstrate the presence of starch in the cotton pollen grains and young ovules that are the main A. grandis food source. We further demonstrate the presence of alpha-amylase activity, an essential enzyme of carbohydrate metabolism for many crop pests, in A. grandis midgut. Two alpha-amylase cDNAs from A. grandis larvae were isolated using RT-PCR followed by 5' and 3' RACE techniques. These encode proteins with predicted molecular masses of 50.8 and 52.7kDa, respectively, which share 58% amino acid identity. Expression of both genes is induced upon feeding and concentrated in the midgut of adult insects. Several alpha-amylase inhibitors from plants were assayed against A. grandis alpha-amylases but, unexpectedly, only the BIII inhibitor from rye kernels proved highly effective, with inhibitors generally active against other insect amylases lacking effect. Structural modeling of Amylag1 and Amylag2 showed that different factors seem to be responsible for the lack of effect of 0.19 and alpha-AI1 inhibitors on A. grandis alpha-amylase activity. This work suggests that genetic engineering of cotton to express alpha-amylase inhibitors may offer a novel route to A. grandis resistance.
Problems and achievements of cotton (Gossypium Hirsutum L. weeds control
Directory of Open Access Journals (Sweden)
T. Barakova
2017-09-01
Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.
A cotton breeding program strives to identify the best performance cultivars or breeding lines which can be used as parents in crosses. Multi-cross combinations provide the means of performance of each parent and assess the combining ability or productivity of parents through the hybridization proce...
Directory of Open Access Journals (Sweden)
Michael G. Patterson
2012-11-01
Full Text Available A three year field experiment was conducted to evaluate the role of soil-inversion, cover crops and herbicide regimes for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. The main plots were two soil-inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. The subplots were three cover crop treatments: crimson clover, cereal rye and winter fallow; and sub subplots were four herbicide regimes: preemergence (PRE alone, postemergence (POST alone, PRE + POST and a no herbicide check (None. The PRE herbicide regime consisted of a single application of pendimethalin at 0.84 kg ae ha−1 plus fomesafen at 0.28 kg ai ha−1. The POST herbicide regime consisted of a single application of glufosinate at 0.60 kg ai ha−1 plus S-metolachlor at 0.54 kg ai ha−1 and the PRE + POST regime combined the prior two components. At 2 weeks after planting (WAP cotton, Palmer amaranth densities, both BR and WR, were reduced ≥90% following all cover crop treatments in the IT. In the NIT, crimson clover reduced Palmer amaranth densities >65% and 50% compared to winter fallow and cereal rye covers, respectively. At 6 WAP, the PRE and PRE + POST herbicide regimes in both IT and NIT reduced BR and WR Palmer amaranth densities >96% over the three years. Additionally, the BR density was reduced ≥59% in no-herbicide (None following either cereal rye or crimson clover when compared to no-herbicide in the winter fallow. In IT, PRE, POST and PRE + POST herbicide regimes controlled Palmer amaranth >95% 6 WAP. In NIT, Palmer amaranth was controlled ≥79% in PRE and ≥95% in PRE + POST herbicide regimes over three years. POST herbicide regime following NIT was not very consistent. Averaged across three years, Palmer amaranth controlled ≥94% in PRE and PRE + POST herbicide regimes regardless of cover crop. Herbicide regime effect on cotton yield was highly significant; the maximum cotton yield was
Structural coloration of chitosan-cationized cotton fabric using photonic crystals
Yavuz, Gonul; Zille, Andrea; Seventekin, N.; Souto, A. Pedro
2017-01-01
Abstract. In this work, poly (styrene-methyl methacrylate-acrylic acid) P(St-MMA-AA) composite nanospheres were deposited onto chitosan-cationized woven cotton fabrics followed by a second layer of chitosan. The deposited photonic crystals (PCs) on the fabrics were evaluated for coating efficiency and resistance, chemical analysis and color variation by optical and SEM microscopy, ATR-FTIR, diffuse reflectance spectroscopy and washing fastness. Chitosan deposition on cotton fab...
Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton
Directory of Open Access Journals (Sweden)
Md. Mizanur Rahman
2015-01-01
Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.
Directory of Open Access Journals (Sweden)
Xiemin Qi
2016-07-01
Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.
Directory of Open Access Journals (Sweden)
Aristide Sawdetuo Hien
Full Text Available Many studies have shown the role of agriculture in the selection and spread of resistance of Anopheles gambiae s.l. to insecticides. However, no study has directly demonstrated the presence of insecticides in breeding sources as a source of selection for this resistance. It is in this context that we investigated the presence of pesticide residues in breeding habitats and their formal involvement in vector resistance to insecticides in areas of West Africa with intensive farming. This study was carried out from June to November 2013 in Dano, southwest Burkina Faso in areas of conventional (CC and biological cotton (BC growing. Water and sediment samples collected from breeding sites located near BC and CC fields were submitted for chromatographic analysis to research and titrate the residual insecticide content found there. Larvae were also collected in these breeding sites and used in toxicity tests to compare their mortality to those of the susceptible strain, Anopheles gambiae Kisumu. All tested mosquitoes (living and dead were analyzed by PCR for species identification and characterization of resistance genes. The toxicity analysis of water from breeding sites showed significantly lower mortality rates in breeding site water from biological cotton (WBC growing sites compared to that from conventional cotton (WCC sites respective to both An. gambiae Kisumu (WBC: 80.75% vs WCC: 92.75% and a wild-type strain (49.75% vs 66.5%. The allele frequencies L1014F, L1014S kdr, and G116S ace -1R mutations conferring resistance, respectively, to pyrethroids and carbamates / organophosphates were 0.95, 0.4 and 0.12. Deltamethrin and lambda-cyhalothrin were identified in the water samples taken in October/November from mosquitoes breeding in the CC growing area. The concentrations obtained were respectively 0.0147ug/L and 1.49 ug/L to deltamethrin and lambdacyhalothrin. Our results provided evidence by direct analysis (biological and chromatographic tests
Directory of Open Access Journals (Sweden)
Xiaojie Yang
2016-10-01
Full Text Available Hybrid vigor contributes in a large way to the yield and quality of cotton (Gossypium hirsutum fiber. Although microRNAs play essential regulatory roles in flower induction and development, it is still unclear if microRNAs are involved in male sterility, as the regulatory molecular mechanisms of male sterility in cotton need to be better defined. In this study, two independent small RNA libraries were constructed and sequenced from the young buds collected from the sporogenous cell formation to the meiosis stage of the male sterile line Yu98-8A and the near-isogenic line. Sequencing revealed 1588 and 1536 known microRNAs and 347 and 351 novel miRNAs from male sterile and male fertile libraries, respectively. MicroRNA expression profiles revealed that 49 conserved and 51 novel miRNAs were differentially expressed. Bioinformatic and degradome analysis indicated the regulatory complexity of microRNAs during flower induction and development. Further RT-qPCR and physiological analysis indicated that, among the different Kyoto Encyclopedia Gene and Genomes pathways, indole-3-acetic acid and gibberellic acid signaling transduction pathways may play pivotal regulatory functions in male sterility.
International Nuclear Information System (INIS)
Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.
2013-01-01
Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)
Radiation mutagenesis in development of genetic fundamentals of cotton selection
International Nuclear Information System (INIS)
Musaev, D.A.; Almatov, A.S.
1987-01-01
Some results of investigations on preparation and genetic analysis of mutants in inbreeding lines of genetic collections of cotton plants, as well as problems on mutant application in practical selection are covered. The results show that the scientific authenticity and efficiency of fundamental and applied investigations in the field of experimental mutagenesis of cotton plants,being a facultative self-polinator, depend on keeping necessary methodical requirements. Application of inbreeding lines of genetic collection with marker features as the initial material, isolation of plants usinng self-polination of flowers on all stages of investigation are related to these requirements. Several methodical recommendations on genetic-selective investigations are developed
Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia
2015-01-01
RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control.
Zhen, Congai; Gao, Xiwu
2016-02-01
In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.
Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.
Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara
2014-06-01
Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.
An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...
Role of secondary metabolites biosynthesis in resistance to cotton ...
African Journals Online (AJOL)
Secondary metabolites production in healthy and diseased sample of leaves of cotton varieties after the attack of CLCuV found maximum phenolics, carotenoids, chlorophyll a, chlorophyll b and total chlorophyll a and b in healthy sample and minimum contents present in diseased sample. CIM-446 was the best variety to ...
Directory of Open Access Journals (Sweden)
FRANCISCO S. RAMALHO
2017-12-01
Full Text Available ABSTRACT The host acceptance behavior and environmental factors as temperature affect the feeding behavior of Lepidoptera pests. Thus, they must be considered in studies about the risk potential of resistance evolution. The current study sets the differences in the feeding behavior of neonate Alabama argillacea (Hübner (Lepidoptera: Noctuidae larvae exposed to Bt and non-Bt cotton plants, under different temperatures and time gap after hatching. Two cotton cultivars were used: the Bt (DP 404 BG - bollgard and the non-transformed isoline, DP 4049. We found that the feeding behavior of neonate A. argillacea is significantly different between Bt and non-Bt cotton. Based on the number of larvae with vegetal tissue in their gut found on the plant and in the organza as well as on the amount of vegetal tissue ingested by the larvae. A. argillacea shows feeding preference for non-Bt cotton plants, in comparison to that on the Bt. However, factors such as temperature and exposure time may affect detection capacity and plant abandonment by the larvae and it results in lower ingestion of vegetal tissue. Such results are relevant to handle the resistance of Bt cotton cultivars to A. argillacea and they also enable determining how the cotton seeds mix will be a feasible handling option to hold back resistance evolution in A. argillacea populations on Bt cotton, when it is compared to other refuge strategies. The results can also be useful to determine which refuge distribution of plants is more effective for handling Bt cotton resistance to A. argillacea.
Genomics-enabled analysis of the emergent disease cotton bacterial blight.
Directory of Open Access Journals (Sweden)
Anne Z Phillips
2017-09-01
Full Text Available Cotton bacterial blight (CBB, an important disease of (Gossypium hirsutum in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars.
Performance of cotton leaf curl virus resistant intrahirsutum f/sub 1/ hybrids
International Nuclear Information System (INIS)
Baloch, M.J.
2004-01-01
The first and foremost effort to combat the devastating cotton leaf curl virus (clcv) disease would be to utilize those clcv resistant germplasm in a hybridization programme which can enhance the possibilities of selecting desirable progenies from segregating populations. In this connection, 16 clcv intrahirsutum F1 hybrids were developed and evaluated for their performance. The hybrids, on an average gave an increase of 26.02 % in seed cotton yield; 11.52 % in bolls per plant; 14.23 % in boll weight; 4.28 % in lint; 3.89 % in fibre length and 8.21 % in earliness against the average of parents. However, among the hybrids, the top three scoring for yield were, BH.121 x Cyto.9/91, Cyto.9/91 x CRIS-226 and VH-137 x CRIS-226. The number of bolls per plant was found to be a major contributing factor for increased yield because the hybrids which set higher bolls correspondingly gave higher yields. Boll weight was not regarded as an important attribute to increase yield because hybrids with moderate boll sizes were among the top three high yielders. For lint %, the hybrids CRIS-129 x LRA-5166 and FH-901 x VH-137 were first for fibre length, whereas CRIS-121 x Cyto.51 and BH-124 x CIM-448 were among the top two rankers. Regarding earliness, the hybrids CRIS-121 x Cyto. 51 gave the highest boll opening percent and next in order was the hybrid VH-137 x DNH-49. Our results thus generally suggest that although the best three hybrids were desirable for other traits, the choice of the hybrids may be made on the priority for characters to be bred. (author)
Major quantitative trait loci (QTL) have been mapped to Upland cotton (Gossypium hirsutum L.) chromosomes 11 and 14 that govern the highly resistant phenotype in response to infection by root-knot nematode (RKN; Meloidogyne incognita Chitwood & White); however, nearly nothing is known regarding the ...
Effects of 1,1-Dimethylpiperidinium Chloride on the Pests and Allelochemicals of Cotton and Pecan.
P. A. Hedin; J. N. Jenkins; J. C. McCarty; J. E. Mulrooney; W. L. Parrott; A. Borazjani; C. H. Graves; T. H. Filer
1984-01-01
The growth regulator, PIX (mepiquat chloride - 1,1-dimethyl-piperdinium chloride), when applied to cotton (Gossypium hirsutum L.) and pecan (Carya illinoensis Koch), caused internode shortening. PIX did not elicit an increase in resistance in cotton to the tobacco budworm (Heliothis virescens (Fab.)], or in pecan...
Developing Cotton IPM by Conserving Parasitoids and Predators of The Main Pest
Directory of Open Access Journals (Sweden)
Nurindah Nurindah
2015-09-01
Full Text Available On early development of intensive cotton program, insect pests were considered as an important aspect in cotton cultivation, so that it needed to be scheduled sprays. The frequency of sprays was 7 times used 12L of chemical insecticides per hectare per season. Development of cotton IPM was emphasized on non-chemical control methods through optimally utilize natural enemies of the cotton main pests (Amrasca biguttulla (IshidaHelicoverpa armigera (Hübner. Conservation of parasitoids and predators by providing the environment that support their population development is an act of supporting the natural enemies as an effective biotic mortality factor of the insect pests. The conservation could be done by improving the plant matter and cultivation techniques that include the use of resistant variety to leafhopper, intercropping cotton with secondary food plants, mulch utilization, using action threshold that considered the presence of natural enemies, and application of botanical insecticides, if needed. Conservation of parasitoids and predators in cotton IPM could control the insect pests without any insecticide spray in obtaining the production of cotton seed. As such, the use of IPM method would increase farmers’ income.
Correlations and Correlated Responses in Upland Cotton (Gossypium hirsutum L.
Directory of Open Access Journals (Sweden)
Echekwu, CA.
2001-01-01
Full Text Available Plant breeders must be concerned with the total array of economic characters in their efforts to develop a crop variety acceptable to farmers. Their selection endeavours must therefore take into consideration how changes in one trait affect, simultaneously changes in other economic attributes. The importance of correlations and correlated responses is therefore self evident in plant breeding endeavours. In this study F3 progenies from a cross between two cotton lines SAMCOT-9 x Y422 were evaluated for two years and performance data were used to obtain correlations between nine agronomic and fibre quality traits in upland cotton. The results indicated that plant helght was significantly and positively correlated with seed cotton yield, number of sympodial and monopodial branches, seed index, fibre length and micronaire index. Positive and significant correlations were also obtained between : seed cotton yield, tint percent and fibre strength and fibre length. Significant negative correlations were obtained between : plant height and lint percent ; number of monopodial branches, sympodial branches and lint percent ; fibre length, fibre strength and micronaire index. The correlated responses in the other eight traits when selection was practiced for seed cotton yield in the present study shows that it might be more profitable to practice direct selection for seed cotton yield compared to selecting for seed cotton yield through any of the other traits.
Resistance of Advanced Soybean Lines to Pod Borrer (Etiella zinckenella
Directory of Open Access Journals (Sweden)
Heru Kuswantoro
2017-07-01
Full Text Available The increasing and stabilizing of soybean product in Indonesia face many limitations. One of the limiting factors is pod borrer (Etiella zinckenella Treitschke infestation that is able to cause yield loss up to 80%. Objective of the research was to find out some advanced soybean lines that resistant to pod borrer. Design was randomized complete block with three replications. Soybean lines were grown gradualy to ensure the simultanously flowering. The plants were caged at 35 days after planting (DAT and infested with the imago of E. zinckenella at 56 DAT. Results showed that different soybean lines affected imago population, eggs population, larvae population, infected pods and infected seeds. Some genotypes were consistantly resistant to E. zinckenella. The resistance of those genotypes were non preference resistance based on eggs population, larvae population, infected pod and infected seeds. This study discovered nine soybean lines that is resistant to E. zinckenella, so that it can be beneficial for improving soybean resistance to this pest through releasing as a new resistant pod borer variety after tested further in potential yield and genetic x environment interaction trials. In addition, there were three varieties and two germplasm accessions that can be used as gene sources for improving the resistance of the varieties. The three varieties are able to be cultivated directly in field to decrease the E. zinckenella occurrence.
Cotton fabrics with UV blocking properties through metal salts deposition
International Nuclear Information System (INIS)
Emam, Hossam E.; Bechtold, Thomas
2015-01-01
Graphical abstract: - Highlights: • Introducing metal salt based UV-blocking properties into cotton fabric. • A quite simple technique used to produce wash resistant UV-absorbers using different Cu-, Zn- and Ti-salts. • Good UPF was obtained after treatment with Cu and Ti salts, and ranged between 11.6 and 14. • The efficiency of the deposited metal oxides is compared on molar basis. - Abstract: Exposure to sunlight is important for human health as this increases the resistance to diverse pathogens, but the higher doses cause skin problems and diseases. Hence, wearing of sunlight protective fabrics displays a good solution for people working in open atmosphere. The current study offered quite simple and technically feasible ways to prepare good UV protection fabrics based on cotton. Metal salts including Zn, Cu and Ti were immobilized into cotton and oxidized cotton fabrics by using pad-dry-cure technique. Metal contents on fabrics were determined by AAS; the highest metal content was recorded for Cu-fabric and it was 360.6 mmol/kg after treatment of oxidized cotton with 0.5 M of copper nitrate. Ti contents on fabrics were ranged between 168.0 and 200.8 mmol/kg and it showed the lowest release as only 38.1–46.4% leached out fabrics after five laundry washings. Metal containing deposits were specified by scanning electron microscopy and energy dispersive X-ray spectroscopy. UV-transmission radiation over treated fabrics was measured and ultraviolet protection factor (UPF) was calculated. UPF was enhanced after treatment with Cu and Ti salts to be 11.6 and 14, respectively. After five washings, the amount of metal (Cu or Ti) retained indicates acceptable laundering durability.
Yellow Rust Resistance in Advanced Lines and Commercial ...
African Journals Online (AJOL)
The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...
Robert, Christopher E; Jiang, Jimmy J; Khoury, Joseph G
2011-03-01
Distal forearm fractures, one of the most common fractures seen in the pediatric population, are regularly treated by closed reduction and casting. Our study investigates the effectiveness of Gore-Tex-lined casting in maintaining the reduction of 100% displaced distal forearm fractures compared with traditional cotton-lined casts. We screened all patients from February 2007 to July 2009 who presented to Children's Hospital in Birmingham, AL with a distal radius fracture. Only patients with 100% displaced distal radius fractures were eligible to be assigned to either the cotton-lined or Gore-Tex-lined cast groups. Power analysis was performed to identify an adequate patient sample size. The mean maximum change between initial post-reduction x-rays and follow-up x-rays for anterior-posterior (AP) angulation, AP displacement, lateral angulation, and lateral displacement of the radius were calculated for both cotton and Gore-Tex groups. The rate of subsequent intervention and/or unacceptable results for each group was also analyzed. Seven hundred and twenty-two patients were treated with distal radius fractures at our hospital with 59 patients eligible for inclusion in our study. Thirty-six of our patients were treated with cotton-lined casts, and 23 patients were treated with Gore-Tex-lined cast. The mean maximum change in AP angulation, AP displacement, lateral angulation, and lateral displacement of the radius after initial reduction was 9.2 degrees, 6.9%, 13.9 degrees, and 13.6%, respectively, for the cotton-lined cast group and 7.7 degrees, 6.1%, 14.6 degrees, and 9.6%, respectively, for the Gore-Tex-lined cast group. There were no statistical differences between the means of the 4 measurements (P=0.33, 0.69, 0.73, and 0.10, respectively). There were also no significant differences between groups for final AP and lateral angulation and displacement. Subgroup analysis showed no significant differences in all measurements between cotton and Gore-Tex groups. Gore
Directory of Open Access Journals (Sweden)
Charles Q. Yang
2016-09-01
Full Text Available Blending Nomex® with cotton improves its affordability and serviceability. Because cotton is a highly flammable fiber, Nomex®/cotton blend fabrics containing more than 20% cotton require flame-retardant treatment. In this research, combination of a hydroxyl functional organophosphorus oligmer (HFPO and 1,2,3,4-butanetetracarboxylic acid (BTCA was used for flame retardant finishing of the 65/35 Nomex®/cotton blend woven fabric. The system contains HFPO as a flame retardant, BTCA as a bonding agent, and triethenolamine (TEA as a reactive additive used to enhance the performance of HFPO/BTCA. Addition of TEA improves the hydrolysis resistance of the HFPO/BTCA crosslinked polymeric network on the blend fabric. Additionally, TEA enhances HFPO’s flame retardant performance by reducing formation of calcium salts and also by providing synergistic nitrogen to the treated blend fabric. The Nomex®/cotton blend fabric treated with the HFPO/BTCA/TEA system shows high flame resistance and high laundering durability at a relatively low HFPO concentration of 8% (w/w. The heat release properties of the treated Nomex®/cotton blend fabric were measured using microscale combustion calorimetry. The functions of BTCA; HFPO and TEA on the Nomex®/cotton blend fabric were elucidated based on the heat release properties, char formation, and fire performance of the treated blend fabric.
Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.
2013-01-01
A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable
Directory of Open Access Journals (Sweden)
Yunyu Wu
2017-12-01
Full Text Available The development of resistant varieties and hybrid combinations has been the most effective and economical strategy to control blast disease caused by Magnaporthe oryzae. However, the distribution of major R genes and blast resistance characterization in hybrid rice parents has not been well investigated, resulting in their limited use in hybrid rice blast-resistance breeding. In the present study, 88 elite indica hybrid rice parental lines were evaluated with 30 isolates of M. oryzae collected from the main planting area of indica hybrid rice in China and were characterized for the presence of 11 major resistance genes using molecular markers. The pathogenicity assays showed that four types of hybrid rice parent line showed some resistance to M. oryzae. However, the proportions of highly resistant lines and the mean resistance frequency (RF varied among the four types, with resistance in decreasing order shown by three-line restorer lines, three-line maintainer lines, two-line sterile lines, and two-line restorer lines. All 88 hybrid rice parental lines carried more than one R gene, but none carried the R genes Pi1 and Pi2. Although Pid3 and Pi9 were present only in three-line restorer lines and Pigm only in three-line maintainer lines, the remaining six R genes (Pib, Pid2, Pi5, Pia, Pi54, and Pita were present in the four types of hybrid rice parent with significantly different distribution frequencies. The correlation between R genes and resistance reactions was investigated. The results are expected to provide useful information for rational utilization of major R genes in hybrid rice breeding programs. Keywords: Hybrid rice parental lines, Magnaporthe oryzae, Pi genes, Resistance evaluation, Molecular markers
Lodging resistant pea line derived after mutagenic treatment
International Nuclear Information System (INIS)
Naidenova, N.; Vassilevska-Ivanova, R.
2006-01-01
Line 1/502 is a new lodging resistant pea ( Pisum sativum L.) developed for the Bulgarian field pea industry. This line is a direct chlorophyll mutant, which originates after treatment of the initial line, cultivar Auralia, with 150 Gy 60 Co γ - radiation. In regional evaluation trials conducted in Sofia over seven successive seasons 1/502 has revealed improved standing ability that most probably is a result from modification of the architecture of the plants appearing in reduction of plant height. The agronomic and morphological characteristics of the mutant line were reported. The upright plant habit and resistance to lodging is especially beneficial for production of high quality peas because pods are held above the soil surface during crop development and during maturity which aids in keeping the peas clean and free of pathogens that can cause discoloration and rotting. (authors)
Cheng Fang; Bruce A. Babcock
2003-01-01
In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...
Fabrication of superhydrophobic cotton fabrics using crosslinking polymerization method
Jiang, Bin; Chen, Zhenxing; Sun, Yongli; Yang, Huawei; Zhang, Hongjie; Dou, Haozhen; Zhang, Luhong
2018-05-01
With the aim of removing and recycling oil and organic solvent from water, a facile and low-cost crosslinking polymerization method was first applied on surface modification of cotton fabrics for water/oil separation. Micro-nano hierarchical rough structure was constructed by triethylenetetramine (TETA) and trimesoyl chloride (TMC) that formed a polymeric layer on the surface of the fabric and anchored Al2O3 nanoparticles firmly between the fabric surface and the polymer layer. Superhydrophobic property was further obtained through self-assembly grafting of hydrophobic groups on the rough surface. The as-prepared cotton fabric exhibited superoleophilicity in atmosphere and superhydrophobicity both in atmosphere and under oil with the water contact angle of 153° and 152° respectively. Water/oil separation test showed that the as-prepared cotton fabric can handle with various oil-water mixtures with a high separation efficiency over 99%. More importantly, the separation efficiency remained above 98% over 20 cycles of reusing without losing its superhydrophobicity which demonstrated excellent reusability in oil/water separation process. Moreover, the as-prepared cotton fabric possessed good contamination resistance ability and self-cleaning property. Simulation washing process test showed the superhydrophobic cotton fabric maintained high value of water contact angle above 150° after 100 times washing, indicating great stability and durability. In summary, this work provides a brand-new way to surface modification of cotton fabric and makes it a promising candidate material for oil/water separation.
Impact of Bollgard cotton on Indian cotton production and Income of ...
Indian Academy of Sciences (India)
Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.
Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad
2018-01-05
Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Kozawa, Takahiro; Oizumi, Hiroaki; Itani, Toshiro; Tagawa, Seiichi
2010-11-01
The development of extreme ultraviolet (EUV) lithography has progressed owing to worldwide effort. As the development status of EUV lithography approaches the requirements for the high-volume production of semiconductor devices with a minimum line width of 22 nm, the extraction of resist parameters becomes increasingly important from the viewpoints of the accurate evaluation of resist materials for resist screening and the accurate process simulation for process and mask designs. In this study, we demonstrated that resist parameters (namely, quencher concentration, acid diffusion constant, proportionality constant of line edge roughness, and dissolution point) can be extracted from the scanning electron microscopy (SEM) images of patterned resists without the knowledge on the details of resist contents using two types of latest EUV resist.
Impact of efficient refuge policies for Bt cotton in India on world cotton trade
Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.
2010-01-01
India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...
Screening Pakistani cotton for drought tolerance
International Nuclear Information System (INIS)
Soomro, M.H.; Markhand, G.S.
2011-01-01
The drought is one of the biggest abiotic stresses for crop production in arid and semi-arid agriculture. Thus it is a challenge for plant scientists to screen and develop the drought tolerant cotton lines. In this study, 31 cotton genotypes/cultivars were evaluated under two irrigation regimes i. e., seven irrigations (Control) and two irrigations (Stress), using split plot design with four replications. The crop growth, yield and some physiological parameters were studied. There were high inter-varietal differences for all the parameters under control as well as drought stress. Although all the varieties for all parameters were significantly affected by drought but however, CRIS-9, MARVI, CRIS-134, CRIS-126, CRIS-337, CRIS-355 and CRIS-377 maintained highest performance for all the parameters studied under high drought conditions. (author)
The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...
International Nuclear Information System (INIS)
Haidar, S.; Khan, I.A.; Mansoor, S.
2002-01-01
In both M1 and M2 plant height decreased with the increase in dose for both the mutagens. The 15 Krad and 0.15M EMS doses increased 122.7 and 128.3 gm seed cotton yield as compared to control respectively while all other doses of both mutagens decreased the yield of seed cotton. The EMS dose 0.10 M drastically decreased 184 gm seed cotton yield as compared to control. There was no larger effect of both mutagens on GOT % whereas staple length was slightly increased and micronaire value decreased as compared to control for all the doses of both mutagens. It was observed in M2 that mutation dose 10 Krad increased 165.6 gm seed cotton yield as compared to control but slight reduction in GOT % was observed. In M2 GOT were increased 3.5 % with 15 Krad and 3.6 % with EMS 0.10 M as compared to control. There were no larger effects for both mutagens in case of staple length, micronaire and uniformity ratio for all the doses as compared to control. respectively. In both M1 and M2 no plant was observed susceptible to cotton leaf curl virus and bacterial blight diseases of cotton
Carter, William W.
1981-01-01
Gossypium arboreum 'Nanking CB 1402' possessed a high level of resistance to Rotylenchulus reniformis. Within 16 h, the nematode penetrated roots of resistant and susceptible cottons equally. After 36 h, significantly fewer nematodes were found in resistant roots. Larvae fed in either an endodermal or pericyclic cell and had no specificity for root tissue of a particular age. In roots of resistant G. arboreum '1402,' wall breakdown of pericyclic cells was evident after 3 d, endodermal and cortical cells collapsed, and the hypertrophied pericyclic cells disintegrated within 12 d. Cell walls immediately adjacent to the nematode's head were thickened and more safranin positive in resistant than in susceptible cotton cultivars. Several other cultivars of G. arboreum were also resistant to R. reniformis, based on nematode fecundity and percent egg reduction. PMID:19300777
Stelescu, Maria Daniela; Manaila, Elena; Nicula, Gheorghe; Iordache, Ovidiu; Dinca, Laurentiu Christian; Berechet, Mariana-Daniela; Vamesu, Mariana; Gurau, Dana
2014-01-01
This paper presents the improvement of the antimicrobial character of woven fabrics based on cotton. The woven fabrics were cleaned in oxygen plasma and treated by padding with silver chloride and titanium dioxide particles. The existence of silver and titanium on woven fabrics was evidenced by electronic microscope images (SEM, EDAX) and by flame atomic absorption spectrophotometry. The antimicrobial tests were performed with two fungi: Candida albicans and Trichophyton interdigitale. The obtained antimicrobial effect was considerably higher compared to the raw fabrics. Treatment of dyed fabrics with a colloidal solution based on silver chloride and titanium dioxide particles does not considerably influence colour resistance of dyes. PMID:25276112
Directory of Open Access Journals (Sweden)
VIVIAN M. RUMJANEK
2001-03-01
Full Text Available Multidrug resistance to chemotherapy is a major obstacle in the treatment of cancer patients. The best characterised mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein. However, the resistance process is multifactorial. Studies of multidrug resistance mechanisms have relied on the analysis of cancer cell lines that have been selected and present cross-reactivity to a broad range of anticancer agents. This work characterises a multidrug resistant cell line, originally selected for resistance to the Vinca alkaloid vincristine and derived from the human erythroleukaemia cell K562. This cell line, named Lucena 1, overexpresses P-glycoprotein and have its resistance reversed by the chemosensitisers verapamil, trifluoperazine and cyclosporins A, D and G. Furthermore, we demonstrated that methylene blue was capable of partially reversing the resistance in this cell line. On the contrary, the use of 5-fluorouracil increased the resistance of Lucena 1. In addition to chemotherapics, Lucena 1 cells were resistant to ultraviolet A radiation and hydrogen peroxide and failed to mobilise intracellular calcium when thapsigargin was used. Changes in the cytoskeleton of this cell line were also observed.A resistência a múltiplos fármacos é o principal obstáculo no tratamento de pacientes com câncer. O mecanismo responsável pela resistência múltipla mais bem caracterizado envolve a expressão do produto do gene MDR-1, a glicoproteína P. Entretanto, o processo de resistência tem fatores múltiplos. Estudos de mecanismos de resistência m��ltipla a fármacos têm dependido da análise de linhagens celulares tumorais que foram selecionadas e apresentam reatividade cruzada a uma ampla faixa de agentes anti-tumorais. Este trabalho caracteriza uma linhagem celular com múltipla resistência a fármacos, selecionada originalmente pela resistência ao alcalóide de Vinca vincristina e derivado
Comparison of airway measurements during influenza-induced tachypnea in infant and adult cotton rats
Directory of Open Access Journals (Sweden)
Prince Gregory A
2009-06-01
Full Text Available Abstract Background Increased respiratory rate (tachypnea is frequently observed as a clinical sign of influenza pneumonia in pediatric patients admitted to the hospital. We previously demonstrated that influenza infection of adult cotton rats (Sigmodon hispidus also results in tachypnea and wanted to establish whether this clinical sign was observed in infected infant cotton rats. We hypothesized that age-dependent differences in lung mechanics result in differences in ventilatory characteristics following influenza infection. Methods Lung tidal volume, dynamic elastance, resistance, and pleural pressure were measured in a resistance and compliance system on mechanically-ventilated anesthestized young (14–28 day old and adult (6–12 week old cotton rats. Animals at the same age were infected with influenza virus, and breathing rates and other respiratory measurements were recorded using a whole body flow plethysmograph. Results Adult cotton rats had significantly greater tidal volume (TV, and lower resistance and elastance than young animals. To evaluate the impact of this increased lung capacity and stiffening on respiratory disease, young and adult animals were infected intra-nasally with influenza A/Wuhan/359/95. Both age groups had increased respiratory rate and enhanced pause (Penh during infection, suggesting lower airway obstruction. However, in spite of significant tachypnea, the infant (unlike the adult cotton rats maintained the same tidal volume, resulting in an increased minute volume. In addition, the parameters that contribute to Penh were different: while relaxation time between breaths and time of expiration was decreased in both age groups, a disproportionate increase in peak inspiratory and expiratory flow contributed to the increase in Penh in infant animals. Conclusion While respiratory rate is increased in both adult and infant influenza-infected cotton rats, the volume of air exchanged per minute (minute volume is
Distribution and Potential Impact of Feral Cotton on the ...
African Journals Online (AJOL)
Transgenic Bt cotton with insecticidal properties presents a potential solution to the bollworm infestation in Tanzania. However, concerns associated with transgenic crops viz.; transgene flow to wild and feral relatives, increased potential for resistance evolution, need to be addressed prior to adoption of any transgenic crop.
What are farmers really planting? Measuring the presence and effectiveness of Bt cotton in Pakistan.
Directory of Open Access Journals (Sweden)
David J Spielman
Full Text Available Genetically modified, insect-resistant Bacillus thuringiensis (Bt cotton is cultivated extensively in Pakistan. Past studies, however, have raised concerns about the prevalence of Bt cotton varieties possessing weak or nonperforming insect-resistance traits conferred by the cry gene. We examine this issue using data drawn from a representative sample of cotton-growing households that were surveyed in six agroclimatic zones spanning 28 districts in Pakistan in 2013, as well as measurements of Cry protein levels in cotton tissue samples collected from the sampled households' main fields. The resultant dataset combines information from 593 sampled households with corresponding plant tissue diagnostics from 70 days after sowing, as well as information from 589 sampled households with corresponding diagnostics from 120 days after sowing. Our analysis indicates that 11 percent of farmers believed they were cultivating Bt cotton when, in fact, the Cry toxin was not present in the tested tissue at 70 days after sowing (i.e., a Type I error. The analysis further indicates that 5 percent of farmers believed they were cultivating non-Bt cotton when, in fact, the Cry toxin was present in the tested tissue (i.e., a Type II error. In addition, 17 percent of all sampled farmers were uncertain whether or not they were cultivating Bt cotton. Overall, 33 percent of farmers either did not know or were mistaken in their beliefs about the presence of the cry gene in the cotton they cultivated. Results also indicate that toxic protein levels in the plant tissue samples occurred below threshold levels for lethality in a significant percentage of cases, although these measurements may also be affected by factors related to tissue sample collection, handling, storage, and testing procedures. Nonetheless, results strongly suggest wide variability both in farmers' beliefs and in gene expression. Such variability has implications for policy and regulation in Pakistan
Jang, Wonjun; Chung, Il Jun; Kim, Junwoo; Seo, Seongmin; Park, Yong Tae; Choi, Kyungwho
2018-05-01
In this study, thin films containing poly(vinyl alcohol) (PVA) and graphene nanoplatelets (GNPs), stabilized with poly(4-styrene-sulfonic acid) (PSS), were assembled by a simple and cost-effective layer-by-layer (LbL) technique in order to introduce the anti-flammability to cotton. These antiflammable layers were characterized by using UV-vis spectrometry and quartz crystal microbalance as a function of the number of bilayers deposited. Scanning electron microscopy was used to visualize the morphology of the thin film coatings on the cotton fabric. The graphene-polymer thin films introduced anti-flammable properties through thermally stable carbonaceous layers at a high temperature. The thermal stability and flame retardant property of graphene-coated cotton was demonstrated by thermogravimetric analysis, cone calorimetry, and vertical flame test. The results indicate that LbL-assembled graphene-polymer thin films can be applied largely in the field of flame retardant.
THE POTENTIAL IMPACTS OF THE PORT OF SALVADOR IMPROVEMENTS ON THE BRAZILIAN COTTON INDUSTRY
Directory of Open Access Journals (Sweden)
Rafael Costa
2015-01-01
Full Text Available A spatial price equilibrium model of the international cotton sector was used to analyze the impacts of the Port of Salvador improvements on the Brazilian cotton industry and world cotton trade. The port of Salvador is undergoing relevant improvements in its facilities and physical structure. As a result of these improvements, the port of Salvador is expected to become more competitive and attract ocean shipping companies which are willing to export products directly to Asian importing markets. Scenarios with different reduction in export cost for the port of Salvador were examined. For all scenarios, the new direct ocean shipping lines were found to be important for the cotton exporters in Brazil, especially for the producers in the state of Bahia. In addition, results suggested that the state of Bahia would have the potential of becoming the largest cotton exporting state in Brazil.
Selection of wheat lines with resistance to Fusarium graminearum by somaclonal variation
International Nuclear Information System (INIS)
Sun Guangzu
1997-10-01
The screening wheat new lines which have the resistance to Fusarium graminearum were completed by in vitro induced mutation and cell screening. Four new lines with resistance to Fusarium graminearum were obtained. The field inoculating determination in 1990∼1996 showed that their resistance was 1∼2 degree higher than that of parents, and there were variations in main agronomic traits between the new lines and their parents. Changes of the defensive enzymes (SOD, POD), sugar-protein on cell surface, and ultrastructure were investigated by using new lines and their parents under the action of toxin of Fusarium graminearum. The new lines under the action of toxin of Fusarium graminearum have the ability to increase the defensive enzyme activity and thickness of sugarprotein on cell surface and to reduce the damage of cell membrane system that would result in resistance increasing. (8 refs., 3 figs., 3 tabs.)
The performance of cutinase and pectinase in cotton scouring
Agrawal, Pramod
2005-01-01
Advances in biotechnology and enzymology have brought new lines of research and have accelerated the development of enzymatic applications in wet textile processing for now nearly one decade. Amongst the various stages of cotton preparation, wet textile processing is a highly energy, water and
International Nuclear Information System (INIS)
Murty, B.R.; Thakur, S.R.; Prakash, N.; Mehta, S.L.; Bhakta, S.T.
1983-01-01
Under the need to rescue hybrid pearl millet cultivation in India from devastating damage by downy mildew, a mutation induction project was started in 1971 to make the commonly used male sterile parent Tift 23A resistant to the disease. Simultaneously sources of resistance from West Africa were used in crossbreeding by which climatic adaptation and male sterility had to be transferred. A number of mildew-resistant hybrids were developed, both from induced mutation and introduction. The resistant male sterile lines were further examined as to their common features and differences from susceptible lines. A strong evidence for nuclear-cytoplasmic interaction was obtained by biochemical and ultrastructural investigations. (author)
Cotton (Gossypium hirsutum L.) producers in Alabama and across the Cotton Belt are faced with a rapidly expanding problem that decreases yields and increases production costs: herbicide-resistant weeds. Producers are increasingly relying on production methods that raise production costs, such as add...
Directory of Open Access Journals (Sweden)
Francisco das Chagas Vidal Neto
2008-02-01
Full Text Available Os efeitos de caracteres mutantes morfológicos do algodoeiro (Gossypium hirsutum L. r. latifolium Hutch.: folha okra, bráctea frego e planta vermelha, em relação à resistência à mosca-branca (Bemisia tabaci biótipo B Hemiptera: Aleyrodidae, foram avaliados em experimentos com ou sem chance de escolha. Os experimentos foram conduzidos em casa-de-vegetação, no delineamento de blocos ao acaso, em fatorial 23 + 1, com quatro repetições. O mutante com a característica planta vermelha foi menos atrativo e menos preferido para oviposição, em relação à planta verde, em ambos os ensaios, com ou sem escolha. Não houve preferência quanto à forma da folha e ao tipo de bráctea.The effects of cotton lines (Gossypium hirsutum L. r. latifolium Hutch. with mutants morphologic characteristics: okra leaf, frego bract and red plant in relation to host plant resistance to whitefly (Bemisia tabaci bioyipe B Hemiptera: Aleyrodidae, were evaluated in choice or no choice assays. The assays were carried out in the greenhouse conditions, according to a completely randomized block design, in a 23 + 1 in a factorial arrangement with four replications. The mutant with red plant characteristic was less attractive and less preferred for oviposition than the normal green plant does, in both, whit or without choice tests. It did not have preference in relation to the form of the leaf and bract type.
