WorldWideScience

Sample records for resistant cotton lines

  1. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  2. Use of radiation induction to improve new cotton lines resistant to Heliothis armigera

    Energy Technology Data Exchange (ETDEWEB)

    Hormchan, P [Dept. of Entomology, Faculty of Agriculture, Kasetsart Univ., Bangkok (Thailand); Wongpiyasatid, A [Dept. of Applied and Isotopes Faculty fo Science, Kasetsart Univ., Bangkok (Thailand)

    1996-12-01

    Ratchada 1 (R{sub 1}) seeds irradiated with 300 gray of gamma rays in order to obtain new cotton lines resistant to the American bollworm with high yield and good quality were compared with Srisamrong 2 (SR{sub 1}) and Ratchada 1 (R{sub 1}), the present recommended varieties to the farmers. The experiments were conducted under both laboratory and field conditions for 3 consecutive years and 2 new lines, A P{sub 1} and A P{sub 2} in M{sub 5} with the required attribute, were finally selected. In the lab, after feeding 2 nd instar bollworm larvae with young leaves of tested lines and the controls the increased weight, larval length, pupal weight of new lines were found to be better than those of SR{sub 2} and R{sub 1} including % gossypol and flavonoids, the substances being expected to give antibiotic effect to the insects. Physical aberration was also noticed in A P{sub 1}. As of the field condition, with the similar amount of bollworm numbers, the 10 fresh boll weight, lint weight, seed weight, % lint, micronaire fibre strength, and fibre length were found to be higher and better than those of both controls as well. However, further tests in large scale of farmers` field a period of time will have to be undertaken to ascertain the result

  3. Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species

    Science.gov (United States)

    To Identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode and fungal disease resistance traits, a series of interspecific cotton (Gossypium spp.) chromosome substitution (CS) lines were used in this study. The CS lines were developed in ...

  4. Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species.

    Science.gov (United States)

    Ulloa, M; Wang, C; Saha, S; Hutmacher, R B; Stelly, D M; Jenkins, J N; Burke, J; Roberts, P A

    2016-04-01

    Chromosome substitution (CS) lines in plants are a powerful genetic resource for analyzing the contribution of chromosome segments to phenotypic variance. In this study, a series of interspecific cotton (Gossypium spp.) CS lines were used to identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode or fungal disease resistance traits. The CS lines were developed in the G. hirsutum L. TM-1 background with chromosome or chromosome segment substitutions from G. barbadense L. Pima 3-79 or G. tomentosum. Root-knot nematode (Meloidogyne incognita) and fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) (races 1 and 4) resistance alleles and quantitative trait loci (QTL) previously placed on cotton chromosomes using SSR markers in two interspecific recombinant inbred line populations were chosen for testing. Phenotypic responses of increased resistance or susceptibility in controlled inoculation and infested field assays confirmed the resistance QTLs, based on substitution with the positive or negative allele for resistance. Lines CS-B22Lo, CS-B04, and CS-B18 showed high resistance to nematode root-galling, confirming QTLs on chromosomes 4 and 22 (long arm) with resistance alleles from Pima 3-79. Line CS-B16 had less fusarium race 1-induced vascular root staining and higher percent survival than the TM-1 parent, confirming a major resistance QTL on chromosome 16. Lines CS-B(17-11) and CS-B17 had high fusarium race 4 vascular symptoms and low survival due to susceptible alleles introgressed from Pima 3-79, confirming the localization on chromosome 17 of an identified QTL with resistance alleles from TM1 and other resistant lines. Analyses validated regions on chromosomes 11, 16, and 17 harboring nematode and fusarium wilt resistance genes and demonstrated the value of CS lines as both a germplasm resource for breeding programs and as a powerful genetic analysis tool for determining QTL effects for disease

  5. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    Science.gov (United States)

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

  6. At-line cotton color measurements by portable color spectrophotometers

    Science.gov (United States)

    As a result of reports of cotton bales that had significant color changes from their initial Uster® High Volume Instrument (HVI™) color measurements, a program was implemented to measure cotton fiber color (Rd, +b) at-line in remote locations (warehouse, mill, etc.). The measurement of cotton fiber...

  7. 76 FR 60448 - Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton

    Science.gov (United States)

    2011-09-29

    ...] Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton AGENCY... our determination that a cotton line developed by Syngenta Biotechnology, Inc., designated as event... submitted by Syngenta Biotechnology, Inc., in its petition for a determination of nonregulated status, our...

  8. Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

    Directory of Open Access Journals (Sweden)

    Haonan Zhang

    Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

  9. TRACTION RESISTANCE IN CHITOSAN TREATED COTTON

    Directory of Open Access Journals (Sweden)

    LOX Wouter

    2015-05-01

    Full Text Available Nowadays natural products interest has increased. However, when some products are included on textile fibers, they have no affinity and need some binders or other kind of auxiliaries to improve the yeld of the process, and some of them are not so natural as the product which are binding and consequently the “bio” definition is missed as some of them can be considered as highly pollutant. Chitosan is a common used bonding agent for cotton. It improves the antimicrobial and antifungal activity, improves wound healing and is a non-toxic bonding agent. The biopolymer used in this work is chitosan, which is a deacetylated derivative of chitin. These properties depend on the amount of deacetylation (DD and the Molecular weight (MW. Along with these improving properties, as it requires some acid pH to ve solved the treatment with chitosan can have some decreasing mechanical properties. The aim of that paper is to evaluate the change in breaking force of the treated samples and a change in elongation of those samples. It compared different amounts of concentration of chitosan with non treated cotton. The traction resistance test were performed on a dynamometer. The test was conducted according to the UNE EN ISO 13934-1 standard.