International Nuclear Information System (INIS)
Cheng Beijiu; Tian Qiuyuan; Li Zhan; Zhou Liren
1996-01-01
The exogenous DNAs of G. Bickll P. and H. Cannabinus were introduced into the upland cotton Si 2 by Ar + implantation and DNA solution trickling method. The results showed that the exogenous DNA introduction was promoted significantly and the types and frequencies of character variation in progeny were increased by Ar + implantation. Furthermore, most of the variation tend to be stable. Among the Ar + implantation doses tested, 2 x 10 15 Ar + /cm 2 was the best for introducing exogenous DNA and inducing character variation, the variation rate reached to 16.2%. Some new lines with character of resistance to wilt disease, early maturity, few gland in seed and fine fiber quality have been obtained
Rastrojo, Alberto; García-Hernández, Raquel; Vargas, Paola; Camacho, Esther; Corvo, Laura; Imamura, Hideo; Dujardin, Jean-Claude; Castanys, Santiago; Aguado, Begoña; Gamarro, Francisco; Requena, Jose M
2018-04-13
Leishmaniasis is a serious medical issue in many countries around the World, but it remains largely neglected in terms of research investment for developing new control and treatment measures. No vaccines exist for human use, and the chemotherapeutic agents currently used are scanty. Furthermore, for some drugs, resistance and treatment failure are increasing to alarming levels. The aim of this work was to identify genomic and trancriptomic alterations associated with experimental resistance against the common drugs used against VL: trivalent antimony (Sb III , S line), amphotericin B (AmB, A line), miltefosine (MIL, M line) and paromomycin (PMM, P line). A total of 1006 differentially expressed transcripts were identified in the S line, 379 in the A line, 146 in the M line, and 129 in the P line. Also, changes in ploidy of chromosomes and amplification/deletion of particular regions were observed in the resistant lines regarding the parental one. A series of genes were identified as possible drivers of the resistance phenotype and were validated in both promastigotes and amastigotes from Leishmania donovani, Leishmania infantum and Leishmania major species. Remarkably, a deletion of the gene LinJ.36.2510 (coding for 24-sterol methyltransferase, SMT) was found to be associated with AmB-resistance in the A line. In the P line, a dramatic overexpression of the transcripts LinJ.27.T1940 and LinJ.27.T1950 that results from a massive amplification of the collinear genes was suggested as one of the mechanisms of PMM resistance. This conclusion was reinforced after transfection experiments in which significant PMM-resistance was generated in WT parasites over-expressing either gene LinJ.27.1940 (coding for a D-lactate dehydrogenase-like protein, D-LDH) or gene LinJ.27.1950 (coding for an aminotransferase of branched-chain amino acids, BCAT). This work allowed to identify new drivers, like SMT, the deletion of which being associated with resistance to AmB, and the tandem D
Alleles conferring improved fiber quality from EMS mutagenesis of elite cotton genotypes
The elite gene pool of cotton (Gossypium spp.) has less diversity than those of most other major crops, making identification of novel alleles important to ongoing crop improvement. A total of 3,164 M5 lines resulting from ethyl methanesulfonate mutagenesis of two G. hirsutum breeding lines, TAM 94L...
Khan, Muhammad Azmat Ullah; Shahid, Ahmad Ali; Rao, Abdul Qayyum; Bajwa, Kamran Shehzad; Samiullah, Tahir Rehman; Muzaffar, Adnan; Nasir, Idrees Ahmad; Husnain, Tayyab
2015-12-01
Gossypium arboreumis resistant to Cotton leaf curl Burewala virus and its cognate Cotton leaf curl Multan beta satellite ( CLCuBuV and CLCuMB ). However, the G. arboreum wax deficient mutant (GaWM3) is susceptible to CLCuV . Therefore, epicuticular wax was characterized both quantitatively and qualitatively for its role as physical barrier against whitefly mediated viral transmission and co-related with the titer of each viral component (DNA-A, alphasatellite and betasatellite) in plants. The hypothesis was the CLCuV titer in cotton is dependent on the amount of wax laid down on plant surface and the wax composition. Analysis of the presence of viral genes, namely alphasatellite, betasatellite and DNA-A, via real-time PCR in cotton species indicated that these genes are detectable in G. hirsutum , G. harknessii and GaWM3, whereas no particle was detected in G. arboreum . Quantitative wax analysis revealed that G. arboreum contained 183 μg.cm -2 as compared to GaWM3 with only 95 μg.cm -2 . G. hirsutum and G. harknessii had 130 μg.cm -2 and 146 μg.cm -2 , respectively. The GCMS results depicted that Lanceol, cis was 45% in G. harknessii . Heptadecanoic acid was dominant in G. arboreum with 25.6%. GaWM3 had 18% 1,2,-Benenedicarboxylic acid. G. hirsutum contained 25% diisooctyl ester. The whitefly feeding assay with Nile Blue dye showed no color in whiteflies gut fed on G. arboreum . In contrast, color was observed in the rest of whiteflies. From results, it was concluded that reduced quantity as well as absence of (1) 3-trifluoroacetoxytetradecane, (2) 2-piperidinone,n-|4-bromo-n-butyl|, (3) 4-heptafluorobutyroxypentadecane, (4) Silane, trichlorodocosyl-, (5) 6- Octadecenoic acid, methyl ester, and (6) Heptadecanoicacid,16-methyl-,methyl ester in wax could make plants susceptible to CLCuV , infested by whiteflies.
Mechanical Characterization of Cotton Fiber/Polyester Composite Material
Directory of Open Access Journals (Sweden)
Altaf Hussain Rajper
2014-04-01
Full Text Available Development of composite from natural fiber for lower structural application is growing for long-term sustainable perspective. Cotton fiber composite material has the added advantages of high specific strength, corrosion resistance, low cost and low weight compared to glass fiber on the expense of internal components of IC engines. The primary aim of the research study is to examine the effect of the cotton fiber on mechanical properties of lower structural applications when added with the polyester resin. In this paper composite material sample has been prepared by hand Lay-Up process. A mould is locally developed in the laboratory for test sample preparation. Initially samples of polyester resin with appropriate ratio of the hardener were developed and tested. At the second stage yarns of cotton fiber were mixed with the polyester resin and sample specimens were developed and tested. Relative effect of the cotton as reinforcing agent was examined and observed that developed composite specimen possess significant improvement in mechanical properties such as tensile strength was improved as 19.78 % and modulus of elasticity was increased up to 24.81%. Through this research it was also observed that developed composite material was of ductile nature and its density decreases up to 2.6%. Results from this study were compared with relevant available advanced composite materials and found improved mechanical properties of developed composite material
Directory of Open Access Journals (Sweden)
Michael A. Gore
2014-03-01
Full Text Available The superior fiber properties of L. serve as a source of novel variation for improving fiber quality in Upland cotton ( L., but introgression from has been largely unsuccessful due to hybrid breakdown and a lack of genetic and genomic resources. In an effort to overcome these limitations, we constructed a linkage map and conducted a quantitative trait locus (QTL analysis of 10 agronomic and fiber quality traits in a recombinant inbred mapping population derived from a cross between TM-1, an Upland cotton line, and NM24016, an elite line with stabilized introgression from . The linkage map consisted of 429 simple-sequence repeat (SSR and 412 genotyping-by-sequencing (GBS-based single-nucleotide polymorphism (SNP marker loci that covered half of the tetraploid cotton genome. Notably, the 841 marker loci were unevenly distributed among the 26 chromosomes of tetraploid cotton. The 10 traits evaluated on the TM-1 × NM24016 population in a multienvironment trial were highly heritable, and most of the fiber traits showed considerable transgressive variation. Through the QTL analysis, we identified a total of 28 QTLs associated with the 10 traits. Our study provides a novel resource that can be used by breeders and geneticists for the genetic improvement of agronomic and fiber quality traits in Upland cotton.
Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu
2016-01-01
Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.
Zhang, Feng; Zhu, Guozhong; Du, Lei; Shang, Xiaoguang; Cheng, Chaoze; Yang, Bing; Hu, Yan; Cai, Caiping; Guo, Wangzhen
2016-02-03
Cotton is an economically important crop throughout the world, and is a pioneer crop in salt stress tolerance research. Investigation of the genetic regulation of salinity tolerance will provide information for salt stress-resistant breeding. Here, we employed next-generation RNA-Seq technology to elucidate the salt-tolerant mechanisms in cotton using the diploid cotton species Gossypium davidsonii which has superior stress tolerance. A total of 4744 and 5337 differentially expressed genes (DEGs) were found to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation elucidated salt overly sensitive (SOS) and reactive oxygen species (ROS) signaling pathways. Furthermore, we found that photosynthesis pathways and metabolism play important roles in ion homeostasis and oxidation balance. Moreover, our studies revealed that alternative splicing also contributes to salt-stress responses at the posttranscriptional level, implying its functional role in response to salinity stress. This study not only provides a valuable resource for understanding the genetic control of salt stress in cotton, but also lays a substantial foundation for the genetic improvement of crop resistance to salt stress.
Resistivity tomography using line electrode; Sendenryugen wo tsukatta hiteiko tomography
Energy Technology Data Exchange (ETDEWEB)
Sugimoto, Y [Dia Consultants Company, Tokyo (Japan)
1996-10-01
Resistivity tomography (RT) using line electrode was studied. Although line electrode is available even for RT, in casing line electrode, only one kind of electrode data is obtained. The calculation method of potential and sensitivity distributions based on line electrode is not yet established. Since various data in various measurement arrangements are required for analysis of RT, the new measurement method was devised which measures resistivities while successively changing the tip depth of line electrode. Until now, although potential has been calculated under the assumption that outflow current per unit length of line electrode is uniform, this assumption is incorrect. The new potential distribution calculation method was thus proposed. Sensitivity distribution calculation for inverse analysis is also described. RT using line electrode could precisely obtain deep information which couldn`t be obtained only by measurement along the surface measuring line. Although RT is poorer in accuracy than the previous point electrode method, it will be probably improved by 3-electrode arrangement. RT is also useful in the case difficult to apply point electrode method. 3 refs., 10 figs.
International Nuclear Information System (INIS)
Vasti, S.M.
1981-06-01
Disease resistant, high yielding and higher quality cotton varieties were developed. 42 interspecific hybrid progenies of earlier crosses between Gossypium barbadense and Gossypium tomentosum or Gossypium barbadense and Gossypium hirsutum were included. Out of these, 22 progenies in F 3 generation were irradiated by gamma radiation doses of 20 and 25 kR. A list is given of interspecific hybrid progenies, as are the lists of boll rot susceptible and resistant plants in the irradiated and non-irradiated populations and/or successful crosses made between 1977 and 1978
[Establishment of human multidrug-resistant lung carcinoma cell line (D6/MVP)].
Ma, Sheng-lin; Feng, Jian-guo; Gu, Lin-hui; Ling, Yu-tian
2003-03-01
To establish human multidrug-resistant lung carcinoma cell line (D6/MVP) with its characteristics studied. Intermittent administration of high-dose MMC, VDS and DDP (MVP) was used to induce human lung carcinoma cell line (D6) to a multidrug-resistant variety (D6/MVP). MTT assay was used to study the multidrug resistance of D6/MVP to multianticarcinogen. Flow cytometry was used to study the cell cycle distribution and the expression of P-gp, multidrug resistance-associated protein (MRP) and GSH/GST. 1. D6/MVP was resistant to many anti-tumor agents, with the IC(50) 13.3 times higher and the drug resistance 2 - 6 times higher than D6, 2. The multiplication time of D6/MVP was prolonged and the cell number of S-phase decreased while that of G1- and G(2)-phase increased and 3. The expression of P-gp and MRP was enhanced significantly (96.2% vs 51.7%), but the expression of GSH/GST kept stable. D6/MVP is a multidrug-resistant cell line possessing the basic characteristics of drug-resistance.
Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...
DEFF Research Database (Denmark)
Kongsted, Per; Svane, Inge M; Lindberg, Henriette
2016-01-01
To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...
Indian Bt cotton varieties do not affect the performance of cotton aphids.
Directory of Open Access Journals (Sweden)
Nora C Lawo
Full Text Available Cotton varieties expressing Cry proteins derived from the soil bacterium Bacillus thuringiensis (Bt are grown worldwide for the management of pest Lepidoptera. To prevent non-target pest outbreaks and to retain the biological control function provided by predators and parasitoids, the potential risk that Bt crops may pose to non-target arthropods is addressed prior to their commercialization. Aphids play an important role in agricultural systems since they serve as prey or host to a number of predators and parasitoids and their honeydew is an important energy source for several arthropods. To explore possible indirect effects of Bt crops we here examined the impact of Bt cotton on aphids and their honeydew. In climate chambers we assessed the performance of cotton aphids, Aphis gossypii Glover (Hemiptera: Aphididae when grown on three Indian Bt (Cry1Ac cotton varieties (MECH 12, MECH 162, MECH 184 and their non-transformed near isolines. Furthermore, we examined whether aphids pick up the Bt protein and analyzed the sugar composition of aphid honeydew to evaluate its suitability for honeydew-feeders. Plant transformation did not have any influence on aphid performance. However, some variation was observed among the three cotton varieties which might partly be explained by the variation in trichome density. None of the aphid samples contained Bt protein. As a consequence, natural enemies that feed on aphids are not exposed to the Cry protein. A significant difference in the sugar composition of aphid honeydew was detected among cotton varieties as well as between transformed and non-transformed plants. However, it is questionable if this variation is of ecological relevance, especially as honeydew is not the only sugar source parasitoids feed on in cotton fields. Our study allows the conclusion that Bt cotton poses a negligible risk for aphid antagonists and that aphids should remain under natural control in Bt cotton fields.
Resistance Evaluation of Radish (Raphanus sativus L. Inbred Lines against Turnip mosaic virus
Directory of Open Access Journals (Sweden)
Ju-Yeon Yoon
2017-03-01
Full Text Available Leaves of twenties radish (Raphanus sativus L. inbred lines were mechanically inoculated with Turnip mosaic virus (TuMV strain HY to evaluate TuMV resistance of the radish inbred lines. The inoculated radish plants were incubated at 22°C±3°C and resistance assessment was examined using symptom development for 4 weeks. Based on the reactions of differential radish inbred lines, 16 radish lines were produced mild mosaic, mottling, mosaic and severe mosaic symptoms by TuMV infection. These results were confirmed by RT-PCR analysis of TuMV coat protein gene, suggesting that TuMV is responsible for the disease symptoms. Four resistant radish lines did not induce systemic mosaic symptoms on upper leaves and chlorosis in stem tissues for 4 weeks, showing they were symptomless by 8 weeks. Further examination of TuMV infection in the 4 radish lines showed no TuMV infection in all systemic leaves. These results suggest that the 4 radish lines are highly resistant to TuMV.
Line 63-1: A New Virus-resistant Transgenic Papaya
Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.
2005-01-01
The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment
Use of induced mutations for cotton breeding in India
International Nuclear Information System (INIS)
Raut, R.N.
1980-01-01
A large number of studies have been reported in recent years on the use of induced mutations in the improvement of food crops and ornamentals. Similar investigations on fibre crops like cotton have, however, been relatively few. The fact that most of the economically useful characters in cotton are under polygenic control appears to be the main limiting factor. Inspite of this there are reports of radiation induced useful mutations used as commercial varieties. As early as 1950 a X-ray induced mutant variety of G. hirsutum cotton Indore-2 was released for commercial cultivation in Madhya Pradesh and covered more than one lac hectares. More recently an early maturing mutant variety MCU-7 was released for cultivation in summer rice fallows of Tamil Nadu and covers nearly 10,000 acres. Other promising mutant strains found suitable b.v large scale trials and recommended for cultivation under specific conditions are Okra leaf mutant, photoinsensitive mutant of MCU-5 (named Rasmi) and Jassid tolerant early maturing mutant 4-1 (Pusa Ageti). In addition improved varieties like Badnaawar-1, Khandwa-2 and M64 have been evolved by utilizing mutant lines in cross breeding. The scope of induced mutation method as a breeding technique for cotton improvement in India is very wide. (author)
Evaluation of rice mutant lines for resistance to brown planthopper, nilaparvata lugens stall
International Nuclear Information System (INIS)
Mugiono
1985-01-01
The most important and common insect in rice cultivation in South East Asia is brown planthopper, nilaparvata lugens stall. Seven rice mutant lines produced by the National Atomic Energy Agency, Indonesia, were tested at IRRI, the Philippines for resistance to brown planthopper. Those mutant lines were Atomita 1, 627/10-3/PsJ, Atomita 2 and 627/4-E/PsJ originated from Pelita 1/1 which was irradiated with 0.2 kGy of gamma rays and A227/2/PsJ, A227/3/PsJ and A227/5/PsJ, originated from early maturing mutant A23/PsJ/72K from irradiated Pelita 1/1 which was irradiated with 0.1 kGy of gamma rays. Evaluation of resistance was carried out by seedling bulk screening, honeydew excretion, survival and population build up tests by using brown planthopper biotype 1, 2 and 3. Results of these tests showed that the seven tested mutant lines were resistant to biotype 1 but susceptible to biotype 2. Reaction to biotype 3 showed that six mutant lines tested were moderately resistant and only one mutant of 627/4-E/PsJ was susceptible. Reactions of the mutant lines to biotype 1, 2 and 3 were different from the resistant varieties, Mudgo or ASD-7. This indicated that mutant lines might have gene(s) for resistance which differed from those of resistant varieties. The results showed that resistance to brown planthopper is possible to be introduced in Indonesian rice varieties by means of mutations. (author)
Directory of Open Access Journals (Sweden)
Emily A. Kendall
2017-03-01
Full Text Available Treatment failure and resistance amplification are common among patients with rifampin-resistant tuberculosis (TB. Drug susceptibility testing (DST for second-line drugs is recommended for these patients, but logistical difficulties have impeded widespread implementation of second-line DST in many settings. To provide a quantitative perspective on the decision to scale up second-line DST, we synthesize literature on the prevalence of second-line drug resistance, the expected clinical and epidemiologic benefits of using second-line DST to ensure that patients with rifampin-resistant TB receive effective regimens, and the costs of implementing (or not implementing second-line DST for all individuals diagnosed with rifampin-resistant TB. We conclude that, in most settings, second-line DST could substantially improve treatment outcomes for patients with rifampin-resistant TB, reduce transmission of drug-resistant TB, prevent amplification of drug resistance, and be affordable or even cost-saving. Given the large investment made in each patient treated for rifampin-resistant TB, these payoffs would come at relatively small incremental cost. These anticipated benefits likely justify addressing the real challenges faced in implementing second-line DST in most high-burden settings.
Durable Superomniphobic Surface on Cotton Fabrics via Coating of Silicone Rubber and Fluoropolymers
Directory of Open Access Journals (Sweden)
Arsheen Moiz
2018-03-01
Full Text Available Performance textiles that protect human from different threats and dangers from environment are in high demand, and the advancement in functionalization technology together with employing advanced materials have made this an area of research focus. In this work, silicone rubber and environmentally friendly fluoropolymers have been employed to explore superomniphobic surface on cotton fabrics without compromising comfort much. It has been found that a cross-linked network between the rubber membrane and the fluoropolymers has been formed. The surface appearance, morphology, handle, thickness and chemical components of the surface of cotton fabrics have been changed. The coated fabrics showed resistance to water, aqueous liquid, oil, chemicals and soil. The comfort of the coated fabrics is different to uncoated cotton fabrics due to the existence of coated layers on the surface of cotton fabrics. This work would benefit the development and design of the next generation of performance textiles with balanced performance and comfort.
Dictionary of cotton: Picking & ginning
Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...
Characterization and drug resistance patterns of Ewing's sarcoma family tumor cell lines.
Directory of Open Access Journals (Sweden)
William A May
Full Text Available Despite intensive treatment with chemotherapy, radiotherapy and surgery, over 70% of patients with metastatic Ewing's Sarcoma Family of Tumors (EFT will die of their disease. We hypothesize that properly characterized laboratory models reflecting the drug resistance of clinical tumors will facilitate the application of new therapeutic agents to EFT. To determine resistance patterns, we studied newly established EFT cell lines derived from different points in therapy: two established at diagnosis (CHLA-9, CHLA-32, two after chemotherapy and progressive disease (CHLA-10, CHLA-25, and two at relapse after myeloablative therapy and autologous bone marrow transplantation (post-ABMT (CHLA-258, COG-E-352. The new lines were compared to widely studied EFT lines TC-71, TC-32, SK-N-MC, and A-673. These lines were extensively characterized with regard to identity (short tandem repeat (STR analysis, p53, p16/14 status, and EWS/ETS breakpoint and target gene expression profile. The DIMSCAN cytotoxicity assay was used to assess in vitro drug sensitivity to standard chemotherapy agents. No association was found between drug resistance and the expression of EWS/ETS regulated genes in the EFT cell lines. No consistent association was observed between drug sensitivity and p53 functionality or between drug sensitivity and p16/14 functionality across the cell lines. Exposure to chemotherapy prior to cell line initiation correlated with drug resistance of EFT cell lines in 5/8 tested agents at clinically achievable concentrations (CAC or the lower tested concentration (LTC: (cyclophosphamide (as 4-HC and doxorubicin at CAC, etoposide, irinotecan (as SN-38 and melphalan at LTC; P<0.1 for one agent, and P<0.05 for four agents. This panel of well-characterized drug-sensitive and drug-resistant cell lines will facilitate in vitro preclinical testing of new agents for EFT.
International Nuclear Information System (INIS)
Tursunkhodjayeva, F.M.
2004-01-01
Full text: Knowledge of plants' hormone receptor sites is essential to understanding of the principles of phytohormone action in cells and tissues. The hormone abscisic acid (ABA) takes part in many important physiological processes of plants, including water balance and resistance to salt stress. The detection of salt tolerance in the early stages of ontogenesis is desirable for effective cultivation of cotton. Usually such characteristics are determined visually after genetic analysis of hybrids over several generations. This classic method of genetics requires a long time to grow several generations of cotton plants. In this connection we study ABA-binding protein contents in subcellular fractions isolated from seedlings of several kinds of cotton with different tolerance to salt stress. The contents of ABA-binding protein in nuclei and chloroplasts fractions isolated from cotton seedlings were determined using radioimmunoanalysis. The subcellular fractions were prepared by ultracentrifugation in 0,25 - 2,2 M sucrose gradient. ABA-binding protein was isolated from cotton seedlings by affinity chromatography. The antibodies against ABA-binding protein of cotton were developed in rabbits according standard protocols. Than the antibodies were labelled by radioisotope J 125 according Greenwood et al. It was shown, that the nuclei and chloroplasts fractions isolated from cotton with high tolerance to salt stress contain ABA-binding protein up to 1,5-1,8 times more, than the same fractions from cotton with low tolerance to salt stress. So, the ABA-binding protein contents in cotton seedlings may be considered as a marker for screening of cotton kinds, which may potentially have high tolerance to salt stress
International Nuclear Information System (INIS)
Bree, Chris van; Kreder, Natasja Castro; Loves, Willem J.P.; Franken, Nicolaas A.P.; Peters, Godefridus J.; Haveman, Jaap
2002-01-01
Purpose: To determine cross-resistance to anti-tumor treatments in 2',2'difluorodeoxycytidine (dFdC, gemcitabine)-resistant human tumor cells. Methods and Materials: Human lung carcinoma cells SW-1573 (SWp) were made resistant to dFdC (SWg). Sensitivity to cisplatin (cDDP), paclitaxel, 5-fluorouracil (5-FU), methotrexate (MTX), cytarabine (ara-C), and dFdC was measured by a proliferation assay. Radiosensitivity and radioenhancement by dFdC of this cell panel and the human ovarian carcinoma cell line A2780 and its dFdC-resistant variant AG6000 were determined by clonogenic assay. Bivariate flowcytometry was performed to study cell cycle changes. Results: In the SWg, a complete deoxycytidine kinase (dCK) deficiency was found on mRNA and protein level. This was accompanied by a 10-fold decrease in dCK activity which resulted in the >1000-fold resistance to dFdC. Sensitivity to other anti-tumor drugs was not altered, except for ara-C (>100-fold resistance). Radiosensitivity was not altered in the dFdC-resistant cell lines SWg and AG6000. High concentrations (50-100 μM dFdC) induced radioenhancement in the dFdC-resistant cell lines similar to the radioenhancement obtained at lower concentrations (10 nM dFdC) in the parental lines. An early S-phase arrest was found in all cell lines after dFdC treatment where radioenhancement was achieved. Conclusions: In the dFdC-resistant lung tumor cell line SWg, the deficiency in dCK is related to the resistance to dFdC and ara-C. No cross-resistance was observed to other anti-tumor drugs used for the treatment in lung cancer. Sensitivity to ionizing radiation was not altered in two different dFdC-resistant cell lines. Resistance to dFdC does not eliminate the ability of dFdC to sensitize cells to radiation
Fire Resistant Panels for the Tunnel Linings
Directory of Open Access Journals (Sweden)
Gravit Marina
2016-01-01
Full Text Available Presents the results of studies of innovative materials in the field of experimental and theoretical research fire resistance fireproof panels Pyro-Safe Aestuver T. Owing to the assembly simplicity, materials cheapness, high ecological standard, recycling, reuse potential, are benefit. Research work is running to improve the knowledge about fireproof panels Pyro-Safe Aestuver T for tunnel lining, its basic performance, its long term behavior and in particular also its fire proof for example when used for the lining of road tunnels.
29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...
African Journals Online (AJOL)
rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...
Resistive effects on line-tied magnetohydrodynamic modes in cylindrical geometry
International Nuclear Information System (INIS)
Delzanno, Gian Luca; Evstatiev, E. G.; Finn, John M.
2007-01-01
An investigation of the effect of resistivity on the linear stability of line-tied magnetohydrodynamic (MHD) modes is presented in cylindrical geometry, based on the method recently developed in the paper by Evstatiev et al. [Phys. Plasmas 13, 072902 (2006)]. The method uses an expansion of the full solution of the problem in one-dimensional radial eigenfunctions. This method is applied to study sausage modes (m=0, m being the poloidal wavenumber), kink modes (m=1), and m=2 modes. All these modes can be resistively unstable. It is found that m≠0 modes can be unstable below the ideal MHD threshold due to resistive diffusion of the field lines, with growth rates proportional to resistivity. For these resistive modes, there is no indication of tearing, i.e., current sheets or boundary layers due to ideal MHD singularities. That is, resistivity acts globally on the whole plasma column and not in layers. Modes with m=0, on the other hand, can exist as tearing modes if the equilibrium axial magnetic field reverses sign within the plasma
Huang, Jian; Hao, HongFei
2018-05-01
Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.
Huang, Jian; Hao, HongFei
2018-05-11
Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.
Cotton transformation via pollen tube pathway.
Wang, Min; Zhang, Baohong; Wang, Qinglian
2013-01-01
Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.
Dinitroaniline herbicide resistance and the microtubule cytoskeleton.
Anthony; Hussey
1999-03-01
Dinitroaniline herbicides have been used for pre-emergence weed control for the past 25 years in cotton, soybean, wheat and oilseed crops. Considering their long persistence and extensive use, resistance to dinitroanilines is fairly rare. However, the most widespread dinitroaniline-resistant weeds, the highly resistant (R) and the intermediate (I) biotypes of the invasive goosegrass Eleusine indica, are now infesting more than 1000 cotton fields in the southern states of the USA. The molecular basis of this resistance has been identified, and found to be a point mutation in a major microtubule cytoskeletal protein, alpha-tubulin. These studies have served both to explain the establishment of resistance and to reveal fundamental properties of tubulin gene expression and microtubule structure.
CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).
Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S
2017-07-01
The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.
Pollen- and seed-mediated transgene flow in commercial cotton seed production fields.
Directory of Open Access Journals (Sweden)
Shannon Heuberger
Full Text Available BACKGROUND: Characterizing the spatial patterns of gene flow from transgenic crops is challenging, making it difficult to design containment strategies for markets that regulate the adventitious presence of transgenes. Insecticidal Bacillus thuringiensis (Bt cotton is planted on millions of hectares annually and is a potential source of transgene flow. METHODOLOGY/PRINCIPAL FINDINGS: Here we monitored 15 non-Bt cotton (Gossypium hirsutum, L. seed production fields (some transgenic for herbicide resistance, some not for gene flow of the Bt cotton cry1Ac transgene. We investigated seed-mediated gene flow, which yields adventitious Bt cotton plants, and pollen-mediated gene flow, which generates outcrossed seeds. A spatially-explicit statistical analysis was used to quantify the effects of nearby Bt and non-Bt cotton fields at various spatial scales, along with the effects of pollinator abundance and adventitious Bt plants in fields, on pollen-mediated gene flow. Adventitious Bt cotton plants, resulting from seed bags and planting error, comprised over 15% of plants sampled from the edges of three seed production fields. In contrast, pollen-mediated gene flow affected less than 1% of the seed sampled from field edges. Variation in outcrossing was better explained by the area of Bt cotton fields within 750 m of the seed production fields than by the area of Bt cotton within larger or smaller spatial scales. Variation in outcrossing was also positively associated with the abundance of honey bees. CONCLUSIONS/SIGNIFICANCE: A comparison of statistical methods showed that our spatially-explicit analysis was more powerful for understanding the effects of surrounding fields than customary models based on distance. Given the low rates of pollen-mediated gene flow observed in this study, we conclude that careful planting and screening of seeds could be more important than field spacing for limiting gene flow.
Oktay EROĞAN; Emine KARADEMIR; Çetin KARADEMIR; Aydın UNAY
2013-01-01
The susceptibility of cotton genotypes obtained from F6 and F7 generations to Verticillium wilt (VW) disease (Verticillium dahliae Kleb.), was studied under artificial and natural infestation during 2009 and 2010 growing seasons at the Cotton Research Institute’s, Nazilli, Aydın, Turkey. In this study, fifteen cotton breeding lines and two control varieties were used as plant material. During the cotton growing season, foliar disease index (FDI), vascular disease index (VDI) and pot disease i...
Basit, Muhammad; Saeed, Shafqat; Saleem, Mushtaq Ahmad; Denholm, Ian; Shah, Maqbool
2013-06-01
Resistance levels in whitefly, Bemisia tabaci (Gennadius) collections from cotton and sunflower (up to four districts) for five neonicotinoids and two insect growth regulators (IGRs) were investigated for two consecutive years. Based on the LC50(s), all collections showed slight to moderate levels of resistance for the tested insecticides compared with the laboratory susceptible population. The data also indicated that cotton and sunflower collections had similar resistance levels. In comparison (four collections), Vehari collections showed higher resistance for acetamiprid, thiacloprid, and nitenpyram compared with those of others. Average resistance ratios for acetamiprid, thiacloprid, and nitenpyram ranged from 5- to 13-, 4- to 8-, and 9- to 13-fold, respectively. Multan and Vehari collections also exhibited moderate levels (9- to 16-fold) of resistance to buprofezin. Furthermore, toxicity of neonicotinoids against immature stages was equal to that of insect growth regulators. The data also suggested that resistance in the field populations was stable. After selection for four generations with bifenthrin (G1 to G4), resistance to bifenthrin increased to 14-fold compared with the laboratory susceptible population. Selection also increased resistance to fenpropathrin, lambdacyhalothrin, imidacloprid, acetamiprid, and diafenthuron. Cross-resistance and stability of resistance in the field populations is of some concern. Rotation of insecticides having no cross-resistance and targeting the control against immature stages may control the resistant insects, simultaneously reducing the selection pressure imposed.
Negative resists for i-line lithography utilizing acid-catalyzed intramolecular dehydration reaction
Ueno, Takumi; Uchino, Shou-ichi; Hattori, Keiko T.; Onozuka, Toshihiko; Shirai, Seiichiro; Moriuchi, Noboru; Hashimoto, Michiaki; Koibuchi, S.
1994-05-01
Chemical amplification negative resist system composed of a novolak resin, a carbinol and an acid generator is investigated for i-line phase-shift lithography. The reaction in this resist is based on an acid-catalyzed intramolecular dehydration reaction. The dehydration products act as aqueous-base dissolution inhibitors, and carbinol compounds in unexposed areas work as dissolution promoters. The resist composed of a novolak resin, 1,4-bis((alpha) -hydroxyisopropyl) benzene (DIOL-1) and 2- naphthoylmethyltetramethylenesulfonium triflate (PAG-2) gives the best lithographic performance in terms of sensitivity and resolution. Line-and-space patterns of 0.275 micrometers are obtained using an i-line stepper (NA:0.45) in conjunction with a phase shifting mask.
A first-line antiretroviral therapy-resistant HIV patient with rhinoentomophthoromycosis
Directory of Open Access Journals (Sweden)
Rachita Dhurat
2018-01-01
Full Text Available The Conidiobolus coronatus-related rhinoentomophthoromycosis in immunocompetent and immunocompromised (HIV negative individuals has been treated successfully with antifungal drugs. However, C. coronatus infections in first-line antiretroviral therapy (ART-resistant (HIV infected individuals particularly with rhinoentomophthoromycosis have not been reported previously. Here, we describe a case of itraconazole non-responding rhinoentomophthoromycosis in an HIV-infected patient with first-line antiretroviral (ART drug resistance which was successfully managed through systematic diagnostic and therapeutic approaches in dermatologic setting. A 32-year-old HIV-1-infected man presented with painless swelling, nasal redness and respiratory difficulty. The patient was receiving first-line ART and had a history of traumatic injury before the onset of nasopharyngeal manifestations. The patient's previous history included oral candidiasis and pulmonary tuberculosis.
Characterisation and Manipulation of Docetaxel Resistant Prostate Cancer Cell Lines
LENUS (Irish Health Repository)
O'Neill, Amanda J
2011-10-07
Abstract Background There is no effective treatment strategy for advanced castration-resistant prostate cancer. Although Docetaxel (Taxotere®) represents the most active chemotherapeutic agent it only gives a modest survival advantage with most patients eventually progressing because of inherent or acquired drug resistance. The aims of this study were to further investigate the mechanisms of resistance to Docetaxel. Three Docetaxel resistant sub-lines were generated and confirmed to be resistant to the apoptotic and anti-proliferative effects of increasing concentrations of Docetaxel. Results The resistant DU-145 R and 22RV1 R had expression of P-glycoprotein and its inhibition with Elacridar partially and totally reversed the resistant phenotype in the two cell lines respectively, which was not seen in the PC-3 resistant sublines. Resistance was also not mediated in the PC-3 cells by cellular senescence or autophagy but multiple changes in pro- and anti-apoptotic genes and proteins were demonstrated. Even though there were lower basal levels of NF-κB activity in the PC-3 D12 cells compared to the Parental PC-3, docetaxel induced higher NF-κB activity and IκB phosphorylation at 3 and 6 hours with only minor changes in the DU-145 cells. Inhibition of NF-κB with the BAY 11-7082 inhibitor reversed the resistance to Docetaxel. Conclusion This study confirms that multiple mechanisms contribute to Docetaxel resistance and the central transcription factor NF-κB plays an immensely important role in determining docetaxel-resistance which may represent an appropriate therapeutic target.
Directory of Open Access Journals (Sweden)
Hamid Ashrafi
2015-07-01
Full Text Available Upland cotton ( L. has a narrow germplasm base, which constrains marker development and hampers intraspecific breeding. A pressing need exists for high-throughput single nucleotide polymorphism (SNP markers that can be readily applied to germplasm in breeding and breeding-related research programs. Despite progress made in developing new sequencing technologies during the past decade, the cost of sequencing remains substantial when one is dealing with numerous samples and large genomes. Several strategies have been proposed to lower the cost of sequencing for multiple genotypes of large-genome species like cotton, such as transcriptome sequencing and reduced-representation DNA sequencing. This paper reports the development of a transcriptome assembly of the inbred line Texas Marker-1 (TM-1, a genetic standard for cotton, its usefulness as a reference for RNA sequencing (RNA-seq-based SNP identification, and the availability of transcriptome sequences of four other cotton cultivars. An assembly of TM-1 was made using Roche 454 transcriptome reads combined with an assembly of all available public expressed sequence tag (EST sequences of TM-1. The TM-1 assembly consists of 72,450 contigs with a total of 70 million bp. Functional predictions of the transcripts were estimated by alignment to selected protein databases. Transcriptome sequences of the five lines, including TM-1, were obtained using an Illumina Genome Analyzer-II, and the short reads were mapped to the TM-1 assembly to discover SNPs among the five lines. We identified >14,000 unfiltered allelic SNPs, of which ∼3,700 SNPs were retained for assay development after applying several rigorous filters. This paper reports availability of the reference transcriptome assembly and shows its utility in developing intraspecific SNP markers in upland cotton.
Increased frequency of pink bollworm resistance to Bt toxin Cry1Ac in China.
Directory of Open Access Journals (Sweden)
Peng Wan
Full Text Available Transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The main approach for delaying pest adaptation to Bt crops uses non-Bt host plants as "refuges" to increase survival of susceptible pests. To delay evolution of pest resistance to transgenic cotton producing Bt toxin Cry1Ac, the United States and some other countries have required refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. The "natural" refuge strategy focuses on cotton bollworm (Helicoverpa armigera, the primary target of Bt cotton in China that attacks many crops, but it does not apply to another major pest, pink bollworm (Pectinophora gossypiella, which feeds almost entirely on cotton in China. Here we report data showing field-evolved resistance to Cry1Ac by pink bollworm in the Yangtze River Valley of China. Laboratory bioassay data from 51 field-derived strains show that the susceptibility to Cry1Ac was significantly lower during 2008 to 2010 than 2005 to 2007. The percentage of field populations yielding one or more survivors at a diagnostic concentration of Cry1Ac increased from 0% in 2005-2007 to 56% in 2008-2010. However, the median survival at the diagnostic concentration was only 1.6% from 2008 to 2010 and failure of Bt cotton to control pink bollworm has not been reported in China. The early detection of resistance reported here may promote proactive countermeasures, such as a switch to transgenic cotton producing toxins distinct from Cry1A toxins, increased planting of non-Bt cotton, and integration of other management tactics together with Bt cotton.
Loss and stabilization of resistance to aminopterin in mouse cell lines
International Nuclear Information System (INIS)
Safronov, V.V.; Kapitsa, O.S.; Sapegina, M.B.; Gorodetskii, S.I.
1986-01-01
Using step-wise selection, lines of mouse L-cells were obtained (clones B-82, TK-), resistance to aminopterin (AP) of which exceeds resistance of parental cells by 10 3 -5 x 10 4 times. Increased resistance is the result of amplification of the gene for dihydrofolate reductase (DHFR), which was established according to increase in enzyme activity by 15-120 times and by cytogenetic methods. Development and disappearance of resistance to AP was studied and karyological analysis of lines obtained was conducted. Two types of karylogical changes were revealed: the presence of double microchromosomes (DM) and of a marker chromosome having homogeneously staining regions (HSR). The localization of the DHFR and HSR genes was demonstrated using in situ hybridization. At early stages of the development of resistance and for a long time, an extrachromosomal localization of amplified genes in the structure of DM, which determine unstable resistance to toxin, is fundamental. The possibility was demonstrated of the long-term existence of cells in which DM and HSR are present simultaneously. Change in number of copies of the DHFR gene in lines of such cells occurs through change in the number of DM, while size and localization of HSR are constant in different conditions of cell culturing. The presence of HSR determines stable resistance to AP. Data were obtained in support of an intermediate relative stabilization of resistance, which is caused by temporary insertion of copies of the DHFR gene into other sections of chromosomes, in addition to HSR dispersed variously through the genome
Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance
International Nuclear Information System (INIS)
Abro, S.; Khan, M.A.; Sial, M.A.
2015-01-01
Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)
Superoleophobic cotton textiles
Leng, B.; Shao, Z.; With, de G.; Ming, W.
2009-01-01
Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we
7 CFR 1205.319 - Cotton-producing region.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...
Sun, Ling; Zhu, Zesheng
2017-08-01
This paper is to show the ability of remote sensing image analysis combined with statistical analysis to characterize the environmental risk assessment of cotton in rotation with rice and cotton in rotation with other crops in two ways: (1) description of rotation period of cotton in rotation with rice and cotton in rotation with other crops by the observational study or natural experiment; (2) analysis of rotation period calculation of cotton in rotation with rice and cotton in rotation with other crops. Natural experimental results show that this new method is very promising for determining crop rotation period for estimating regional averages of environmental risk. When it is applied to determining crop rotation period, two requested remote sensing images of regional crop are required at least.
Detection of underground mined voids using line electrode resistivity technique - case study
Energy Technology Data Exchange (ETDEWEB)
Peng, S.S.; Ziaie, F. (West Virginia University, Morgantown, WV (USA))
1991-06-01
A new resistivity method was developed and tested in three phases; simulated model, similitude model, and field survey. This resistivity method was a combination of the Bristow arrangement and line electrode method. Three line electrodes were chosen so that the sinkhole electrode was emplaced at a far distance from the other two electrodes. Any of the two electrodes and the sinkhole electrode were activated and several resistivity profiles perpendicular to the line electrode prepared for different electrodes activation. Subsurface cavities caused resistivity anomalies which were interpreted to locate their sources (cavities) and estimate the depths and dimension of the cavities. A coal mine site employing the room and pillar mining system was selected to confirm the results of the laboratory. The results of the interpretation indicated that the entry with a dimension of 135 cm high and 5.40 m wide at a depth of 25.50 m can be detected by this method. The resolution of the detectability of this method proved a great success when compared to other resistivity techniques. 6 refs., 6 figs.
Fabrication of recyclable superhydrophobic cotton fabrics
Han, Sang Wook; Park, Eun Ji; Jeong, Myung-Geun; Kim, Il Hee; Seo, Hyun Ook; Kim, Ju Hwan; Kim, Kwang-Dae; Kim, Young Dok
2017-04-01
Commercial cotton fabric was coated with SiO2 nanoparticles wrapped with a polydimethylsiloxane (PDMS) layer, and the resulting material surface showed a water contact angle greater than 160°. The superhydrophobic fabric showed resistance to water-soluble contaminants and maintained its original superhydrophobic properties with almost no alteration even after many times of absorption-washing cycles of oil. Moreover, superhydrophobic fabric can be used as a filter to separate oil from water. We demonstrated a simple method of fabrication of superhydrophobic fabric with potential interest for use in a variety of applications.
Zalucki, M P; Cunningham, J P; Downes, S; Ward, P; Lange, C; Meissle, M; Schellhorn, N A; Zalucki, J M
2012-08-01
Cotton growing landscapes in Australia have been dominated by dual-toxin transgenic Bt varieties since 2004. The cotton crop has thus effectively become a sink for the main target pest, Helicoverpa armigera. Theory predicts that there should be strong selection on female moths to avoid laying on such plants. We assessed oviposition, collected from two cotton-growing regions, by female moths when given a choice of tobacco, cotton and cabbage. Earlier work in the 1980s and 1990s on populations from the same geographic locations indicated these hosts were on average ranked as high, mid and low preference plants, respectively, and that host rankings had a heritable component. In the present study, we found no change in the relative ranking of hosts by females, with most eggs being laid on tobacco, then cotton and least on cabbage. As in earlier work, some females laid most eggs on cotton and aspects of oviposition behaviour had a heritable component. Certainly, cotton is not avoided as a host, and the implications of these finding for managing resistance to Bt cotton are discussed.
The Impacts of U.S. Cotton Programs on the West and Central African Countries Cotton Export Earnings
Fadiga, Mohamadou L.; Mohanty, Samarendu; Pan, Suwen
2005-01-01
This study uses a stochastic simulation approach based on a partial equilibrium structural econometric model of the world fiber market to examine the effects of a removal of U.S. cotton programs on the world market. The effects on world cotton prices and African export earnings were analyzed. The results suggest that on average an elimination of U.S. cotton programs would lead to a marginal increase in the world cotton prices thus resulting in minimal gain for cotton exporting countries in Af...
SOCIO-ECONOMIC BACKGROUND BELT THE ORGANIZATION OF COTTON PRODUCTION-RAW
Directory of Open Access Journals (Sweden)
M. Juraev
2016-01-01
Full Text Available An important requirement imposed; to the strategy of creating a new cotton complex of Tajikistan is its scientific basis in regional – territorial aspect, reflecting the diversity of natural, socio - economic, demographic, geographic and other conditions of the country. If you save the backlog of the industry that is currently taking place, the formation of the basic foundations of the national economy which includes the "Cotton Complex", will be less effective and risky in the socio-economic terms, and would not be achievable conditions for solving a class of useful employment of the rural population. Building a cotton complex objective requires historical – economic approach, ie methodological basis of the values of the industry and its place in the structure of the national economy, which is based on the following scientific – practical approaches: the use of storage still scientific and – technical knowledge; restoring the level of mechanization of agriculture – economic activities; recovery of hydraulic structures; evidence – based delivery of balanced fertilizer elemental based standards; functioning of agrochemical service; the Organization of the introduction of high-yielding seed varieties of cotton resistant to disease; meet the needs of manufacturers of bank loans; the creation of agricultural service workers, taking into account the world practice; create a system of state support for rural enterprise including a system of benefi ts and privileges.
Energy Technology Data Exchange (ETDEWEB)
Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Ahmad, Raza; Moon, Jae Sun; Kwon, Suk Yoon [Korea Research Institute of Beoscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Dong Sub [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)
2010-09-15
Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M{sub 3}, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M{sub 4} generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo.
Directory of Open Access Journals (Sweden)
Charles Freeman
2016-06-01
Full Text Available The purpose of this study is to examine attitudes and perceptions about organic cotton of Mississippi cotton growers and producers in comparison to fashion-conscious consumers, including advantages/disadvantages of growing and production processes, quality control, consumer preferences, and competitive price structures/profit margins. A sample size of 16 local Mississippi growers and/or producers and 44 undergraduate students at a mid-major Southeastern university were chosen to participate in the study. Instruments were developed based on current research and the definition of organic cotton production defined by the United States Department of Agriculture. Results indicate 75% of growers and producers do not perceive a quality difference between organic and conventionally grown cotton, while 72.7% of the consumers report organically grown cotton is capable of producing a higher quality product compared to conventionally grown cotton. Even with an increase in organic cotton prices (25- 40% higher premium, only 25% of growers and producers would be willing to convert, while a majority (52.3% of consumers would not be willing to spend more than 25% extra for an organically grown cotton product. Consumers indicate the negative effects of conventionally grown cotton, yet many report little knowledge about organic cotton production, while growers/producers immediately dismiss organically grown cotton as a retail marketing strategy.
In vitro release of arachidonic acid and in vivo responses to respirable fractions of cotton dust
International Nuclear Information System (INIS)
Thomson, T.A.; Edwards, J.H.; Al-Zubaidy, T.S.; Brown, R.C.; Poole, A.; Nicholls, P.J.
1986-01-01
It was considered that the fall in lung function seen after exposure to cotton dust may be attributable in part to the activity of arachidonic acid metabolites, such as leucotrienes as well as to the more established release of histamine by cotton dust. However, we found that cotton and barley dusts elicited poor release of arachidonic acid from an established macrophage like cell line compared with that observed with other organic dusts. In the experimental animal, pulmonary cellular responses to both cotton and barley dust were similar to those evoked by moldy hay and pigeon dropping dusts, although after multiple doses a more severe response was seen to cotton and barley. Since both moldy hay and pigeon droppings elicit a greater arachidonic acid release than cotton or barley, a role for arachidonic acid in inducing the cellular response is less likely than other factors. There are limitations to our conclusions using this system, i.e., the arachidonic acid may be released in a nonmetabolized form, although it is noted that the two dusts with the greatest arachidonic acid release produce their clinical responses in humans largely by hypersensitivity mechanisms
Directory of Open Access Journals (Sweden)
Weiping Fang
Full Text Available Although cotton genic male sterility (GMS plays an important role in the utilization of hybrid vigor, its precise molecular mechanism remains unclear. To characterize the molecular events of pollen abortion, transcriptome analysis, combined with histological observations, was conducted in the cotton GMS line, Yu98-8A. A total of 2,412 genes were identified as significant differentially expressed genes (DEGs before and during the critical pollen abortion stages. Bioinformatics and biochemical analysis showed that the DEGs mainly associated with sugars and starch metabolism, oxidative phosphorylation, and plant endogenous hormones play a critical and complicated role in pollen abortion. These findings extend a better understanding of the molecular events involved in the regulation of pollen abortion in genic male sterile cotton, which may provide a foundation for further research studies on cotton heterosis breeding.
Raman spectroscopy differentiates between sensitive and resistant multiple myeloma cell lines
Franco, Domenico; Trusso, Sebastiano; Fazio, Enza; Allegra, Alessandro; Musolino, Caterina; Speciale, Antonio; Cimino, Francesco; Saija, Antonella; Neri, Fortunato; Nicolò, Marco S.; Guglielmino, Salvatore P. P.
2017-12-01
Current methods for identifying neoplastic cells and discerning them from their normal counterparts are often nonspecific and biologically perturbing. Here, we show that single-cell micro-Raman spectroscopy can be used to discriminate between resistant and sensitive multiple myeloma cell lines based on their highly reproducible biomolecular spectral signatures. In order to demonstrate robustness of the proposed approach, we used two different cell lines of multiple myeloma, namely MM.1S and U266B1, and their counterparts MM.1R and U266/BTZ-R subtypes, resistant to dexamethasone and bortezomib, respectively. Then, micro-Raman spectroscopy provides an easily accurate and noninvasive method for cancer detection for both research and clinical environments. Characteristic peaks, mostly due to different DNA/RNA ratio, nucleic acids, lipids and protein concentrations, allow for discerning the sensitive and resistant subtypes. We also explored principal component analysis (PCA) for resistant cell identification and classification. Sensitive and resistant cells form distinct clusters that can be defined using just two principal components. The identification of drug-resistant cells by confocal micro-Raman spectroscopy is thus proposed as a clinical tool to assess the development of resistance to glucocorticoids and proteasome inhibitors in myeloma cells.
International Nuclear Information System (INIS)
Janat, M.; Kalhout, A.
2007-04-01
Field experiment was conducted over two growing seasons to assess different planting densities of cotton variety Aleppo 118 (71.000, 57.000, 48.000, 41.000, 33.500 plants /ha), and two irrigation systems; one irrigation line per one planting row and one irrigation line per two planting rows. Nitrogen fertilizer (120 kg N/ha) as Urea (46% N) was injected through the irrigation system in six equally split applications. A labeled area (1.0 m 2 ) was established for the labeled sub plots and labeled Urea was applied to the labeled sub plots in the same manner as for unlabeled N fertilizer. Irrigation scheduling was accomplished using the direct method of neutron scattering technique. Irrigation was determined when the soil moisture content in the active root depth reached almost 80% of the field capacity. The amount of water applied for one line / one row were 6738 and 9149 m 3 /ha, whereas, for one line/two rows were 7489 and 12653 m 3 / ha for the two growing seasons 2004 and 2005 respectively. The objectives of the experiment were to evaluate the effect of different planting densities and two irrigation system on cotton yield, lint properties, dry matter yield, N-uptake, chlorophyll content and leaf area. The experimental design was randomized block design with 6 replications for each irrigation method. Results revealed that no significant differences between all different plant densities were recorded for all growth parameters tested in this study such as seed cotton yield, dry matter yield, lint properties, chlorophyll content and leaf area.(author)
Directory of Open Access Journals (Sweden)
Bálint Tegze
Full Text Available BACKGROUND: Developing chemotherapy resistant cell lines can help to identify markers of resistance. Instead of using a panel of highly heterogeneous cell lines, we assumed that truly robust and convergent pattern of resistance can be identified in multiple parallel engineered derivatives of only a few parental cell lines. METHODS: Parallel cell populations were initiated for two breast cancer cell lines (MDA-MB-231 and MCF-7 and these were treated independently for 18 months with doxorubicin or paclitaxel. IC50 values against 4 chemotherapy agents were determined to measure cross-resistance. Chromosomal instability and karyotypic changes were determined by cytogenetics. TaqMan RT-PCR measurements were performed for resistance-candidate genes. Pgp activity was measured by FACS. RESULTS: All together 16 doxorubicin- and 13 paclitaxel-treated cell lines were developed showing 2-46 fold and 3-28 fold increase in resistance, respectively. The RT-PCR and FACS analyses confirmed changes in tubulin isofom composition, TOP2A and MVP expression and activity of transport pumps (ABCB1, ABCG2. Cytogenetics showed less chromosomes but more structural aberrations in the resistant cells. CONCLUSION: We surpassed previous studies by parallel developing a massive number of cell lines to investigate chemoresistance. While the heterogeneity caused evolution of multiple resistant clones with different resistance characteristics, the activation of only a few mechanisms were sufficient in one cell line to achieve resistance.
Hypoxia-induced resistance to doxorubicin and methotrexate in human melanoma cell lines in vitro.
Sanna, K; Rofstad, E K
1994-07-15
Rodent cell lines can develop resistance to doxorubicin and methotrexate during hypoxic stress. This has so far not been observed in human tumor cell lines. The purpose of our communication is to show that doxorubicin and methotrexate resistance can also develop in human melanoma cells during exposure to hypoxia. Four cell lines (BEX-c, COX-c, SAX-c, WIX-c) have been studied. Cells were exposed to hypoxia (O2 concentration WIX-c. BEX-c and SAX-c were sensitive to methotrexate without hypoxia pre-treatment, whereas COX-c and WIX-c were resistant initially. Hypoxia-induced drug resistance was present immediately after reoxygenation and tended to decrease with time but remained statistically significant even 42 hr after reoxygenation.
Evaluation of disease resistance in cotton plants with reduced levels of methylated phytoalexins
The production of sesquiterpenoids in cotton tissues contribute to the plant’s constitutive and inducible defense against pathogens. In roots, gossypol (G), desoxyhemigossypol (dHG), hemigossypol (HG), and their methylated derivatives MG, DMG, dMHG, and MHG are the main defense compounds. dHG is ...
Flame retardant cotton fabrics by electron beam-induced polymerization of vinyl phosphonate oligomer
International Nuclear Information System (INIS)
Sawai, Takeshi; Ametani, Kazuo; Enomoto, Ichiro
1988-01-01
Vinyl phosphonate oligomer is presently used commercially as a cellulosic flame retardant in conjugation with N-methylol acrylamide, using a persulfate catalyst and a thermal cure. This combination can also be cured at room temperature with electron beams, as can the vinyl phosphonate alone. For the textile application, fixation of flame retardants by electron beams with low energy is one of the most promising applications. For the purpose of preparing flame resistant cotton fabrics such as bed sheets and pajamas, flame retardant curing of vinyl phosphonate oligomer on cotton fabrics was examined using electron beams from a self-sealed electron beam processor and gamma rays from a 60 Co source. A joint investigation was undertaken by the Tokyo Metropolitan Textile Research Institute and Tokyo Metropolitan Isotope Research Center to determine the feasibility of curing vinyl phosphonate oligomer on the cotton fabrics for textile finishing. (author)
U.S. Cotton Prices and the World Cotton Market: Forecasting and Structural Change
Isengildina-Massa, Olga; MacDonald, Stephen
2009-01-01
The purpose of this study was to analyze structural changes that took place in the cotton industry in recent years and develop a statistical model that reflects the current drivers of U.S. cotton prices. Legislative changes authorized the U.S. Department of Agriculture to resume publishing cotton price forecasts for the first time in 79 years. In addition, systematic problems have become apparent in the forecasting models used by USDA and elsewhere, highlighting the need for an updated review...
The Management of Insect Pests in Australian Cotton: An Evolving Story.
Wilson, Lewis J; Whitehouse, Mary E A; Herron, Grant A
2018-01-07
The Australian cotton industry progressively embraced integrated pest management (IPM) to alleviate escalating insecticide resistance issues. A systems IPM approach was used with core principles that were built around pest ecology/biology and insecticide resistance management; together, these were integrated into a flexible, year-round approach that facilitated easy incorporation of new science, strategies, and pests. The approach emphasized both strategic and tactical elements to reduce pest abundance and rationalize decisions about pest control, with insecticides as a last resort. Industry involvement in developing the approach was vital to embedding IPM within the farming system. Adoption of IPM was facilitated by the introduction of Bt cotton, availability of selective insecticides, economic validation, and an industry-wide extension campaign. Surveys indicate IPM is now embedded in industry, confirming the effectiveness of an industry-led, backed-by-science approach. The amount of insecticide active ingredient applied per hectare against pests has also declined dramatically. Though challenges remain, pest management has transitioned from reactively attempting to eradicate pests from fields to proactively managing them year-round, considering the farm within the wider landscape.
International Nuclear Information System (INIS)
Xiao Wuming; Wang Hui; Liu Yongzhu; Guo Tao; Chen Zhiqiang; Yang Qiyun; Zhu Xiaoyuan
2012-01-01
The main agronomic traits and resistance to rice blast of 34 space-induced lines from an elite rice cultivar, Zhong-er-ruan-zhan were evaluated at their SP 4 . The resistance to blast of the mutant lines had been tested by two blast isolates previously. It was found that the mutant lines showed significant difference in plant height, effective panicles, panicle length and grains per panicle etc. from their parent. The range of variation in 1000-grain weight the largest, followed by the seed-setting rate, and that of effective panicles was the least among all the traits. Except for the line Z34, 33 mutant lines had broader resistance spectra than the wild-type based on the test with 38 different blast isolates, and all the 33 lines were also resistant to the panicle blast in the field. The result confirmed that selection for resistant to blast in lower generations was reliable. Taking account of agronomic traits and blast resistance, promising lines with resistance to blast and good agronomic characters could be selected from those mutant lines. Therefore, the elite rice germplasm with enhanced disease resistance can be produced. (authors)
Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis).
Oliveira, Gustavo R; Silva, Maria C M; Lucena, Wagner A; Nakasu, Erich Y T; Firmino, Alexandre A P; Beneventi, Magda A; Souza, Djair S L; Gomes, José E; de Souza, José D A; Rigden, Daniel J; Ramos, Hudson B; Soccol, Carlos R; Grossi-de-Sa, Maria F
2011-09-09
The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.
Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis
Directory of Open Access Journals (Sweden)
Gomes José E
2011-09-01
Full Text Available Abstract Background The cotton boll weevil (Anthonomus grandis is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Results Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. Conclusions The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.
International Nuclear Information System (INIS)
Breier, A.; Uhrik, B.; Barancik, M.; Stefankova, Z.; Tribulova, N.
1994-01-01
Effect of pentoxifylline (PTX) on vincristine (VCR) resistance of multidrug resistant L1210/VCR mouse leukemic cell line was studied. Reversal effect of PTX (in concentration 50-150 mg dm -3 ) on vincristine resistance, i.e. potentiation of vincristine cytotoxicity on L1210/VCR cells by PTX was found. PTX alone in the above concentration did not exert any significant effect on sensitive or resistant cell lines in the absence of vincristine. Resistance of L1210/VCR cell line was found previously to be accompanied with overexpression of drug transporting P-glycoprotein. Indeed, lower level of 3 H-vincristine accumulation by resistant L1210/VCR cell line in comparison with sensitive L1210 cell line was observed. Accumulation of 3 H-vincristine by L1210/VCR cell line was significantly increased in the presence of PTX. PTX in the same condition did not exert any considerable effect on accumulation of 3 H-vincristine by nonresistant L1210 cells. Observable morphological damage was observed in 1210/VCR cells cultivated in medium containing vincristine (0.2 mg dm -3 ) and pentoxifylline (100 mg dm -3 ) in comparison with the non-damaged cells in the presence of vincristine or pentoxifylline alone. The results obtained indicate that pentoxifylline may be considered as a reversal agent in multidrug resistance. (author)
Afzal, M B S; Shad, S A
2016-06-01
Cotton mealybug Phenacoccus solenopsis (Tinsley) (Homoptera: Pseudococcidae) is a sucking pest of worldwide importance causing huge losses by feeding upon cotton in various parts of the world. Because of the importance of this pest, this research was carried out to select emamectin resistance in P. solenopsis in the laboratory to study cross-resistance, stability, realized heritability, and fitness cost of emamectin resistance. After selection from third generation (G3) to G6, P. solenopsis developed very high emamectin resistance (159.24-fold) when compared to a susceptible unselected population (Unsel pop). Population selected to emamectin benzoate conferred moderate (45.81-fold), low (14.06-fold), and no cross-resistance with abamectin, cypermethrin, and profenofos, respectively compared to the Unsel pop. A significant decline in emamectin resistance was observed in the resistant population when not exposed to emamectin from G7 to G13. The estimated realized heritability (h (2)) for emamectin resistance was 0.84. A high fitness cost was associated with emamectin resistance in P. solenopsis. Results of this study may be helpful in devising insecticide resistance management strategies for P. solenopsis.
Effects of soybean Kunitz trypsin inhibitor on the cotton boll weevil (Anthonomus grandis).
Franco, Octávio L; Dias, Simoni C; Magalhães, Claudio P; Monteiro, Ana C S; Bloch, Carlos; Melo, Francislete R; Oliveira-Neto, Osmundo B; Monnerat, Rose G; Grossi-de-Sá, Maria Fátima
2004-01-01
The cotton boll weevil, Anthonomus grandis, is an economically important pest of cotton in tropical and subtropical areas of several countries in the Americas, causing severe losses due to their damage in cotton floral buds. Enzymatic assays using gut extracts from larval and adult boll weevil have demonstrated the presence of digestive serine proteinase-like activities. Furthermore, in vitro assays showed that soybean Kunitz trypsin inhibitor (SKTI) was able to inhibit these enzymes. Previously, in vivo effects of black-eyed pea trypsin chymotrypsin inhibitor (BTCI) have been demonstrated towards the boll weevil pest. Here, when neonate larvae were reared on an artificial diet containing SKTI at three different concentrations, a reduction of larval weight of up to 64% was observed for highest SKTI concentration 500 microM. The presence of SKTI caused an increase in mortality and severe deformities of larvae, pupae and adult insects. This work therefore represents the first observation of a Kunitz trypsin inhibitor active in vivo and in vitro against A. grandis. Bioassays suggested that SKTI could be used as a tool in engineering crop plants, which might exhibit increased resistance against cotton boll weevil.
Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.
2006-01-01
The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this paper is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the
Bouwhuis, G.H. (Gerrit); Brinks, G.J. (Ger); Groeneveld, R.A.J. (Richard); Oelerich, J. (Jens)
2014-01-01
The recycling of post consumer cotton textile waste is highly requested, due to the high environmental impact of cotton production. Often cotton is mixed in blends with polyethylene terephthalate (PET). For the generation of high value products from recycled cotton, it essential that PET is
Directory of Open Access Journals (Sweden)
Peng Han
Full Text Available The cotton aphid Aphis gossypii Glover is the main aphid pest in cotton fields in the Yangtze River Valley Cotton-planting Zone (YRZ in central China. Various natural enemies may attack the cotton aphid in Bt cotton fields but no studies have identified potential specific top-down forces that could help manage this pest in the YRZ in China. In order to identify possibilities for managing the cotton aphid, we monitored cotton aphid population dynamics and identified the effect of natural enemies on cotton aphid population growth using various exclusion cages in transgenic Cry1Ac (Bt+CpTI (Cowpea trypsin inhibitor cotton field in 2011. The aphid population growth in the open field (control was significantly lower than those protected or restricted from exposure to natural enemies in the various exclusion cage types tested. The ladybird predator Propylaea japonica Thunberg represented 65% of Coccinellidae predators, and other predators consisted mainly of syrphids (2.1% and spiders (1.5%. The aphid parasitoids Aphidiines represented 76.7% of the total count of the natural enemy guild (mainly Lysiphlebia japonica Ashmead and Binodoxys indicus Subba Rao & Sharma. Our results showed that P. japonica can effectively delay the establishment and subsequent population growth of aphids during the cotton growing season. Aphidiines could also reduce aphid density although their impact may be shadowed by the presence of coccinellids in the open field (likely both owing to resource competition and intraguild predation. The implications of these results are discussed in a framework of the compatibility of transgenic crops and top-down forces exerted by natural enemy guild.
Mutant lines of currant tomato, valuable germplasm with multiple disease resistance
International Nuclear Information System (INIS)
Govorova, G.F.; Khrustaleva, V.V.; Shcherbakov, V.K.
1987-01-01
Studies were carried out for two years on eight mutant lines of currant tomato at the Krymsk Experimental Breeding Station of the N.I. Vavilov All-Union Scientific Research Institute of Plant-Growing (VIR). The station is situated in an area of commercial field tomato growing (Krasnodar region). The mutant lines of currant tomato (VIR specimen No. k-4053) were obtained through chronic gamma-irradiation. A disease resistance evaluation of the mutants was carried out for Verticillium wilt (Verticillium albo-atrum Rein. and Berth.), for black bacterial spotting (Xanthomonas vesicatoria Dows.), for tobacco mosaic virus Nicotiana 1 Smith), for streak virus (Nicotiana 1), for the combination TMV with X and Y potato viruses, for cucumber virus (Cucumis 1), and also for top rot. Fifty plants of each mutant line were evaluated and checks were made three times in each season. A comparison of the currant tomato mutants with the standard tomato varieties demonstrates the better resistance shown by the mutant germplasm to the main pathogens. The degree to which some currant tomato mutants were affected by Verticillium was lower than that of the most VerticiIlium-resistant samples of tomato evaluated between 1975 and 1981. The mutants of currant tomato should therefore be of interest as germplasm in breeding tomatoes for improved multiple disease resistance
Molina, Ricardo; Teixidó, Josep Maria; Kan, Chi-Wai; Jovančić, Petar
2017-02-15
Plasma polymerization using hydrophobic monomers in the gas phase is a well-known technology to generate hydrophobic coatings. However, synthesis of functional hydrophobic coatings using plasma technology in liquids has not yet been accomplished. This work is consequently focused on polymerization of a liquid fluorinated monomer on cotton fabric initiated by atmospheric plasma in a dielectric barrier discharge configuration. Functional hydrophobic coatings on cotton were successfully achieved using in situ atmospheric plasma-initiated polymerization of fluorinated monomer dissolved in ethanol. Gravimetric measurements reveal that the amount of polymer deposited on cotton substrates can be modulated with the concentration of monomer in ethanol solution, and cross-linking reactions occur during plasma polymerization of a fluorinated monomer even without the presence of a cross-linking agent. FTIR and XPS analysis were used to study the chemical composition of hydrophobic coatings and to get insights into the physicochemical processes involved in plasma treatment. SEM analysis reveals that at high monomer concentration, coatings possess a three-dimensional pattern with a characteristic interconnected porous network structure. EDX analysis reveals that plasma polymerization of fluorinated monomers takes place preferentially at the surface of cotton fabric and negligible polymerization takes place inside the cotton fabric. Wetting time measurements confirm the hydrophobicity of cotton coatings obtained although equilibrium moisture content was slightly decreased. Additionally, the abrasion behavior and resistance to washing of plasma-coated cotton has been evaluated.
Baffes, John
2005-01-01
Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...
Directory of Open Access Journals (Sweden)
Dereje Berihun Sitotaw
2017-01-01
Full Text Available The tensile properties such as tensile strength which is measured as breaking force in Newton (N and elongation percent (% at break of single jersey and 1×1 rib (knitted with full needles knitted fabrics made from 100% cotton and cotton/Lycra yarns (5% Lycra yarn content in 95% combed cotton yarn are investigated in this research. The sample fabrics are conditioned for 24 hours at 20±1°C temperature and 65±2% relative humidity before testing. Ten specimens (five for lengthwise and five for widthwise have been taken from each of the two knitted structures, those made from 100% cotton and cotton/Lycra (at 95/5 percent ratio blend yarns. According to the discussion and as found from the investigations, the tensile properties of single jersey and 1×1 rib knitted fabrics made from 100% cotton and cotton/Lycra yarns are significantly different from each other and both of the knitted fabrics have high elongation percent at break with cotton/Lycra blend yarns as compared to 100% cotton yarn. Knitted fabrics made from cotton/Lycra blended yarn have low breaking force and high elongation percent at break relative to knitted fabrics made from 100% cotton yarns.
Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming
2017-10-01
Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.
Genome Editing in Cotton with the CRISPR/Cas9 System
Directory of Open Access Journals (Sweden)
Wei Gao
2017-08-01
Full Text Available Genome editing is an important tool for gene functional studies as well as crop improvement. The recent development of the CRISPR/Cas9 system using single guide RNA molecules (sgRNAs to direct precise double strand breaks in the genome has the potential to revolutionize agriculture. Unfortunately, not all sgRNAs are equally efficient and it is difficult to predict their efficiency by bioinformatics. In crops such as cotton (Gossypium hirsutum L., with labor-intensive and lengthy transformation procedures, it is essential to minimize the risk of using an ineffective sgRNA that could result in the production of transgenic plants without the desired CRISPR-induced mutations. In this study, we have developed a fast and efficient method to validate the functionality of sgRNAs in cotton using a transient expression system. We have used this method to validate target sites for three different genes GhPDS, GhCLA1, and GhEF1 and analyzed the nature of the CRISPR/Cas9-induced mutations. In our experiments, the most frequent type of mutations observed in cotton cotyledons were deletions (∼64%. We prove that the CRISPR/Cas9 system can effectively produce mutations in homeologous cotton genes, an important requisite in this allotetraploid crop. We also show that multiple gene targeting can be achieved in cotton with the simultaneous expression of several sgRNAs and have generated mutations in GhPDS and GhEF1 at two target sites. Additionally, we have used the CRISPR/Cas9 system to produce targeted gene fragment deletions in the GhPDS locus. Finally, we obtained transgenic cotton plants containing CRISPR/Cas9-induced gene editing mutations in the GhCLA1 gene. The mutation efficiency was very high, with 80.6% of the transgenic lines containing mutations in the GhCLA1 target site resulting in an intense albino phenotype due to interference with chloroplast biogenesis.
Genetics of the ovule fuzzless trait in Gossypium arboreum germplasm line PI 615737
The diploid cotton species Gossypium arboreum possesses many favorable agronomic traits such as drought tolerance and disease resistance, which can be utilized in the development of improved upland cotton cultivars. The USDA National Plant Germplasm System maintains more than 1,600 G. arboreum acces...
Transcriptome analysis of cytoplasmic male sterility and restoration in CMS-D8 cotton.
Suzuki, Hideaki; Rodriguez-Uribe, Laura; Xu, Jiannong; Zhang, Jinfa
2013-10-01
A global view of differential expression of genes in CMS-D8 of cotton was presented in this study which will facilitate the understanding of cytoplasmic male sterility in cotton. Cytoplasmic male sterility (CMS) is a maternally inherited trait in higher plants which is incapable of producing functional pollen. However, the male fertility can be restored by one or more nuclear-encoded restorer genes. A genome-wide transcriptome analysis of CMS and restoration in cotton is currently lacking. In this study, Affymetrix GeneChips© Cotton Genome Array containing 24,132 transcripts was used to compare differentially expressed (DE) genes of flower buds at the meiosis stage between CMS and its restorer cotton plants conditioned by the D8 cytoplasm. A total of 458 (1.9 %) of DE genes including 127 up-regulated and 331 down-regulated ones were identified in the CMS-D8 line. Quantitative RT-PCR was used to validate 10 DE genes selected from seven functional categories. The most frequent DE gene group was found to encode putative proteins involved in cell wall expansion, such as pectinesterase, pectate lyase, pectin methylesterase, glyoxal oxidase, polygalacturonase, indole-3-acetic acid-amino synthetase, and xyloglucan endo-transglycosylase. Genes in cytoskeleton category including actin, which plays a key role in cell wall expansion, cell elongation and cell division, were also highly differentially expressed between the fertile and CMS plants. This work represents the first study in utilizing microarray to identify CMS-related genes by comparing overall DE genes between fertile and CMS plants in cotton. The results provide evidence that many CMS-associated genes are mainly involved in cell wall expansion. Further analysis will be required to elucidate the molecular mechanisms of male sterility which will facilitate the development of new hybrid cultivars in cotton.
International Nuclear Information System (INIS)
Zhang, Ping; Zhang, Zhiyuan; Zhou, Xiaojian; Qiu, Weiliu; Chen, Fangan; Chen, Wantao
2006-01-01
Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differentiated tongue squamous cell carcinoma. Global gene expression in this resistant cell line and its sensitive parent cell line was analyzed using Affymetrix HG-U95Av2 microarrays. Candidate genes involved in DNA repair, the MAP pathway and cell cycle regulation were chosen to validate the microarray analysis results. Cell cycle distribution and apoptosis following cisplatin exposure were also investigated. Cisplatin resistance in Tca/cisplatin cells was stable for two years in cisplatin-free culture medium. The IC50 for cisplatin in Tca/cisplatin was 6.5-fold higher than that in Tca8113. Microarray analysis identified 38 genes that were up-regulated and 25 that were down-regulated in this cell line. Some were novel candidates, while others are involved in well-characterized mechanisms that could be relevant to cisplatin resistance, such as RECQL for DNA repair and MAP2K6 in the MAP pathway; all the genes were further validated by Real-time PCR. The cell cycle-regulated genes CCND1 and CCND3 were involved in cisplatin resistance; 24-hour exposure to 10 μM cisplatin induced a marked S phase block in Tca/cisplatin cells but not in Tca8113 cells. The Tca8113 cell line and its stable drug-resistant variant Tca/cisplatin provided a useful model for identifying candidate genes responsible for the mechanism of cisplatin resistance in oral squamous cell carcinoma. Our data provide a useful basis for screening candidate targets for early diagnosis and further intervention in cisplatin resistance
Directory of Open Access Journals (Sweden)
Zhang Ping
2006-09-01
Full Text Available Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differentiated tongue squamous cell carcinoma. Global gene expression in this resistant cell line and its sensitive parent cell line was analyzed using Affymetrix HG-U95Av2 microarrays. Candidate genes involved in DNA repair, the MAP pathway and cell cycle regulation were chosen to validate the microarray analysis results. Cell cycle distribution and apoptosis following cisplatin exposure were also investigated. Results Cisplatin resistance in Tca/cisplatin cells was stable for two years in cisplatin-free culture medium. The IC50 for cisplatin in Tca/cisplatin was 6.5-fold higher than that in Tca8113. Microarray analysis identified 38 genes that were up-regulated and 25 that were down-regulated in this cell line. Some were novel candidates, while others are involved in well-characterized mechanisms that could be relevant to cisplatin resistance, such as RECQL for DNA repair and MAP2K6 in the MAP pathway; all the genes were further validated by Real-time PCR. The cell cycle-regulated genes CCND1 and CCND3 were involved in cisplatin resistance; 24-hour exposure to 10 μM cisplatin induced a marked S phase block in Tca/cisplatin cells but not in Tca8113 cells. Conclusion The Tca8113 cell line and its stable drug-resistant variant Tca/cisplatin provided a useful model for identifying candidate genes responsible for the mechanism of cisplatin resistance in oral squamous cell carcinoma. Our data provide a useful basis for screening candidate targets for early diagnosis
Directory of Open Access Journals (Sweden)
Wee Tek Tay
2015-11-01
Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the
USVL-380, A zucchini yellow mosaic virus resistant watermelon breeding line
We report the development of a novel watermelon line ‘USVL-380’ [Citrullus lanatus (Thunb.) Matsum. & Nakai] resistant to the zucchini yellow mosaic virus-Florida strain (ZYMV-FL). This breeding line is homozygous for the recessive eukaryotic elongation factor eIF4E allele associated with ZYMV-resis...
Chen, Yu; Wang, Yingying; Zhao, Ting; Yang, Jianwei; Feng, Shouli; Nazeer, Wajad; Zhang, Tianzhen; Zhou, Baoliang
2015-01-01
Gossypium arboreum, a cultivated cotton species (2n = 26, AA) native to Asia, possesses invaluable characteristics unavailable in the tetraploid cultivated cotton gene pool, such as resistance to pests and diseases and tolerance to abiotic stresses. However, it is quite difficult to transfer favorable traits into Upland cotton through conventional methods due to the cross-incompatibility of G. hirsutum (2n = 52, AADD) and G. arboreum. Here, we improved an embryo rescue technique to overcome the cross-incompatibility between these two parents for transferring favorable genes from G. arboreum into G. hirsutum. Our results indicate that MSB2K supplemented with 0.5 mgl-1 kinetin and 250 mg-1 casein hydrolysate is an efficient initial medium for rescuing early (3 d after pollination) hybrid embryos. Eight putative hybrids were successfully obtained, which were further verified and characterized by cytology, molecular markers and morphological analysis. The putative hybrids were subsequently treated with different concentrations of colchicine solution to double their chromosomes. The results demonstrate that four putative hybrid plants were successfully chromosome-doubled by treatment with 0.1% colchicine for 24 h and become amphiploid, which were confirmed by cytological observation, self-fertilization and backcrossing. Preliminary assessments of resistance at seedling stage indicate that the synthetic amphiploid showed highly resistant to Verticillium and drought. The synthetic amphiploid between G. hirsutum × G. arboreum would lay the foundation for developing G. arboreum-introgressed lines with the uniform genetic background of G. hirsutum acc TM-1, which would greatly enhance and simplify the mining, isolation, characterization, cloning and use of G. arboreum-specific desirable genes in future cotton breeding programs. PMID:26061996
Sakthivel, Seethalakshmi; Habeeb, S K M; Raman, Chandrasekar
2018-03-12
Cotton is an economically important crop and its production is challenged by the diversity of pests and related insecticide resistance. Identification of the conserved target across the cotton pest will help to design broad spectrum insecticide. In this study, we have identified conserved sequences by Expressed Sequence Tag profiling from three cotton pests namely Aphis gossypii, Helicoverpa armigera, and Spodoptera exigua. One target protein arginine kinase having a key role in insect physiology and energy metabolism was studied further using homology modeling, virtual screening, molecular docking, and molecular dynamics simulation to identify potential biopesticide compounds from the Zinc natural database. We have identified four compounds having excellent inhibitor potential against the identified broad spectrum target which are highly specific to invertebrates.
The water footprint of cotton consumption
Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.
2005-01-01
The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the
Malaquias, J B; Ramalho, F S; Omoto, C; Godoy, W A C; Silveira, R F
2014-03-01
Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is one of the most common asopine species in the neotropical region and its occurrence was reported in several countries of South and Central America, as an important biological control agent for many crops. This study was carried out to identify the imidacloprid impacts on the functional response of predator P. nigrispinus fed on Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) strain resistant to lambda-cyhalothrin, on Bt cotton expressing Cry1Ac (Bollgard(®)). Spodoptera frugiperda larvae were used in the following conditions: resistant (1) and susceptible (2) strains to lambda-cyhalothrin fed on Bollgard(®) cotton leaves (DP 404 BG); and resistant (3) and susceptible (4) strains to lambda-cyhalothrin fed on non-genetically modified cotton leaves (cultivar DP4049). The predatory behavior of P. nigrispinus was affected by imidacloprid and the type II asymptotic curve was the one that best described the functional response data. Handling time (T h ) of predator females did not differ among treatments in the presence of imidacloprid. The attack rate did decrease, however, due to an increase in the density of larvae offered. Regardless of the treatment (S. frugiperda strain or cotton cultivar), the predation of P. nigrispinus females on S. frugiperda larvae was significantly lower when exposed to imidacloprid, especially at a density of 16 larvae/predator. The predation behavior of P. nigrispinus on S. frugiperda larvae is affected by the insecticide imidacloprid showing that its applications should be used in cotton crop with caution.
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
The growth, development and consumption of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls grown under elevated CO2 (double-ambient vs. ambient) in open-top chambers were examined. Significant decreases in protein, total amino acid, water and nitrogen content and increases in free fatty acid were observed in cotton bolls. Changes in quality of cotton bolls affected the growth, development and food utilization of H. armigera. Significantly longer larval development duration in three successive generations and lower pupal weight of the second and third generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower fecundity was also found in successive three generations of H. armigera fed on cotton bolls grown under elevated CO2. The consumption per larva occurred significant increase in successive three generations and frass per larva were also significantly increased during the second and third generations under elevated CO2. Significantly lower relative growth rate, efficiency of conversion of ingested food and significant higher relative consumption rate in successive three generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower potential female fecundity, larval numbers and population consumption were found in the second and third generations of cotton bollworm fed on cotton bolls grown under elevated CO2. The integrative effect of higher larval mortality rate and lower adult fecundity resulted in significant decreases in potential population consumption in the latter two generations. The results show that elevated CO2 adversely affects cotton bolls quality, which indicates the potential population dynamics and potential population consumption of cotton bollworm will alleviate the harm to the plants in the future rising CO2 atmosphere.
Directory of Open Access Journals (Sweden)
Giovani Greigh Brito
2014-07-01
Full Text Available The initial goal of this study was to measure the efficiency of carbon isotope discrimination (Δ in distinguishing between cotton plant genotypes subjected to two water regimes. In addition, ∆ measurements, leaf water potential and gas exchange ratios were monitored. Using Brazilian breeding lines, this study also tested the usability of ∆ as a proxy for selecting high-performing yield components in cotton plants grown in unfavorable conditions, particularly water deficiency. For these experiments, ∆ and yield components were measured and their correlations analyzed. Differences among cotton genotypes for Δ (p < 0.0001 were verified, and it was found that this variable was significantly correlated with gas exchange. There was a significant positive correlation between Δ and seed cotton yield only in the site experiencing severe water deficiency (Santa Helena de Goiás. However, Δ had a significant negative correlation with fiber percentage. Our results indicate that Δ is a suitable tool for cotton phenotyping, and it may be applied in cotton breeding programs that aim to produce high-performing yield components in unfavorable conditions.
Evaluation of cotton stalks destroyers
Bianchini, Aloisio; Borges, Pedro H. de M.
2013-01-01
The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...
Cotton : Market setting, trade policies, and issues
Baffes, John
2004-01-01
The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...
Image processing for stripper harvested cotton trash content measurement a progress report
This study was initiated to provide the basis for obtaining on-line information as to the levels of the various types of gin trash. The objective is to provide the ginner with knowledge of the quantity of the various trash components in the raw uncleaned seed cotton. This information is currently no...
Creation and evaluation of best cotton mutant lines
International Nuclear Information System (INIS)
Rastegari, S. J.; Hosseini, Z.
2001-01-01
During (1997-1999) a study was carried out to recognize the best mutant lines, which were already obtained from a mutation breeding project. A Triple Rectangular Latis Design (8 7) in form of randomized complete blocks (RCB) with fifty- six treatments and three replications, were used in Estahban, Kordkouy and Varamin, under different ecological conditions, rainfall (Kordkouy) desert (Varamin) hot and dry (Estahban). During growing season some important morphological characteristics were recorded. Some lines had specific characters, for example: line 3191 (Chirpan 150 gray) had a low leaf number per plant, line 3169 (Bakhtegan 200 gray) plants were clustered. The results of the data in Varamin station showed that Bakhtegan irradiated with 150 gray line 3485 and Tashkand with 300 gray line 3451 compared to check (Varamin with 4373 kg/ha) had highest yield with 4942 kg/ha, and 4871 kg/ha respectively. In view of boll weight line 3405 of Sahel irradiated with 200 gray had highest boll weight (6.5 g/boll). In Kordkouy station the best mutant line was Chirpan irradiated with 250 gray, line 3208, with 20% yield increase compared to Sahel and 30% yield increase compared to original Chirpan. In respect to irradiation effect on lint percentage and fiber quality, the results showed; there was a positive effect on lint percentage of all varieties, especially in Tashkant, Bakhtegan and Chirpan which are inherently weak in lint percentage. As a whole gamma radiation did not have any negative effect on fiber quality. Even in Estahban 1.6 to 2.4 mm fiber increase were observed in some Chirpan irradiated material (C150-3516) and (C200-3523)
Carbon contributions from roots in cotton based rotations
Tan, D. K. Y.; Hulugalle, N. R.