  10. Inheritance of resistance to Colletotrichum gossypii var. cephalosporioides in cotton

    Directory of Open Access Journals (Sweden)

    Mansuêmia Alves Couto de Oliveira

    2010-01-01

    Full Text Available The objective of this study was to analyze the inheritance of the resistance to cotton ramulosis. For thispurpose, two groups of lines with contrasting performance for the evaluated trait were crossed. The disease-susceptibleparents were Delta Opal, CNPA 999 and CNPA 2161, and those with resistance BRS Facual, CNPA 2043 and CNPA 2984,resulting in nine crosses, always of one resistant and one susceptible parent, totalizing 42 treatments. The experiment was setup in a randomized complete block design with three replications. It was verified that the genetic control of ramulosisresistance is predominantly oligogenic, and the number of genes involved depends on the parents that participate in eachcross, due to the possibility of differential loci fixation. Evidence of partial dominance in the sense of increasing diseaseresistance was found, but there were also indications that dominance is not unidirectional.

  11. Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield.

    Science.gov (United States)

    Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

    2017-08-30

    RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.

  12. Role of secondary metabolites biosynthesis in resistance to cotton ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.

  13. Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

    Science.gov (United States)

    Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-08-01

    Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. TEST OF COTTON LINES WITH DROUGHT TOLERANT INTERCROPPED WITH MAIZE

    Directory of Open Access Journals (Sweden)

    Kadarwati F.T.

    2017-12-01

    Full Text Available The distribution of cotton cultivation is mostly located in the sub-optimal land due to competition with the field crop. The cotton cultivation in Indonesia is always done through intercropping with pulses. This research aims to test the suitability of cotton lines with drought-tolerant intercropped with maize. The research is conducted in February to August 2016 at Asembagus Experimental Garden, Situbondo. Planting materials used in this research are 6 lines and 2 varieties of drought-tolerant cotton consist of strain 03001/9, 03008/24, 03008/25, 03017/13, 06062/3, 06063/3, kanesia 10 and kanesia 14. The research prepared by the draft randomized group with three replications. The observation parameter consists of plant height, canopy width, number of generative branches, number of fruits, fruits weight, the yield of seed cotton, and corn dry results. The research result shows that the strain 03017/13 and 03008/24 have the highest consecutive acceptance of IDR 17,860,681 and IDR 17,520,879, the increase in revenue compared to monoculture is IDR 6,278,473 and IDR 5,668,191, seed cotton production amounted to 2470.01 kg/ha and 2329.72 kg/ha, maize production amounted to 2001.54 kg/ha and 2112.74 kg/ha, LER 1.68 and 1.60, number of harvested fruit of 12.66 and 11.76 fruits/plant, fruit weight of 4.05 and 4.17 g/fruit.

  15. Identification of resistance to Aspergillus flavus infection in cotton germplasm

    Science.gov (United States)

    Natural resistance of in cottonseed to Aspergillus flavus infection has not been explored to date. A green fluorescent protein (GFP) expressing -70 strain was used to assess the resistance of seed from thirty five35 cotton varieties including representatives from Gossypium arboreum, G. barbadense, a...

  16. Genetic diversity/impurity estimation in sources of natural resistance against cotton leaf curl disease in pakistan

    International Nuclear Information System (INIS)

    Sarwar, G.

    2007-01-01

    Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)

  17. Induced mutation of new cotton lines tolerant to verticillium wilt with improved characters

    International Nuclear Information System (INIS)

    Rastegary, G.; Hoseiny Neghad, Z.

    1998-01-01

    Induction of mutation for genetic variation has been used in crop improvement for many years. The mutant lines can be used either directly or as a new genetic source in cross breeding. In cotton 'eleven' and 'two' mutant varieties as new genetic sources have been evolved directly and indirectly, respectively. One of the major obstacles in cotton production in northern region of Iran, Gorgan and Gonbad (where they are known as the main cultivation area of this crop), is the presence of verticillium wilt fungal disease. Since this fungus is soil-born, and can not be controlled chemically, the most efficient way of combating against the disease is to breed for the tolerance/resistance of the species. For this purpose, a mutation breeding technique was applied using gamma radiation as mutagen. The seeds of four varieties (Shirpan, Tashkand, Bakhtegan, and Sahel) were irradiated after reaching a proper absorbed humidity. The radiation doses of 150 to 350 Gy were applied and the seeds were cultivated in two different locations (Varamin and Kordkuy) as M1 generation. The cotton balls of each individual healthy plant was harvested to attain the seeds of M2 rows. In M2, the plants with different degrees of tolerance to the disease were compared to the selected parents (taking into consideration that the soil was contaminated). The good yielding lines with different level of tolerance were taken up to the 5th generation, yielding 70 lines of superior qualitative and quantitative traits. (author)