2012-04-01
Most research on the decline in soil organic carbon (SOC) stocks in Australian cotton farming systems has focussed on the inputs from above-ground crop residues, with contribution from roots being less studied. This paper aims to outline the contribution of cotton roots and roots of other crops to soil carbon stocks in furrow-irrigated Vertisols in several cotton (Gossypium hirsutum L.)-based rotations. Data was collected from cotton-based rotation systems: cotton monoculture, cotton-vetch (Vicia benghalensis) Roth.), cotton-wheat (Triticum aestivum L.), cotton-wheat-vetch, cotton-corn, corn-corn, cotton-sorghum (Sorghum bicolor L.) and from BollgardTM II (Bt) and non-Bt cotton. Land management systems were permanent beds, with or without standing stubble, and conventional tillage. Root growth in the surface 0.10 m was measured with the core-break method, and that in the 0.10 to 1.0 m depth with a minirhizotron and I-CAP image capture system. These measurements were used to derive root C added to soil through intra-seasonal root death (Clost), C in roots remaining at the end of season (Croot), and total root C added to soil (Ctotal = Croot + Clost). Ctotal in non-Bt cotton (Sicot 80RRF, 0.9 t C/ha/year) was higher than in Bt cotton (Sicot 80RRF, 0.6 t C/ha/year). Overall, Ctotal from cotton roots ranges between 0.5 to 5 t C/ha/year, with Clost contributing 25-70%. Ctotal was greater with vetch than with wheat and was in the order of vetch in cotton-wheat-vetch (5.1 t C/ha/year) > vetch in cotton-vetch (1.9 t C/ha/year) > wheat in cotton-wheat (1.6 t C/ha/year) = wheat in cotton-wheat-vetch (1.7 t C/ha/year). Intra-seasonal root mortality accounted for 12% of total root carbon in vetch and 36% in wheat. Average corn Ctotal with monoculture was 9.3 t/ha and with cotton-corn 5.0 t/ha. Ctotal averaged between both treatments was, thus, of the order of 7.7 t C/ha/year and average Clost 0.04 t/ha/yr. Sorghum roots contributed less carbon with conventional tillage (8.2 t
Kumar, Jitendra; Gunapati, Samatha; Alok, Anshu; Lalit, Adarsh; Gadre, Rekha; Sharma, Naresh C; Roy, Joy K; Singh, Sudhir P
2015-05-01
Cotton leaf curl disease (CLCuD) is a serious disease of cotton on the Indian subcontinent. In the present study, three cotton leaf curl viruses, cotton leaf curl Burewala virus (CLCuBuV), cotton leaf curl Kokhran virus (CLCuKoV) and cotton leaf curl Multan virus (CLCuMV), and their associated satellites, cotton leaf curl Multan betasatellite (CLCuMB) and cotton leaf curl Multan alphasatellite (CLCuMA), were detected. CLCuBuV with either intact (CLCuBuV-1) or mutant (CLCuBuV-2) transcriptional activator protein (TrAP) were detected in different plants. Agroinoculation with CLCuBuV-1 or CLCuBuV-2 together with CLCuMB and CLCuMA, resulted in typical leaf curling and stunting of tobacco plants. Inoculation with CLCuKoV or an isolate of CLCuMV (CLCuMV-2), together with CLCuMB and CLCuMA, induced severe leaf curling, while the other isolate of CLCuMV (CLCuMV-1), which was recombinant in origin, showed mild leaf curling in tobacco. To investigate the effect of intact or mutant TrAP and also the recombination events, CLCuBuV-1, CLCuBuV-2, CLCuMV-1 or CLCuMV-2 together with the satellites (CLCuMA and CLCuMB) were transferred to cotton via whitefly-mediated transmission. Cotton plants containing CLCuBuV-1, CLCuBuV-2 or CLCuMV-2 together with satellites showed curling and stunting, whereas the plants having CLCuMV-1 and the satellites showed only mild and indistinguishable symptoms. CLCuBuV-1 (intact TrAP) showed severe symptoms in comparison to CLCuBuV-2 (mutant TrAP). The present study reveals that two types of CLCuBuV, one with an intact TrAP and the other with a mutant TrAP, exist in natural infection of cotton in India. Additionally, CLCuMuV-1, which has a recombinant origin, induces mild symptoms in comparison to the other CLCuMV isolates.
Overexpression of c-Jun contributes to sorafenib resistance in human hepatoma cell lines.
Directory of Open Access Journals (Sweden)
Yuki Haga
Full Text Available Despite recent advances in treatment strategies, it is still difficult to cure patients with hepatocellular carcinoma (HCC. Sorafenib is the only approved multiple kinase inhibitor for systemic chemotherapy in patients with advanced HCC. The majority of advanced HCC patients are resistant to sorafenib. The mechanisms of sorafenib resistance are still unknown.The expression of molecules involved in the mitogen-activated protein kinase (MAPK signaling pathway in human hepatoma cell lines was examined in the presence or absence of sorafenib. Apoptosis of human hepatoma cells treated with sorafenib was investigated, and the expression of Jun proto-oncogene (c-Jun was measured.The expression and phosphorylation of c-Jun were enhanced in human hepatoma cell lines after treatment with sorafenib. Inhibiting c-Jun enhanced sorafenib-induced apoptosis. The overexpression of c-Jun impaired sorafenib-induced apoptosis. The expression of osteopontin, one of the established AP-1 target genes, was enhanced after treatment with sorafenib in human hepatoma cell lines.The protein c-Jun plays a role in sorafenib resistance in human hepatoma cell lines. The modulation and phosphorylation of c-Jun could be a new therapeutic option for enhancing responsiveness to sorafenib. Modulating c-Jun may be useful for certain HCC patients with sorafenib resistance.
Directory of Open Access Journals (Sweden)
Yunhe Li
Full Text Available The ladybird beetle, Coleomegilla maculata (DeGeer, is a common and abundant predator in many cropping systems. Its larvae and adults are predaceous, feeding on aphids, thrips, lepidopteran larvae and plant tissues, such as pollen. Therefore, this species is exposed to insecticidal proteins expressed in insect-resistant, genetically engineered cotton expressing Cry proteins derived from Bacillus thuringiensis (Bt. A tritrophic bioassay was conduced to evaluate the potential impact of Cry2Ab- and Cry1Ac-expressing cotton on fitness parameters of C. maculata using Bt-susceptible and -resistant larvae of Trichoplusia ni as prey. Coleomegilla maculata survival, development time, adult weight and fecundity were not different when they were fed with resistant T. ni larvae reared on either Bt or control cotton. To ensure that C. maculata were not sensitive to the tested Cry toxins independent from the plant background and to add certainty to the hazard assessment, C. maculata larvae were fed artificial diet incorporated with Cry2Ab, Cry1Ac or both at >10 times higher concentrations than in cotton tissue. Artificial diet containing E-64 was included as a positive control. No differences were detected in any life-table parameters between Cry protein-containing diet treatments and the control diet. In contrast, larvae of C. maculata fed the E-64 could not develop to the pupal stage and the 7-d larval weight was significantly negatively affected. In both feeding assays, the stability and bioactivity of Cry proteins in the food sources were confirmed by ELISA and sensitive-insect bioassays. Our results show that C. maculata is not affected by Bt cotton and is not sensitive to Cry2Ab and Cry1Ac at concentrations exceeding the levels in Bt cotton, thus demonstrating that Bt cotton will pose a negligible risk to C. maculata. More importantly, this study demonstrates a comprehensive system for assessing the risk of genetically modified plants on non
Processing and properties of PCL/cotton linter compounds
Energy Technology Data Exchange (ETDEWEB)
Bezerra, Elieber Barros; Franca, Danyelle Campos; Morais, Dayanne Diniz de Souza; Araujo, Edcleide Maria [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Departamento de Engenharia de Materiais; Rosa, Morsyleide de Freitas; Morais, Joao Paulo Saraiva [Embrapa Tropical Agroindustia, Fortaleza, CE (Brazil); Wellen, Renate Maria Ramos, E-mail: wellen.renate@gmail.com [Universidade Federal da Paraiaba (UFPB), Joao Pessoa, PB (Brazil)
2017-03-15
Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton nanolinter compounds. Adding cotton linter to PCL did not change its crystalline character as showed by XRD; however an increase in degree of crystallinity was observed by means of DSC. From mechanical tests in tension was observed an increase in ductility of PCL, and from mechanical tests in flexion an increase in elastic modulus upon addition of cotton linter, whereas impact strength presented lower values for PCL/cotton linter and PCL/cotton nanolinter compounds. SEM images showed that PCL presents plastic fracture and cotton linter has an interlacing fibril structure with high L/D ratio, which are in agreement with matrix/fibril morphology observed for PCL/cotton linter compounds. PCL/cotton linter compounds made in this work cost less than neat PCL matrix and presented improved properties making feasible its commercial use. (author)
Xia, J.
1997-01-01
Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on
Directory of Open Access Journals (Sweden)
M. Crescimanno
2009-01-01
Full Text Available The aim of our study was to evaluate the capability of a crude extract of phenols from extra virgin olive oil of Moraiolo cultivar to induce apoptosis and/or differentiation in sensitive and resistant HL60 cell lines to anticancer drugs (Typical Multidrug Resistance. Our data highlight that the crude extract is able to induce apoptosis on both sensitive and resistant cells, whereas the exposure to a number of anticancer drugs does not induce apoptosis in resistant cells. In differentiation experiments we investigated the capability of crude extract of phenols to induce the expression of CD11 granulocytic or CD14 monocytic cell surface antigen in sensitive and resistant HL60 cell lines. At IC50 dose level (17 ug/ml and 32 ug/ml respectively for sensitive and resistant cell lines, the crude extract induced differentiation associated with the expression of CD14 monocytic cell lines but not that of CD11 granulocityc cell surface antigen. Further investigations are in progress to better clarify the mechanism by which olive oil phenols induce diffentiation on this cell line.
International Nuclear Information System (INIS)
Makhdum, M.I.; Din, S.U.
2007-01-01
Water is the most limiting factor in cotton production and numerous efforts are being made to improve crop drought tolerance. A field study was conducted with the objectives to determine the effects of different application rates of glycine betaine in field grown cotton at Central Cotton Research Institute, Multan. Four levels of glycine betaine (0.0, 1.0, 3.0 and 6.0 kg ha-1) were applied at three physiological growth stages i.e. at squaring, first flower and peak flowering. Cotton cultivar CIM-448 was used as test crop. Results showed that crop sprayed with glycine betaine at the rate of 6.0 kg ha-1 maintained 120.0, 62.1, 69.7 and 35.5 percent higher net CO/sub 2/ assimilation rate (PN), transpiration rate (E), stomatal resistance (gs) and water use efficiency (PN/E), respectively over that of untreated crop. Crop spayed with glycine betaine at peak flowering stage maintained higher PN, E, gs and PN/E compared to at other stages of growth. (author)
Fungal diversity associated with verticillium wilt of cotton
International Nuclear Information System (INIS)
Khaskheli, M.I.; Sun, J.L.; Li, F.
2014-01-01
The association of fungal diversity with Verticillium wilt is rarely known, which is important to know for the control of this detrimental disease. Our study is the preliminary attempt to find the associations of fungal diversity with Verticillium wilt and provides the baseline information for biological control. About 30 different fungi from soil and 23 from cotton plants were isolated and confirmed through molecular characterization. The colony forming unit (CFU)/g dry soil of fungi before and after planting cotton showed significant variation among all the fungi. The overall frequency of all fungi for soil after sowing was significantly higher than before sowing. A. alternata, F. equiseti, F. concentricum, A. flavus, F. proliferatum, and Chaetomium sp. associated with high resistance (Arcot-1) to Verticillium wilt, whereas, V. dahliae, A.niger and Paecilomyces sp., with high susceptible (Arcot-438) germplasm. However, T. basicola, C. ramotenellum and G. intermedia were isolated from both. Soil plating was comparatively easiest than soil dilution method for the determination of frequency percentage, however, later method is useful for the screening of single spore isolation. Most of the antagonistic species were screened from soil; nevertheless, Paecilomyces and Chaetomium spp. were screened from plant and soil. In vitro test of T. longibrachiatum. T. atroviride, Paecilomyces and T. viride showed the strongest efficacy against V. dahliae. These efficient bio-agents can be used as an effective tool for other future studies regarding to Verticillium wilt of cotton. (author)
DEFF Research Database (Denmark)
Tegze, Balint; Szallasi, Zoltan Imre; Haltrich, Iren
2012-01-01
Background: Developing chemotherapy resistant cell lines can help to identify markers of resistance. Instead of using a panel of highly heterogeneous cell lines, we assumed that truly robust and convergent pattern of resistance can be identified in multiple parallel engineered derivatives of only...
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...
Development and validation of SUCROS-Cotton : A potential crop growth simulation model for cotton
Zhang, L.; Werf, van der W.; Cao, W.; Li, B.; Pan, X.; Spiertz, J.H.J.
2008-01-01
A model for the development, growth and potential production of cotton (SUCROS-Cotton) was developed. Particular attention was given to the phenological development of the plant and the plasticity of fruit growth in response to temperature, radiation, daylength, variety traits, and management. The
Indian Academy of Sciences (India)
First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...
Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens
2011-01-01
Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301
Ergonomic Evaluation of Battery Powered Portable Cotton Picker
Dixit, A.; Manes, G. S.; Singh, A.; Prakash, A.; Mahal, J. S.
2012-09-01
Ergonomic evaluation of battery powered portable manual cotton picker was carried out on two subjects for three cotton varieties and was compared against manual method of picking. It is a hand operated machine and has a pair of chain with small sharp edged teeth and sprockets and is operated by a light weight 12 V battery. Cotton gets entangled with the chain and is collected and guided into the collection bag. Average heart rate, oxygen consumption, workload, energy expenditure was more in case of cotton picking by manual cotton picker as compared to manual picking for both the subjects for all three cotton variety types. Oxygen consumption varied from 0.81 to 0.97 l/min, workload varied from 36.32 to 46.16 W and energy expenditure varied from 16.83 to 20.33 kJ/min for both the subject in case of machine picking for all three cotton varieties. The maximum discomfort experienced by the subjects during picking cotton by manual cotton picker was in right wrist palm, right forearm, upper and lower back, left shoulder and in lower legs and both feet.
After examining ear-colonizing pest resistance, 20 maize lines from the USDA-ARS germplasm enhancement of Maize (GEM) Program were evaluated for whorl-feeding fall armyworm (FAW) (Spodoptera frugiperda) resistance using four maize inbred lines as the resistant and susceptible controls. Both FAW inju...
Heterotic studies and inbreeding depression in f/sub 2/populations of upland cotton
International Nuclear Information System (INIS)
Panni, M.K.
2012-01-01
To study the genetic potential, heterotic effects and inbreeding depression, 8 X 8 F/sub 2/diallel populations with parental lines of upland cotton were grown during crop season 2010 in a randomized complete block design at Khyber Pakhtunkhwa Agricultural University Peshawar, Pakistan. Highly significant ( p = 0.01 ) variations were noticed among parental lines and F/sub 2/ populations for all the traits. According to genotypes mean performance for various traits, plant height varied from 101.60 to 126.30 cm and 98.60 to 140.60 cm, bolls plant/sup -1/ (12.87 to 19.53; 12.13 to 22.60), boll weight (3.80 to 5.01 g; 3.04 to 5.38 g) and seed cotton yield plant/sup -1/ varied from 55.74 to 85.47 g and 45.57 to 96.05 g in parental cultivars and their F/sub 2/ populations, respectively. However, 12 and 7 F/sub 2/ populations manifested significant heterosis over mid and better parents for plant height, 7 and 3 for bolls plant/sup -1/, 13 and 9 for boll weight and 13 and 5 F/sub 2/ populations for seed cotton yield plant/sup -1/, respectively. F/sub 2/ populations i.e. CIM-554 X CIM-473, CIM-554 X CIM-499, CIM-496 X SLH-284, CIM-473 X CIM-446 and CIM-554 X SLH-284 with low mean values for plant height performed better and manifested highly significant heterotic values over mid and better parents for bolls per plant, boll weight and seed cotton yield. By comparing F/sub 2/ mean values with F/sub 1/s, inbreeding depression was observed for plant height (0.66 to 23. 99%), bolls per plant (5.00 to 63.16%), boll weight (0.20 to 23.24%) and seed cotton yield (0.44 to 75.52%). However, 62% of F/sub 2/ populations revealed negative values for inbreeding depression, 14% for bolls per plant, 77% for boll weight and 21% for yield, revealed that these F/sub 2/ populations were more stable and performed better than F/sub 1/s even after segregation. Although, F/sub 2/ populations may display less heterosis as compared to F/sub 1/, but still better than high parents and can be used as
Wang, Xiao-Yan; Wen-Feng, Li; Ying-Kun, Huang; Xin, Lu; Zhi-Ming, Luo; Jiong, Yin; Hong-Li, Shan; Rong-Yue, Zhang
2013-01-01
Sugarcane brown rust disease caused by Puccinia melanocephala is one of the important fungal diseases affecting sugarcane yield around the world. Cultivar resistance is the most appropriate control method for this disease. In this study, 62 introgression lines chosen from the crossing Saccharum officinarum L. cv. Ludashi x Erianthus rockii Yunnan 95-19 were evaluated for brown rust resistance using artificial inoculation. More than 30% of the introgression lines were identified as resistant. ...
Zhang Ping; Zhang Zhiyuan; Zhou Xiaojian; Qiu Weiliu; Chen Fangan; Chen Wantao
2006-01-01
Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differe...
7 CFR 1427.1203 - Eligible ELS cotton.
2010-01-01
... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton... must be either: (1) Baled lint, including baled lint classified by USDA's Agricultural Marketing..., under the provisions of this subpart, has been made available; (2) Imported ELS cotton; (3) Raw...
Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.
de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L
2005-02-01
Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.
Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing
2017-10-01
Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.
Influence of Laundering on the Quality of Sewn Cotton and Bamboo Woven Fabrics
Directory of Open Access Journals (Sweden)
Jurgita KOŽENIAUSKIENĖ
2013-03-01
Full Text Available In the presented study the effect of laundering on the quality of sewn cotton and bamboo plain woven fabrics was investigated considering both the textile parameters and the type of chemical treatment. Quality parameters of sewn cotton and bamboo woven fabrics such as: fabric strength, seam strength and seam slippage at the moment of 4 mm seam opening were evaluated before and after washing with “Tide” washing powder without softeners or with softeners: “Surcare” and “Pflege Weicspuler”. There was also determined surface density, warp and weft densities as well as thicknesses under the pressures 0.625 kPa and 3.125 kPa, and calculated the comparative thickness that was considered as softness or porosity of fabrics. Notwithstanding that both the investigated fabrics were cellulosic their behavior after laundering was different. Under the tested conditions, unwashed and laundered with or without chemical softeners cotton fabric didn’t demonstrate seam slippage. The seam slippage resistance of laundered without or with softener specimens of bamboo fabric was increased in respect to control fabric. The larger changes in seam efficiency and seam strength because of laundering were determined for bamboo woven fabric then for cotton fabric. They could be influenced by the higher changes in bamboo fabric’s structure. The highest difference between the structure parameters of both fabrics was determined for comparative thickness. It was significantly increased for cotton fabric and decreased for bamboo fabric after chemical softening comparing to untreated fabrics.DOI: http://dx.doi.org/10.5755/j01.ms.19.1.3831
Directory of Open Access Journals (Sweden)
Anwaar H K Alvi
Full Text Available Helicoverpa armigera (Hübner is one of the most destructive pests of several field and vegetable crops, with indiscriminate use of insecticides contributing to multiple instances of resistance. In the present study we assessed whether H. armigera had developed resistance to Bt cotton and compared the results with several conventional insecticides. Furthermore, the genetics of resistance was also investigated to determine the inheritance to Cry1Ac resistance. To investigate the development of resistance to Bt cotton, and selected foliar insecticides, H. armigera populations were sampled in 2010 and 2011 in several cotton production regions in Pakistan. The resistance ratios (RR for Cry1Ac, chlorpyrifos, profenofos, cypermethrin, spinosad, indoxacarb, abamectin and deltamethrin were 580-fold, 320-, 1110-, 1950-, 200-, 380, 690, and 40-fold, respectively, compared with the laboratory susceptible (Lab-PK population. Selection of the field collected population with Cry1Ac in 2010 for five generations increased RR to 5440-fold. The selection also increased RR for deltamethrin, chlorpyrifos, profenofos, cypermethrin, spinosad, indoxacarb, abamectin to 125-folds, 650-, 2840-, 9830-, 370-, 3090-, 1330-fold. The estimated LC(50s for reciprocal crosses were 105 µg/ml (Cry1Ac-SEL female × Lab-PK male and 81 g µg/ml (Lab-PK female × Cry1Ac-SEL male suggesting that the resistance to Cry1Ac was autosomal; the degree of dominance (D(LC was 0.60 and 0.57 respectively. Mixing of enzyme inhibitors significantly decreased resistance to Cry1Ac suggesting that the resistance to Cry1Ac and other insecticides tested in the present study was primarily metabolic. Resistance to Cry1Ac was probably due to a single but unstable factor suggesting that crop rotation with non-Bt cotton or other crops could reduce the selection pressure for H. armigera and improve the sustainability of Bt cotton.
Energy usage for cotton ginning in Australia
Energy Technology Data Exchange (ETDEWEB)
Ismail, S.A. [MARA Univ. of Technology, Shah Alam (Malaysia). Faculty of Applied Sciences; Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture; Chen, G.; Baillie, C.; Symes, T. [Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture
2010-07-01
This paper reported on a study that evaluated the energy consumption of cotton gins used in Australia. The average electricity use is 52.3 kWh per bale. In practicality, the electricity consumption for different gins is correlated linearly with the bale numbers produced. The cost of electricity is therefore important in cotton ginning operations. The power factor in all the gins monitored in this study was greater than 0.85. The study showed that the use of gas dryers was highly influenced by the cotton moisture and regulated drying temperature. In general, electricity and gas consumption comprised 61 and 39 per cent of total energy use respectively. The study showed that 60.38 kg of carbon dioxide are emitted for ginning each bale of cotton. This paper described a newly developed method for monitoring the energy performance in cotton gins. Detailed monitoring and analysis carried out at 2 gin sites revealed that electricity consumption is not influenced much by changes in trash content in the module, degree of moisture and lint quality. However, the cotton variety influences the energy consumption. Cotton handling constituted nearly 50 per cent of the power used in both gins.
Gu, Mei-ying; Tang, Guang-mu; Liu, Hong-liang; Li, Zhi-qiang; Liu, Xiao-wei; Xu, Wan-li
2016-01-01
In this study, field trials were conducted to examine the effects of cotton stalk biochar on microbial population, function and structural diversity of microorganisms in rhizosphere soil of continuous cotton cropping field in Xinjiang by plate count, Biolog and DGGE methods. The experiment was a factorial design with four treatments: 1) normal fertilization with cotton stalk removed (NPK); 2) normal fertilization with cotton stalk powdered and returned to field (NPKS); 3) normal fertilization plus cotton stalk biochar at 22.50 t · hm⁻² (NPKB₁); and 4) normal fertilization plus cotton stalk biochar at 45.00 t · hm⁻² (NPKB₂). The results showed that cotton stalk biochar application obviously increased the numbers of bacteria and actinomycetes in the rhizospheric soil. Compared with NPK treatment, the number of fungi was significantly increased in the NPKB₁treatment, but not in the NPKB₂ treatment. However, the number of fungi was generally lower in the biochar amended (NPKB₁, NPKB₂) than in the cotton stalk applied plots (NPKS). Application of cotton stalk biochar increased values of AWCD, and significantly improved microbial richness index, suggesting that the microbial ability of utilizing carbohydrates, amino acids and carboxylic acids, especially phenolic acids was enhanced. The number of DGGE bands of NPKB₂ treatment was the greatest, with some species of Gemmatimonadetes, Acidobacteria, Proteobacteria and Actinobacteria being enriched. UPGMC Cluster analysis pointed out that bacterial communities in the rhizospheric soil of NPKB₂ treatment were different from those in the NPK, NPKS and NPKB₁treatments, which belonged to the same cluster. These results indicated that application of cotton stalk biochar could significantly increase microbial diversity and change soil bacterial community structure in the cotton rhizosphere soil, thus improving the health of soil ecosystem.
Influence of Tencel/cotton blends on knitted fabric performance
Directory of Open Access Journals (Sweden)
Alaa Arafa Badr
2016-09-01
Full Text Available The requirements in terms of wearing comfort with sportswear, underwear and outerwear are widely linked to the use of new fibers. Today, Tencel fiber is one of the most important developments in regenerated cellulosic fiber. However, the relation between Tencel fiber properties and fabric characteristics has not been enough studied in the literature especially the influence of fiber materials on mechanical, Ultraviolet Protection Factor (UPF and absorption properties. Therefore, in this study, knitted fabric samples were manufactured with eight different yarns with two fabric types (single jersey and single jersey with Lycra. 30/1-Ne yarns from natural and regenerated cellulosic fibers: 50% Tencel-LF/50% cotton, 67% Tencel-LF/33% cotton, 67% Tencel-STD/33% cotton, 70% bamboo/30% cotton, 100% bamboo, 100% Modal, 100% Micro-Modal and 100% cotton were employed. Then, all the produced fabrics were subjected to five cycles laundering and then flat dried. The results show that 67% Tencel-LF/33% cotton has more flexural rigidity and withdrawing handle force than 67% Tencel-STD/33% cotton fabric, while 67% Tencel-STD/33% cotton has a merit of durability during bursting test. Blending Egyptian cotton fibers with bamboo and Tencel as in 70/30% bamboo/cotton and 50/50% Tencel-LF/cotton improve UPF of the produced fabric.
Magalhães, D M; Borges, M; Laumann, R A; Sujii, E R; Mayon, P; Caulfield, J C; Midega, C A O; Khan, Z R; Pickett, J A; Birkett, M A; Blassioli-Moraes, M C
2012-12-01
The boll weevil, Anthonomus grandis, has been monitored through deployment of traps baited with aggregation pheromone components. However, field studies have shown that the number of insects caught in these traps is significantly reduced during cotton squaring, suggesting that volatiles produced by plants at this phenological stage may be involved in attraction. Here, we evaluated the chemical profile of volatile organic compounds (VOCs) emitted by undamaged or damaged cotton plants at different phenological stages, under different infestation conditions, and determined the attractiveness of these VOCs to adults of A. grandis. In addition, we investigated whether or not VOCs released by cotton plants enhanced the attractiveness of the aggregation pheromone emitted by male boll weevils. Behavioral responses of A. grandis to VOCs from conspecific-damaged, heterospecific-damaged (Spodoptera frugiperda and Euschistus heros) and undamaged cotton plants, at different phenological stages, were assessed in Y-tube olfactometers. The results showed that volatiles emitted from reproductive cotton plants damaged by conspecifics were attractive to adults boll weevils, whereas volatiles induced by heterospecific herbivores were not as attractive. Additionally, addition of boll weevil-induced volatiles from reproductive cotton plants to aggregation pheromone gave increased attraction, relative to the pheromone alone. The VOC profiles of undamaged and mechanically damaged cotton plants, in both phenological stages, were not different. Chemical analysis showed that cotton plants produced qualitatively similar volatile profiles regardless of damage type, but the quantities produced differed according to the plant's phenological stage and the herbivore species. Notably, vegetative cotton plants released higher amounts of VOCs compared to reproductive plants. At both stages, the highest rate of VOC release was observed in A. grandis-damaged plants. Results show that A. grandis uses
Yuan, W; Sui, C G; Ma, X; Ma, J
2018-05-23
Objective: To explore new multidrug resistant genes of pancreatic cancer by establishment and characterization of chemo-resistant cell lines. Methods: The cisplatin-resistant cell line JF305/CDDP and the gemcitabine-resistant cell line PANC-1/GEM were induced by high-dose intermittent treatment. CCK-8 assay was used to detect the 50% inhibiting concentration (IC(50)), drug resistance index (R), cross-resistance, and growth difference of different cells. The changes of cell cycle and migration ability of drug-resistant cells were determined by flow cytometry and transwell assay, respectively. And then real-time fluorescence quantitative PCR was used to detect the expression of multidrug resistance-related genes. Results: The drug resistance indexes of JF305/CDDP and PANC-1/GEM were 15.3 and 27.31, respectively, and there was cross-resistance. Compared with the parental cells, the proliferation rate of JF305/CDDP was decreased by 40% on the fourth day ( P PANC-1 cells upregulated MRP2 level ( P PANC-1/GEM, were successfully established. MSX2 might be a new drug resistance related gene in pancreatic cancer cells by up-regulation of MRP2 expression.
Superhydrophobic cotton by fluorosilane modification
CSIR Research Space (South Africa)
Erasmus, E
2009-12-01
Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...
Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin
2013-03-28
Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G
Endogenous superoxide dismutase and catalase activities and radiation resistance in mouse cell lines
International Nuclear Information System (INIS)
Davy, C.A.; Tesfay, Z.; Jones, J.; Rosenberg, R.C.; McCarthy, C.; Ostrand-Rosenberg, S.
1988-01-01
The relationship between the endogenous cytoplasmic levels of the enzymes superoxide dismutase and catalase and the inhibition of cell proliferation by γ-radiation has been studied in 11 mouse cell lines. The resistance of these mouse cell lines to radiation was found to vary by over 25-fold. No correlation was found between the cytoplasmic level of CuZn-superoxide dismutase or catalase and the resistance to radiation as measured by extrapolation number (EN), quasi-threshold dose (Dsub(q)), or Dsub(o). None of the cell lines had detectable cytoplasmic Mn-superoxide dismutase. The apparent Ksub(i) of potassium cyanide for mouse CuZn-superoxide dismutase was determined (Ksub(i) = 6.5 μmol dm -3 ). (author)
Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts
The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...
Red leaf lettuce breeding line with resistance to corky root, 06-810
The Agricultural Research Service, United States Department of Agriculture (USDA) announces the release of a breeding line of red leaf lettuce (Lactuca sativa L.), 06-810. The line may be suitable for commercial production, and is suitable for use as a source of resistance to corky root disease in t...
Reproduction of Meloidogyne incognita on Winter Cover Crops Used in Cotton Production.
Timper, Patricia; Davis, Richard F; Tillman, P Glynn
2006-03-01
Substantial reproduction of Meloidogyne incognita on winter cover crops may lead to damaging populations in a subsequent cotton (Gossypium hirsutum) crop. The amount of population increase during the winter depends on soil temperature and the host status of the cover crop. Our objectives were to quantify M. incognita race 3 reproduction on rye (Secale cereale) and several leguminous cover crops and to determine if these cover crops increase population densities of M. incognita and subsequent damage to cotton. The cover crops tested were 'Bigbee' berseem clover (Trifolium alexandrinum), 'Paradana' balansa clover (T. balansae), 'AU Sunrise' and 'Dixie' crimson clover (T. incarnatum), 'Cherokee' red clover (T. pratense), common and 'AU Early Cover' hairy vetch (Vicia villosa), 'Cahaba White' vetch (V. sativa), and 'Wrens Abruzzi' rye. In the greenhouse tests, egg production was greatest on berseem clover, Dixie crimson clover, AU Early Cover hairy vetch, and common hairy vetch; intermediate on Balansa clover and AU Sunrise crimson clover; and least on rye, Cahaba White vetch, and Cherokee red clover. In both 2002 and 2003 field tests, enough heat units were accumulated between 1 January and 20 May for the nematode to complete two generations. Both AU Early Cover and common hairy vetch led to greater root galling than fallow in the subsequent cotton crop; they also supported high reproduction of M. incognita in the greenhouse. Rye and Cahaba White vetch did not increase root galling on cotton and were relatively poor hosts for M. incognita. Only those legumes that increased populations of M. incognita reduced cotton yield. In the southern US, M. incognita can complete one to two generations on a susceptible winter cover crop, so cover crops that support high nematode reproduction may lead to damage and yield losses in the following cotton crop. Planting rye or Meloidogyne-resistant legumes as winter cover crops will lower the risk of increased nematode populations
Cotton fiber quality determined by fruit position, temperature and management
Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.
2013-01-01
CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.
Directory of Open Access Journals (Sweden)
Miyo Takahiro
2004-11-01
Full Text Available Abstract Background Seasonal fluctuations in susceptibility to organophosphate insecticides were observed in the Katsunuma population of Drosophila melanogaster for two consecutive years; susceptibility to three organophosphates tended to increase in the fall. To examine the hypothesis that variation in fitness among resistant and susceptible genotypes could trigger the change of genetic constitution within the fall population, we investigated density-independent population projection trajectories starting from single adult females with characteristics of chromosome-substituted lines resistant and susceptible to the three organophosphates. Results Density-independent population projection trajectories, expressed as the ratios of the number of each chromosome-substituted line to that of line SSS, for which all chromosomes were derived from the susceptible line, showed significant declines in numbers with time for all the resistant chromosome-substituted lines. Conclusion The declining tendency in the density-independent population projection trajectories of the resistant chromosome-substituted lines could explain the simultaneous decline in the levels of resistance to the three organophosphates, observed in the Katsunuma population in the fall.
Cotton for removal of aquatic oil spills
International Nuclear Information System (INIS)
Parker, H.W.; Fedler, C.B.; Heintz, C.E.; Nash, P.T.; Carr, D.L.; Lu, M.
1992-01-01
Raw cotton has considerable potential for selective removal of spilled oil and oil products from surface waters, since the natural waxes on the raw cotton make it preferentially oil wet. This potential was recognized in the early seventies at Texas Tech University. More recently other research workers have considered cotton as an adsorbent for spilled oil. The adsorbent market is now dominated by synthetic materials, such as air-blown polypropylene fiber, inorganic clays, and recycled paper and paper products. This paper further examines the potential of cotton in relation to these other adsorbents. Emphasis is placed on the potential for complete biodegradation of oil-soaked cotton adsorbents as a means avoiding the expense for incineration and/or the long-term environmental risk associated with placing the used adsorbents in landfills
Directory of Open Access Journals (Sweden)
Fernando D. Sánchez-Mora
2017-04-01
Full Text Available Downy mildew (Plasmopara viticola is the main grapevine disease in humid regions. In the present investigation, marker-assisted selection (MAS was used to develop grapevine lines homozygous in loci Rpv1 and Rpv3 for resistance against P. viticola. The experimental populations UFSC-2013-1 (n = 420 and UFSC-2013-2 (n = 237 were obtained by self-pollination of two F1 full-sib plants, originated from a cross between two distinct breeding lines containing the downy mildew resistance loci Rpv1 and Rpv3 in heterozygosity. The two experimental populations were genotyped with four microsatellite markers flanking the two downy mildew resistance loci. Among 637 genotyped plants, 300 (48.2% were homozygous for at least one resistance locus and 10 (1.57% were homozygous for both Rpv1 and Rpv3 loci. These 10 plants challenged with P. viticola inoculum showed a clearly enhanced level of resistance. These plants have a great potential as resistance donors in grapevine breeding.
Directory of Open Access Journals (Sweden)
Muhammad Nouman Tahir
Full Text Available Cotton leaf curl disease (CLCuD is a severe disease of cotton that occurs in Africa and Pakistan/northwestern India. The disease is caused by begomoviruses in association with specific betasatellites that differ between Africa and Asia. During survey of symptomatic cotton in Sindh (southern Pakistan Cotton leaf curl Gezira virus (CLCuGV, the begomovirus associated with CLCuD in Africa, was identified. However, the cognate African betasatellite (Cotton leaf curl Gezira betasatellite was not found. Instead, two Asian betasatellites, the CLCuD-associated Cotton leaf curl Multan betasatellite (CLCuMB and Chilli leaf curl betasatellite (ChLCB were identified. Inoculation of the experimental plant species Nicotiana benthamiana showed that CLCuGV was competent to maintain both CLCuMB and ChLCB. Interestingly, the enations typical of CLCuD were only induced by CLCuGV in the presence of CLCuMB. Also in infections involving both CLCuMB and ChLCB the enations typical of CLCuMB were less evident. This is the first time an African begomovirus has been identified on the Indian sub-continent, highlight the growing threat of begomoviruses and particularly the threat of CLCuD causing viruses to cotton cultivation in the rest of the world.
Directory of Open Access Journals (Sweden)
Xueqiang Su
2017-10-01
Full Text Available Plant type III polyketide synthase (PKS can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV. The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber.
Structural coloration of chitosan-cationized cotton fabric using photonic crystals
Yavuz, G.; Zille, A.; Seventekin, N.; Souto, A. P.
2017-10-01
In this work, poly (styrene-methyl methacrylate-acrylic acid) P(St-MMA-AA) composite nanospheres were deposited onto chitosan-cationized woven cotton fabrics followed by a second layer of chitosan. The deposited photonic crystals (PCs) on the fabrics were evaluated for coating efficiency and resistance, chemical analysis and color variation by optical and SEM microscopy, ATR-FTIR, diffuse reflectance spectroscopy and washing fastness. Chitosan deposition on cotton fabric provided cationic groups on the fiber surface promoting electrostatic interaction with photonic crystals. SEM images of the washed samples indicate that the PCs are firmly coated on the cotton surface only in the chitosan treated sample. The photonic nanospheres show an average diameter of 280 nm and display a face-centered cubic closepacking structure with an average thickness of 10 μm. A further chitosan post-treatment enhances color yield of the samples due to the chitosan transparent covering layer that induce bright reflections where the angles of incidence and reflection are the same. After washing, no photonic crystal can be detected on control fabric surface. However, the sample that received a chitosan post-treatment showed a good washing fastness maintaining a reasonable degree of iridescence. Chitosan fills the spaces between the polymer spheres in the matrix stabilizing the photonic structure. Sizeable variations in lattice spacing will allow color variations using more flexible non-close-packed photonic crystal arrays in chitosan hydrogels matrices.
Miyaji, Naomi; Shimizu, Motoki; Miyazaki, Junji; Osabe, Kenji; Sato, Maho; Ebe, Yusuke; Takada, Satoko; Kaji, Makoto; Dennis, Elizabeth S; Fujimoto, Ryo; Okazaki, Keiichi
2017-12-01
Resistant and susceptible lines in Brassica rapa have different immune responses against Fusarium oxysporum inoculation. Fusarium yellows caused by Fusarium oxysporum f. sp. conglutinans (Foc) is an important disease of Brassicaceae; however, the mechanism of how host plants respond to Foc is still unknown. By comparing with and without Foc inoculation in both resistant and susceptible lines of Chinese cabbage (Brassica rapa var. pekinensis), we identified differentially expressed genes (DEGs) between the bulked inoculated (6, 12, 24, and 72 h after inoculation (HAI)) and non-inoculated samples. Most of the DEGs were up-regulated by Foc inoculation. Quantitative real-time RT-PCR showed that most up-regulated genes increased their expression levels from 24 HAI. An independent transcriptome analysis at 24 and 72 HAI was performed in resistant and susceptible lines. GO analysis using up-regulated genes at 24 HAI indicated that Foc inoculation activated systemic acquired resistance (SAR) in resistant lines and tryptophan biosynthetic process and responses to chitin and ethylene in susceptible lines. By contrast, GO analysis using up-regulated genes at 72 HAI showed the overrepresentation of some categories for the defense response in susceptible lines but not in the resistant lines. We also compared DEGs between B. rapa and Arabidopsis thaliana after F. oxysporum inoculation at the same time point, and identified genes related to defense response that were up-regulated in the resistant lines of Chinese cabbage and A. thaliana. Particular genes that changed expression levels overlapped between the two species, suggesting that they are candidates for genes involved in the resistance mechanisms against F. oxysporum.
Microbial contamination of water-soaked cotton gauze and its cause.
Oie, S; Yoshida, H; Kamiya, A
2001-01-01
Seven in-use cotton gauze samples and three cotton balls soaked in sterile distilled water in canisters were investigated 7 days after they were prepared in hospital. All samples were contaminated with bacteria including 10(6) to 10(7) colony forming units/ml of Pseudomonas aeruginosa. In vitro viability tests using cotton gauze and cotton balls soaked in sterile distilled water revealed rapid proliferation of P. aeruginosa, Serratia marcescens and Candida albicans. Since the cotton gauze and the cotton balls were soaked in water containing nutrients, such as protein and glucose, these materials may be readily contaminated with bacteria including P. aeruginosa. Thus, when using cotton gauze and cotton balls containing water, microbial contamination should be expected.
Directory of Open Access Journals (Sweden)
Harby E. AHMED
2013-06-01
Full Text Available Some of Historical textiles objects in Egyptian museums are containing different types of adhesives from previous restoration processes. Furthermore, they may contain some protein stains such as blood stains, which could involve more damage for the historical textiles. In the context of removing the adhesives by various methods, one may cause damage in the textiles, therefore the biotechnological application of enzymes seems to be a very promising approach in the restoration of historical objects. Our results show that enzyme removing is the most effective method, among all tested methods, in the removing of resistant old adhesives and stains. The tested enzymes for the removing technique solved the problems caused by other traditional removing techniques of resistant old adhesives from museum textiles. The main fibers of the tested objects were cotton fibers dyed with some natural dyes. Thus, the fibers that were used in this study were cotton, dyed with Turmeric dye, madder dye mordanted with alum, CuSO4 or Ferric Citrate, as well as without mordant. Additionally,we studied the effect of the enzyme on the mechanical parameters of fibers (Tensile strength, Elongation, Crystallinity index, by FTIR, XRD and ASTM. Furthermore, the effect of enzymes on the morphology of the surface of the untreated and enzymatically treated dyed fabric was investigated by using SEM and Stereoscopy. The effect of enzymes as a function of enzyme concentration and time of treatment on the fabrics color parameters was extensively studied. There was no impact-destructive effect on cotton fibers after the enzyme treatment. Thus, we could conclude that the enzyme have a very slight effect on cotton fibers dyed with natural dyes.
Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi
2017-06-01
In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.
Radiation synthesis of silver nanostructures in cotton matrix
International Nuclear Information System (INIS)
Chmielewska, Dagmara; Sartowska, Bożena
2012-01-01
Cotton is one of the most popular natural fibres, composed mainly of cellulose, which finds a wide range of applications in paper, textile and health care products industry. Researchers have focused their interest on the synthesis of cotton nanocomposites, which enhances its mechanical, thermal and antimicrobial properties by the incorporation of various nanoparticles into the cotton matrix. Silver is one of the most popular antimicrobial agents with a wide spectrum of antibacterial and antifungal activity that results from a complex mechanism of its interactions with the cells of harmful microorganism. In this work, electron beam radiation was applied to synthesise silver nanostructures in cotton fibres. Investigations of the influence of the initial silver salt concentration on the size and distribution of the obtained silver nanostructures were carried out. A detailed characterisation of these nanocomposites with SEM-BSE and EDS methods was performed. TGA and DSC analyses were performed to assess the influence of different size silver nanoparticles and the effect of electron beam irradiation on the thermal properties of cotton fibres. A microbiological investigation to determine the antibacterial activity of Ag-cotton nanocomposites was carried out. - Highlights: ► Ag NPs embedded in cotton matrix were synthesised by electron beam irradiation. ► Concentration of silver salt solution influences on size of silver nanoparticles. ► Silver content as well as irradiation affect thermal properties of cotton fabrics. ► Ag-cotton nanocomposites exhibit antibacterial activity against bacteria and fungi.
(Pleurotus pulmonarius) grown on cotton waste and cassava peel
African Journals Online (AJOL)
This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...