  18. Using and development of multi adversity resistance system in cotton

    Directory of Open Access Journals (Sweden)

    Metin Durmuş ÇETİN

    2014-12-01

    Full Text Available The basic approach in plant breeding, make it possible to show the full genetic potential of plant. This methods also protect the health of plant growth over the period, by increasing resistance to diseases and pests is expected to provide. For this purpose, by Bird in 1963, with the name of multi adversity resistance has been initiated in cotton breeding and for many years as a result of the work carried out important varieties and germplasm have been developed. Nowadays, those using for varieties resistant to stress factors such as heat and drought are evaluated. And successful results are obtained.

  19. Radiation resistant lining material

    International Nuclear Information System (INIS)

    Ouchi, Koki; Okagawa, Seigo; Tamaki, Hidehiro.

    1990-01-01

    Rigidity, viscoelasticity, flexibility, radiation resistance, leaching resistance, rust-proofness, endurance, etc. are required for the lining materials to wall surfaces and floor surfaces of facilities used under the effect of radiation rays and for the inner surface protection of vessels for radioactive wastes. The present invention provides radiation resistant lining material capable of satisfying such various requirements in a well-balanced manner. That is, the material contains (A) 100 parts by weight of rapidly curing cement, (B) 50 to 300 % by weight of aggregate, and (C) 80 to 120 parts by weight of polymer emulsion. As the specific example, the ingredient (A) is commercially available under the trade name of Jet Cement. The aggregate of the ingredient (B) has preferably from about 0.6 to 0.2 mm of size and is made of material, preferably, silicon or iron grains. As the ingredient (C), acrylic resin emulsion is preferred. As a result of example, these ingredient constitutions can satisfy each of the required performance described above. (I.S.)

  20. Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Raquel Sampaio Oliveira

    2016-02-01

    Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  1. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

    Science.gov (United States)

    de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  2. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    Science.gov (United States)

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  3. Suppressing Resistance to Bt Cotton with Sterile Insect Releases

    Energy Technology Data Exchange (ETDEWEB)

    Tabashnik, B E [Department of Entomology, University of Arizona, Tucson, AZ (United States); Sisterson, M S [USDA-ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA (United States); Ellsworth, P C [Department of Entomology, University of Arizona, Maricopa Agricultural Center, Maricopa, AZ (United States)

    2011-01-15

    Genetically engineered crops that produce insecticidal toxins from Bacillus thuringiensis (Bt) are grown widely for pest control. However, insect adaptation can reduce the toxins' efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to provide susceptible insects to mate with resistant insects. Variable farmer compliance is one of the limitations of this approach. Here we report the benefits of an alternative strategy where sterile insects are released to mate with resistant insects and refuges are scarce or absent. Computer simulations show that this approach works in principle against pests with recessive or dominant inheritance of resistance. During a largescale, four-year field deployment of this strategy in Arizona, resistance of pink bollworm (Pectinophora gossypiella) to Bt cotton did not increase. A multitactic eradication program that included the release of sterile moths reduced pink bollworm abundance by >99%, while eliminating insecticide sprays against this key invasive pest. (author)

  4. Effect of chitosan on resist printing of cotton fabrics with reactive dyes

    African Journals Online (AJOL)

    The concentration of chitosan, types of resist agent, curing temperature and curing time were varied to determine their effects on resist-printed cotton fabrics. An optimal chitosan concentration of 1.6% resulted in the greatest resist effect on printed cotton fabrics. For mixtures, a 6:4 ratio of citric acid : chitosan and an 8:2 ...

  5. The multi-year effects of repeatedly growing cotton with moderate resistance to Meloidogyne incognita

    Science.gov (United States)

    Kemerait, Robert C.

    2009-01-01

    Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787

  6. Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.

    Science.gov (United States)

    Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab

    2015-09-17

    Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.

  7. Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.

    Science.gov (United States)

    He, S P; Sun, J L; Du, X M

    2011-10-03

    Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.

  8. Seed protein electrophoresis for identification of fine fibre cotton line in Gossypium hirsutum L

    International Nuclear Information System (INIS)

    Gao Guoqiang; Lv Tiexin; Su Xuehe; Liu Xiaoyong; Wu Defang; Zhu Doubei

    2003-01-01

    Gel electrophoresis was conducted to test seed ethanol resolvable protein in cotton. 13 lines were used, including a fine fibre cotton line (98301) in G. hirsutum L., 4 varieties in G. barbadense L. and 8 varieties in G. hirsutum L.. In results of the 98301 line, Zhongmiansuo 12 and Shiyuan 321, no different protein electro-phoresis band pattern was shown among different seeds belong to the same variety, respectively. In comparison among the 98301 seeds sampled from seven different growth sets in Shandong province, their protein band patterns were the same. On the gel plate, three special bands were distinctive to all the varieties in G. hirsutum L. and other three special bands were distinctive to all the varieties in G. barbadense L.. The three characteristic bands of G. hirsutum L. appeared in the protein band pattern of the 98301 line. It showed that the seed protein composition of the line was inclined to G. hirsutum L. mainly. And, a characteristic band of G. Barbadense L. in the band pattern of the 98301 line proved that the fine fibre cotton line derived from a hybrid between G. barbadense and G. hirsutum L.. The 98301 line was easily distinguished from other varieties in G. hirsutum L. by its distinctive band, i.e. band No.1, and another island cotton band, i.e. band No.10

  9. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  10. Field trials to evaluate effects of continuously planted transgenic insect-resistant cottons on soil invertebrates.