Acoustical evaluation of carbonized and activated cotton nonwovens.
Jiang, N; Chen, J Y; Parikh, D V
2009-12-01
An activated carbon fiber nonwoven (ACF) was manufactured from a cotton nonwoven fabric. For the ACF acoustic application, a nonwoven composite of ACF with cotton nonwoven as a base layer was developed. Also produced were the composites of the cotton nonwoven base layer with a layer of glassfiber nonwoven, and the cotton nonwoven base layer with a layer of cotton fiber nonwoven. Their noise absorption coefficients and sound transmission loss were measured using the Brüel and Kjaer impedance tube instrument. Statistical significance of the differences between the composites was tested using the method of Duncan's grouping. The study concluded that the ACF composite exhibited a greater ability to absorb normal incidence sound waves than the composites with either glassfiber or cotton fiber. The analysis of sound transmission loss revealed that the three composites still obeyed the mass law of transmission loss. The composite with the surface layer of cotton fiber nonwoven possessed a higher fabric density and therefore showed a better sound insulation than the composites with glassfiber and ACF.
Resistance to Phytophthora in mutant lines of currant tomato and in their original forms
International Nuclear Information System (INIS)
Khrustaleva, V.V.; Shcherbakov, V.K.
1987-01-01
Information on the production of currant tomato mutants is contained in a previous report. Evaluation of fruit resistance against Phytophthora infestans (Mont.) de Bary was carried out with pathotypes T 0 and T 1 . For artificial infection we used mainly a culture of T 1 (isolate 275), supplied by the Byelorussian Scientific Research Institute of Potato, Fruit and Vegetable Growing at Samokhvalovich. As inoculum for T 0 , a local population of the potato pathotype from the village of Shebantsevo, Moscow province was used. The standard variety 'Gruntovyj gribovskij 1180' was used as the control. Green fruits were taken from the first or second raceme of 20 plants. They were inoculated by spraying in plastic cuvettes with moist filter paper. The cuvettes were covered with glass and maintained at temperature of 18-20 deg. C. The results were checked 5, 9 and 12 days after inoculation. Under natural conditions, each of the 20 plants was also evaluated. As result, three lines with increased resistance to Phytophthora were selected from the original wild-type of currant tomato. Induced mutant forms were tested in the same way for resistance to Phytophthora. Data is presented from 4 years study. Of 26 mutant lines studied, we identified seven whose fruit displayed a stable and enhanced resistance to Phytophthora under both laboratory and field conditions. With regard to leaf infection of these lines, positive results were not obtained. There appears to be no direct relationship between resistance to Phytophthora of the fruit and the leaves. The mutant lines are of determinate type with early and medium ripening time. The average fruit weight is 5-33 g; in the case of the original specimen, it is only 0.9-1.7 g. The fruits have a pleasant sour-sweet taste and a thick skin. It is noteworthy that the mutant lines selected on the basis of their suitability for cultivation not only showed the resistance selected from the wild-type, but in a number of cases even turned out to
Directory of Open Access Journals (Sweden)
Heba I. Mohamed
2014-03-01
Full Text Available A greenhouse test was conducted in 2011 and 2012 growing seasons at Giza Agricultural Research Station to evaluate the reaction of six cotton genotypes to damping-off incited by Fusarium oxysporum. Damping-off incidence on the genotypes ranged from 70-88%. In general, the genotypes could be divided into highly susceptible, susceptible, and moderately susceptible. Data for damping-off incidence and level or activity of some biochemical components (phenols, peroxidase, and polyphenoloxidase were entered into a computerized linear regression analysis. The analysis contrasted seven predictive models by using the biochemical components, singly or in combination, as biochemical predictors. It was evident that models nos. 2 and 6 were the best models for predicting incidence of damping-off. The superiority of these models was attributed to their high RІ values (0.748 and 0.902, respectively and the significance of their F. values (P = 0.026 and P = 0.031, respectively. The results of the present study suggest that peroxidase alone or both peroxidase and polyphenoloxidase, which may or may not parts of damping-off resistance mechanisms, can be used as biochemical markers to predict resistance to damping-off incited by F. oxysporum.
Using cotton plant residue to produce briquettes
Energy Technology Data Exchange (ETDEWEB)
Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility
2000-07-01
In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)
Illustrated weed flora of cotton crop of khairpur district, sindh, pakistan
International Nuclear Information System (INIS)
Memon, R.A.; Bhatti, G.R.
2014-01-01
A survey was carried out for the composition of weed flora of cotton crop of Khairpur district, Sindh, Pakistan. Thirty six weed species belonging to 16 families were noted. Poaceae was found to be most dominant family representing seven species followed by Asteraceae and Papilionaceae, each with five species. Botanical descriptions and illustrations/line drawings of all the recorded taxa were prepared in order to identify the weed species. (author)
de Souza Moreira, Douglas; Ferreira, Rafael Fernandes; Murta, Silvane M F
2016-01-01
Pteridine reductase (PTR1) is an NADPH-dependent reductase that participates in the salvage of pteridines, which are essential to maintain growth of Leishmania. In this study, we performed the molecular characterization of ptr1 gene in wild-type (WTS) and SbIII-resistant (SbR) lines from Leishmania guyanensis (Lg), Leishmania amazonensis (La), Leishmania braziliensis (Lb) and Leishmania infantum (Li), evaluating the chromosomal location, mRNA levels of the ptr1 gene and PTR1 protein expression. PFGE results showed that the ptr1 gene is located in a 797 kb chromosomal band in all Leishmania lines analyzed. Interestingly, an additional chromosomal band of 1070 kb was observed only in LbSbR line. Northern blot results showed that the levels of ptr1 mRNA are increased in the LgSbR, LaSbR and LbSbR lines. Western blot assays using the polyclonal anti-LmPTR1 antibody demonstrated that PTR1 protein is more expressed in the LgSbR, LaSbR and LbSbR lines compared to their respective WTS counterparts. Nevertheless, no difference in the level of mRNA and protein was observed between the LiWTS and LiSbR lines. Functional analysis of PTR1 enzyme was performed to determine whether the overexpression of ptr1 gene in the WTS L. braziliensis and L. infantum lines would change the SbIII-resistance phenotype of transfected parasites. Western blot results showed that the expression level of PTR1 protein was increased in the transfected parasites compared to the non-transfected ones. IC50 analysis revealed that the overexpression of ptr1 gene in the WTS L. braziliensis line increased 2-fold the SbIII-resistance phenotype compared to the non-transfected counterpart. Furthermore, the overexpression of ptr1 gene in the WTS L. infantum line did not change the SbIII-resistance phenotype. These results suggest that the PTR1 enzyme may be implicated in the SbIII-resistance phenotype in L. braziliensis line. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Li, F.; Bibi, N.; Fan, K.; Wang, M.
2016-01-01
Verticillium dahliae is a soil-born fungal pathogen which causes Verticillium wilt in economically important crops including cotton. We conducted a study to monitor the interaction between the fungus and cotton. V. dahliae was transformed with the gene encoding green fluorescent protein. The gene can be constitutively expressed and fluorescence was clearly visible in both hyphae and spores. Due to heterogeneous gene insertion, the growth rate, colony morphology and pathogenicity of fungus transformants showed differences compared with corresponding wild type. Similarly, quantitative real-time PCR analysis also indicated significant differences in the gene expression among different V. dahliae transformants. To study cotton-pathogen interaction, we devised a novel inoculation method and developed a successful infection by keeping GFP-expressed mycelial plug along with aseptic cotton seedlings. After 6-day inoculation, the LSM microscopic image showed that the fungus rapidly formed a mycelial network on the surface of the stems and colonized into plant tissue, displayed an intercellular infection pattern. The early events during cotton colonization by V. dahliae can be successfully observed in 10 days including the plant growth period. Besides, pathological changes of seedlings like tissue discoloration, wilting, stem dehiscence and necrosis can be clearly observed without the influences of soil and other microbes. This inoculation method provides a rapid, effective and environmental friendly technique for the study of cotton-pathogen interaction and identification of resistant plant cultivars. (author)
7 CFR 27.21 - Preparation of samples of cotton.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...
Stability of rust resistance and yield potential of some icarda bread wheat lines in Pakistan
International Nuclear Information System (INIS)
Shah, S.J.A.; Khan, A.J.; Azam, F.; Mirza, J.I.; Atiq-ur-Rehman
2003-01-01
Thirty bread wheat lines resistant to Yellow rust (Yr) were selected after careful screening from two ICARDA nurseries during 1998 - 1999, Rabi season at Nuclear Institute for Food and Agriculture (NIFA), Tarnab, Peshawar under severe disease pressure. In the following crop cycle, these selections were again field evaluated for stability and effectiveness of Yr resistance at multilocations while their yield potential was ascertained at Tarnab in two different trials with Tatara as commercial check. Results revealed that uniformity was found in the potential behavior of 23 lines (77%) in both the cropping seasons against Yr. This included some high yielding (up to 7067 kg/ ha) and low yielding lines (up to 4333 kg / ha) when compared with the check (6089 kg / ha). Yield potential of some high yielding lines with stable Yr resistance should be further evaluated over sites and seasons for wide adaptability, under national uniform testing in order to select and deploy future varieties to combat Yr for acquiring food security in Pakistan.(author)
International Nuclear Information System (INIS)
Mitra, D.; Sabharwal, S.; Majali, A.B.
1998-01-01
Electron beam irradiation technique has been utilized to graft acrylic acid to cotton fabric in order to provide suitable functional groups that can subsequently react with urea or borax for making the fabric fire resistant. Thermal analytical technique such as, DSC and TG have been utilized to investigate the flame retardency characteristic of the grafted and treated fabric. The result shows that decay curve of exothermic peak due to combustion of cotton fabric in case of urea treated fabric at 330 degC becomes broad and shifts to higher temperature in DSC analysis as compared to pure cotton fabric and char residue in TG analysis is 20% in both the case. In borax treated fabric, char residue is found to be 40% in TG analysis and DSC profile is similar to that of urea treated fabric. (author)
STIFFNESS MODIFICATION OF COTTON IN CHITOSAN TREATMENT
Directory of Open Access Journals (Sweden)
CAMPOS Juan
2017-05-01
Full Text Available Chitosan is a biopolymer obtained from chitin, and among their most important aspects highlights its applications in a lot of industrial sectors due to its intrinsic properties, especially in the textile sector. In the last years, chitosan is widely used in the cotton and wool finishing processes due to its bond between them and its properties as an antifungical and antimicrobial properties. In this paper three different molecular weight chitosan are used in the finishing process of cotton to evaluate its influence in the surface properties modification. In order to evaluate the effect of the treatment with chitosan, flexural stiffness test is performed in warp and weft direction, and then the total value is calculated. The cotton fabric is treated with 5 g/L of different types of chitosan in an impregnation bath. This study shows the extent of surface properties modification of the cotton provided by three types of chitosan treatment. The results show that all types of chitosan modify the cotton flexural rigidity properties but the one which modifies it in a relevant manner is chitosan originated from shrimps. Chitosan, textile, flexural stiffnes, chitin, cotton.
2010-08-18
... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... Assistance Program (EAAP) and clarifying the definition of ``active shipping order.'' DATES: Effective Date... address that matter this rule amends in the payment calculation for semi-processed and reginned motes in 7...
THE ELASTICITY OF EXPORT DEMAND FOR US COTTON
Paudel, Laxmi; Houston, Jack E.; Adhikari, Murali; Devkota, Nirmala
2004-01-01
There exist conflicting views among the researchers about the magnitudes of US cotton export demand elasticity, ranging from the highly inelastic to highly elastic. An Armington model was used to analyze the export demand elasticity of US Cotton. Our analysis confirms an elastic nature of US cotton export demand.
7 CFR 1427.23 - Cotton loan deficiency payments.
2010-01-01
..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan... intentions to receive a loan deficiency payment on the identified commodity or (ii) A completed request for a... cotton based on a locked-in adjusted world price, provide identifying numbers for modules or other...
Fourier transform infrared imaging of Cotton trash mixtures
There is much interest in the identification of trash types comingled with cotton lint. A good understanding of the specific trash types present can lead to the fabrication of new equipment which can identify and sort cotton trash found with cotton fiber. Conventional methods, including the High Vo...
Gene cloning: exploring cotton functional genomics and genetic improvement
Institute of Scientific and Technical Information of China (English)
Diqiu LIU; Xianlong ZHANG
2008-01-01
Cotton is the most important natural fiber plant in the world. The genetic improvement of the quality of the cotton fiber and agricultural productivity is imperative under the situation of increasing consumption and rapid development of textile technology. Recently, the study of cotton molecular biology has progressed greatly. A lot of specifically or preferentially expressed cotton fiber genes were cloned and analyzed. On the other hand, identification of stress response genes expressed in cotton was performed by other research groups. The major stress factors were studied including the wilt pathogens Verticillium dahliae, Fusarium oxy-sporum f. sp. vasinfectum, bacterial blight, root-knot nematode, drought, and salt stress. What is more, a few genes related to the biosynthesis of gossypol, other sesquiterpene phytoalexins and the major seed oil fatty acids were isolated from cotton. In the present review, we focused on the major advances in cotton gene cloning and expression profiling in the recent years.
Directory of Open Access Journals (Sweden)
Baozhu Guo
2017-06-01
Full Text Available Two important mycotoxins, aflatoxin and fumonisin, are among the most potent naturally occurring carcinogens, contaminating maize (Zea mays and affecting crop yield and quality. Resistance of maize to pre-harvest mycotoxin contamination, specifically aflatoxin produced by Aspergillus flavus and fumonisin produced by Fusarium verticillioides, is a goal in breeding programs that screen for these important traits with the aim of developing resistant commercial hybrids. We conducted two years of field evaluations on 87 inbred lines originating primarily in China and Mexico and not previously screened for resistance. The objectives of our study were to identify resistant germplasm for breeding purposes and to examine possible relationships between resistances to the two mycotoxins. Aflatoxin and fumonisin were present in samples harvested from all lines in both years. Concentrations of total aflatoxin ranged from 52.00 ± 20.00 to 1524.00 ± 396.00 μg kg−1, while those of fumonisin ranged from 0.60 ± 0.06 to 124.00 ± 19.50 mg kg−1. The inbred lines TUN15, TUN61, TUN37, CY2, and TUN49 showed the lowest aflatoxin accumulation and CN1, GT601, TUN09, TUN61, and MP717 the lowest fumonisin accumulation. TUN61 showed the lowest accumulation of both mycotoxins. This study confirmed previous observations that high levels of aflatoxin can coexist with fumonisin, with 55 maize lines showing a positive correlation coefficient between the concentrations of aflatoxin and fumonisin and 32 lines showing a negative correlation coefficient. These selected lines, particularly TUN61, may provide sources of resistance to mycotoxin contamination in breeding programs. However, the mechanism of resistance in this germplasm remains to be identified. Future research should also address factors that influence the fungus–plant interaction, such as herbivory and environmental stress.
Directory of Open Access Journals (Sweden)
Renesh Bedre
Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Integrating soil conservation practices and glyphosate-resistant crops: impacts on soil.
Locke, Martin A; Zablotowicz, Robert M; Reddy, Krishna N
2008-04-01
Conservation practices often associated with glyphosate-resistant crops, e.g. limited tillage and crop cover, improve soil conditions, but only limited research has evaluated their effects on soil in combination with glyphosate-resistant crops. It is assumed that conservation practices have similar benefits to soil whether or not glyphosate-resistant crops are used. This paper reviews the impact on soil of conservation practices and glyphosate-resistant crops, and presents data from a Mississippi field trial comparing glyphosate-resistant and non-glyphosate-resistant maize (Zea mays L.) and cotton (Gossypium hirsutum L.) under limited tillage management. Results from the reduced-tillage study indicate differences in soil biological and chemical properties owing to glyphosate-resistant crops. Under continuous glyphosate-resistant maize, soils maintained greater soil organic carbon and nitrogen as compared with continuous non-glyphosate-resistant maize, but no differences were measured in continuous cotton or in cotton rotated with maize. Soil microbial community structure based on total fatty acid methyl ester analysis indicated a significant effect of glyphosate-resistant crop following 5 years of continuous glyphosate-resistant crop as compared with the non-glyphosate-resistant crop system. Results from this study, as well as the literature review, indicate differences attributable to the interaction of conservation practices and glyphosate-resistant crop, but many are transient and benign for the soil ecosystem. Glyphosate use may result in minor effects on soil biological/chemical properties. However, enhanced organic carbon and plant residues in surface soils under conservation practices may buffer potential effects of glyphosate. Long-term field research established under various cropping systems and ecological regions is needed for critical assessment of glyphosate-resistant crop and conservation practice interactions. Copyright (c) 2008 by John Wiley & Sons
Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.
Directory of Open Access Journals (Sweden)
Hongjie Feng
Full Text Available BACKGROUND: As a result of changing consumer preferences, cotton (Gossypium Hirsutum L. from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. EXPERIMENTAL DESIGN: Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. RESULT: The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL. The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. CONCLUSIONS: Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.
3rd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins
This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...
2nd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins
This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...
1st stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins
This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...
Directory of Open Access Journals (Sweden)
Karunamurthy Dhivya
2016-09-01
Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.
Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity
Directory of Open Access Journals (Sweden)
F. Ducamp
2012-01-01
Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.
Energy Technology Data Exchange (ETDEWEB)
Bierhuizen, J F; Slatyer, R O
1964-01-01
Experiments have been described in which photosynthesis of cotton leaves enclosed in a leaf chamber was measured under various conditions of light intensity (1000-6000 f.c., corresponding to 3 x 8 x 10/sup 4/-22 x 5 10/sup 4/ erg cm/sup -2/ sec/sup -1/), CO/sub 2/ concentration (200-2000 p.p.m.), temperature (30-40/sup 0/C), relative humidity (40-80%), and windspeed (0 x 6-3 x 1) cm sec/sup -1/). The plants were well watered in order to minimize water stress. The experiments conducted so far indicate that, with the conditions employed, CO/sub 2/ and light were the main factors limiting photosynthesis. At all light intensities there was an almost linear response to CO/sub 2/ concentration up to values of 600-800 p.p.m. CO/sub 2/ above which there appeared to be effective CO/sub 2/ saturation. The response to light was of particular interest. It appeared that, under limiting CO/sub 2/ conditions, an increase in light intensity increased photosynthesis not only by decreasing stomatal resistance, hence resulting in increased CO/sub 2/ diffusion through the stomata, but also by increasing the liquid phase permeability of the mesophyll cell walls to CO/sub 2/ transport. Total resistance in the diffusion pathway, the sum of r', averaged 22 sec cm/sup -1/ at 1000 f.c. for a range of windspeed, CO/sub 2/, temperature, and humidity conditions, and declined progressively to about 7 sec cm/sup -1/ at 6000 f.c. The contribution of the gaseous diffusion resistances (r'/sub a/ + r'/sub al/) decreased, at the same time, from about 8 to 4 sec cm/sup -1/. 26 references, 5 figures, 1 table.
Directory of Open Access Journals (Sweden)
M. Velayati
2011-01-01
Full Text Available Abstract Weeds are problematic plants in agroecosystems as a competitor for crops. In order to evaluate effects of cotton (Gossypium hirsutum and common lambsquarter (Chenopodium album densities on some crop growth indices, a study was conducted during 2006 in Experimental Station of Faculty of Agriculture, The University of Birjand as factorial experiment based on complete randomized block design with four replications. Three densities of cotton (6, 9 and 12 Pl.m-2 and four weed densities (0, 6, 9 and 12 Pl.m-2 were used to provide different weed interference levels. Indeed, three plots in each replication were intended to cultivation of lambsquarter alone at 6, 9 or 12 Pl.m-2. Results showed that crop growth rate (CGR of cotton was influenced by weed density, and its relative growth rate (RGR and net assimilation rate (NAR indicated a declining trend as weed density increased. Dry matter accumulation of cotton also was affected negatively by weed densities, as interference of lambsquarter at 6, 9 and 12 Pl.m-2 resulted to 35, 42 and 48 percent dry matter reduction, respectively, than weed-free treatment. Increasing of cotton density could partly compensate for negative impact of weed attendance on cotton growth. Thus, it seems higher plant densities can be used as a managing tool against weeds in cotton fields to avoid reduction of yield. Keywords: Cotton, Density, Weed, competition, Growth analysis
Gapare, Washington; Liu, Shiming; Conaty, Warren; Zhu, Qian-Hao; Gillespie, Vanessa; Llewellyn, Danny; Stiller, Warwick; Wilson, Iain
2018-03-20
Genomic selection (GS) has successfully been used in plant breeding to improve selection efficiency and reduce breeding time and cost. However, there has not been a study to evaluate GS prediction models that may be used for predicting cotton breeding lines across multiple environments. In this study, we evaluated the performance of Bayes Ridge Regression, BayesA, BayesB, BayesC and Reproducing Kernel Hilbert Spaces regression models. We then extended the single-site GS model to accommodate genotype × environment interaction (G×E) in order to assess the merits of multi- over single-environment models in a practical breeding and selection context in cotton, a crop for which this has not previously been evaluated. Our study was based on a population of 215 upland cotton ( Gossypium hirsutum ) breeding lines which were evaluated for fiber length and strength at multiple locations in Australia and genotyped with 13,330 single nucleotide polymorphic (SNP) markers. BayesB, which assumes unique variance for each marker and a proportion of markers to have large effects, while most other markers have zero effect, was the preferred model. GS accuracy for fiber length based on a single-site model varied across sites, ranging from 0.27 to 0.77 (mean = 0.38), while that of fiber strength ranged from 0.19 to 0.58 (mean = 0.35) using randomly selected sub-populations as the training population. Prediction accuracies from the M×E model were higher than those for single-site and across-site models, with an average accuracy of 0.71 and 0.59 for fiber length and strength, respectively. The use of the M×E model could therefore identify which breeding lines have effects that are stable across environments and which ones are responsible for G×E and so reduce the amount of phenotypic screening required in cotton breeding programs to identify adaptable genotypes. Copyright © 2018, G3: Genes, Genomes, Genetics.
Park, Wonkeun; Scheffler, Brian E; Bauer, Philip J; Campbell, B Todd
2012-06-15
Cotton is the world's primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional/biological distribution, and
21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.
2010-04-01
... used in dry food packaging. 182.70 Section 182.70 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry food packaging that are generally recognized as safe for their intended use, within the meaning of...
Wang, Jiarui; Zhang, Jinhui; Zhang, Lichuan; Zhao, Long; Fan, Sufang; Yang, Zhonghai; Gao, Fei; Kong, Ying; Xiao, Gary Guishan; Wang, Qi
2011-11-01
This study aimed to determine the relationship between the endogenous levels of P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP), lung resistance-related protein (LRP), glutathione-s-transferase-π (GST‑π) and topoisomerase IIα (TopoIIα) and intrinsic drug resistance in four human lung cancer cell lines, SK-MES-1, SPCA-1, NCI-H-460 and NCI-H-446, of different histological types. The expression of P-gp, MRP, LRP, GST-π and TopoIIα was measured by immunofluorescence, Western blotting and RT-PCR. Drug resistance to cisplatin, doxorubicin and VP-16 was determined using MTT assays. The correlation between expression of the resistance-related proteins and their roles in the resistance to drugs in these cancer cell lines was analyzed. We found that the endogenous levels of P-gp, MRP, LRP, GST-π and TopoIIα in the four cell lines varied. The level of GST-π in the SK-MES-1 cells was the highest, whereas the level of P-gp in the SPCA-1 cells was the lowest. The chemoresistance to cisplatin, doxorubicin and VP-16 in the four cell lines was different. The SPCA-1 cell line was most resistance to cisplatin; SK-MES-1 was most resistance to VP-16; whereas SK-MES-1 was most sensitive to doxorubicin. There was a positive correlation between GST-π expression and resistance to cisplatin, between TopoIIα expression and resistance to VP-16; and a negative correlation was noted between TopoIIα expression and resistance to doxorubicin. In summary, the endogenous expression of P-gp, MRP, LRP, GST-π and TopoIIα was different in the four human lung cancer cell lines of different histological types, and this variance may be associated with the variation in chemosensitivity to cisplatin, doxorubicin and VP-16. Among the related proteins, GST-π may be useful for the prediction of the intrinsic resistance to cisplatin, whereas TopoIIα may be useful to predict resistance to doxorubicin and VP-16 in human lung cancer cell lines.
Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad
2018-01-01
Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net
Maiga, Almoustapha Issiaka; Fofana, Djeneba Bocar; Cisse, Mamadou; Diallo, Fodié; Maiga, Moussa Youssoufa; Traore, Hamar Alassane; Maiga, Issouf Alassane; Sylla, Aliou; Fofana, Dionke; Taiwo, Babafemi; Murphy, Robert; Katlama, Christine; Tounkara, Anatole; Calvez, Vincent; Marcelin, Anne-Geneviève
2012-01-01
Objectives We describe the outcomes of second-line drug resistance profiles and predict the efficacy of drugs for third-line therapy in patients monitored without the benefit of plasma HIV-1 RNA viral load (VL) or resistance testing. Methods We recruited 106 HIV-1-infected patients after second-line treatment failure in Mali. VL was determined by the Abbott RealTime system and the resistance by the ViroSeq HIV-1 genotyping system. The resistance testing was interpreted using the latest version of the Stanford algorithm. Results Among the 106 patients, 93 had isolates successfully sequenced. The median age, VL and CD4 cells were respectively 35 years, 72 000 copies/mL and 146 cells/mm3. Patients were exposed to a median of 4 years of treatment and to six antiretrovirals. We found 20% of wild-type viruses. Resistance to etravirine was noted in 38%, to lopinavir in 25% and to darunavir in 12%. The duration of prior nucleos(t)ide reverse transcriptase inhibitor exposure was associated with resistance to abacavir (P < 0.0001) and tenofovir (P = 0.0001), and duration of prior protease inhibitor treatment with resistance to lopinavir (P < 0.0001) and darunavir (P = 0.06). Conclusion Long duration of therapy prior to failure was associated with high levels of resistance and is directly related to limited access to VL monitoring and delayed switches to second-line treatment, precluding efficacy of drugs for third-line therapy. This study underlines the need for governments and public health organizations to recommend the use of VL monitoring and also the availability of darunavir and raltegravir for third-line therapies in the context of limited-resource settings. PMID:22888273
Baer, G Ia; Emets, A I; Blium, Ia B
2014-01-01
The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.
DEFF Research Database (Denmark)
Jacobsen, Kirstine; Alcaraz, Nicolas; Lund, Rikke Raaen
the SeqCap EZ Human Exome Library v3.0 kit and whole-exome sequencing of these (100 bp paired-end) were performed on an Illumina HiSeq 2000 platform. Using a recently developed in-house analysis pipeline the sequencing data were analyzed. The analysis pipeline includes quality control using Trim......Background: Erlotinib (Tarceva®, Roche) has significantly changed the treatment of non-small cell lung cancer (NSCLC) as 70% of patients show significant tumor regression upon treatment (Santarpia et. al., 2013). However, all patients relapse due to development of acquired resistance, which...... mutations in erlotinib-resistant subclones of the NSCLC cell line, HCC827. Materials & Methods: We established 3 erlotinib-resistant subclones (resistant to 10, 20, 30 µM erlotinib, respectively). DNA libraries of each subclone and the parental HCC827 cell line were prepared in biological duplicates using...
Directory of Open Access Journals (Sweden)
Ullah Najeeb
2017-09-01
Full Text Available We investigated the role of ethylene in the response of cotton to high temperature using cotton genotypes with genetically interrupted ethylene metabolism. In the first experiment, Sicot 71BRF and 5B (a lintless variant with compromised ethylene metabolism were exposed to 45°C, either by instantaneous heat shock or by ramping temperatures by 3°C daily for 1 week. One day prior to the start of heat treatment, half the plants were sprayed with 0.8 mM of the ethylene synthesis inhibitor, aminoethoxyvinylglycine (AVG. In a subsequent experiment, Sicot 71BRF and a putatively heat-tolerant line, CIM 448, were exposed to 36 or 45°C for 1 week, and half the plants were sprayed with 20 μM of the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid, (ACC. High temperature exposure of plants in both experiments was performed at the peak reproductive phase (65–68 days after sowing. Elevated temperature (heat shock or ramping to 45°C significantly reduced production and retention of fruits in all cotton lines used in this study. At the termination of heat treatment, cotton plants exposed to 45°C had at least 50% fewer fruits than plants under optimum temperature in all three genotypes, while plants at 36°C remained unaffected. Heat-stressed plants continued producing new squares (fruiting buds after termination of heat stress but these squares did not turn into cotton bolls due to pollen infertility. In vitro inhibition of pollen germination by high temperatures supported this observation. Leaf photosynthesis (Pn of heat-stressed plants (45°C measured at the end of heat treatments remained significantly inhibited, despite an increased leaf stomatal conductance (gs, suggesting that high temperature impairs Pn independently of stomatal behavior. Metabolic injury was supported by high relative cellular injury and low photosystem II yield of the heat-stressed plants, indicating that high temperature impaired photosynthetic electron transport. Both
Weed flora, yield losses and weed control in cotton crop
Jabran, Khawar
2016-01-01
Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....
Increasing cotton stand establishment in soils prone to soil crusting
Many factors can contribute to poor cotton stand establishment, and cotton is notorious for its weak seedling vigor. Soil crusting can be a major factor hindering cotton seedling emergence in many of the cotton production regions of the US and the world. Crusting is mainly an issue in silty soils ...
7 CFR 28.107 - Original cotton standards and reserve sets.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Original cotton standards and reserve sets. 28.107... Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a) The containers of the original Universal Standards and other official cotton standards of the United...
Cotton Production in Mali: Subsidies or Sustainable Development?
Moore, Lindsey
2007-01-01
Current trade rules concerning cotton subsidies are intricately linked with poverty and hunger in Mali. Over half of Mali's economy and over 30 million people depend directly on cotton. It is the main cash crop and the most important source of export revenue. Cotton also plays a key role in development policies and in the fight against poverty by…
Genomic studies for drought tolerance in cotton (abstract)
International Nuclear Information System (INIS)
Mahboob-ur-Rehman; Ullah, I.; Asir, M.; Zafar, Y.; Malik, K.A.
2005-01-01
The cotton germplasm developed in Pakistan has not been screened comprehensively for their response to water stress, which is a pre-requisite in exploring different metabolic pathways, development of genome maps, isolation of genes etc. The objectives of the study were to identify drought tolerant/sensitive cotton genotypes, development of genetic linkage maps, and to identify the most robust DNA markers leading towards marker-assisted selection (MAS). A field trial was conducted to investigate variation in gas exchange parameters and productivity traits in 32 cotton cultivars/promising strains under water stress environment and to ascertain association among these physiological and productivity traits. Photosynthetic rate (P), stomatal conductance (gs) and transpiration rate (E) were significantly reduced under water stress. Substantial genotypic variation for gas exchange parameters especially photosynthetic rate were observed with a significant association with productivity traits under water-limited environment elucidating its use as an indirect selection criterion for seed cotton yield. Moreover, the genotypes FH-901 and CIM-1100 were found the most sensitive and tolerant cultivars, respectively. Four hundred eighty random primers were surveyed on different cotton genotypes involved in population development programs. Out of these, 32 polymorphic primers were identified which are being converted into sequence characterized amplified regions (SCARs). Similarly, 25 out of 150 microstatellite loci (SSRs) were polymorphic among the cotton genotypes. Amplified fragment length polymorphism (AFLP) fingerprinting technique is being exploited to search for additional polymorphisms. The study will have impact on cotton breeding programme by reducing span to develop drought tolerant cotton varieties. (author)
Ali, N; Heslop-Harrison, Js Pat; Ahmad, H; Graybosch, R A; Hein, G L; Schwarzacher, T
2016-08-01
Pyramiding of alien-derived Wheat streak mosaic virus (WSMV) resistance and resistance enhancing genes in wheat is a cost-effective and environmentally safe strategy for disease control. PCR-based markers and cytogenetic analysis with genomic in situ hybridisation were applied to identify alien chromatin in four genetically diverse populations of wheat (Triticum aestivum) lines incorporating chromosome segments from Thinopyrum intermedium and Secale cereale (rye). Out of 20 experimental lines, 10 carried Th. intermedium chromatin as T4DL*4Ai#2S translocations, while, unexpectedly, 7 lines were positive for alien chromatin (Th. intermedium or rye) on chromosome 1B. The newly described rye 1RS chromatin, transmitted from early in the pedigree, was associated with enhanced WSMV resistance. Under field conditions, the 1RS chromatin alone showed some resistance, while together with the Th. intermedium 4Ai#2S offered superior resistance to that demonstrated by the known resistant cultivar Mace. Most alien wheat lines carry whole chromosome arms, and it is notable that these lines showed intra-arm recombination within the 1BS arm. The translocation breakpoints between 1BS and alien chromatin fell in three categories: (i) at or near to the centromere, (ii) intercalary between markers UL-Thin5 and Xgwm1130 and (iii) towards the telomere between Xgwm0911 and Xbarc194. Labelled genomic Th. intermedium DNA hybridised to the rye 1RS chromatin under high stringency conditions, indicating the presence of shared tandem repeats among the cereals. The novel small alien fragments may explain the difficulty in developing well-adapted lines carrying Wsm1 despite improved tolerance to the virus. The results will facilitate directed chromosome engineering producing agronomically desirable WSMV-resistant germplasm.
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
Introduction First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance – Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥2 TAMs; or M184V+≥1 TAM. Virological suppression was defined as viral load (VL) Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥2 TAMs; and 32 with M184V+≥1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤200 cells/µL at genotyping (OR=4.43, 95% CI [1.59–12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39–16.36], p<0.001). Among 87/105 patients with available VL at 12 months after switch to second-line ART, virological suppression was achieved in 85%. The median genotypic susceptibility score (GSS) for the second-line regimen was 2.00. Patients with ART adherence ≥95% were more likely to be virologically suppressed (OR=9.33, 95% CI (2.43–35.81), p=0.001). Measures of patient resistance to second-line ART, including the GSS, were not significantly associated with virological outcome. Conclusions Multi-NRTI RAMs at first-line failure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving
Wai, T; Grumet, R
1995-09-01
The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.
Directory of Open Access Journals (Sweden)
Schrago Carlos EG
2011-08-01
Full Text Available Abstract Background In response to infection, viral genomes are processed by Dicer-like (DCL ribonuclease proteins into viral small RNAs (vsRNAs of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV, a member of the genus Polerovirus, family Luteoviridae. Results Deep sequencing of small RNAs (sRNAs from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. Conclusions This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.
Silva, Tatiane F; Romanel, Elisson A C; Andrade, Roberto R S; Farinelli, Laurent; Østerås, Magne; Deluen, Cécile; Corrêa, Régis L; Schrago, Carlos E G; Vaslin, Maite F S
2011-08-24
In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.
Zhang, Qiang; Gao, Xinpeng; Ren, Yanyun; Ding, Xinhua; Qiu, Jiajia; Li, Ning; Zeng, Fanchang
2018-01-01
Arbuscular mycorrhizal fungi (AMF) play an important role in nutrient cycling processes and plant stress resistance. To evaluate the effect of Rhizophagus irregularis CD1 on plant growth promotion (PGP) and Verticillium wilt disease, the symbiotic efficiency of AMF (SEA) was first investigated over a range of 3% to 94% in 17 cotton varieties. The high-SEA subgroup had significant PGP effects in a greenhouse. From these results, the highest-SEA variety of Lumian 1 was selected for a two-year field assay. Consistent with the performance from the greenhouse, the AMF-mediated PGP of Lumian 1 also produced significant results, including an increased plant height, stem diameter, number of petioles, and phosphorus content. Compared with the mock treatment, AMF colonization obviously inhibited the symptom development of Verticillium dahliae and more strongly elevated the expression of pathogenesis-related genes and lignin synthesis-related genes. These results suggest that AMF colonization could lead to the mycorrhiza-induced resistance (MIR) of Lumian 1 to V. dahliae. Interestingly, our results indicated that the AMF endosymbiont could directly inhibit the growth of phytopathogenic fungi including V. dahliae by releasing undefined volatiles. In summary, our results suggest that stronger effects of AMF application result from the high-SEA. PMID:29342876
Directory of Open Access Journals (Sweden)
Qiang Zhang
2018-01-01
Full Text Available Arbuscular mycorrhizal fungi (AMF play an important role in nutrient cycling processes and plant stress resistance. To evaluate the effect of Rhizophagus irregularis CD1 on plant growth promotion (PGP and Verticillium wilt disease, the symbiotic efficiency of AMF (SEA was first investigated over a range of 3% to 94% in 17 cotton varieties. The high-SEA subgroup had significant PGP effects in a greenhouse. From these results, the highest-SEA variety of Lumian 1 was selected for a two-year field assay. Consistent with the performance from the greenhouse, the AMF-mediated PGP of Lumian 1 also produced significant results, including an increased plant height, stem diameter, number of petioles, and phosphorus content. Compared with the mock treatment, AMF colonization obviously inhibited the symptom development of Verticillium dahliae and more strongly elevated the expression of pathogenesis-related genes and lignin synthesis-related genes. These results suggest that AMF colonization could lead to the mycorrhiza-induced resistance (MIR of Lumian 1 to V. dahliae. Interestingly, our results indicated that the AMF endosymbiont could directly inhibit the growth of phytopathogenic fungi including V. dahliae by releasing undefined volatiles. In summary, our results suggest that stronger effects of AMF application result from the high-SEA.
CSIR Research Space (South Africa)
Van der Sluijs, MHJ
2018-05-01
Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...
Minimization of operational impacts on spectrophotometer color measurements for cotton
A key cotton quality and processing property that is gaining increasing importance is the color of the cotton. Cotton fiber in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), using the parameters Rd and +b. Rd and +b are specific to cotton fiber and are not typical ...
Association mapping of resistance to Verticillium wilt in Gossypium ...
African Journals Online (AJOL)
Verticillium wilt is a major disease affecting the growth of cotton. For screening the resistant genes, 320 Gossypium hirsutum germplasms were evaluated in Verticillium nursery, and association mapping was used to detect the markers associated with the Verticillium wilt resistance. 106 microsatellite marker primer pairs ...
Insect-resistance and high-yield transgenic tobacco obtained by ...
African Journals Online (AJOL)
hope&shola
2010-10-04
Oct 4, 2010 ... had great significance for agricultural sustained develop- ment. Significant advances have been made in insect- resistant gene cry engineering (Cui and Guo, 1998; Ni et al., 1998; Yan, 2003). Insect-resistant trangenic cotton, harbouring the modified, synthesized gene cry, has already been commercialized ...
Directory of Open Access Journals (Sweden)
El-Zahi El-Zahi Saber
2016-04-01
Full Text Available The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae is a polyphagous sap sucking insect with a wide geographical and host range causing severe losses in economically important crops. This study represents the first record of P. solenopsis as a new insect attacking cotton plants (Gossypium barbadense var. Giza 86 in Kafr El-Sheikh governorate, Egypt. The insect was noticed on cotton plants for the first time during its growing season of 2014. The mealybug specimens were collected from infested cotton plants and identified as P. solenopsis. In an attempt to control this pest, eight toxic materials viz., imidacloprid, thiamethoxam, flonicamid, emamectin-benzoate, chlorpyrifos, methomyl, deltamethrin and mineral oil (KZ-oil, belonging to different chemical groups, were tested for their influence against P. solenopsis on cotton under field conditions. Methomyl, imidacloprid, thiamethoxam and chlorpyrifos showed the highest efficacy against P. solenopsis recording 92.3 to 80.4% reduction of the insect population. Flonicamid, emamectin-benzoate and KZ-oil failed to exhibit sufficient P. solenopsis control.
Response of cotton genotypes to boron under-b-adequate conditions
International Nuclear Information System (INIS)
Shah, J. A.; Sial, M. A.; Hassan, Z. U.; Rajpar, I.
2015-01-01
Balanced boron (B) application is well-known to enhance the cotton production; however, the narrow range between B-deficiency and toxicity levels makes it difficult to manage. Cotton genotypes extensively differ in their response to B requirements. The adequate dose of B for one genotype may be insufficient or even toxic to other genotype. The effects of boron (B) on seed cotton yield and its various yield associated traits were studied on 10 cotton genotypes of Pakistan. The pot studies were undertaken to categorize cotton genotypes using B-deficient (control) and B-adequate (2.0 kg B ha-1) levels arranged in CRD with four repeats. The results indicated that the seed cotton yield, yield attributes and B-uptake of genotypes were comparatively decreased in B-deficient stressed treatment. Genotype NIA-Ufaq exhibited wide range of adaptation and ranked as efficient-responsive, as it produced higher seed cotton yield under both B-regimes. SAU-2 and CIM-506 were highly-efficient and remaining all genotypes were medium-efficient. Genotype Sindh-1 produced low seed cotton yield under B deficient condition and ranked as low-efficient. B-efficient cotton genotypes can be grown in B deficient soils without B application. (author)
Directory of Open Access Journals (Sweden)
Zhong Xingguo
2010-08-01
Full Text Available Abstract Background To compare the biological characteristics of three types of human hepatocellular carcinoma multi-drug resistant cell sub-lines Bel-7402/ADM models established by three methods. Methods Established human hepatocellular carcinoma adriamycin (ADM multi-drug resistant cell sub-lines models Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS by three methods of in vitro concentration gradient increased induction, nude mice liver-implanted induction and subcutaneous-implanted induction respectively. Phase contrast microscopy was used to observe the cells and the MTT (methyl thiazolyl tetrazolium method was used to detect drug resistance of the three different sub-lines of cells. Results The three groups of drug resistant cells, Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS generated cross-resistance to ADM and CDDP (cis-Diaminedichloroplatinum, but showed a significant difference in resistance to Bel-7402 IC50 value (P V, 46 h (Bel-7402/ADML, and 45 h (Bel-7402/ADMS. The excretion rates of ADM were significantly increased compared with the parent cell (34.14% line and were 81.06% (Bel-7402/ADMV, 66.56% (Bel-7402/ADML and 61.56% (Bel-7402/ADMS. Expression of P-gp and MRP in the three groups of resistant cells was significantly enhanced (P P > 0.05. Conclusions Stable resistance was involved in the resistant cell line model established by the above three methods. Liver implantation was a good simulation of human hepatocellular and proved to be an ideal model with characteristics similar to human hepatocellular biology and the pharmacokinetics of anticancer drugs.
Nogueira, Douglas Willian; Maluf, Wilson Roberto; Dos Reis Figueira, Antonia; Maciel, Gabriel Mascarenhas; Gomes, Luiz Antonio Augusto; Benavente, Cesar Augusto Ticona
2011-10-01
The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain). The hybrids were obtained using a partial diallel cross design (4 × 4). The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G-77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-bulk, and of group II, 1' = ABX-037G-77-03-05-04-08-bulk, 2' = ABX-037G-77-03-05-02-11-bulk, 3' = Clarice and 4' = Caserta. The 16 hybrids and eight parental lines were evaluated for PRSV-W resistance, parthenocarpic expression and yield in randomized complete-block designs, with three replications. Parthenocarpy and the resistance to PRSV-W were rated by means of a scale from 1 to 5, where 1 = non-parthenocarpic or high resistance to PRSV-W, and 5 = parthenocarpic or high susceptibility to PRSV-W. Both additive and non-additive gene effects were important in the expression of parthenocarpy and resistance to PRSV-W. Whereas estimates of heterosis in parthenocarpy usually tended towards a higher degree, resistance to PRSV-W was towards higher susceptibility. At least one F(1) hybrid was identified with a satisfactory degree of parthenocarpy, resistance to PRSV-W and high fruit-yield.
Directory of Open Access Journals (Sweden)
Douglas Willian Nogueira
2011-01-01
Full Text Available The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain. The hybrids were obtained using a partial diallel cross design (4 x 4. The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-bulk, and of group II, 1' = ABX-037G-77-03-05-04-08-bulk, 2' = ABX-037G-77-03-05-02-11-bulk, 3' = Clarice and 4' = Caserta. The 16 hybrids and eight parental lines were evaluated for PRSV-W resistance, parthenocarpic expression and yield in randomized complete-block designs, with three replications. Parthenocarpy and the resistance to PRSV-W were rated by means of a scale from 1 to 5, where 1 = non-parthenocarpic or high resistance to PRSV-W, and 5 = parthenocarpic or high susceptibility to PRSV-W. Both additive and non-additive gene effects were important in the expression of parthenocarpy and resistance to PRSV-W. Whereas estimates of heterosis in parthenocarpy usually tended towards a higher degree, resistance to PRSV-W was towards higher susceptibility. At least one F1 hybrid was identified with a satisfactory degree of parthenocarpy, resistance to PRSV-W and high fruit-yield.
Insecticide use and practices among cotton farmers in northern ...
African Journals Online (AJOL)
Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...
78 FR 68983 - Cotton Futures Classification: Optional Classification Procedure
2013-11-18
...-AD33 Cotton Futures Classification: Optional Classification Procedure AGENCY: Agricultural Marketing... regulations to allow for the addition of an optional cotton futures classification procedure--identified and... response to requests from the U.S. cotton industry and ICE, AMS will offer a futures classification option...
MicroRNA expression profiling during upland cotton gland forming ...
African Journals Online (AJOL)
Jane
2011-08-15
Aug 15, 2011 ... 2Key Laboratory of Cotton Genetic Improvement, Cotton Research Institute of the Chinese Academy of Agricultural. Sciences, Ministry of ... terpenoid aldehyde biosynthesis pathway, genetic engineering and molecular breeding of cotton. ... toxic to non-ruminant animals and humans, which means that large ...
Evaluating potassium-use-efficiency of five cotton genotypes of pakistan
International Nuclear Information System (INIS)
Hassan, Z.U.; Kubar, K.A.
2014-01-01
Potassium (K) deficiency in Pakistani soils has been recently reported as the major limiting factor affecting sustainable cotton production. The present study was conducted to envisage how K nutrition affect the growth, biomass production, yield and K-use-efficiency of five cotton genotypes, NIBGE-3701, NIBGE-1524 (Bt-transgenic), Sadori, Sindh-1 and SAU-2 (non-Bt conventional), commonly grown in Pakistan. All five genotypes were raised at deficient and adequate K levels, i.e. 0 and 60 kg K/sub 2/O ha-1, respectively. The experiment was performed in plastic pots following a completely randomized factorial design with three repeats. Adequate K nutrition significantly increased various plant growth traits and yield of all cotton genotypes under study, viz. number of sympodia (21%), number of leaves (34%), leaf dry biomass (30%), shoot dry biomass (31%), number of bolls (50%) and yield of seed cotton (92%). Substantial variations were observed among cotton genotypes for their K-use-efficiency and K-response-efficiency. Sadori and SAU-2 were screened as most K-use-efficient cotton genotypes, while Sindh-1 and SAU-2 were ranked as the most K-responsive cotton genotypes. Interestingly, Sadori did not respond to K nutrition. Moreover, Bt cotton genotypes accumulated more K as compared to non-Bt genotypes. The cotton genotype SAU-2 was identified as efficient-response genotype for better adaptation for both low- and high-K-input sustainable cotton agriculture systems. (author)
Dong, Y J; Hwang, S Y
2017-10-01
The cotton aphid, Aphis gossypii (Glover) (Hemiptera: Aphididae), is a major pest of many crops worldwide and a major cucumber plant pest in Taiwan. Because cotton aphids rapidly develop insecticide resistance and because of the insecticide residue problem, a safe and sustainable method is required to replace conventional chemical control methods. Methyl salicylate (MeSA), a herbivore-induced plant volatile, has been shown to affect aphids' behavior and attract the natural enemies of aphids for reducing their population. Therefore, this study examined the direct effects of MeSA on cotton aphids' settling preference, population development, and attractiveness to natural enemies. The efficiency of using MeSA and the commercial insecticide pymetrozine for reducing the cotton aphid population in laboratory and outdoor cucumber plant pot was also examined. The results showed no difference in winged aphids' settling preference and population development between the MeSA and blank treatments. Cucumber plants infested with cotton aphids and baited with 0.1% or 10% MeSA contained significantly higher numbers of the natural enemy of cotton aphids, namely Scymnus (Pullus) sodalis (Weise) (Coleoptera: Coccinellidae), and MeSA-treated cucumber plants contained a lower number of aphids. Significantly lower cotton aphid numbers were found on cucumber plants within a 10-m range of MeSA application. In addition, fruit yield showed no difference between the MeSA and pymetrozine treatments. According to our findings, 0.1% MeSA application can replace insecticides as a cotton aphid control tool. However, large-scale experiments are necessary to confirm its efficiency and related conservation biological control strategies before further use. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Producing Organic Cotton: A Toolkit - Crop Guide, Projekt guide, Extension tools
Eyhorn, Frank
2005-01-01
The CD compiles the following extension tools on organic cotton: Organic Cotton Crop Guide, Organic Cotton Training Manual, Soil Fertility Training Manual, Organic Cotton Project Guide, Record keeping tools, Video "Organic agriculture in the Nimar region", Photos for illustration.
A facile method to fabricate superhydrophobic cotton fabrics
Zhang, Ming; Wang, Shuliang; Wang, Chengyu; Li, Jian
2012-11-01
A facile and novel method for fabricating superhydrophobic cotton fabrics is described in the present work. The superhydrophobic surface has been prepared by utilizing cationic poly (dimethyldiallylammonium chloride) and silica particles together with subsequent modification of (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The size distribution of silica particles was measured by Particle Size Analyzer. The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, the superhydrophobic durability of coated cotton textiles has been evaluated by exposure, immersion and washing tests. The results show that the treated cotton fabrics exhibited excellent chemical stability and outstanding non-wettability with the WCA of 155 ± 2°, which offers an opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications.
Buehler, M. G.; Hershey, C. W.
1986-01-01
A new test structure was developed for evaluating the line spacing between conductors on the same layer using an electrical measurement technique. This compact structure can also be used to measure the sheet resistance, linewidth, and line pitch of the conducting layer. Using an integrated-circuit fabrication process, this structure was fabricated in diffused polycrystalline silicon and metal layers and measured optically and electrically. For the techniques used, the optical measurements were typically one-quarter micron greater than the electrical measurements. Most electrically measured line pitch values were within 2 percent of the designed value. A small difference between the measured and designed line pitch is used to validate sheet resistance, linewidth, and line spacing values.
Directory of Open Access Journals (Sweden)
Jegadeesan Ramalingam
2017-06-01
Full Text Available Bacterial blight (BB, caused by Xanthomonas oryzae pv.oryzae is one among the major diseases in rice, which in severe condition cause losses up to 60% in total yield. Marker assisted pyramiding of three broad spectrum BB resistance genes (xa5, xa13, and Xa21 in prominent rice varieties is the most economical and effective strategy for the management of the BB disease. We report here the pyramiding of three genes (xa5, xa13, and Xa21 in maintainer lines (CO 2B, CO 23B, and CO 24B of three promising wild abortive cytoplasmic male sterile lines (CO 2A, CO 23A, and CO 24A through functional markers assisted back cross breeding. IRBB60 with xa5, xa13, and Xa21 genes is used as a donor parent. BC2F1 and BC2F2 generations from a cross of CO 2B, CO 23B, and CO 24B with IRBB60 were evaluated for bacterial blight and non-fertility restoration. In BC2F1, plants with all three resistance genes (xa5, xa13, and Xa21 and high parent genome recovery was identified. In BC2F2, plants with all resistance genes and without fertility restorer (Rf3 and Rf4 were selected. Based on agronomic traits, BB resistance and maintenance of sterility, two plants each in CO 2B × IRBB60, CO 24B × IRBB60 and one plant in CO 23B × IRBB60 combinations were identified. The identified lines were crossed with respective male sterile lines for conversion of improved B line into CMS line through back-crossing, in addition to selfing. The plants with high recurrent genome and phenotypically similar to parental lines and sterile are being used for the hybrid rice development program. Currently, using these lines (improved CMS line, test crosses were made to develop new rice hybrids. Hybrids combinations viz., CO 23A × AD08009R and CO 24A × IET20898R were found to be stable at different locations with high yield. The R line used in this study has been introgressed with xa5, xa13, and Xa21 genes in a separate breeding program. These new hybrids with resistance against bacterial blight
Milkweed, stink bugs, and Georgia cotton
In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...
DEFF Research Database (Denmark)
Jacobsen, Kirstine
, which in 43-50% of cases are caused by a secondary mutation (T790M) in EGFR. Importantly, a majority of resistance cases are still unexplained (Lin & Bivona, 2012). Our aim is to identify novel resistance mechanisms – and potentially new drug targets - in erlotinib-resistant subclones of the NSCLC cell...... of erlotinib, and in biological triplicates on a Q-Exactive mass spectrometer. Only proteins identified with minimum 2 unique peptides and in minimum 2 of 3 replicates were accepted. Results: Importantly, the resistant clones did not acquire the T790M or other EGFR or KRAS mutations, potentiating...... the identification of novel resistance mechanisms. We identified 2875 cytoplasmic proteins present in all 4 cell lines. Of these 87, 56 and 23 are upregulated >1.5 fold; and 117, 72 and 32 are downregulated >1.5 fold, respectively, in the 3 resistant clones compared to the parental cell line. By network analysis, we...
Fabrication of cotton fabric with superhydrophobicity and flame retardancy.
Zhang, Ming; Wang, Chengyu
2013-07-25
A simple and facile method for fabricating the cotton fabric with superhydrophobicity and flame retardancy is described in the present work. The cotton fabric with the maximal WCA of 160° has been prepared by the covalent deposition of amino-silica nanospheres and the further graft with (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The geometric microstructure of silica spheres was measured by transmission electron microscopy (TEM). The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, diverse performances of superhydrophobic cotton textiles have been evaluated as well. The results exhibited the outstanding superhydrophobicity, excellent waterproofing durability and flame retardancy of the cotton fabric after treatment, offering a good opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.
Biosafety risk assessment approaches for insect-resistant genetically modified crops
Directory of Open Access Journals (Sweden)
Inaam Ullah
2017-02-01
Full Text Available Background: Environmental risk assessment (ERA is imperative for commercial release of insect resistant, genetically modified crops (IR-GMCs.An insect specific, spider venom peptideω-HXTX-Hv1a (Hvt was successfully expressed in cotton plants. The cotton plants producing Hvt protein have demonstrated resistance against economically important insect pest species. The study was performed to assess the effects of Hvt producing cotton plants on Honey bees (Apis mellifera. Methods: Three approaches were used to evaluate the effects of Hvt protein on adults of honeybees; whole plant assays in flight cages, in vitro assays with pollen of Hvt-cotton, and assays with elevated levels of purified Hvt protein. Pollens of Bt cotton or purified Bt proteins were used as control. Results: The field experiments did not yield any meaningful data due to high rate of mortality in all treatments including the control. However, the laboratory experiments provided conclusive results in which Hvt, purified or in pollens, did not affect the survival or longevity of the bees compared to the control. During the course of study we were able to compare the quality, effectiveness and economics of different experiments. Conclusions: We conclude that Hvt either purified or produced in cotton plants do not affect the survival or longevity of honey bees. We are also of the view that starting at laboratory level assays not only gives meaningful data but also saves a lot of time and money that can be spent on other important questions regarding safety of a particular transgenic crop. Hence, a purpose-based, tiered approach could be the best choice for pre-release ERA of IR-GMCs.
Guichelaar, Teun; van Erp, Elisabeth A; Hoeboer, Jeroen; Smits, Noortje A M; van Els, Cécile A C M; Pieren, Daan K J; Luytjes, Willem
2018-01-01
Susceptibility and declined resistance to human pathogens like respiratory syncytial virus (RSV) at old age is well represented in the cotton rat (Sigmodon hispidus). Despite providing a preferred model of human infectious diseases, little is known about aging of its adaptive immune system. We aimed
Phosphoproteome and Transcriptome of RA-Responsive and RA-Resistant Breast Cancer Cell Lines.
Directory of Open Access Journals (Sweden)
Marilyn Carrier
Full Text Available Retinoic acid (RA, the main active vitamin A metabolite, controls multiple biological processes such as cell proliferation and differentiation through genomic programs and kinase cascades activation. Due to these properties, RA has proven anti-cancer capacity. Several breast cancer cells respond to the antiproliferative effects of RA, while others are RA-resistant. However, the overall signaling and transcriptional pathways that are altered in such cells have not been elucidated. Here, in a large-scale analysis of the phosphoproteins and in a genome-wide analysis of the RA-regulated genes, we compared two human breast cancer cell lines, a RA-responsive one, the MCF7 cell line, and a RA-resistant one, the BT474 cell line, which depicts several alterations of the "kinome". Using high-resolution nano-LC-LTQ-Orbitrap mass spectrometry associated to phosphopeptide enrichment, we found that several proteins involved in signaling and in transcription, are differentially phosphorylated before and after RA addition. The paradigm of these proteins is the RA receptor α (RARα, which was phosphorylated in MCF7 cells but not in BT474 cells after RA addition. The panel of the RA-regulated genes was also different. Overall our results indicate that RA resistance might correlate with the deregulation of the phosphoproteome with consequences on gene expression.
7 CFR 27.25 - Additional samples of cotton; drawing.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed, separate samples, if desired, may be drawn and furnished to the owner of the cotton. ...
DeepCotton: in-field cotton segmentation using deep fully convolutional network
Li, Yanan; Cao, Zhiguo; Xiao, Yang; Cremers, Armin B.
2017-09-01
Automatic ground-based in-field cotton (IFC) segmentation is a challenging task in precision agriculture, which has not been well addressed. Nearly all the existing methods rely on hand-crafted features. Their limited discriminative power results in unsatisfactory performance. To address this, a coarse-to-fine cotton segmentation method termed "DeepCotton" is proposed. It contains two modules, fully convolutional network (FCN) stream and interference region removal stream. First, FCN is employed to predict initially coarse map in an end-to-end manner. The convolutional networks involved in FCN guarantee powerful feature description capability, simultaneously, the regression analysis ability of neural network assures segmentation accuracy. To our knowledge, we are the first to introduce deep learning to IFC segmentation. Second, our proposed "UP" algorithm composed of unary brightness transformation and pairwise region comparison is used for obtaining interference map, which is executed to refine the coarse map. The experiments on constructed IFC dataset demonstrate that our method outperforms other state-of-the-art approaches, either in different common scenarios or single/multiple plants. More remarkable, the "UP" algorithm greatly improves the property of the coarse result, with the average amplifications of 2.6%, 2.4% on accuracy and 8.1%, 5.5% on intersection over union for common scenarios and multiple plants, separately.
Directory of Open Access Journals (Sweden)
Nowak-Woźny D.
2005-01-01
Full Text Available The electrical resistively and intensity of X-ray diffraction reflexes were determined for overhead line wires deformed plastically and immersed at different solutions. Immersing (chemical ageing was performed by plastic deformation along the wire axis. During chemical ageing the samples were exposed to the action of the Cl-, SO4 2-, and SO3 2- ions. Resistively was measured at room temperature and at liquid nitrogen temperature. After the X-ray and resistively measurement data were compared, it was found that three processes could take place: the flow of ions through the boundary between a sample and environment; the mechanical relaxation of vacancies near a line of dislocations, and the ordering of microstructure. These effects can lead to the anisotropy of resistively.
Directory of Open Access Journals (Sweden)
Kravik Katherine L
2006-05-01
Full Text Available Abstract Background Treatment of cells with the anti-cancer drug 5-fluorouracil (5-FU causes DNA damage, which in turn affects cell proliferation and survival. Two stable wild-type TP53 5-FU-resistant cell lines, ContinB and ContinD, generated from the HCT116 colon cancer cell line, demonstrate moderate and strong resistance to 5-FU, respectively, markedly-reduced levels of 5-FU-induced apoptosis, and alterations in expression levels of a number of key cell cycle- and apoptosis-regulatory genes as a result of resistance development. The aim of the present study was to determine potential differential responses to 8 and 24-hour 5-FU treatment in these resistant cell lines. We assessed levels of 5-FU uptake into DNA, cell cycle effects and apoptosis induction throughout treatment and recovery periods for each cell line, and alterations in expression levels of DNA damage response-, cell cycle- and apoptosis-regulatory genes in response to short-term drug exposure. Results 5-FU treatment for 24 hours resulted in S phase arrests, p53 accumulation, up-regulation of p53-target genes on DNA damage response (ATF3, GADD34, GADD45A, PCNA, cell cycle-regulatory (CDKN1A, and apoptosis-regulatory pathways (FAS, and apoptosis induction in the parental and resistant cell lines. Levels of 5-FU incorporation into DNA were similar for the cell lines. The pattern of cell cycle progression during recovery demonstrated consistently that the 5-FU-resistant cell lines had the smallest S phase fractions and the largest G2(/M fractions. The strongly 5-FU-resistant ContinD cell line had the smallest S phase arrests, the lowest CDKN1A levels, and the lowest levels of 5-FU-induced apoptosis throughout the treatment and recovery periods, and the fastest recovery of exponential growth (10 days compared to the other two cell lines. The moderately 5-FU-resistant ContinB cell line had comparatively lower apoptotic levels than the parental cells during treatment and recovery
Study of mungbean intercropping in cotton planted with different techniques
International Nuclear Information System (INIS)
Khan, M.B.; Khaliq, A.
2004-01-01
Bio-economic efficiency of different cotton-based intercropping systems was determined at the Agronomic Research Area, University of Agriculture, Faisalabad, (Pakistan) during 1996-1997 and 1997-98. Cotton cultivar NIAB-78 was planted in 80-cm apart single rows and 120-cm spaced double row strips with the help of a single row hand drill. Intercropping systems were cotton alone and cotton + mungbean. Experiment was laid out in a RCBD with split arrangements in four replications. Planting patterns were kept in main plots and intercropping systems in sub-plots. Inter crop was sown in the space between 80-cm apart single rows as well as 120-cm spaced double row strips. Competition functions like relative crowding coefficient, competitive ratio, aggressivity, land equivalent ratio and area time equivalent ratio were calculated for the assessment of the benefits of the intercropping. Partial budget was prepared for determining net field benefits of the systems under study. Growing of cotton in 120-cm spaced double row strips proved superior to 80-cm spaced single rows. Intercropping decreased the seed cotton production significantly in both years, however, inter crop not only covered this loss but also increased overall productivity. Higher net field benefit (NFB) was obtained from cotton + mungbean than sole cropping of cotton. Farmers with small land holdings, seriously constrained by low crop income can adopt the practice of intercropping of mungbean in cotton. (author)
Fourier-transform imaging of cotton and botanical and field trash mixtures
Botanical and field cotton trash comingled with cotton lint can greatly reduce the marketability and quality of cotton. Trash can be found comingled with cotton lint during harvesting, ginning, and processing, thus this study is of interest. Attenuated Total Reflectance-Fourier Transform Infrared (A...
Warabi, E; Usui, K; Tanaka, Y; Matsumoto, H
2001-08-01
The diphenyl ether herbicide oxyfluorfen (2-chloro-4-trifluoromethylphenyl 3-ethoxy-4-nitrophenyl ether) inhibits protoporphyrinogen oxidase (Protox) which catalyzes the oxidation of protoporphyrinogen IX (Protogen) to protoporphyrin IX (Proto IX), the last step of the common pathway to chlorophyll and haeme biosynthesis. We have selected an oxyfluorfen-resistant soybean cell line by stepwise selection methods, and the resistance mechanism has been investigated. No growth inhibition was observed in resistant cells at a concentration of 10(-7) M oxyfluorfen, a concentration at which normal cells did not survive. While the degree of inhibition of total extractable Protox by oxyfluorfen was the same in both cell types, the enzyme activity in the mitochondrial fraction from non-treated resistant cells was about nine-fold higher than that from normal cells. Northern analysis of mitochondrial Protox revealed that the concentration of mitochondrial Protox mRNA was much higher in resistant cells than that in normal cells. There were no differences in the absorption and metabolic breakdown of oxyfluorfen. The growth of resistant cells was also insensitive to oxadiazon [5-tert-butyl-3-(2,4-dichloro-5-isopropoxyphenyl)-1,3,4-oxadiazol-2-(3H)- one], the other chemical class of Protox inhibitor. Therefore, the resistance of the selected soybean cell line to oxyfluorfen is probably mainly due to the overproduction of mitochondrial Protox.
International Nuclear Information System (INIS)
Qazi, A. M.; Akram, M.; Ahmad, A.
2006-01-01
A field experiment was conducted on a sandy loam soil for three consecutive years (2002-2005) to study the effects of combined use of chemical fertilizers (NPK) and organic manure (municipal solid waste manure-MSWM) on soil organic matter, bulk density, porosity, penetration resistance, and yields of crops in cotton (Desi)-wheat cropping system. After three years, organic matter content of the surface (0-15 cm) soil increased (42-68%)to 7.1-8.4 g kg from an initial level of 5.0 g kg with out any significant interaction between two fertilizer doses, three management techniques and six seasons except for dose x season interaction where higher organic matter contents were found after each cotton harvest by site-specific fertilizer application. In general, the bulk density of the surface soil increased un-impressively with the time by unique use of fertilizers and decreased gradually by application of integrated plant nutrients management (IPNM) technique using MSWM with or without pesticides/herbicides use. Porosity of soil increased (2.5 %) by applying IPNM technique compared to unique use of chemical fertilizers. Penetration resistance was increased with unique use of fertilizers to a level of 0.80 M Pa from initial value of 0.74 MPa. Presumably due to higher intrinsic bulk density of the soil. Over the three years, on an average, the MSW manured and fertilized plots (IPNM with pesticides/herbicides use ) produced higher i.e. 2% and 11% increase in seed cotton and wheat grain yields respectively than did the plots receiving chemical fertilizers. Neglecting herbicides/pesticides application decreased (4-5%) seed cotton yield. (author)
7 CFR 1427.174 - Maturity of seed cotton loans.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427.174 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION... Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...
The preparation and antibacterial effects of dopa-cotton/AgNPs
International Nuclear Information System (INIS)
Xu Hong; Shi Xue; Ma Hui; Lv Yihang; Zhang Linping; Mao Zhiping
2011-01-01
Silver nanoparticles (AgNPs) have been known to have powerful antibacterial activity. In this paper, in situ generation of AgNPs on the surface of dopamine modified cotton fabrics (dopa-cotton/AgNPs) in aqueous solution under room temperature is presented. X-ray photoelectron spectroscopy (XPS) and field emission scanning electron microscope (FE-SEM) were used to analyze the surface chemical composition and the morphology of the modified cotton fabrics, respectively. The results indicated that the surface of cotton fabrics was successfully coated with polydopamine and AgNPs. The cotton fabrics with AgNPs showed durable antibacterial activity.
Shen, Mingwang; Xiao, Yanni; Rong, Libin; Meyers, Lauren Ancel; Bellan, Steven E
2017-06-28
Early initiation of antiretroviral therapy (ART) reduces the risk of drug-sensitive HIV transmission but may increase the transmission of drug-resistant HIV. We used a mathematical model to estimate the long-term population-level benefits of ART and determine the scenarios under which earlier ART (treatment at 1 year post-infection, on average) could decrease simultaneously both total and drug-resistant HIV incidence (new infections). We constructed an infection-age-structured mathematical model that tracked the transmission rates over the course of infection and modelled the patients' life expectancy as a function of ART initiation timing. We fitted this model to the annual AIDS incidence and death data directly, and to resistance data and demographic data indirectly among men who have sex with men (MSM) in San Francisco. Using counterfactual scenarios, we assessed the impact on total and drug-resistant HIV incidence of ART initiation timing, frequency of acquired drug resistance, and second-line drug effectiveness (defined as the combination of resistance monitoring, biomedical drug efficacy and adherence). Earlier ART initiation could decrease the number of both total and drug-resistant HIV incidence when second-line drug effectiveness is sufficiently high (greater than 80%), but increase the proportion of new infections that are drug resistant. Thus, resistance may paradoxically appear to be increasing while actually decreasing. © 2017 The Author(s).
Marketing policies and economic interests in the cotton sector of Kenya
Dijkstra, T.
1990-01-01
This report, which is based on field research carried out in 1988, examines the marketing arrangements for raw cotton, cotton lint and cotton seed in Kenya, as well as the relationships and conflicts between the actors involved. The report starts with the history of cotton production and marketing
Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed
2018-02-27
The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10
Role of free radicals in an adriamycin-resistant human small cell lung cancer cell line
Meijer, C.; Mulder, N H; Timmer-Bosscha, H; Zijlstra, J G; de Vries, E G
1987-01-01
In two Adriamycin (Adr) resistant sublines (GLC4-Adr1 and GLC4-Adr2) of a human small cell lung carcinoma cell line, GLC4, cross-resistance for radiation was found. GLC4-Adr1 has an acquired Adr resistance factor of 44 after culturing without Adr for 20 days and GLC4-Adr2, the same subline cultured
76 FR 32067 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions
2011-06-03
... ``Any AUP cotton'' and replacing it with the phrase ``Mature AUP cotton'' to clarify the AUP cotton must be mature in order to calculate a conversion factor between AUP cotton and ELS cotton. List of... dividing Price A by 85 percent of Price B. * * * * * (f) Mature AUP cotton harvested or appraised from...
Directory of Open Access Journals (Sweden)
Teodoro Stadler
2009-06-01
Full Text Available El control de las poblaciones de Anthonomus grandis Boheman, por debajo de su umbral de daño económico durante el ciclo del cultivo del algodón, se realiza en forma efectiva hasta el momento, a través de insecticidas de síntesis. La presión selectiva de las aplicaciones extensivas e intensivas de insecticidas hace imperativa la detección temprana de focos de resistencia a los mismos, en función de un correcto manejo del fenómeno. Se desarrolló un método de diagnóstico de resistencia para A. grandis a partir de la técnica "vial test", que fue adaptada en forma de "kit" para el monitoreo rápido y sencillo de los focos de resistencia en el campo. La toxicidad (CL99, para calcular la concentración discriminante (CD del insecticida y la preparación del "kit", se obtiene a partir de bioensayos de laboratorio con una cepa normal susceptible de A. grandis. Se determinó la vida media de los insecticidas dentro de los viales por CIPAC MT 46, para establecer una fecha de vencimiento del "kit". La CD y el método en su conjunto fueron validados a través de ensayos a campo. El "kit", usado en el monitoreo de resistencia en el campo, fue especialmente diseñado para ser utilizado en las condiciones geográficas, económicas y socio-culturales presentes en la región algodonera argentina. La implementación de esta técnica permitirá conseguir la información necesaria, y así obtener una apropiada alternancia de insecticidas. Como consecuencia, se prevé una reducción de impacto ambiental de las prácticas agronómicas en el control de plagas en algodón.The in-season control of the cotton boll weevil Anthonomus grandis Boheman is done by insecticide application, which so far is the only effective way to reduce boll weevil populations to levels below economic significance. The extensive and intensive control actions with insecticides cause selective pressure on pest populations. Thus, to achieve an accurate insecticide resistance
Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing
2014-11-06
Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved
A study on measurement of radiation resistance of Pyronema domesticum sclerotia
International Nuclear Information System (INIS)
Aoshuang, Y.; Ailian, W.; Ying, Z.
2000-01-01
Measurements of radiation resistance have been carried out using two strains of Pyronema domesticum which were isolated from Chinese cotton swab gauze. A 'sand-washing' technique was developed to overcome the difficulties when harvesting sclerotia spores from cultured plates and preparing spore suspensions for further use. Three types of microbial preparations, spore suspension, inoculated cotton and spore dot, were exposed to gamma radiation. A dose-survival curve method and a fraction positive method were employed to determine radiation resistance. D 10 values derived from this study are within the range of 2.0-3.0 kGy. Concerns associated with the current study indicate that further work is needed. (author)
Real-time electron density measurements from Cotton-Mouton effect in JET machine
International Nuclear Information System (INIS)
Brombin, M.; Boboc, A.; Zabeo, L.; Murari, A.
2008-01-01
Real-time density profile measurements are essential for advanced fusion tokamak operation and interferometry is a proven method for this task. Nevertheless, as a consequence of edge localized modes, pellet injections, fast density increases, or disruptions, the interferometer is subject to fringe jumps, which produce loss of the signal preventing reliable use of the measured density in a real-time feedback controller. An alternative method to measure the density is polarimetry based on the Cotton-Mouton effect, which is proportional to the line-integrated electron density. A new analysis approach has been implemented and tested to verify the reliability of the Cotton-Mouton measurements for a wide range of plasma parameters and to compare the density evaluated from polarimetry with that from interferometry. The density measurements based on polarimetry are going to be integrated in the real-time control system of JET since the difference with the interferometry is within one fringe for more than 90% of the cases.
Zwollo, Patty; Ray, Jocelyn C; Sestito, Michael; Kiernan, Elizabeth; Wiens, Gregory D; Kaattari, Steve; StJacques, Brittany; Epp, Lidia
2015-01-01
Bacterial cold water disease (BCWD) is a chronic disease of rainbow trout, and is caused by the Gram-negative bacterium Flavobacterium psychrophilum (Fp), a common aquaculture pathogen. The National Center for Cool and Cold Water Aquaculture has bred two genetic lines of rainbow trout: a line of Fp-resistant trout (ARS-Fp-R or R-line trout) and a line of susceptible trout (ARS-Fp-S, or S-line). Little is known about how phenotypic selection alters immune response parameters or how such changes relate to genetic disease resistance. Herein, we quantify interindividual variation in the distribution and abundance of B cell populations (B cell signatures) and examine differences between genetic lines of naive animals. There are limited trout-specific cell surface markers currently available to resolve B cell subpopulations and thus we developed an alternative approach based on detection of differentially expressed transcription factors and intracellular cytokines. B cell signatures were compared between R-line and S-line trout by flow cytometry using antibodies against transcription factors early B cell factor-1 (EBF1) and paired domain box protein Pax5, the pro-inflammatory cytokine IL-1β, and the immunoglobulin heavy chain mu. R-line trout had higher percentages of EBF(+) B myeloid/ progenitor and pre-B cells in PBL, anterior and posterior kidney tissues compared to S-line trout. The opposite pattern was detected in more mature B cell populations: R-line trout had lower percentages of both IgM(+) mature B cells and IgM-secreting cells in anterior kidney and PBL compared to S-line trout. In vitro LPS-activation studies of PBL and spleen cell cultures revealed no significant induction differences between R-line and S-line trout. Together, our findings suggest that selective resistance to BCWD may be associated with shifts in naive animal developmental lineage commitment that result in decreased B lymphopoiesis and increased myelopoiesis in BCWD resistant trout relative
Cotton in Benin: governance and pest management
Togbe, C.E.
2013-01-01
Key words: cotton, synthetic pesticides, neem oil (Azadirachta indica), Beauveria bassiana,
Bacillus thuringiensis, field experiment, farmers’ participation
Pests are one of the main factors limiting cotton production worldwide. Most of the pest
control
Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.
Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan
2016-09-26
Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.
Orientation of cotton growers of multan district about heal hazards and pesticide use
International Nuclear Information System (INIS)
Haq, Q.U.; Hussain, R.; Ali, T.; Ahmad, M.
2008-01-01
Cotton growing farmers and cotton pickers are the twin pillars of cotton growing community. Cotton growing farmers (male) are involved in monitoring of quality and quantity of cotton crops by handsome usage of pesticides for better marketing of cotton crops. Whereas, cotton pickers (female) are involved in picking of cotton mainly. To assess their knowledge and source of knowledge about pesticides related health problems, the study was designed and conducted in 20 villages of district Multan selected by multistage random sampling technique. From the selected 20 villages, from the list bearing the villages, mouzas and union councils of district Multan, 220 cotton growers and 150 cotton pickers were selected by simple random sampling technique and interviewed through a reliable and validated interview schedule. The data collected were processed through Statistical Package for Social Sciences (SPSS). The results showed that 75% of cotton growing farmers were having orientation about side effects of pesticides whereas, almost 8% of cotton growers were having no knowledge about side effects of pesticides. (author)
Hou, Liyuan; Zhang, Xiaojun; Li, Xin; Jia, Juqing; Yang, Huizhen; Zhan, Haixian; Qiao, Linyi; Guo, Huijuan; Chang, Zhijian
2015-07-28
Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68-0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.
Ecoinformatics reveals effects of crop rotational histories on cotton yield.
Meisner, Matthew H; Rosenheim, Jay A
2014-01-01
Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.
Ecoinformatics reveals effects of crop rotational histories on cotton yield.
Directory of Open Access Journals (Sweden)
Matthew H Meisner
Full Text Available Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.
Weed hosts of cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae).
Vennila, S; Prasad, Y G; Prabhakar, M; Agarwal, Meenu; Sreedevi, G; Bambawale, O M
2013-03-01
The exotic cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) invaded India during 2006, and caused widespread infestation across all nine cotton growing states. P. solenopsis also infested weeds that aided its faster spread and increased severity across cotton fields. Two year survey carried out to document host plants of P. solenopsis between 2008 and 2010 revealed 27, 83, 59 and 108 weeds belonging to 8, 18, 10 and 32 families serving as alternate hosts at North, Central, South and All India cotton growing zones, respectively. Plant species of four families viz., Asteraceae, Amaranthaceae, Malvaceae and Lamiaceae constituted almost 50% of the weed hosts. While 39 weed species supported P. solenopsis multiplication during the cotton season, 37 were hosts during off season. Higher number of weeds as off season hosts (17) outnumbering cotton season (13) at Central over other zones indicated the strong carryover of the pest aided by weeds between two cotton seasons. Six, two and seven weed hosts had the extreme severity of Grade 4 during cotton, off and cotton + off seasons, respectively. Higher number of weed hosts of P. solenopsis were located at roadside: South (12) > Central (8) > North (3) zones. Commonality of weed hosts was higher between C+S zones, while no weed host was common between N+S zones. Paper furnishes the wide range of weed hosts of P. solenopsis, discusses their significance, and formulated general and specific cultural management strategies for nationwide implementation to prevent its outbreaks.
Assessment of Bollgard II cotton pollen mediated transgenes flow to ...
African Journals Online (AJOL)
Assessment of Bollgard II cotton pollen mediated transgenes flow to conventional cotton in the farming conditions of Burkina ... This has led to experiment on Bt cotton from 2003 to 2007. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT
Elemental analysis of cotton by laser-induced breakdown spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Schenk, Emily R.; Almirall, Jose R.
2010-05-01
Laser-induced breakdown spectroscopy (LIBS) has been applied to the elemental characterization of unprocessed cotton. This research is important in forensic and fraud detection applications to establish an elemental fingerprint of U.S. cotton by region, which can be used to determine the source of the cotton. To the best of our knowledge, this is the first report of a LIBS method for the elemental analysis of cotton. The experimental setup consists of a Nd:YAG laser that operates at the fundamental wavelength as the LIBS excitation source and an echelle spectrometer equipped with an intensified CCD camera. The relative concentrations of elements Al, Ba, Ca, Cr, Cu, Fe, Mg, and Sr from both nutrients and environmental contributions were determined by LIBS. Principal component analysis was used to visualize the differences between cotton samples based on the elemental composition by region in the U.S. Linear discriminant analysis of the LIBS data resulted in the correct classification of >97% of the cotton samples by U.S. region and >81% correct classification by state of origin.
Directory of Open Access Journals (Sweden)
Laura López-Hoffman
Full Text Available Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the "economic benefits" arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars due to the introduction and widespread adoption of Bt (Bacillus thuringiensis cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function--in this case bat population numbers--is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.
López-Hoffman, Laura; Wiederholt, Ruscena; Sansone, Chris; Bagstad, Kenneth J.; Cryan, Paul M.; Diffendorfer, James E.; Goldstein, Joshua; LaSharr, Kelsie; Loomis, John; McCracken, Gary; Medellin, Rodrigo A.; Russell, Amy; Semmens, Darius J.
2014-01-01
Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the “economic benefits” arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana) to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars) due to the introduction and widespread adoption of Bt (Bacillus thuringiensis) cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function – in this case bat population numbers – is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.
Investigating a signature of temozolomide resistance in GBM cell lines using metabolomics.
St-Coeur, Patrick-Denis; Poitras, Julie J; Cuperlovic-Culf, Miroslava; Touaibia, Mohamed; Morin, Pier
2015-10-01
Glioblastoma multiforme (GBM) is the most common form of malignant glioma. Current therapeutic approach to treat this malignancy involves a combination of surgery, radiotherapy and chemotherapy with temozolomide. Numerous mechanisms contributing to inherent and acquired resistance to this chemotherapeutic agent have been identified and can lead to treatment failure. This study undertook a metabolomics-based approach to characterize the metabolic profiles observed in temozolomide-sensitive and temozolomide-resistant GBM cell lines as well as in a small sub-set of primary GBM tumors. This approach was also utilized to explore the metabolic changes modulated upon cell treatment with temozolomide and lomeguatrib, an MGMT inhibitor with temozolomide-sensitizing potential. Metabolites previously explored for their potential role in chemoresistance including glucose, citrate and isocitrate demonstrated elevated levels in temozolomide-resistant GBM cells. In addition, a signature of metabolites comprising alanine, choline, creatine and phosphorylcholine was identified as up-regulated in sensitive GBM cell line across different treatments. These results present the metabolic profiles associated with temozolomide response in selected GBM models and propose interesting leads that could be leveraged for the development of therapeutic or diagnostic tools to impact temozolomide response in GBMs.
Directory of Open Access Journals (Sweden)
Santos Terezinha Monteiro dos
2002-01-01
Full Text Available Host plants may influence indirectly biological characteristics of predators, on a positive or negative way, poiting out the importance of studies evaluating the effect of cultivars on the third trophic level. This study evaluates the biological aspects and predatory capacity of Podisus nigrispinus adults fed Alabama argillacea larvae reared on cotton genotypes. The predator was fed daily with fourth instar larvae reared on leaves of the following genotypes CNPA Precoce 1 (hirsute, CNPA 9211-31 (high gossypol level, CNPA 9211-41 (medium gossypol level and GL2 GL3 (gossypol glandless. The pre-oviposition, oviposition and post-oviposition periods and the oviposition capacity of P. nigripinus were not affected when preyed on cotton leafworms reared on the listed cotton genotypes. Mean weight of predator females was higher (126.2 mg when they fed on A. argillacea reared on GL2 GL3 cotton leaves, in comparison to the observed weight (96.2mg of P. nigripinus females fed on larvae reared on CNPA 9211-41. Longevity of P. nigrispinus ranged 30.7 to 31.5 days for females and 38.0 to 66.3 days for males. P. nigrispinus females preyed 125.2 to 184.0 A. argillacea larvae during its adult stage, while adult males preyed 135.7 to 205.0 leafworms. Using plant resistance in association with P. nigrispinus is viable to control A. argillacea, because resistant genotypes do not influence negatively the biological characteristics of the predator.