    Science.gov (United States)

    Li, Xiaogang; Liu, Biao; Wang, Xingxiang; Han, Zhengmin; Cui, Jinjie; Luo, Junyu

    2012-03-01

    Impacts on soil invertebrates are an important aspect of environmental risk assessment and post-release monitoring of transgenic insect-resistant plants. The purpose of this study was to research and survey the effects of transgenic insect-resistant cottons that had been planted over 10 years on the abundance and community structure of soil invertebrates under field conditions. During 3 consecutive years (2006-2008), eight common taxa (orders) of soil invertebrates belonging to the phylum Arthropoda were investigated in two different transgenic cotton fields and one non-transgenic cotton field (control). Each year, soil samples were taken at four different growth stages of cotton (seedling, budding, boll forming and boll opening). Animals were extracted from the samples using the improved Tullgren method, counted and determined to the order level. The diversity of the soil fauna communities in the different fields was compared using the Simpson's, Shannon's diversity indices and evenness index. The results showed a significant sampling time variation in the abundance of soil invertebrates monitored in the different fields. However, no difference in soil invertebrate abundance was found between the transgenic cotton fields and the control field. Both sampling time and cotton treatment had a significant effect on the Simpson's, Shannon's diversity indices and evenness index. They were higher in the transgenic fields than the control field at the growth stages of cotton. Long-term cultivation of transgenic insect-resistant cottons had no significant effect on the abundance of soil invertebrates. Collembola, Acarina and Araneae could act as the indicators of soil invertebrate in this region to monitor the environmental impacts of transgenic plants in the future. This journal is © The Royal Society of Chemistry 2012

  11. Influence of Soil Temperature on Meloidogyne incognita Resistant and Susceptible Cotton, Gossypium hirsutum

    OpenAIRE

    Carter, William W.

    1982-01-01

    The degree of resistance by a cotton plant to Meloidogyne incognita is affected by soil temperature, particularly in moderately resistant cultivars, The total number of nematodes in the resistant and moderately resistant rools at 35 C was equal to, or greater than, the number in susceptible roots at 20, 25, or 30 C. A shift in numbers to developing and egg-bearing forms of nematodes in the susceptible cultivar as tentperature increased indicates development was affected by temperature rather ...

  12. Creation and evaluation of best cotton mutant lines

    International Nuclear Information System (INIS)

    Rastegari, S. J.; Hosseini, Z.

    2001-01-01

    During (1997-1999) a study was carried out to recognize the best mutant lines, which were already obtained from a mutation breeding project. A Triple Rectangular Latis Design (8 7) in form of randomized complete blocks (RCB) with fifty- six treatments and three replications, were used in Estahban, Kordkouy and Varamin, under different ecological conditions, rainfall (Kordkouy) desert (Varamin) hot and dry (Estahban). During growing season some important morphological characteristics were recorded. Some lines had specific characters, for example: line 3191 (Chirpan 150 gray) had a low leaf number per plant, line 3169 (Bakhtegan 200 gray) plants were clustered. The results of the data in Varamin station showed that Bakhtegan irradiated with 150 gray line 3485 and Tashkand with 300 gray line 3451 compared to check (Varamin with 4373 kg/ha) had highest yield with 4942 kg/ha, and 4871 kg/ha respectively. In view of boll weight line 3405 of Sahel irradiated with 200 gray had highest boll weight (6.5 g/boll). In Kordkouy station the best mutant line was Chirpan irradiated with 250 gray, line 3208, with 20% yield increase compared to Sahel and 30% yield increase compared to original Chirpan. In respect to irradiation effect on lint percentage and fiber quality, the results showed; there was a positive effect on lint percentage of all varieties, especially in Tashkant, Bakhtegan and Chirpan which are inherently weak in lint percentage. As a whole gamma radiation did not have any negative effect on fiber quality. Even in Estahban 1.6 to 2.4 mm fiber increase were observed in some Chirpan irradiated material (C150-3516) and (C200-3523)

  13. Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

    Science.gov (United States)

    Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

    2016-09-01

    Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

  14. Fitness cost of resistance to Bt cotton linked with increased gossypol content in pink bollworm larvae.

    Directory of Open Access Journals (Sweden)