Guichelaar, Teun; van Erp, Elisabeth A; Hoeboer, Jeroen; Smits, Noortje A M; van Els, Cécile A C M; Pieren, Daan K J; Luytjes, Willem
2018-05-01
Susceptibility and declined resistance to human pathogens like respiratory syncytial virus (RSV) at old age is well represented in the cotton rat (Sigmodon hispidus). Despite providing a preferred model of human infectious diseases, little is known about aging of its adaptive immune system. We aimed to define aging-related changes of the immune system of this species. Concomitantly, we asked whether the rate of immunological alterations may be stratified by physiological aberrations encountered during aging. With increasing age, cotton rats showed reduced frequencies of T cells, impaired induction of antibodies to RSV, higher incidence of aberrations of organs and signs of lipemia. Moreover, old animals expressed high biological heterogeneity, but the age-related reduction of T cell frequency was only observed in those specimens that displayed aberrant organs. Thus, cotton rats show age-related alterations of lymphocytes that can be classified by links with health status. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Wang, Xiaoxiao; Wang, Yingying; Wang, Chen; Chen, Yu; Chen, Yu; Feng, Shouli; Zhao, Ting; Zhou, Baoliang
2016-10-07
Gossypium anomalum (BB genome) possesses the desirable characteristics of drought tolerance, resistance to diseases and insect pests, and the potential for high quality fibers. However, it is difficult to transfer the genes associated with these desirable traits into cultivated cotton (G. hirsutum, AADD genome). Monosomic alien addition lines (MAALs) can be used as a bridge to transfer desired genes from wild species into G. hirsutum. In cotton, however, the high number and smaller size of the chromosomes has resulted in difficulties in discriminating chromosomes from wild species in cultivated cotton background, the development of cotton MAALs has lagged far behind many other crops. To date, no set of G. hirsutum-G. anomalum MAALs was reported. Here the amphiploid (AADDBB genome) derived from G. hirsutum × G. anomalum was used to generate a set of G. hirsutum-G. anomalum MAALs through a combination of consecutive backcrossing, genomic in situ hybridization (GISH), morphological survey and microsatellite marker identification. We improved the GISH technique used in our previous research by using a mixture of two probes from G. anomalum and G. herbaceum (AA genome). The results indicate that a ratio of 4:3 (G. anomalum : G. herbaceum) is the most suitable for discrimination of chromosomes from G. anomalum and the At-subgenome of G. hirsutum. Using this improved GISH technique, 108 MAAL individuals were isolated. Next, 170 G. hirsutum- and G. anomalum-specific codominant markers were obtained and employed for characterization of these MAAL individuals. Finally, eleven out of 13 MAALs were identified. Unfortunately, we were unable to isolate Chrs. 1B a and 5B a due to their very low incidences in backcrossing generation, as these remained in a condition of multiple additions. The characterized lines can be employed as bridges for the transfer of desired genes from G. anomalum into G. hirsutum, as well as for gene assignment, isolation of chromosome
T-Stimulator effect on cotton protein composition and synthesis in salinization stress
International Nuclear Information System (INIS)
Ibragimova, E.A.; Nazirova, E.R.; Samarkhodjaeva, N.R.; Nalbandyan, A.A.; Babaev, T.A.
2004-01-01
Full text: T-stimulator was established to possess a wide spectrum of physiological effects, to enhance plant adaptation to thermal stress and to increase plant resistance to pathogens. Plant adaptation to unfavorable conditions manifests in changes in many links of metabolism, that of proteins included. We studied effect of cottonseed treatment with T-stimulator on composition and synthesis of plasma membrane proteins upon chloride salinization by means of the radioisotope method. Electrophoretic fractionation of cottonseed plasma membrane proteins showed absence of more than 40 polypeptides with molecular mass from 10 to more than 100 kDa in the cotton root membranes. Major fractions-polypeptides with molecular mass of 61, 53, 46, 25, 21, 20 and 18 kDa constitute about 50% of the total polypeptide composition. The salinization significantly affects the total membrane protein output, proportion of some polypeptides and their synthesis rate. Analysis of phoreogram radioautographs showed that 2-hour exposition of cotton roots to 35 S methionine suppresses synthesis of major polypeptides with molecular mass of 63, 61 and 53 kDa, that of low molecular polypeptides (46, 20, 18 kDa) increasing. Changes in the proportion of major polypeptides in cotton plasma membranes, reduction in rate of biosynthesis of high molecular fractions with the general suppression of label inclusion in the membrane fraction are the evidence for a disturbance in biosynthesis of some membrane proteins in cotton tissue cells upon salinization. The inhibiting effect of salinization on the protein-synthesizing system was observed in plants treated with T-stimulator, but the rate of synthesis in plasma membranes of the treated plants was found significantly higher. The activation of some plasma membrane proteins under T-stimulator effect suggests an association with the increase in adaptation of the treated plants to the disturbing effect of salinization
CATEGORIZATION OF EXTRANEOUS MATTER IN COTTON USING MACHINE VISION SYSTEMS
The Cotton Trash Identification System (CTIS) was developed at the Southwestern Cotton Ginning Research Laboratory to identify and categorize extraneous matter in cotton. The CTIS bark/grass categorization was evaluated with USDA-Agricultural Marketing Service (AMS) extraneous matter calls assigned ...
Fenik, S I; Solodushko, V G; Kaliniak, T B; Blium, Ia B
2007-01-01
Nicotiana plumbaginifolia callus lines with the equal resistance to cadmium have been produced under different selective conditions--either without inhibition of the phytochelatin synthesis (line Cd-R) or in the presence of the inhibitor butionine sulfoximine (line Cd-Ri). The level of phytochelatin synthesis in the line Cd-R five-fold exceeded the control value and in the line Cd-Ri it was twice as much as in the control. It was shown that in the control line mainly three cadmium-binding proteins are expressed of the molecular weihgts 41, 34 and 19 kD. The common feature of the both resistant lines is the expression of the cadmium-binding proteins of 40, 37 and 19 kD. The resistant lines differ with respect to the synthesis of relatively low-molecular cadmium-binding proteins. The proteins of the molecular weights 12.5, 11.5 and 9 kD are expressed in the line Cd-R, while the proteins of 13 and 10 kD are expressed in the line Cd-Ri. It was supposed that both the phytochelatins and the Cd-binding proteins contribute to the resisitance of N. plumbaginifolia callus lines to cadmium and the lack of the phytochelatins can be equilibrated by the changes in the low-molecular Cd-binding protein synthesis.
Directory of Open Access Journals (Sweden)
Julie H Levison
Full Text Available We investigated the prevalence of wild-type virus (no major drug resistance and drug resistance mutations at second-line antiretroviral treatment (ART failure in a large HIV treatment program in South Africa.HIV-infected patients ≥ 15 years of age who had failed protease inhibitor (PI-based second-line ART (2 consecutive HIV RNA tests >1000 copies/ml on lopinavir/ritonavir, didanosine, and zidovudine were identified retrospectively. Patients with virologic failure were continued on second-line ART. Genotypic testing for drug resistance was performed on frozen plasma samples obtained closest to and after the date of laboratory confirmed second-line ART failure. Of 322 HIV-infected patients on second-line ART, 43 were adults with confirmed virologic failure, and 33 had available plasma for viral sequencing. HIV-1 RNA subtype C predominated (n = 32, 97%. Mean duration on ART (SD prior to initiation of second-line ART was 23 (17 months, and time from second-line ART initiation to failure was 10 (9 months. Plasma samples were obtained 7(9 months from confirmed failure. At second-line failure, 22 patients (67% had wild-type virus. There was no major resistance to PIs found. Eleven of 33 patients had a second plasma sample taken 8 (5.5 months after the first. Median HIV-1 RNA and the genotypic resistance profile were unchanged.Most patients who failed second-line ART had wild-type virus. We did not observe evolution of resistance despite continuation of PI-based ART after failure. Interventions that successfully improve adherence could allow patients to continue to benefit from second-line ART therapy even after initial failure.
Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay.
Kozaki, Tomoaki; Lee, Soomin; Nishimura, Takayuki; Katsuura, Tetsuo; Yasukouchi, Akira
2011-01-10
Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO). In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). The melatonin levels were analyzed in duplicate using commercially available ELISA kits. The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL). The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level (<6 pg/mL), although the BA plots didn't show proportional and relative biases, there was no significant correlation between passive and cotton saliva collection samples. Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.
Chemical analysis of plasma-assisted antimicrobial treatment on cotton
International Nuclear Information System (INIS)
Kan, C W; Lam, Y L; Yuen, C W M; Luximon, A; Lau, K W; Chen, K S
2013-01-01
This paper explores the use of plasma treatment as a pretreatment process to assist the application of antimicrobial process on cotton fabric with good functional effect. In this paper, antimicrobial finishing agent, Microfresh Liquid Formulation 9200-200 (MF), and a binder (polyurethane dispersion, Microban Liquid Formulation R10800-0, MB) will be used for treating the cotton fabric for improving the antimicrobial property and pre-treatment of cotton fabric by plasma under atmospheric pressure will be employed to improve loading of chemical agents. The chemical analysis of the treated cotton fabric will be conducted by Fourier transform Infrared Spectroscopy.
Glyphosate resistance in common ragweed (Ambrosia artemisiifolia L.)from Mississippi, USA
Glyphosate is one of the most commonly used broad-spectrum herbicides over the last 40 years. Due to widespread adoption of glyphosate-resistant (GR) crop technology, especially, corn, cotton, and soybean, several weed species in agronomic situations have developed resistance to this herbicide. Rese...
Directory of Open Access Journals (Sweden)
Eliana Alcantra
2011-06-01
Full Text Available Effect of silicon and acibenzolar-s-methyl on colored cotton plants infested or not with Aphis gossypii Glover (Hemiptera, Aphididae. The aphid Aphis gossypii is an insect pest that causes damage mainly at the beginning of the cotton plant development. The effect of resistance inductors silicon and acibenzolar-s-methyl (ASM on the development of colored cotton plants were researched in the presence and absence of A. gossypii. Three colored cotton cultivars were sown in pots and individually infested with 25 apterous aphids, 13 days after the application of the inductors. Fifteen days after plant emergence, the silicon was applied at a dosage equivalent to 3 t/ha and acibenzolar-s-methyl in 0.2% solution of the product BION 500®. After 21 days of infestation the following parameters were evaluated: plant height, stem diameter, dry matter of aerial part and root, and total number of aphids replaced. It was verified that the plant height was reduced in the presence of aphids and all variables were negatively affected by the application of ASM. However, silicon did not affect plant development.
Field Comparison of Fertigation Vs. Surface Irrigation of Cotton Crop
International Nuclear Information System (INIS)
Janat, M.
2004-01-01
Based on previous results of the same nature, one nitrogen rate 180 kg N ha -1 was tested under two-irrigation methods, surface irrigation and drip fertigation of cotton (Cultivar Rakka-5) for two consecutive seasons 2000 and 2001. The study aimed to answer various questions regarding the applicability of drip fertigation at farm level and the effect of its employment on yield and growth parameters, compared to surface irrigation. Nitrogen fertilizer was either injected in eight equally split applications for the drip fertigated cotton or divided in four unequally split applications as recommend by Ministry of Agriculture (20% before planting, 40% at thinning, 20% after 60 days from planting and 20% after 75 days after planting). 15 N labeled urea was used to evaluate nitrogen fertilizer efficiency. The experimental design was randomized block design with seven replicates. Results showed that drip fertigation led to water saving exceeding 50% in some cases. Field germination percentage was highly increased under drip- fertigated cotton relative to surface-irrigated cotton. Dry matter and seed cotton yield of surface-irrigated cotton was slightly higher than that of drip-fertigated cotton in the first growing season. The reason for that was due to the hot spill that occurred in the region, which exposed the cotton crop to water stress and consequently pushed the cotton into early flowering. Lint properties were not affected by the introduction of drip-fertigation. Actually some properties were improved relative to the standard properties identified by the cotton Bureau.Nitrogen uptake was slightly increased under drip fertigation whereas nitrogen use efficiencies were not constant along the growing seasons. The reason for that could be lateral leaching and root proliferation into the labeled and unlabeled subplots. Field water use efficiency was highly increased for both growing seasons under drip fertigation practice. The rate of field water use efficiencies
Spíndola, A F; Silva-Torres, C S A; Rodrigues, A R S; Torres, J B
2013-08-01
The ladybird beetle, Eriopis connexa (Germar) (Coleoptera: Coccinellidae), is one of the commonest predators of aphids (Hemiptera: Aphididae) in the cotton agroecosystem and in many other row and fruit crops in Brazil, and has been introduced into other countries such as the USA for purposes of aphid control. In addition, the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae) is the most serious cotton pest where it occurs, including Brazil. Controlling boll weevils and other pests such as cotton defoliators still tends to involve the intense application of insecticides to secure cotton production. The pyrethroid insecticide lambda-cyhalothrin (LCT) is commonly used, but this compound is not effective against aphids; hence, a desirable strategy would be to maintain E. connexa populations in cotton fields where LCT is applied. Using populations of E. connexa resistant (Res) and susceptible (Sus) to LCT, we compared behavioural responses on treated cotton plants and under confinement on partially and fully treated surfaces, and assessed the insects' survival on treated plants compared with that of the boll weevil. The E. connexa resistant population caged on treated plants with 15 and 75 g a.i. ha-1 exhibited ≫82% survival for both insecticide concentrations compared with ≪3% and ≪17% survival for susceptible E. connexa populations and boll weevils, respectively. The response of E. connexa Res and Sus populations when released, either on the soil or on the plant canopy, indicated avoidance towards treated plants, as measured by elapsed time to assess the plant. When compared with susceptible individuals, resistant ones took longer time to suffer insecticide knockdown, had a higher recovery rate after suffering knockdown, and spent more time in the plant canopy. Based on behavioural parameters evaluated in treated arenas, no ladybird beetles exhibited repellency. However, irritability was evident, with the susceptible population exhibiting
Passive and active protection of cotton textiles
Bochove, C. van
1967-01-01
In rotproofing of cotton a distinction is made between passive and active protection. In passive protection, the structure of the cotton fibre is modified in such a way that the fibre can longer be attacked. This modification of structure can be effected on different levels: microscopical,
Incorporating a Sorghum Habitat for Enhancing Lady Beetles (Coleoptera: Coccinellidae in Cotton
Directory of Open Access Journals (Sweden)
P. G. Tillman
2012-01-01
Full Text Available Lady beetles (Coleoptera: Coccinellidae prey on insect pests in cotton. The objective of this 2 yr on-farm study was to document the impact of a grain sorghum trap crop on the density of Coccinellidae on nearby cotton. Scymnus spp., Coccinella septempunctata (L., Hippodamia convergens Guérin-Méneville, Harmonia axyridis (Pallas, Coleomegilla maculata (De Geer, Cycloneda munda (Say, and Olla v-nigrum (Mulsant were found in sorghum over both years. Lady beetle compositions in sorghum and cotton and in yellow pyramidal traps were similar. For both years, density of lady beetles generally was higher on cotton with sorghum than on control cotton. Our results indicate that sorghum was a source of lady beetles in cotton, and thus incorporation of a sorghum habitat in farmscapes with cotton has great potential to enhance biocontrol of insect pests in cotton.
Satellite-based monitoring of cotton evapotranspiration
Dalezios, Nicolas; Dercas, Nicholas; Tarquis, Ana Maria
2016-04-01
Water for agricultural use represents the largest share among all water uses. Vulnerability in agriculture is influenced, among others, by extended periods of water shortage in regions exposed to droughts. Advanced technological approaches and methodologies, including remote sensing, are increasingly incorporated for the assessment of irrigation water requirements. In this paper, remote sensing techniques are integrated for the estimation and monitoring of crop evapotranspiration ETc. The study area is Thessaly central Greece, which is a drought-prone agricultural region. Cotton fields in a small agricultural sub-catchment in Thessaly are used as an experimental site. Daily meteorological data and weekly field data are recorded throughout seven (2004-2010) growing seasons for the computation of reference evapotranspiration ETo, crop coefficient Kc and cotton crop ETc based on conventional data. Satellite data (Landsat TM) for the corresponding period are processed to estimate cotton crop coefficient Kc and cotton crop ETc and delineate its spatiotemporal variability. The methodology is applied for monitoring Kc and ETc during the growing season in the selected sub-catchment. Several error statistics are used showing very good agreement with ground-truth observations.
Integrated nutrients management for 'desi' cotton
International Nuclear Information System (INIS)
Qazi, M.A.; Akram, M.; Ahmad, N.; Khattak, M.A.
2007-01-01
Intensive cropping with no return of crop residues and other organic inputs result in the loss of soil organic matter (SOM) and nutrient supply in (Desi) cotton-wheat cropping system in Pakistan. For appraisal of problem and finding solution to sustainability, we evaluated six treatments comprised of two fertilizer doses and three management techniques over a period of three years (2003-05) monitoring their effects on seed cotton yield and soil fertility. The techniques included chemical fertilizers, municipal solid waste manure (MSWM) integrated with chemical fertilizers in 1:4 ratios with, and without pesticides. The results revealed that cotton yields. Were enhanced by 19% due to site-specific fertilizer dose over conventional dose. Ignoring weeds control by means of herbicided application resulted in 5% decrease of seed cotton yield in IPNM technique positive effect of MSWM integration was noted on soil test phosphorus and SOM. Site-specific fertilizer application and integrated plant nutrient management by MSWM proved their suitability as the techniques not only improve soil quality in terms of sustained levels of organic matter and phosphorus but also provide a safe way of waste disposal. (author)
Ni, Xinzhi; Xu, Wenwei; Krakowsky, Matthew D; Buntin, G David; Brown, Steve L; Lee, R Dewey; Coy, Anton E
2007-10-01
Identifying and using native insect resistance genes is the core of integrated pest management. In this study, 10 experimental corn, Zea mays L., hybrids and 10 inbred lines were screened for resistance to major ear-feeding insects in the southeastern Coastal Plain region of the United States during 2004 and 2005. Ear-feeding insect damage was assessed at harvest by visual damage rating for the corn earworm, Helicoverpa zea (Boddie), and by the percentage of kernels damaged by the maize weevil, Sitophilus zeamais Motschulsky, and stink bugs [combination of Euschistus servus (Say) and southern green stink bug, Nezara viridula (L.)]. Among the eight inbred lines and two control populations examined, C3S1B73-5b was resistant to corn earworm, maize weevil, and stink bugs. In contrast, C3S1B73-4 was resistant to corn earworm and stink bugs, but not to maize weevil. In a similar manner, the corn hybrid S1W*CML343 was resistant to all three ear-feeding insects, whereas hybrid C3S1B73-3*Tx205 was resistant to corn earworm and maize weevil in both growing seasons, but susceptible to stink bugs in 2005. The silk-feeding bioassay showed that corn earworm developed better on corn silk than did fall armyworm. Among all phenotypic traits examined (i.e., corn ear size, husk extension, and husk tightness), only corn ear size was negatively correlated to corn earworm damage in the inbred lines examined, whereas only husk extension (i.e., coverage) was negatively correlated to both corn earworm and maize weevil damage on the experimental hybrids examined. Such information could be used to establish a baseline for developing agronomically elite corn germplasm that confers multiple ear-feeding insect resistance.
Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen
2016-12-01
A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.
Resistively detected NMR line shapes in a quasi-one-dimensional electron system
Fauzi, M. H.; Singha, A.; Sahdan, M. F.; Takahashi, M.; Sato, K.; Nagase, K.; Muralidharan, B.; Hirayama, Y.
2017-06-01
We observe variation in the resistively detected nuclear magnetic resonance (RDNMR) line shapes in quantum Hall breakdown. The breakdown occurs locally in a gate-defined quantum point contact (QPC) region. Of particular interest is the observation of a dispersive line shape occurring when the bulk two-dimensional electron gas (2DEG) set to νb=2 and the QPC filling factor to the vicinity of νQPC=1 , strikingly resemble the dispersive line shape observed on a 2D quantum Hall state. This previously unobserved line shape in a QPC points to a simultaneous occurrence of two hyperfine-mediated spin flip-flop processes within the QPC. Those events give rise to two different sets of nuclei polarized in the opposite direction and positioned at a separate region with different degrees of electronic spin polarization.
Exploring potential and opportunities for pakistan cotton export
International Nuclear Information System (INIS)
Afridi, G. S.; Tariq, S. A.
2016-01-01
Agriculture is the single largest shareholder to GDP an employment to labour force. It has major share in export but unfortunately unable to meet international standards. This study aims to analyze the pattern of Pakistan cotton export, and to explore sector's export potential and opportunities. This new research endeavor with well-tested analytical tools enabled the trade experts and policy makers to explore the answer of lackness for diversification in export, HS-2- digits aggregated data for cotton sub-sectors have been used with latest data from 2004 to 2013 for the panel 39 countries. Revealed comparative advantage (RCA) index and gravity model approach was employed considering country and time specific fixed effect. The RCA index revealed that cotton sub-sectors have comparative advantage in export and there is gradual gain in the competitiveness with time. The opportunity exists in the markets of low, lower-middle and upper middle income countries and countries those have fair trade (low tariff and non-tariff barriers) for cotton export. Greater export potential lies with malaysia, kenya jordan, thailand, mauritius, netherlands norway, Australia and russian federation for export of cotton, however, export potential for cotton has been exhausted with canada, france, india, iran and saudi arabia. The study provide the policy information that countries of Latin america, eastern europe, central asia and northern africa are virgin for export. Therefore, pakistan should penetrate in these markets for export of cotton and other agricultural products. cognizant to new trade theories, pakistan focus on quality to gain maximum trade volume in the markets of high income countries, Pakistan may develop trade agreement with ASEAN, SAFTA, and EU-27 for export of agricultural products. (author)
Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay
Directory of Open Access Journals (Sweden)
Katsuura Tetsuo
2011-01-01
Full Text Available Abstract Background Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO. In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Methods Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection and into clear sterile tubes (passive saliva collection. The melatonin levels were analyzed in duplicate using commercially available ELISA kits. Results The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL. The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level ( Conclusion Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.
Processing and Properties of PCL/Cotton Linter Compounds
Bezerra,Elieber Barros; França,Danyelle Campos; Morais,Dayanne Diniz de Souza; Rosa,Morsyleide de Freitas; Morais,João Paulo Saraiva; Araújo,Edcleide Maria; Wellen,Renate Maria Ramos
2017-01-01
Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton...
Cycling of fertilizer and cotton crop residue nitrogen
International Nuclear Information System (INIS)
Rochester, I.J.; Constable, G.A.; MacLeod, D.A.
1993-01-01
Mineral nitrogen (N), nitrate and ammonium contents were monitored in N-fertilized soils supporting cotton crops to provide information on the nitrification, mineralization and immobilization processes operating in the soil. The relative contributions of fertilizer N, previous cotton crop residue N and indigenous soil N to the mineral N pools and to the current crop's N uptake were calculated. After N fertilizer (urea) application, the soil's mineral N content rose rapidly and subsequently declined at a slower rate. The recovery of 15 N-labelled urea as mineral N declined exponentially with time. Biological immobilization (and possibly denitrification to some extent) were believed to be the major processes reducing post-application soil mineral N content. Progressively less N was mineralized upon incubation of soil sampled through the growing season. Little soil N (either from urea or crop residue) was mineralized at crop maturity. Cycling of N was evident between the soil mineral and organic N pools throughout the cotton growing season. Considerable quantities of fertilizer N were immobilized by the soil micro biomass; immobilized N was remineralized and subsequently taken up by the cotton crop. A large proportion of the crop N was taken up in the latter part of the season when the soil mineral N content was low. It is suggested that much of the N taken up by cotton was derived from microbial sources, rather than crop residues. The application of cotton crop residue (stubble) slightly reduced the mineral N content in the soil by encouraging biological immobilization. 15 N was mineralized very slowly from the labelled crop residue and did not contribute significantly to the supply of N to the current crop. Recovery of labelled fertilizer N and labelled crop residue N by the cotton crop was 28% and 1%, respectively. In comparison, the apparent recovery of fertilizer N was 48%. Indigenous soil N contributed 68% of the N taken up by the cotton crop. 33 refs., 1 tab
Directory of Open Access Journals (Sweden)
Liyuan Hou
2015-07-01
Full Text Available Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt, is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68–0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.
Resistance of common bean breeding lines to Phaeoisariopsis griseola isolates from Honduras
Angular leaf spot (ALS) disease caused by Phaeoisariopsis griseola Sacc. Ferraris, is currently one of the most important factors limiting bean productivity in Central America. The development of breeding lines which combine resistance to ALS and Bean Golden Yellow Mosaic Virus (BGYMV) and tolerance...
Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick C K; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher K C; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin
2014-01-01
First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance - Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥ 2 TAMs; or M184V+≥ 1 TAM. Virological suppression was defined as viral load (VL) failure and (2) factors associated with virological suppression after 12 months on second-line. A total of 105 patients from 10 sites in Thailand, Hong Kong, Indonesia, Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥ 1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥ 2 TAMs; and 32 with M184V+≥ 1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤ 200 cells/µL at genotyping (OR=4.43, 95% CI [1.59-12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39-16.36], pfailure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving virological response. This emphasizes the importance of continued adherence counselling well into second-line therapy.
Resilient modulus of black cotton soil
Directory of Open Access Journals (Sweden)
K.H. Mamatha
2017-03-01
Full Text Available Resilient modulus (MR values of pavement layers are the basic input parameters for the design of pavements with multiple layers in the current mechanistic empirical pavement design guidelines. As the laboratory determination of resilient modulus is costly, time consuming and cumbersome, several empirical models are developed for the prediction of resilient modulus for different regions of the world based on the database of resilient modulus values of local soils. For use of these relationships there is a need to verify the suitability of these models for local conditions. Expansive clay called black cotton soil (BC soil is found in several parts of India and is characterized by low strength and high compressibility. This soil shows swell – shrink behaviour upon wetting and drying and are problematic. The BC soil shows collapse behaviour on soaking and therefore the strength of the soil needs to be improved. Additive stabilization is found to be very effective in stabilizing black cotton soils and generally lime is used to improve the strength and durability of the black cotton soil. In this paper, the results of repeated load tests on black cotton soil samples for the determination of MR under soaked and unsoaked conditions at a relative compaction levels of 100% and 95% of both standard and modified proctor conditions are reported. The results indicate that the black cotton soil fails to meet the density requirement of the subgrade soil and shows collapse behaviour under soaked condition. To overcome this, lime is added as an additive to improve the strength of black cotton soil and repeated load tests were performed as per AASHTO T 307 - 99 for MR determination. The results have shown that the samples are stable under modified proctor condition with MR values ranging from 36 MPa to 388 MPa for a lime content of 2.5% and curing period ranging from 7 to 28 days. Also, it is observed that, the CBR based resilient modulus is not in agreement
Changes in cotton gin energy consumption apportioned by ten functions
The public is concerned about air quality and sustainability. Cotton producers, gin owners and plant managers are concerned about rising energy prices. Both have an interest in cotton gin energy consumption trends. Changes in cotton gins’ energy consumption over the past fifty years, a period of ...
farmers' knowledge and perceptions of cotton insect pests and their
African Journals Online (AJOL)
Prince Acheampong
A survey of 337 cotton farmers in the three northern regions of Ghana was ... five applications were made during the season. ... Keywords: cotton, farmer knowledge and perception, insect pest control, Ghana. .... bordered on tests of farmers' knowledge of cotton insect pests, their damage ..... Agricultural Experiment Station.
Cotton fabric finishing with TiO2/SiO2 composite hydrosol based on ionic cross-linking method
International Nuclear Information System (INIS)
Xu, Z.J.; Tian, Y.L.; Liu, H.L.; Du, Z.Q.
2015-01-01
Highlights: • We studied the cotton finishing with TiO 2 /SiO 2 based on ionic cross-linking method. • The samples treated with CHTAC had lower value of whiteness. • The samples treated with BTCA achieved higher crease recovery angle and lower tensile strength. • The ionic cross-linking treatment (CHTAC + BTCA + TiO 2 /SiO 2 ) was better than with TiO 2 /SiO 2 sol alone. - Abstract: Cotton fabric was successfully modified by 3-chloro-2-hydroxypropyl trimethyl ammonium chloride (CHTAC), 1,2,3,4-butanetetracarboxylic acid (BTCA) and TiO 2 /SiO 2 sol. Self-cleaning characteristic was investigated using a Color Measuring and Matching System with 6 h sunlight irradiation. And the stability of TiO 2 /SiO 2 coatings was explored by measuring the washing fastness and wrinkle resistance of treated cotton samples. In addition, whiteness index, crease recovery angle and tensile strength retention (%) of treated samples were evaluated. Moreover, the morphology, structure change and crystallinity of samples were observed by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD), respectively. The results revealed that the samples treated with CHTAC had lower value of whiteness index as compared with original cotton fabric. It was also found that samples treated with BTCA achieved higher crease recovery angle and lower tensile strength. Moreover, the treatment of CHTAC and BTCA had adverse effect on the crystallinity of cotton samples, as treated samples had lower crystallinity in comparison with raw cotton fabrics. Nevertheless, the stability of self-cleaning coatings was better for samples treated with ionic cross-linking treatment (CHTAC + BTCA + TiO 2 /SiO 2 ) than samples treated with TiO 2 /SiO 2 sol alone. Furthermore, compared with original samples the UV-blocking property of ionic cross-linking treated samples was obviously enhanced
Remote sensing techniques for monitoring the Rio Grande Valley cotton stalk destruction program
Energy Technology Data Exchange (ETDEWEB)
Richardson, A.J.; Gerbermann, A.H.; Summy, K.R.; Anderson, G.L. (Department of Agriculture, Weslaco, TX (United States))
1993-09-01
Post harvest cotton (Gossypium hirsutum L.) stalk destruction is a cultural practice used in the Rio Grande Valley to suppress over wintering populations of boll weevils (Anthonomus grandis Boheman) without using chemicals. Consistent application of this practice could substantially reduce insecticide usage, thereby minimizing environmental hazards and increasing cotton production profits. Satellite imagery registered within a geographic information system was used to monitor the cotton stalk destruction program in the Rio Grande Valley. We found that cotton stalk screening procedures based on standard multispectral classification techniques could not reliably distinguish cotton from sorghum. Greenness screening for cotton plant stalks after the stalk destruction deadline was possible only where ground observations locating cotton fields were available. These findings indicate that a successful cotton stalk destruction monitoring program will require satellite images and earth referenced data bases showing cotton field locations.
Induced mutations for improvement of desi cotton
International Nuclear Information System (INIS)
Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.
2000-01-01
Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology
Effects of saliva collection using cotton swab on cortisol enzyme immunoassay.
Kozaki, Tomoaki; Hashiguchi, Nobuko; Kaji, Yumi; Yasukouchi, Akira; Tochihara, Yutaka
2009-12-01
Cotton swabs are among the most commonly used devices for collecting saliva, but various studies have reported that their use impacts the results of salivary cortisol assays. These studies, however, estimated this impact by comparing the average of the concentration and/or scatter plots. In the present study, we estimated the impact of cotton swabs on the results of salivary cortisol enzyme immunoassay (EIA) by Bland-Altman plot. Eight healthy males (aged 20-23 years) provided four saliva samples on different days to yield a total of 32 samples. Saliva samples were collected directly in plastic tubes using plastic straws and then pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). There was a lower correlation between cotton and passive saliva collection. Individually, four subjects showed a negative correlation between passive and cotton saliva collection. A Bland-Altman plot indicated that cotton swabs causes a proportional bias on the EIA assay result. Our findings indicate a considerable effect of using cotton swabs for saliva collection, and subject-specific variability in the impact. A Bland-Altman plot further suggests possible reasons for this effect.
Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects
Directory of Open Access Journals (Sweden)
Waqas Malik
2014-01-01
Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.
2007-01-01
The point of departure of this study is that first-line managers play a pivotal role in the facilitation of change initiatives in organisations world-wide. Resistance to change is one of the primary reasons why change interventions fail or why success is not achieved in the change process. More specific, the inability of first-line managers to deal with resistance to change has been cited as a primary cause for change projects to fail. There is no evidence that any research has been conducted...
Directory of Open Access Journals (Sweden)
Carlos Alberto Domingues da Silva
Full Text Available ABSTRACT: In this study, we determined the spatial and temporal distribution of fallen cotton squares and small cotton bolls fallen damaged by boll weevil and the efficiency and time interval of the equipment used to collect cotton samples. Spatial and temporal distribution of cotton squares and small cotton bolls fallen on the soil damaged by boll weevil among cotton rows was determined in an experimental design of randomized blocks in a factorial arrangement of 4x3, represented by soil surface tracks located at 1-11cm, 12-22cm, 23-33cm, and 34-44cm away from the planting row of cotton plants 70, 85, and 100 days of age. Efficiency and collection time interval of the cotton samples fallen on the soil infested by boll weevil by plastic rakes that were straight or fan-shaped, big broom, collector instrument model CNPA and aspirator of leaves ‘Trapp’ were determined in randomized block design with five treatments, 10 repetitions for each. Results demonstrated that the collection of cotton samples must be performed with greater attention to soil strips located below the cotton top projection and aspirator ‘Trapp’ of leaves was more appropriate for the operation as it used less time of collection with similar efficiency to other available equipment.
Polyploidization altered gene functions in cotton (Gossypium spp.).
Xu, Zhanyou; Yu, John Z; Cho, Jaemin; Yu, Jing; Kohel, Russell J; Percy, Richard G
2010-12-16
Cotton (Gossypium spp.) is an important crop plant that is widely grown to produce both natural textile fibers and cottonseed oil. Cotton fibers, the economically more important product of the cotton plant, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that large numbers of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across At and Dt subgenomes of tetraploid AD cottons. In the present study, the organization and evolution of the fiber development genes were investigated through the construction of an integrated genetic and physical map of fiber development genes whose functions have been verified and confirmed. A total of 535 cotton fiber development genes, including 103 fiber transcription factors, 259 fiber development genes, and 173 SSR-contained fiber ESTs, were analyzed at the subgenome level. A total of 499 fiber related contigs were selected and assembled. Together these contigs covered about 151 Mb in physical length, or about 6.7% of the tetraploid cotton genome. Among the 499 contigs, 397 were anchored onto individual chromosomes. Results from our studies on the distribution patterns of the fiber development genes and transcription factors between the At and Dt subgenomes showed that more transcription factors were from Dt subgenome than At, whereas more fiber development genes were from At subgenome than Dt. Combining our mapping results with previous reports that more fiber QTLs were mapped in Dt subgenome than At subgenome, the results suggested a new functional hypothesis for tetraploid cotton. After the merging of the two diploid Gossypium genomes, the At subgenome has provided most of the genes for fiber development, because it continues to function similar to its fiber producing diploid A genome ancestor. On the other hand, the Dt subgenome, with its non-fiber producing D genome ancestor
A Grey Fuzzy Logic Approach for Cotton Fibre Selection
Chakraborty, Shankar; Das, Partha Protim; Kumar, Vidyapati
2017-06-01
It is a well known fact that the quality of ring spun yarn predominantly depends on various physical properties of cotton fibre. Any variation in these fibre properties may affect the strength and unevenness of the final yarn. Thus, so as to achieve the desired yarn quality and characteristics, it becomes imperative for the spinning industry personnel to identify the most suitable cotton fibre from a set of feasible alternatives in presence of several conflicting properties/attributes. This cotton fibre selection process can be modelled as a Multi-Criteria Decision Making (MCDM) problem. In this paper, a grey fuzzy logic-based approach is proposed for selection of the most apposite cotton fibre from 17 alternatives evaluated based on six important fibre properties. It is observed that the preference order of the top-ranked cotton fibres derived using the grey fuzzy logic approach closely matches with that attained by the past researchers which proves the application potentiality of this method in solving varying MCDM problems in textile industries.
Hamers, Raph L.; Sigaloff, Kim C. E.; Wensing, Annemarie M.; Wallis, Carole L.; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E.; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S.; Rinke de Wit, Tobias F.; Schuurman, Rob; Siwale, M.; Njovu, C.; Labib, M.; Menke, J.; Botes, M. E.; Conradie, F.; Ive, P.; Sanne, I.; Wallis, C. L.; Letsoalo, E.; Stevens, W. S.; Hardman, M.; Wellington, M.; Luthy, R.; Mandaliya, K.; Abdallah, S.; Jao, I.; Dolan, M.; Namayanja, G.; Nakatudde, L.; Nankya, I.; Kiconco, M.; Abwola, M.; Mugyenyi, P.; Osibogun, A.; Akanmu, S.; Schuurman, R.; Wensing, A. M.; Straatsma, E.; Wit, F. W.; Dekker, J.; van Vugt, M.; Lange, J. M.
2012-01-01
Background. Human immunodeficiency virus type 1 (HIV-1) drug resistance may limit the benefits of antiretroviral therapy (ART). This cohort study examined patterns of drug-resistance mutations (DRMs) in individuals with virological failure on first-line ART at 13 clinical sites in 6 African
Insect pests management of bt cotton through the manipulation of different eco-friendly techniques
International Nuclear Information System (INIS)
Ahmad, N.; Khan, M.H.; Tofique, M.
2011-01-01
This study was designed to manage insect pests of Bt cotton through the manipulation of different eco-friendly techniques. A perusal of data, based on the overall performance of different treatments reflected that lowest population of jassids (0.29) was observed in bio-control treated Bt cotton followed by bio-control treated conventional cotton (0.41). Mean per leaf population of thrips was found lowest in insecticide treated Bt cotton (0.97) which was statically at par with bi-control treated conventional cotton (0.95), biocontrol treated Bt cotton (1.09) and colour traps treated Bt cotton (1.50). In case of white flies, bio-control treated Bt cotton and bio-control treated conventional cotton again proved effective in maintaining the population at lower levels per leaf (0.33 and 0.35 respectively). No bollworms infestation was recorded in transgenic cotton whereas higher attack of the same was observed in the untreated conventional cotton block. The best results were achieved with the application of bio-control agents in combination with Bt cotton resulting in least infestation by insect pests and maximum seed yield of 3657 kg/ha. The population of Chrysoperla carnea was significantly higher in Bt and conventional cotton treated with bio-control agents as compared to the other treatments. The parasitism percentage of Trichogramma chilonis was observed significantly higher in bio-control treated conventional cotton. The studies manifested that combination of bio-control technology with Bt cotton effectively preserves the local beneficial insect fauna indicating its potential to be used as integrated management system against different insect pests of cotton. (author)
MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...
Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey
2015-05-01
Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.
Transepithelial resistance and claudin expression in trout RTgill-W1 cell line
DEFF Research Database (Denmark)
T. Trubitt, Rebecca; Rabeneck, D. Brett; Bujak, Joanna
2015-01-01
In the present study, we examined the trout gill cell line RTgill-W1 as a possible tool for in vitro investigation of epithelial gill function in fish. After seeding in transwells, transepithelial resistance (TER) increased until reaching a plateau after 1–2 days (20–80 Ω⋅cm2), which was then mai......In the present study, we examined the trout gill cell line RTgill-W1 as a possible tool for in vitro investigation of epithelial gill function in fish. After seeding in transwells, transepithelial resistance (TER) increased until reaching a plateau after 1–2 days (20–80 Ω⋅cm2), which...... was then maintained for more than 6 days. Tetrabromocinnamic acid, a known stimulator of TER via casein kinase II inhibition, elevated TER in the cell line to 125% of control values after 2 and 6 h. Treatment with ethylenediaminetetraacetic acid induced a decrease in TER to b15% of pre-treatment level. Cortisol...... detected Cldn-10e and Cldn-30 immunoreactive proteins of expected molecular weight in samples from rainbow trout gills but not from RTgill-W1 cultures, possibly due to low expression levels. Collectively, these results show that the RTgill-W1 cell layers have tight junctions between cells, are sensitive...
Using atmospheric pressure plasma treatment for treating grey cotton fabric.
Kan, Chi-Wai; Lam, Chui-Fung; Chan, Chee-Kooi; Ng, Sun-Pui
2014-02-15
Conventional wet treatment, desizing, scouring and bleaching, for grey cotton fabric involves the use of high water, chemical and energy consumption which may not be considered as a clean process. This study aims to investigate the efficiency of the atmospheric pressure plasma (APP) treatment on treating grey cotton fabric when compared with the conventional wet treatment. Grey cotton fabrics were treated with different combinations of plasma parameters with helium and oxygen gases and also through conventional desizing, scouring and bleaching processes in order to obtain comparable results. The results obtained from wicking and water drop tests showed that wettability of grey cotton fabrics was greatly improved after plasma treatment and yielded better results than conventional desizing and scouring. The weight reduction of plasma treated grey cotton fabrics revealed that plasma treatment can help remove sizing materials and impurities. Chemical and morphological changes in plasma treated samples were analysed by FTIR and SEM, respectively. Finally, dyeability of the plasma treated and conventional wet treated grey cotton fabrics was compared and the results showed that similar dyeing results were obtained. This can prove that plasma treatment would be another choice for treating grey cotton fabrics. Copyright © 2013 Elsevier Ltd. All rights reserved.
Genetic transformation of cry1EC gene into cotton ( Gossypium ...
African Journals Online (AJOL)
Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...
Fiber quality challenges facing the cotton industry
The cotton industry is in the midst of an exciting time with increased domestic consumption, but also facing pressure from other crops and the global marketplace. In order to ensure the US cotton crop remains the fiber of choice for the world it is important to keep an eye on the challenges to fibe...
Within canopy distribution of cotton seed N
Whole cotton seeds can be an important component of dairy rations. Nitrogen content of the seed is an important determinant of the feed value of the seed. Efforts to increase the seed value as feed will be enhanced with knowledge of the range and distribution of seed N within the cotton crop. This s...
Identification of resistance to Maize rayado fino virus in maize inbred lines
Maize rayado fino virus (MRFV) is one of the most important virus diseases of maize in America. Severe yield losses, ranging from 10 to 50% in landraces to nearly 100% in contemporary cultivars, have been reported. Resistance has been reported in populations, but few inbred lines have been identifie...
Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S
2012-11-01
Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.
Directory of Open Access Journals (Sweden)
Wu-ge LIU
2008-09-01
Full Text Available The broad-spectrum blast resistance gene Pi-1, from donor line BL122, was introduced into a thermo-sensitive genic male sterile rice line GD-8S, which possessed good grain quality but high susceptibility to rice blast, by using backcross breeding and molecular marker-assisted selection. Five elite improved male sterile lines, RGD8S-1, RGD8S-2, RGD8S-3, RGD8S-4 and RGD8S-5, were selected based on the results of molecular marker analysis, spikelet sterility, recovery rate of genetic background and agronomic traits. Thirty-three representative blast isolates collected from Guangdong Province, China were used to inoculate the improved lines and the original line GD-8S artificially. The resistance frequencies of the improved lines ranged from 76.47% to 100%, much higher than that of the original line GD-8S (9.09%. On the agronomic characters, there were no significant differences between the improved lines and GD-8S except for flag leaf length and panicle number per plant. The improved lines could be used for breeding hybrid rice with high blast resistance.