    Jennifer L Williams

    Full Text Available Fitness costs of resistance to Bacillus thuringiensis (Bt crops occur in the absence of Bt toxins, when individuals with resistance alleles are less fit than individuals without resistance alleles. As costs of Bt resistance are common, refuges of non-Bt host plants can delay resistance not only by providing susceptible individuals to mate with resistant individuals, but also by selecting against resistance. Because costs typically vary across host plants, refuges with host plants that magnify costs or make them less recessive could enhance resistance management. Limited understanding of the physiological mechanisms causing fitness costs, however, hampers attempts to increase costs. In several major cotton pests including pink bollworm (Pectinophora gossypiella, resistance to Cry1Ac cotton is associated with mutations altering cadherin proteins that bind this toxin in susceptible larvae. Here we report that the concentration of gossypol, a cotton defensive chemical, was higher in pink bollworm larvae with cadherin resistance alleles than in larvae lacking such alleles. Adding gossypol to the larval diet decreased larval weight and survival, and increased the fitness cost affecting larval growth, but not survival. Across cadherin genotypes, the cost affecting larval growth increased as the gossypol concentration of larvae increased. These results suggest that increased accumulation of plant defensive chemicals may contribute to fitness costs associated with resistance to Bt toxins.

  15. Role of secondary metabolites biosynthesis in resistance to cotton ...

    African Journals Online (AJOL)

    Secondary metabolites production in healthy and diseased sample of leaves of cotton varieties after the attack of CLCuV found maximum phenolics, carotenoids, chlorophyll a, chlorophyll b and total chlorophyll a and b in healthy sample and minimum contents present in diseased sample. CIM-446 was the best variety to ...

  16. Gamma ray induced diversity in restorer line of cotton (Gossypium Hirsutum)

    International Nuclear Information System (INIS)

    Mehetre, S.S.; Patil, V.R.; Surana, P.P.

    2000-01-01

    Looking to the limitation of very few restorers available in cotton a diversification of available restorer line was undertaken by gamma irradiation. The four hundred individual plants selected from individual M 2 families were crossed with CMS lines. Out of which 12 plants restored fertility in CMS lines and their F 1 's with CMS produced more heterotic hybrids than their checks (control). The results indicated that sufficient variability can be induced with the help of gamma rays and the diversification of restorers is possible within a short period with simultaneous improvement in either one or two characters. (author)

  17. Fitness of Bt-resistant cabbage loopers on Bt cotton plants.

    Science.gov (United States)

    Tetreau, Guillaume; Wang, Ran; Wang, Ping

    2017-10-01

    Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Identification of exotic genetic components and DNA methylation pattern analysis of three cotton introgression lines from Gossypium bickii.

    Science.gov (United States)

    He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming

    2011-01-01

    The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.

  19. INDUCING RESISTANCE IN COTTON AGAINST COLLETOTRICHUM GOSSYPII VAR. CEPHALOSPORIOIDES WITH ESSENTIAL OILS

    Directory of Open Access Journals (Sweden)

    B. T. Santos

    2016-11-01

    Full Text Available This study aimed to evaluate the potential of essential oils of rosemary (Rosmarinus officinalis, baccharis (Baccharis trimera, lemon grass (Cymbopogon citratus, basil (Ocimum basilicum and eucalyptus (Corymbia citriodora in inducing resistance in cotton plants against C. gossypii var. cephalosporioides. The inductive effect of the essential oils was evaluated in plants growing in pots in the environment, which were treated with 1% essential oil at 47 days of age. 24 hours after elicitor treatment the plants were inoculated with a suspension of 1.5 x 105 conidia mL-1 of C. gossypii var. cephalosporioides. Five evaluations were performed disease and calculated the area under the disease progress curve. All essential oils showed potential for inducing resistance against cotton C. gossypii var. cephalosporioides.

  20. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    Science.gov (United States)

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  1. Optimizing Organophosphorus Fire Resistant Finish for Cotton Fabric Using Box-Behnken Design

    International Nuclear Information System (INIS)

    Sohail, Y.; Parag, B.; Nemeshwaree, B.; Giorgio, R.

    2016-01-01

    N-methylol dimethyl phosphono propionamide (MDPA) is one of the most utilized fire resistant (FR) finishes for cotton fabrics, utilized as part of a formulation with trimethylol melamine (TMM) to acquire better crosslinking and enhanced FR properties. The system parameters of the finishing treatment were upgraded for better FR properties and low mechanical loss to the fabric by the response surface methodology utilizing Box-Behnken statistical designed experimental strategy. The impacts of concentration on the cotton fabric’s properties (fire resistance and mechanical properties) were assessed with the regression equations. The optimum conditions by predicting the FR reagents focusing intact mechanical properties of the fabric were additionally studied. It was found that the parameters of crosslinking agents in the FR formulation have a prime role in the general FR properties of the cotton fabrics. The R-squared estimations of the considerable number of responses were above 92%, demonstrating the level of relationship between the predicted values by the Box-Behnken frameworks and the real test results.

  2. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  3. Analyses of Fusarium wilt race 3 resistance in Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Abdullaev, Alisher A; Salakhutdinov, Ilkhom B; Egamberdiev, Sharof Sh; Kuryazov, Zarif; Glukhova, Ludmila A; Adilova, Azoda T; Rizaeva, Sofiya M; Ulloa, Mauricio; Abdurakhmonov, Ibrokhim Y

    2015-06-01

    Fusarium wilt [Fusarium oxysporum f.sp. vasinfectum (FOV) Atk. Sny & Hans] represents a serious threat to cotton (Gossypium spp.) production. For the last few decades, the FOV pathogen has become a significant problem in Uzbekistan causing severe wilt disease and yield losses of G. hirsutum L. cultivars. We present the first genetic analyses of FOV race 3 resistance on Uzbek Cotton Germplasm with a series of field and greenhouse artificial inoculation-evaluations and inheritance studies. The field experiments were conducted in two different sites: the experimental station in Zangiota region-Environment (Env) 1 and the Institute of Cotton Breeding (Env-2, Tashkent province). The Env-1 was known to be free of FOV while the Env-2 was known to be a heavily FOV infested soil. In both (Env-1 and Env-2) of these sites, field soil was inoculated with FOV race 3. F2 and an F3 Upland populations ("Mebane B1" × "11970") were observed with a large phenotypic variance for plant survival and FOV disease severity within populations and among control or check Upland accessions. Wilt symptoms among studied F2 individuals and F3 families significantly differed depending on test type and evaluation site. Distribution of Mendelian rations of susceptible (S) and resistant (R) phenotypes were 1S:1R field Env-1 and 3S:1R field Env-2 in the F2 population, and 1S:3R greenhouse site in the F3 population. The different segregation distribution of the Uzbek populations may be explained by differences in FOV inoculum level and environmental conditions during assays. However, genetic analysis indicated a recessive single gene action under high inoculum levels or disease pressure for FOV race 3 resistance. Uzbek germplasm may be more susceptible than expected to FOV race 3, and sources of resistance to FOV may be limited under the FOV inoculum levels present in highly-infested fields making the breeding process more complex.

  4. Inheritance of resistance to cotton blue disease Herança da resistência do algodoeiro à doença-azul

    Directory of Open Access Journals (Sweden)

    Osmério Pupim Junior

    2008-05-01

    Full Text Available The objective of this work was to determine the inheritance of cotton blue disease resistance by cotton plants. Populations derived from the CD 401 and Delta Opal resistant varieties were evaluated, through a greenhouse test with artificial inoculation by viruliferous aphids. Cotton blue disease resistance is conditioned by one dominant gene, both in CD 401 and Delta Opal varieties.O objetivo deste trabalho foi determinar a herança da resistência do algodoeiro à doença-azul. Populações derivadas das variedades resistentes CD 401 e Delta Opal foram avaliadas em casa de vegetação, por meio da inoculação de pulgões virulíferos. A resistência à doença-azul do algodoeiro é condicionada por um gene dominante, tanto em 'DC 401' quanto em 'Delta Opal'.

  5. Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents

    International Nuclear Information System (INIS)

    Baloch, M.J.; Baloch, Q.B.

    2005-01-01

    Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)

  6. Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

    Science.gov (United States)

    Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso

    2016-10-01

    The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.

  7. Integrated Palmer Amaranth Management in Glufosinate-Resistant Cotton: II. Primary, Secondary and Conservation Tillage

    Directory of Open Access Journals (Sweden)

    Michael G. Patterson

    2013-01-01

    Full Text Available A three year field experiment was conducted to evaluate the role of soil inversion, cover crops and spring tillage methods for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. Main plots were two soil inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. Subplots were three cover treatments: crimson clover, cereal rye or none (i.e., winter fallow; and the sub subplots were four secondary spring tillage methods: disking followed by (fb cultivator (DCU, disking fb chisel plow (DCH, disking fb disking (DD and no tillage (NT. Averaged over years and soil inversion, the crimson clover produced maximum cover biomass (4390 kg ha−1 fb cereal rye (3698 kg ha−1 and winter fallow (777 kg ha−1. Two weeks after planting (WAP and before the postemergence (POST application, Palmer amaranth WR and BR density were two- and four-times less, respectively, in IT than NIT. Further, Palmer amaranth WR and BR density were reduced two-fold following crimson clover and cereal rye than following winter fallow at 2 WAP. Without IT, early season Palmer amaranth densities were 40% less following DCU, DCH and DD, when compared with IT. Following IT, no spring tillage method improved Palmer amaranth control. The timely application of glufosinate + S-metolachlor POST tank mixture greatly improved Palmer amaranth control in both IT and NIT systems. The highest cotton yields were obtained with DD following cereal rye (2251 kg ha−1, DD following crimson clover (2213 kg ha−1 and DD following winter fallow (2153 kg ha−1. On average, IT cotton yields (2133 kg ha−1 were 21% higher than NIT (1766 kg ha−1. Therefore, from an integrated weed management standpoint, an occasional fall IT could greatly reduce Palmer amaranth emergence on farms highly infested with glyphosate-resistant Palmer amaranth. In addition, a cereal rye or crimson clover cover crop can effectively reduce early season Palmer

  8. Incipient resistance of Helicoverpa punctigera to the Cry2Ab Bt toxin in Bollgard II cotton.

    Directory of Open Access Journals (Sweden)

    Sharon Downes

    Full Text Available Combinations of dissimilar insecticidal proteins ("pyramids" within transgenic plants are predicted to delay the evolution of pest resistance for significantly longer than crops expressing a single transgene. Field-evolved resistance to Bacillus thuringiensis (Bt transgenic crops has been reported for first generation, single-toxin varieties and the Cry1 class of proteins. Our five year data set shows a significant exponential increase in the frequency of alleles conferring Cry2Ab resistance in Australian field populations of Helicoverpa punctigera since the adoption of a second generation, two-toxin Bt cotton expressing this insecticidal protein. Furthermore, the frequency of cry2Ab resistance alleles in populations from cropping areas is 8-fold higher than that found for populations from non-cropping regions. This report of field evolved resistance to a protein in a dual-toxin Bt-crop has precisely fulfilled the intended function of monitoring for resistance; namely, to provide an early warning of increases in frequencies that may lead to potential failures of the transgenic technology. Furthermore, it demonstrates that pyramids are not 'bullet proof' and that rapid evolution to Bt toxins in the Cry2 class is possible.