International Nuclear Information System (INIS)
Ali, L.; Maqsood, M.A.; Ashraf, M.
2009-01-01
Cotton is generally grown on alkaline calcareous soils in arid and semi-arid areas of the country. Sodium can interact with other earth cations like K, Ca and Mg. Therefore, a pot study was conducted to investigate the growth, yield and ionic response of two cotton varieties. Four levels of K and Na were developed after considering indigenous K, Na status in soil. The treatments of K+Na in mg/kg were adjusted as, 105+37.5, 135+30 135+37.5 and 105+30 (control). Control treatment represented indigenous K, Na status of soil. The experiment continued until maturity. Application of K and Na increased seed cotton yield and boll weight significantly (p<0.01). Both varieties varied non-significantly with respect to K:Na ratio in leaf. The beneficial effects of Na with K application over control on seed cotton yield and boll weight were greater in NIBGE-2 than in MNH-786. Increase in seed cotton yield was attributed to maximum boll weight of both varieties. Significant negative correlation (r= -0.89, - 0.76, n= 4) was found between K:Na ratio and K use efficiency in shoot of NIBGE-2 and MNH-786, respectively. (author)
Directory of Open Access Journals (Sweden)
Pulikanti Guruprasad Reddy
2017-08-01
Full Text Available Helium (He ion lithography is being considered as one of the most promising and emerging technology for the manufacturing of next generation integrated circuits (ICs at nanolevel. However, He-ion active resists are rarely reported. In this context, we are introducing a new non-chemically amplified hybrid resist (n-CAR, MAPDSA-MAPDST, for high resolution He-ion beam lithography (HBL applications. In the resist architecture, 2.15 % antimony is incorporated as heavy metal in the form of antimonate. This newly developed resists has successfully used for patterning 20 nm negative tone features at a dose of 60 μC/cm2. The resist offered very low line edge roughness (1.27±0.31 nm for 20 nm line features. To our knowledge, this is the first He-ion active hybrid resist for nanopatterning. The contrast (γ and sensitivity (E0 of this resist were calculated from the contrast curve as 0.73 and 7.2 μC/cm2, respectively.
Reddy, Pulikanti Guruprasad; Thakur, Neha; Lee, Chien-Lin; Chien, Sheng-Wei; Pradeep, Chullikkattil P.; Ghosh, Subrata; Tsai, Kuen-Yu; Gonsalves, Kenneth E.
2017-08-01
Helium (He) ion lithography is being considered as one of the most promising and emerging technology for the manufacturing of next generation integrated circuits (ICs) at nanolevel. However, He-ion active resists are rarely reported. In this context, we are introducing a new non-chemically amplified hybrid resist (n-CAR), MAPDSA-MAPDST, for high resolution He-ion beam lithography (HBL) applications. In the resist architecture, 2.15 % antimony is incorporated as heavy metal in the form of antimonate. This newly developed resists has successfully used for patterning 20 nm negative tone features at a dose of 60 μC/cm2. The resist offered very low line edge roughness (1.27±0.31 nm) for 20 nm line features. To our knowledge, this is the first He-ion active hybrid resist for nanopatterning. The contrast (γ) and sensitivity (E0) of this resist were calculated from the contrast curve as 0.73 and 7.2 μC/cm2, respectively.
Hamers, Raph L.; Schuurman, Rob; Sigaloff, Kim C. E.; Wallis, Carole L.; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E.; Wellington, Maureen; Osibogun, Akin; Wit, Ferdinand W.; van Vugt, Michèle; Stevens, Wendy S.; de Wit, Tobias F. Rinke
2012-01-01
Background The effect of pretreatment HIV-1 drug resistance on the response to first-line combination antiretroviral therapy (ART) in sub-Saharan Africa has not been assessed. We studied pretreatment drug resistance and virological, immunological, and drug-resistance treatment outcomes in a large
Directory of Open Access Journals (Sweden)
Imen Trabelsi
2016-10-01
Full Text Available The behavior of seven faba bean breeding lines toward Orobanche foetida and Orobanche crenata infestation was examined under field, pots, and in vitro conditions and compared to reference cultivars. The breeding lines presented resistance reaction to Orobanche spp. in different experiment conditions. In infested field by O. foetida, the grain yield reduction ranged from 55.7 to 83% for the breeding lines compared to 97% for the susceptible cultivar Badï. Lines L6 and L7 were the less affected by Orobanche parasitism considering severity, number of emerged Orobanche, and yield. In pots, the number of attachments varied from .6 to 3.4 and from 1.4 to 6.4 for the breeding lines against 10.4 and 12.3 for Badï inoculated, respectively, by O. foetida and O. crenata. In Petri dish experiment, Orobanche germination reached the highest rates; 69.9 and 59.7%, respectively, with O. crenata and O. foetida for Badï. For the breeding lines, it ranged from 6.3 to 44.9% for O. crenata and from 4.8 to 40.8% for O. foetida. Moreover, all breeding lines showed low tubercles number and delay in Orobanche attachments as compared to Badï. All breeding lines, except L5, maintained an acceptable level of resistance to Orobanche species manifested by a reduced Orobanche germination rate, low Orobanche number and dry weight, delay of attachments, and higher grain production compared to Badï. L5 seems to be less resistant even it behaves better than Badï in different culture conditions. The studied breeding lines could be recommended as resistance sources or candidates for varieties registrations.
Fiber sample presentation system for spectrophotometer cotton fiber color measurements
The Uster® High Volume Instrument (HVI) is used to class U.S. cotton for fiber color, yielding the industry accepted, cotton-specific color parameters Rd and +b. The HVI examines a 9 square inch fiber sample, and it is also used to test large AMS standard cotton “biscuits” or rectangles. Much inte...
IMPROVED SPECTROPHOTOMETER FIBER SAMPLING SYSTEM FOR COTTON FIBER COLOR MEASUREMENTS
Cotton in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), and the parameters Rd and +b are used to designate color grades for cotton fiber. However, Rd and +b are cotton-specific color parameters, and the need existed to demonstrate the relationships of Rd and +b to...
DEFF Research Database (Denmark)
Jacobsen, Kirstine; Lund, Rikke Raaen; Beck, Hans Christian
Background: Erlotinib (Tarceva®, Roche) has significantly changed the treatment of non-small cell lung cancer (NSCLC) as 70% of patients show significant tumor regression when treated. However, all patients relapse due to development of acquired resistance, which in 43-50% of cases are caused...... by a secondary mutation (T790M) in EGFR. Importantly, a majority of resistance cases are still unexplained. Our aim is to identify novel resistance mechanisms in erlotinib-resistant subclones of the NSCLC cell line HCC827. Materials & Methods: We established 3 erlotinib-resistant subclones (resistant to 10, 20...... or other EGFR or KRAS mutations, potentiating the identification of novel resistance mechanisms. We identified 2875 cytoplasmic proteins present in all 4 cell lines. Of these 87, 56 and 23 are upregulated >1.5 fold; and 117, 72 and 32 are downregulated >1.5 fold, respectively, in the 3 resistant clones...
Modern trends on development of cotton production and processing chain Uzbekistan
Abdimumin Alikulov
2010-01-01
The cotton production complex of Uzbekistan has high rating comparing other export oriented branches. Cotton fiber value in 2008 share made 12% from total export of the country. The paper observes some trends and policy developments in cotton industry development.
CSIR Research Space (South Africa)
Fassihi, A
2014-11-01
Full Text Available . The results obtained on different Upland cottons have clearly demonstrated the practical value of the yarn dismantler in enabling yarns to be automatically dismantled into their constituent fibres, which can then be tested by instrument, such as the AFIS...
Quantification and characterization of cotton crop biomass residue
Cotton crop residual biomass remaining in the field after mechanical seed cotton harvest is not typically harvested and utilized off-site thereby generating additional revenue for producers. Recently, interest has increased in utilizing biomass materials as feedstock for the production of fuel and ...
Governing the transnational organic cotton network from Benin
Glin, L.C.; Mol, A.P.J.; Oosterveer, P.J.M.; Vodouhè, S.
2012-01-01
In this article, we attempt to conceptualize the historical development and the governance structure of the transnational organic cotton network from Benin. We aim to discover how the organic cotton production-consumption network is governed locally and internationally. Existing bodies of literature
Naegele, R P; Ashrafi, H; Hill, T A; Chin-Wo, S Reyes; Van Deynze, A E; Hausbeck, M K
2014-05-01
Phytophthora capsici is an important pepper (Capsicum annuum) pathogen causing fruit and root rot, and foliar blight in field and greenhouse production. Previously, an F6 recombinant inbred line population was evaluated for fruit rot susceptibility. Continuous variation among lines and partial and isolate-specific resistance were found. In this study, Phytophthora fruit rot resistance was mapped in the same F6 population between Criollo del Morelos 334 (CM334), a landrace from Mexico, and 'Early Jalapeno' using a high-density genetic map. Isolate-specific resistance was mapped independently in 63 of the lines evaluated and the two parents. Heritability of the resistance for each isolate at 3 and 5 days postinoculation (dpi) was high (h(2) = 0.63 to 0.68 and 0.74 to 0.83, respectively). Significant additive and epistatic quantitative trait loci (QTL) were identified for resistance to isolates OP97 and 13709 (3 and 5 dpi) and 12889 (3 dpi only). Mapping of fruit traits showed potential linkage with few disease resistance QTL. The partial fruit rot resistance from CM334 suggests that this may not be an ideal source for fruit rot resistance in pepper.
Zinc comprising coordination compounds as growth stimulants of cotton seeds
International Nuclear Information System (INIS)
Yusupov, Z.N.; Nurmatov, T.M.; Rakhimova, M.M.; Dzhafarov, M.I.; Nikolaeva, T.B.
1991-01-01
Present article is devoted to zinc comprising coordination compounds as growth stimulants of cotton seeds. The influence of zinc coordination compounds with physiologically active ligands on germinative energy and seed germination of cotton was studied. The biogical activity and effectiveness of zinc comprising coordination compounds at application them for humidification of cotton seeds was studied as well.
Women cotton pickers perceptions about health hazards due to pesticide use in irrigated punjab
International Nuclear Information System (INIS)
Abbas, M.; Mehmood, I.; Bashir, A.; Hassan, S.
2015-01-01
In Pakistan, cotton crop has special importance from the perspective of largest employment generation both for males and females in the production and value chains. Cotton picking is primarily a female specific activity in all cropping zones of Pakistan. Women cotton pickers mostly belong to poor rural society involved in this labour force to feed their families. Cotton pickers in Pakistan face some serious health related problems due to heavy use of pesticides on cotton crop. The present study was designed to investigate the problem faced by women cotton pickers and their role in household decision making. Overall 150 women cotton pickers were interviewed from Bahawalnagar, Sahiwal and Vehari districts of cotton-wheat zone of the Punjab. Summary statistics of women cotton pickers' showed mean average age was 33 years and had 2.4 ears of formal schooling and 10 years of cotton picking experience. The main reasons for cotton picking reported were to reduce family financial burden (30%) followed by better access to food and resource (23%) and better education of children (21%). Majority of the respondents (97.33%) reported that the mode of payments of cotton picking was in cash and the most of the respondents (83.70%) reported that they got wages in time. Only few respondents (8.70%) were aware of health hazards due to pesticides and only 10% women wear protective clothes during cotton picking. Majority of the respondents (76%) wash their clothes after cotton picking whereas almost all the respondents wash their hand after cotton picking. The women cotton pickers faced health problem, tiredness (54.5%), mental disturbance (9.90%) and fatigue (8.00%). More than 58% women reported their involvement in household decision making regarding food and groceries while 30.6% women involved in decision about education of children. It is suggested that the female cotton pickers should be educated about the importance (in terms of disease treatment and long-run health costs
Glyphosate resistant weeds - a threat to conservation agriculture
Glyphosate-resistant weeds are now present throughout the Southeast. Hundreds of thousands of conservation tillage cotton acres, some currently under USDA Natural Resources Conservation Service (NRCS) conservation program contracts, are at risk of being converted to higher-intensity tillage systems....
Zhou, Meiliang; Sun, Guoqing; Sun, Zhanmin; Tang, Yixiong; Wu, Yanmin
2014-06-13
Cotton fiber is considered as the backbone of the textile industry. The productivity of cotton crop is severely hampered by the occurrence of pathogens, pests, and various environmental factors. Nevertheless, cotton plant has developed sophisticated mechanisms to respond to environment stresses to avoid detrimental effects on its growth and development. Therefore, understanding the mechanisms of cotton fiber development and environment stress response is of considerable interest for designing agriculture breeding strategies to ensure sustainable productivity. The application of proteomics technologies to advance our knowledge in cotton fiber development and abiotic/biotic stress tolerance has increased dramatically in the last 5years as evidenced by the large amount of publications in this area. This review summarizes the work which has been reported for cotton proteomics and evaluates the findings in context of the approaches that are widely employed with the aim to generate novel insight useful for cotton improvement. Cotton (Gossypium spp.) is considered as the foremost commercially important fiber crop grown all over the world and is deemed as the backbone of the textile industry. Cotton is also an important source of edible oil seed and a nutrient-rich food crop as cottonseed contains high-quality protein and oil. The growth and productivity of cotton crop are often hampered by various biotic stress factors, such as insect pests and pathogens. In addition, cotton plants are frequently subjected to unavoidable environmental factors that cause abiotic stress, such as salt, heat and drought. Proteomic techniques provide one of the best options for understanding the gene function and phenotypic changes during cotton fiber development and stress response. This review first summarizes the work which has been reported for cotton proteomics about cotton fiber development and abiotic/biotic stress tolerance, and also evaluates the findings in context of the approaches
MicroRNA signature of cis-platin resistant vs. cis-platin sensitive ovarian cancer cell lines
Directory of Open Access Journals (Sweden)
Kumar Smriti
2011-09-01
Full Text Available Abstract Background Ovarian cancer is the leading cause of death from gynecologic cancer in women worldwide. According to the National Cancer Institute, ovarian cancer has the highest mortality rate among all the reproductive cancers in women. Advanced stage diagnosis and chemo/radio-resistance is a major obstacle in treating advanced ovarian cancer. The most commonly employed chemotherapeutic drug for ovarian cancer treatment is cis-platin. As with most chemotherapeutic drugs, many patients eventually become resistant to cis-platin and therefore, diminishing its effect. The efficacy of current treatments may be improved by increasing the sensitivity of cancer cells to chemo/radiation therapies. Methods The present study is focused on identifying the differential expression of regulatory microRNAs (miRNAs between cis-platin sensitive (A2780, and cis-platin resistant (A2780/CP70 cell lines. Cell proliferation assays were conducted to test the sensitivity of the two cell lines to cis-platin. Differential expression patterns of miRNA between cis-platin sensitive and cis-platin resistant cell lines were analyzed using novel LNA technology. Results Our results revealed changes in expression of 11 miRNAs out of 1,500 miRNAs analyzed. Out of the 11 miRNAs identified, 5 were up-regulated in the A2780/CP70 cell line and 6 were down regulated as compared to cis-platin sensitive A2780 cells. Our microRNA data was further validated by quantitative real-time PCR for these selected miRNAs. Ingenuity Pathway Analysis (IPA and Kyoto Encyclopedia of Genes and Genomes (KEGG analysis was performed for the selected miRNAs and their putative targets to identify the potential pathways and networks involved in cis-platin resistance. Conclusions Our data clearly showed the differential expression of 11 miRNAs in cis-platin resistant cells, which could potentially target many important pathways including MAPK, TGF-β signaling, actin cytoskeleton, ubiquitin mediated
Color measurements of cotton fiber and cotton textile products are important quality parameters. The Uster® High Volume Instrument (HVI) is an instrument used globally to classify cotton quality, including cotton color. Cotton color by HVI is based on two cotton-specific color parameters—Rd (diffuse...
Single-Wall Carbon Nanotube-Coated Cotton Yarn for Electrocardiography Transmission
Directory of Open Access Journals (Sweden)
Yuliang Zhao
2018-03-01
Full Text Available We fabricated a type of conductive fabric, specifically single-wall carbon nanotube-coated cotton yarns (SWNT-CYs, for electrocardiography (ECG signal transmission utilizing a “dipping and drying” method. The conductive cotton yarns were prepared by dipping cotton yarns in SWNTs (single-wall carbon nanotubes solutions and then drying them at room temperature—a simple process that shows consistency in successfully coating cotton yarns with conductive carbon nanotubes (CNTs. The influence of fabrication conditions on the conductivity properties of SWNT-CYs was investigated. The results demonstrate that our conductive yarns can transmit weak bio-electrical (i.e., ECG signals without significant attenuation and distortion. Our conductive cotton yarns, which combine the flexibility of conventional fabrics and the good conductivity of SWNTs, are promising materials for wearable electronics and sensor applications in the future.
In vitro microbiologic evaluation of PTFE and cotton as spacer materials.
Paranjpe, Avina; Jain, Sumita; Alibhai, Karim J; Wadhwani, Chandur P; Darveau, Richard P; Johnson, James D
2012-09-01
To microbiologically evaluate the efficacy of cotton and polytetrafluoroethylene (PTFE) tape used as spacer materials. Twenty-six extracted human molars were restored using either cotton or PTFE tape as spacers under a standardized provisional restorative material (Cavit). The teeth were incubated for 7 days in a culture of Streptococcus gordonii or in liquid media alone. The spacers were removed and tested for bacterial contamination. The access cavities were also evaluated for bacterial contamination. Nine of 10 teeth with cotton spacers and one of 10 teeth with PTFE spacers were positive for S gordonii growth. The nine teeth in the cotton group also showed contamination of the access cavities. Even under optimal conditions, cotton spacers may cause leakage into the access cavities. Cotton fibers may serve as a route for bacterial contamination of the access cavities and root canal space. In contrast, PTFE tape did not provide an avenue for bacterial contamination.
Management of begomovirus-incited diseases on tomatoes in Guatemala continues to be a challenge and there continues to be a need to better understand the genetics of resistance to begomoviruses. In this study, the resistant line, Gh13, was crossed with the susceptible line, HUJ-VF, that lacked the ...
Directory of Open Access Journals (Sweden)
Pengjun Zhang
Full Text Available The solenopsis mealybug, Phenacoccus solenopsis, has been recently recognized as an aggressively invasive pest in China, and is now becoming a serious threat to the cotton industry in the country. Thus, it is necessary to investigate the molecular mechanisms employed by cotton for defending against P. solenopsis before the pest populations reach epidemic levels. Here, we examined the effects of exogenous jasmonic acid (JA, salicylic acid (SA, and herbivory treatments on feeding behavior and on development of female P. solenopsis. Further, we compared the volatile emissions of cotton plants upon JA, SA, and herbivory treatments, as well as the time-related changes in gossypol production and defense-related genes. Female adult P. solenopsis were repelled by leaves from JA-treated plant, but were not repelled by leaves from SA-treated plants. In contrast, females were attracted by leaves from plants pre-infested by P. solenopsis. The diverse feeding responses by P. solenopsis were due to the difference in volatile emission of plants from different treatments. Furthermore, we show that JA-treated plants slowed P. solenopsis development, but plants pre-infested by P. solenopsis accelerated its development. We also show that P. solenopsis feeding inhibited the JA-regulated gossypol production, and prevented the induction of JA-related genes. We conclude that P. solenopsis is able to prevent the activation of JA-dependent defenses associated with basal resistance to mealybugs.
The cotton farming pipeline of Malawi and South Africa: Management implications
Directory of Open Access Journals (Sweden)
J. P. Grundling
2008-12-01
Full Text Available Purpose of the study: The purpose this paper is to identify and describe the characteristics and influences of the cotton farming pipeline in Malawi and South Africa. Problem investigated: A broad based approach was followed to investigate the cotton farming pipeline to identify the major driving forces of the cotton pipeline in each of the respective countries. Research approach: A qualitative field research approach was followed to compile data on cotton farming in Malawi and South Africa. Data was compiled upstream from input suppliers, downstream from ginners, cotton transport conveyors, cotton marketing managers and agricultural government officials as well as from farmers and agricultural organizations. Findings: In Malawi a family farming model is followed versus an industrial model of production in South Africa. Despite the differences in approach, the farmers in both countries are faced with similar problems. In this regard, an urgent rethinking of the technological conditions of production and the possibilities of technological change is needed. Recommendations: The research proposes that these countries can benefit from establishing institutions like agricultural co-operatives and mechanisms like the development of a free traffic mechanism of seed-cotton. Conclusion: The present research may assist in developing first layer managerial recommendations that could enhance the sustainability and co-existence of cotton farming in the two countries.
Effect of low doses gamma irradiation of cotton seeds
International Nuclear Information System (INIS)
Al-Oudat, M.; Khalifa, Kh.
1996-01-01
Field experiments and then large scale application of irradiated cotton seeds (C.V. Aleppo-40) were carried out during three seasons (1986, 1987 and 1988) for field experiment at ACSAD Station in Dier-Ezzor and 1988, 1989 and 1990 for large scale application at Euphrate's Basin, Al-Ghab and Salamia, farmers farms. The above areas were selected as they represent major cotton production areas in Syria. The aims of the experiments were to study the effect of low doses of gamma irradiation 0, 5, 10, 20, 30, 40 and 50 Gy on cotton yield and to look for the optimum dose of gamma irradiation to obtain best results. The results show that, there were positive effect (P<0.95) for doses 5-30 Gy in increasing cotton yield. The highest increase was at dose of 10 Gy. which as 19.5% higher than control. For the large scale application using 10 Gy the increase in cotton yield varied from 10-39% compared to control. (author). 11 refs., 6 figs
DEFF Research Database (Denmark)
Frogne, Thomas; Benjaminsen, Rikke; Sonne-Hansen, Katrine
2008-01-01
cell lines concomitant with inhibition of Erk and unaltered Akt activation. In concert, inhibition of Erk with U0126 preferentially reduced growth of resistant cell lines. Treatment with ErbB3 neutralizing antibodies inhibited ErbB3 activation and resulted in a modest but statistically significant...... activation was observed only in the parental MCF-7 cells. The downstream kinases pAkt and pErk were increased in five of seven and in all seven resistant cell lines, respectively. Treatment with the EGFR inhibitor gefitinib preferentially inhibited growth and reduced the S phase fraction in the resistant...... growth inhibition of two resistant cell lines. These data indicate that ligand activated ErbB3 and EGFR, and Erk signaling play important roles in fulvestrant resistant cell growth. Furthermore, the decreased level of ErbB4 in resistant cells may facilitate heterodimerization of ErbB3 with EGFR and ErbB2...
Field evaluation of Bt cotton crop impact on nontarget pests: cotton aphid and boll weevil.
Sujii, E R; Togni, P H B; de A Ribeiro, P; de A Bernardes, T; Milane, P V G N; Paula, D P; Pires, C S S; Fontes, E M G
2013-02-01
Bt cotton plants expressing Cry1Ac protein have high specificity for the control of lepidopteran larvae. However, studies conducted in several countries have shown these plants have a differential impact on nontarget herbivores. The aim of this study was to compare the colonization rates and population abundance of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae) and the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae), in plots of Bt (Nuopal) and non-Bt cotton (Delta Opal) in an experimental field in Brasilia, DF, Brazil. No difference was observed in the preference and colonization by winged aphids to plants from the two treatments. There was no significant difference in abundance of wingless aphids or in the production of winged aphids between treatments. Apparently, the parameters that control factors such as fecundity, survival, and dispersal were similar on both Bt and non-Bt plants. Monitoring of plants for coccinellids, a specialist predator of aphids, and ants that act on the dispersal of aphids among plants showed no significant difference between Bt and non-Bt plants, supporting the inference above. Regarding the effect on boll weevil, there was also no significant difference between treatments in the total number of fruiting structures attacked in each plot, the percentage of fruiting structures attacked per plant or on the number of weevils emerging from fruits with boll weevil damage from egg-laying, when damaged fruit samples were held in the laboratory. Based on these results, we conclude that there is no impact of Bt cotton crop expressing Cry1Ac on the nontarget herbivores tested under field conditions.
Landscape crop composition effects on cotton yield, Lygus hesperus densities and pesticide use.
Meisner, Matthew H; Zaviezo, Tania; Rosenheim, Jay A
2017-01-01
Landscape crop composition surrounding agricultural fields is known to affect the density of crop pests, but quantifying these effects, as well as measuring how they translate to changes in yield, is difficult. Using a large dataset consisting of 1498 records of commercial cotton production in California between 1997 and 2008, we explored the relationship between landscape composition and cotton yield, the density of Lygus hesperus (a key cotton pest) at field-level and within-field spatial scales and pesticide use. We found that the crop composition immediately adjacent to a cotton field was associated with substantial differences in cotton yield, L. hesperus density and pesticide use. Furthermore, crops that tended to be associated with increased L. hesperus density also tended to be associated with increased pesticide use and decreased cotton yield. Our results suggest a possible mechanism by which landscape composition can affect cotton yield: by increasing the density of pests which in turn damage cotton plants. Our quantification of how surrounding crops affect pest densities, and in turn yield, in cotton fields has significant impacts for cotton farmers, who can use this information to help optimize crop selection and ranch layout. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Wanli Du
Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.
7 CFR 28.8 - Classification of cotton; determination.
2010-01-01
... Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of the Act, the classification of any cotton shall be determined by the quality of a sample in accordance... employees will determine all fiber property measurements using High Volume Instruments. The classification...
The prevalence of byssinosis among cotton workers in the north of Benin.
Hinson, A V; Schlünssen, V; Agodokpessi, G; Sigsgaards, T; Fayomi, B
2014-10-01
Cotton is the main agricultural export product in Benin. Cotton dust is thus present in the air during the handling and processing of cotton. This dust contains a mixture of substances including ground up plant matter, fibres, bacteria, fungi, soil, pesticides, noncotton matter, and other contaminants. While cotton processing is decreasing in industrialized countries, it is increasing in developing countries. Cotton processing, particularly in the early processes of spinning, can cause byssinosis. To determine the respiratory effects of cotton dust exposure among cotton mill workers in Benin. In a cross-sectional study, 109 workers exposed to cotton dust and 107 unexposed workers were studied. The International Commission on Occupational Health (ICOH) questionnaire was used for data collection on respiratory symptoms. For each worker, crossshift pulmonary function was performed with a dry spirometer. Based on the severity of respiratory symptoms and spirometry byssinosis was defined and classified according to the criteria of Schilling, et al. The mean ± SD age of the exposed and unexposed workers was 46.3 ± 7.8 and 37.0 ± 8.3 years, respectively (pcotton mill workers in Benin is high and needs prompt attention of health care workers and policymakers.
Structure and properties of cotton fabrics treated with functionalized dialdehyde chitosan.
He, Xuemei; Tao, Ran; Zhou, Tianchi; Wang, Chunxia; Xie, Kongliang
2014-03-15
In this research, modified cotton fabrics were prepared by pad-dry-cure technique from the aldehyde chitosan solution containing 3-aminopropyltriethoxysilane (APTES) and 1,2-ethanediamine (EDA) respectively. The structural characterization of the modified cotton fabrics was performed by attenuated total reflection ATR, scanning electron microscopy (SEM) and thermogravimetry (TG) analysis and physical mechanical properties were measured. The adsorption kinetics of modified cotton fabrics were also investigated by using the pseudo first-order and pseudo second-order kinetic model. The dyeing rate constant k1, k2 and half adsorption time t1/2 were calculated, respectively. The results show that the mechanical properties of different modified cotton fabrics were improved, and the surface color depth values (K/S), UV index UPF and anti-wrinkle properties were better than those of untreated cotton. Dyeing kinetics data at different temperatures indicate that Direct Pink 12B up-take on the modified cotton fabrics fitted to pseudo second-order kinetic model. Copyright © 2014 Elsevier Ltd. All rights reserved.
Efficacy of Cotton Root Destruction and Winter Cover Crops for Suppression of Hoplolaimus columbus.
Davis, R F; Baird, R E; McNeil, R D
2000-12-01
The efficacy of rye (Secale cereale) and wheat (Triticum aestivum) winter cover crops and cotton stalk and root destruction (i.e., pulling them up) were evaluated in field tests during two growing seasons for Hoplolaimus columbus management in cotton. The effect of removing debris from the field following root destruction also was evaluated. Wheat and rye produced similar amounts of biomass, and both crops produced more biomass (P Cover crops did not suppress H. columbus population levels or increase subsequent cotton yields. Cotton root destruction did not affect cotton stand or plant height the following year. Cotton root destruction lowered (P rye or wheat cover crop or cotton root destruction following harvest is ineffective for H. columbus management in cotton.
Main Effect QTL with Dominance Determines Heterosis for Dynamic Plant Height in Upland Cotton
Directory of Open Access Journals (Sweden)
Lianguang Shang
2016-10-01
Full Text Available Plant height, which shows dynamic development and heterosis, is a major trait affecting plant architecture and has an indirect influence on economic yield related to biological yield in cotton. In the present study, we carried out dynamic analysis for plant height and its heterosis by quantitative trait loci (QTL mapping at multiple developmental stages using two recombinant inbred lines (RILs and their backcross progeny. At the single-locus level, 47 QTL were identified at five developmental stages in two hybrids. In backcross populations, QTL identified at an early stage mainly showed partial effects and QTL detected at a later stage mostly displayed overdominance effects. At the two-locus level, we found that main effect QTL played a more important role than epistatic QTL in the expression of heterosis in backcross populations. Therefore, this study implies that the genetic basis of plant height heterosis shows dynamic character and main effect QTL with dominance determines heterosis for plant height in Upland cotton.
Pilot scale cotton gin trash energy recovery
Energy Technology Data Exchange (ETDEWEB)
Harp, S.L. [Oklahoma State Univ., Stillwater, OK (United States)
1993-12-31
During the summer of 1992 a 520,000 kcal/h (2,064,400 Btu/hr) biomass combustor was installed at a cotton gin in southwestern Oklahoma. The gin has a capacity of approximately 35 bales per hour. Each bale of cotton ginned weighs about 227 kg (500 lb) and produces about 68 kg (150 lb) of trash. Therefore, this gin produces about 52,360 kg (115,500 lb) of trash per day during a typical ginning season. Approximately 2 million kg (4 million lb) of gin trash are produced at this site each year. Cotton must first be dried to about 3-5% moisture content before the ginning process is begun. To accomplish this at this gin, two six million Btu/hour direct fired gas heaters are used to heat air for drying the cotton. The biomass combustor was installed to operate in parallel with one of the heaters to supply heated air for the drying process. A pneumatic conveying system was installed to intercept a portion of the gin trash and divert it to the burner. The burner was operated during the 1992 ginning season, which lasted from September through November, with few problems.
Influence of cover crops on insect pests and predators in conservation tillage cotton.
Tillman, Glynn; Schomberg, Harry; Phatak, Sharad; Mullinix, Benjamin; Lachnicht, Sharon; Timper, Patricia; Olson, Dawn
2004-08-01
In fall 2000, an on-farm sustainable agricultural research project was established for cotton, Gossypium hirsutum L., in Tift County, Georgia. The objective of our 2-yr research project was to determine the impact of several cover crops on pest and predator insects in cotton. The five cover crop treatments included 1) cereal rye, Secale cereale L., a standard grass cover crop; 2) crimson clover, Trifolium incarnatum L., a standard legume cover crop; 3) a legume mixture of balansa clover, Trifolium michelianum Savi; crimson clover; and hairy vetch, Vicia villosa Roth; 4) a legume mixture + rye combination; and 5) no cover crop in conventionally tilled fields. Three main groups or species of pests were collected in cover crops and cotton: 1) the heliothines Heliothis virescens (F.) and Helicoverpa zea (Boddie); 2) the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois); and 3) stink bugs. The main stink bugs collected were the southern green stink bug, Nezara viridula (L.); the brown stink bug, Euschistus servus (Say); and the green stink bug, Acrosternum hilare (Say). Cotton aphids, Aphis gossypii Glover, were collected only on cotton. For both years of the study, the heliothines were the only pests that exceeded their economic threshold in cotton, and the number of times this threshold was exceeded in cotton was higher in control cotton than in crimson clover and rye cotton. Heliothine predators and aphidophagous lady beetles occurred in cover crops and cotton during both years of the experiment. Geocoris punctipes (Say), Orius insidiosus (Say), and red imported fire ant, Solenopsis invicta Buren were relatively the most abundant heliothine predators observed. Lady beetles included the convergent lady beetle, Hippodamia convergens Guérin-Méneville; the sevenspotted lady beetle, Coccinella septempunctata L.; spotted lady beetle, Coleomegilla maculata (DeGeer); and the multicolored Asian lady beetle, Harmonia axyridis (Pallas). Density of G. punctipes was
Radiation degradation of short-cotton linters
International Nuclear Information System (INIS)
Ma Zue Teh; Zhou Rui Min
1984-01-01
Radiation degradation of short-cotton linters has been studied by using X-ray diffraction, an infrared spectrometer and a viscosimeter. Average molecular weight and crystallinity of short-cotton linters and the change of reducing sugar in γ-radiation degradation were examined. It was found that cellulosic saccharification in hydrolysis was enhanced with preirradiation of linter. This probably resulted from the radiation induced change of cellulosic structure. Sensitizers to promote radiation degradation effect were investigated. Carbon tetrachloride has been found to be effective. (author)
7 CFR 1427.16 - Movement and protection of warehouse-stored cotton.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Movement and protection of warehouse-stored cotton. 1427.16 Section 1427.16 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY... Cotton Loan and Loan Deficiency Payments § 1427.16 Movement and protection of warehouse-stored cotton. (a...
Hulse-Kemp, Amanda M; Ashrafi, Hamid; Zheng, Xiuting; Wang, Fei; Hoegenauer, Kevin A; Maeda, Andrea B V; Yang, S Samuel; Stoffel, Kevin; Matvienko, Marta; Clemons, Kimberly; Udall, Joshua A; Van Deynze, Allen; Jones, Don C; Stelly, David M
2014-10-30
Cotton (Gossypium spp.) is the largest producer of natural fibers for textile and is an important crop worldwide. Crop production is comprised primarily of G. hirsutum L., an allotetraploid. However, elite cultivars express very small amounts of variation due to the species monophyletic origin, domestication and further bottlenecks due to selection. Conversely, wild cotton species harbor extensive genetic diversity of prospective utility to improve many beneficial agronomic traits, fiber characteristics, and resistance to disease and drought. Introgression of traits from wild species can provide a natural way to incorporate advantageous traits through breeding to generate higher-producing cotton cultivars and more sustainable production systems. Interspecific introgression efforts by conventional methods are very time-consuming and costly, but can be expedited using marker-assisted selection. Using transcriptome sequencing we have developed the first gene-associated single nucleotide polymorphism (SNP) markers for wild cotton species G. tomentosum, G. mustelinum, G. armourianum and G. longicalyx. Markers were also developed for a secondary cultivated species G. barbadense cv. 3-79. A total of 62,832 non-redundant SNP markers were developed from the five wild species which can be utilized for interspecific germplasm introgression into cultivated G. hirsutum and are directly associated with genes. Over 500 of the G. barbadense markers have been validated by whole-genome radiation hybrid mapping. Overall 1,060 SNPs from the five different species have been screened and shown to produce acceptable genotyping assays. This large set of 62,832 SNPs relative to cultivated G. hirsutum will allow for the first high-density mapping of genes from five wild species that affect traits of interest, including beneficial agronomic and fiber characteristics. Upon mapping, the markers can be utilized for marker-assisted introgression of new germplasm into cultivated cotton and in
Current university and USDA lab cotton contamination research
U.S. cotton is considered to have some of the lowest levels of contamination in the world. However, that reputation is in jeopardy as complaints of contamination from domestic and foreign mills are on the rise. Cotton contamination can be classified under four major categorizes: fabrics and strings ...
African Journals Online (AJOL)
DR. AMINU
1Department of Chemistry, Federal College of Education, Kano – Nigeria. 2Department of ... its versatility were examined taken into consideration, the molecular structure. ... hemicelluloses, pectin, coloring matter and ash ... temperature for a fixed period of time. These processes rendered the cotton 99% cellulose in nature.
Directory of Open Access Journals (Sweden)
Lei Fang
Full Text Available Fiber strength is the key trait that determines fiber quality in cotton, and it is closely related to secondary cell wall synthesis. To understand the mechanism underlying fiber strength, we compared fiber transcriptomes from different G. barbadense chromosome introgression lines (CSILs that had higher fiber strengths than their recipient, G. hirsutum acc. TM-1. A total of 18,288 differentially expressed genes (DEGs were detected between CSIL-35431 and CSIL-31010, two CSILs with stronger fiber and TM-1 during secondary cell wall synthesis. Functional classification and enrichment analysis revealed that these DEGs were enriched for secondary cell wall biogenesis, glucuronoxylan biosynthesis, cellulose biosynthesis, sugar-mediated signaling pathways, and fatty acid biosynthesis. Pathway analysis showed that these DEGs participated in starch and sucrose metabolism (328 genes, glycolysis/gluconeogenesis (122 genes, phenylpropanoid biosynthesis (101 genes, and oxidative phosphorylation (87 genes, etc. Moreover, the expression of MYB- and NAC-type transcription factor genes were also dramatically different between the CSILs and TM-1. Being different to those of CSIL-31134, CSIL-35431 and CSIL-31010, there were many genes for fatty acid degradation and biosynthesis, and also for carbohydrate metabolism that were down-regulated in CSIL-35368. Metabolic pathway analysis in the CSILs showed that different pathways were changed, and some changes at the same developmental stage in some pathways. Our results extended our understanding that carbonhydrate metabolic pathway and secondary cell wall biosynthesis can affect the fiber strength and suggested more genes and/or pathways be related to complex fiber strength formation process.
Muthusamy, Annamalai; Jayabalan, Narayanasamy
2014-12-01
The purpose of the investigation was to induce somaclonal variations by gamma rays (GR), ethylmethane sulphonate (EMS) and sodium azide (SA) during in vitro organogenesis of cotton. The shoot tip explants were irradiated with 5-50 Gray (Gy) GR (Cobalt 60), 0.5-5.0 mM EMS and SA separately, and inoculated on Murashige and Skoog (MS) medium fortified with plant growth regulator (PGR) for organogenesis. The plantlets with well-developed root systems were acclimatized and transferred into the experimental field to screen the somaclonal variations during growth and development. The number of somaclonal variations was observed in growth of irradiated/treated shoot tips, multiplication, plantlet regeneration and growth in vitro and ex vitro. The lower doses/concentrations of mutagenic treatments showed significant enhancement in selected agronomical characters and they showed decreased trends with increasing doses/concentrations of mutagenic agents. The results of the present study revealed the influence of lower doses/concentrations of mutagenic treatments on in vitro and ex vitro growth of cotton plantlets and their significant improvement in agronomical characters which needs further imperative stability analysis. The present observations showed the platform to use lower doses/concentrations of mutagenic agents to induce variability for enhanced agronomical characters, resistant and tolerant cotton varieties.
Inheritance and segregation of exogenous genes in transgenic cotton
Indian Academy of Sciences (India)
1Key Laboratory of Cotton Genetic Improvement of the Ministry of Agriculture, Cotton Research Institute, Chinese. Academy of Agricultural Sciences, Anyang Henan 455 112, People's Republic of China. 2Institute ..... Athens, Greece. Xie D. X. ...
Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban
2010-11-01
Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.
Gong, Y-H; Ai, G-M; Li, M; Shi, X-Y; Diao, Q-Y; Gao, X-W
2017-12-01
Carboxylesterases (CarEs) play an important role in detoxifying insecticides in insects. Over-expression and structural modification of CarEs have been implicated in the development of organophosphate (OP) insecticide resistance in insects. A previous study identified four nonsynonymous mutations (resulting in four amino acid residue substitutions) in the open reading frame of the carboxylesterase gene of resistant cotton aphids compared to the omethoate susceptible strain, which has possibly influenced the development of resistance to omethoate (a systemic OP insecticide). The current study further characterized the function of these mutations, both alone and in combination, in the hydrolysis of OP insecticides. The metabolism results suggest that the combination of four mutations, mainly existing in the laboratory-selected OP-resistant cotton aphid population, increased the OP hydrolase activity (approximately twofold) at the cost of detectable carboxylesterase activity. The functional studies of single or multiple mutations suggest the positive effect of H104R, A128V and T333P on the acquisition of OP hydrolase activity, especially the combination of H104R with A128V or T333P. K484R substitution decreased both the OP hydrolase activity and the CarE activity, indicating that this mutation primarily drives the negative effect on the acquisition of OP hydrolase activity amongst these four mutations in the resistant strain. The modelling and docking results are basically consistent with the metabolic results, which strongly suggest that the structural gene modification is the molecular basis for the OP resistance in this laboratory-selected cotton aphid strain. © 2017 The Royal Entomological Society.
Conductive Cotton Textile from Safely Functionalized Carbon Nanotubes
Directory of Open Access Journals (Sweden)
Mohammad Jellur Rahman
2015-01-01
Full Text Available Electroconductive cotton textile has been prepared by a simple dipping-drying coating technique using safely functionalized multiwalled carbon nanotubes (f-MWCNTs. Owing to the surface functional groups, the f-MWCNTs become strongly attached with the cotton fibers forming network armors on their surfaces. As a result, the textile exhibits enhanced electrical properties with improved thermal conductivity and therefore is demonstrated as a flexible electrothermal heating element. The fabricated f-MWCNTs/cotton textile can be heated uniformly from room temperature to ca. 100°C within few minutes depending on the applied voltage. The textile shows good thermal stability and repeatability during a long-term heating test.
The Optimal Tax on Antebellum U.S. Cotton Exports
Douglas A. Irwin
2001-01-01
The United States produced about 80 percent of the world's cotton in the decades prior to the Civil War. How much monopoly power did the United States possess in the world cotton market and what would have been the effect of an optimal export tax? This paper estimates the elasticity of foreign demand for U.S. cotton exports and uses the elasticity in a simple partial equilibrium model to calculate the optimal export tax and its effect on prices, trade, and welfare. The results indicate that t...