  9. Detoxifying enzyme studies on cotton leafhopper, Amrasca biguttula biguttula (Ishida, resistance to neonicotinoid insecticides in field populations in Karnataka, India

    Directory of Open Access Journals (Sweden)

    Halappa Banakar

    2016-12-01

    Full Text Available The cotton leafhopper (Amrasca biguttula biguttula Ishida is considered to be an alarming insect pest causing both quantitative and qualitative loss in cotton. In situ bioassay studies were done and the role of detoxifying enzymes in conferring resistance to neonicotinoid groups of insecticides in low (MUD, medium (DVG, high (HVR and very high (GLB pesticide usage areas of Karnataka were determined. Bioassay studies showed that imidacloprid, thiamethoxam, acetamiprid, thiacloprid and clothianidin registered varying levels of resistance for all the locations studied. The resistance ratio was high in imidacloprid (3.35, 8.57, 9.15 and 12.27 fold respectively and the lowest in dinoferuran (1.86, 5.13, 6.71 and 9.88 fold respectively. Furthermore, the enzyme activity ratio (glutathione-S-transferase was relatively greater, and corresponded to the higher LC50 values of neonicotinoids for very high, high, medium and low pesticide usage areas. Our study suggested that the higher activity of the detoxifying enzyme in the resistance population of cotton leafhopper apparently has a significant role in endowing resistance to neonicotinoid groups of insecticides. However, this study recommends using neonicotinoids in cotton growing areas with caution.

  10. Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

    Directory of Open Access Journals (Sweden)

    Iftikhar Ali Khan

    2016-02-01

    Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

  11. Variations in seed protein content of cotton (Gossypium hirsutum L.) mutant lines by in vivo and in vitro mutagenesis.

    Science.gov (United States)

    Muthusamy, Annamalai; Jayabalan, Narayanasamy

    2013-01-01

    The present work describes the influence of gamma irradiation (GR), ethyl methane sulphonate (EMS) and sodium azide (SA) treatment on yield and protein content of selected mutant lines of cotton. Seeds of MCU 5 and MCU 11 were exposed to gamma rays (GR), ethyl methane sulphonate (EMS) and sodium azide (SA). Lower dose of gamma irradiation (100-500 Gy), 10-50 mM EMS and SA at lower concentration effectively influences in improving the yield and protein content. Significant increase in yield (258.9 g plant(-1)) and protein content (18.63 mg g(-1) d. wt.) as compared to parental lines was noted in M2 generations. During the subsequent field trials, number of mutant lines varied morphologically in terms of yield as well as biochemical characters such as protein. The selected mutant lines were bred true to their characters in M3 and M4 generations. The significant increase in protein content and profiles of the mutant lines with range of 10.21-18.63 mg g(-1). The SDS-PAGE analysis of mutant lines revealed 9 distinct bands of different intensities with range of 26-81 kDa. The difference in intensity of bands was more (41, 50 and 58 kDa) in the mutant lines obtained from in vitro mutation than in vivo mutation. Significance of such stimulation in protein content correlated with yielding ability of the mutant lines of cotton in terms of seed weight per plant. The results confirm that in cotton it is possible to enhance the both yield and biochemical characters by in vivo and in vitro mutagenic treatments.

  12. The economic impact and the distribution of benefits and risk from the adoption of insect resistant (Bt) cotton in West Africa:

    OpenAIRE

    Falck-Zepeda, Jose; Horna, Daniela; Smale, Melinda

    2007-01-01

    "Cotton is the largest source of export receipts of several West African countries. Statistics however show a decreasing tendency in cotton yields and an increasing tendency in pesticide use. Under this circumstances there appear to be potential payoffs from the use of biotechnology products in the farming systems of the region. In this study we estimate different scenarios for the potential deployment of insect resistant cotton in selected countries in West Africa (WA). We use an economic su...

  13. Losing Chlordimeform Use in Cotton Production. Its Effects on the Economy and Pest Resistance. Agricultural Economic Report Number 587.

    Science.gov (United States)

    Osteen, Craig; Suguiyama, Luis

    This report examines the economic implications of losing chlordimeform use on cotton and considers chlordimeform's role in managing the resistance of bollworms and tobacco budworms to synthetic pyrethroids. It estimates changes in prices, production, acreage, consumer expenditures, aggregate producer returns, regional crop effects, and returns to…

  14. Fire Resistant Panels for the Tunnel Linings

    Directory of Open Access Journals (Sweden)

    Gravit Marina

    2016-01-01

    Full Text Available Presents the results of studies of innovative materials in the field of experimental and theoretical research fire resistance fireproof panels Pyro-Safe Aestuver T. Owing to the assembly simplicity, materials cheapness, high ecological standard, recycling, reuse potential, are benefit. Research work is running to improve the knowledge about fireproof panels Pyro-Safe Aestuver T for tunnel lining, its basic performance, its long term behavior and in particular also its fire proof for example when used for the lining of road tunnels.

  15. Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

    Science.gov (United States)

    Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

    2016-08-01

    Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  16. Estimates of genetic parameters from line x tester mating design for some quantitative traits in upload cotton, gossypium hirsutum L

    International Nuclear Information System (INIS)

    Baloch, M.H.; Kumbher, M.B.; Jatoi, W.A.

    2008-01-01

    Combining abilities of cotton varieties were evaluated using a line x tester design with eight lines and 4 testers. Good performance combination was found between the varieties CRIS-134 and BH-147. The former was a good candidate for fibre length improvement and the latter, a good parent for yield improvement. The specific combining ability suggested that both additive and dominant genes controlled the characters. Hybrid performance per se may be used to predict the parental performance for specific combining ability and thus for hybrid crop development. (author)

  17. Transcriptome Analysis of Cotton (Gossypium hirsutum L. Genotypes That Are Susceptible, Resistant, and Hypersensitive to Reniform Nematode (Rotylenchulus reniformis.

    Directory of Open Access Journals (Sweden)

    Ruijuan Li

    Full Text Available Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.. An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747, resistant (BARBREN-713, and hypersensitive (LONREN-1 genotypes of cotton (Gossypium hirsutum L. with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.

  18. Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

    2017-12-01

    Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. Resistance to glufosinate is proportional to phosphinothricin acetyltransferase expression and activity in LibertyLink(®) and WideStrike(®) cotton.

    Science.gov (United States)

    Carbonari, Caio A; Latorre, Débora O; Gomes, Giovanna L G C; Velini, Edivaldo D; Owens, Daniel K; Pan, Zhiqiang; Dayan, Franck E

    2016-04-01

    Insertion of the gene encoding phosphinothricin acetyltransferase (PAT) has resulted in cotton plants resistant to the herbicide glufosinate. However, the lower expression and commensurate reduction in PAT activity is a key factor in the low level of injury observed in the WideStrike(®) cotton and relatively high level of resistance observed in LibertyLink(®) cotton. LibertyLink(®) cotton cultivars are engineered for glufosinate resistance by overexpressing the bar gene that encodes phosphinothricin acetyltransferase (PAT), whereas the insect-resistant WideStrike(®) cultivars were obtained using the similar pat gene as a selectable marker. The latter cultivars carry some level of resistance to glufosinate which enticed certain farmers to select this herbicide for weed control with WideStrike(®) cotton. The potency of glufosinate on conventional FM 993, insect-resistant FM 975WS, and glufosinate-resistant IMACD 6001LL cotton cultivars was evaluated and contrasted to the relative levels of PAT expression and activity. Conventional cotton was sensitive to glufosinate. The single copy of the pat gene present in the insect-resistant cultivar resulted in very low RNA expression of the gene and undetectable PAT activity in in vitro assays. Nonetheless, the presence of this gene provided a good level of resistance to glufosinate in terms of visual injury and effect on photosynthetic electron transport. The injury is proportional to the amount of ammonia accumulation. The strong promoter associated with bar expression in the glufosinate-resistant cultivar led to high RNA expression levels and PAT activity which protected this cultivar from glufosinate injury. While the insect-resistant cultivar demonstrated a good level of resistance to glufosinate, its safety margin is lower than that of the glufosinate-resistant cultivar. Therefore, farmers should be extremely careful in using glufosinate on cultivars not expressly designed and commercialized as resistant to this

  20. Performance of cotton leaf curl virus resistant intrahirsutum f/sub 1/ hybrids

    International Nuclear Information System (INIS)

    Baloch, M.J.

    2004-01-01

    The first and foremost effort to combat the devastating cotton leaf curl virus (clcv) disease would be to utilize those clcv resistant germplasm in a hybridization programme which can enhance the possibilities of selecting desirable progenies from segregating populations. In this connection, 16 clcv intrahirsutum F1 hybrids were developed and evaluated for their performance. The hybrids, on an average gave an increase of 26.02 % in seed cotton yield; 11.52 % in bolls per plant; 14.23 % in boll weight; 4.28 % in lint; 3.89 % in fibre length and 8.21 % in earliness against the average of parents. However, among the hybrids, the top three scoring for yield were, BH.121 x Cyto.9/91, Cyto.9/91 x CRIS-226 and VH-137 x CRIS-226. The number of bolls per plant was found to be a major contributing factor for increased yield because the hybrids which set higher bolls correspondingly gave higher yields. Boll weight was not regarded as an important attribute to increase yield because hybrids with moderate boll sizes were among the top three high yielders. For lint %, the hybrids CRIS-129 x LRA-5166 and FH-901 x VH-137 were first for fibre length, whereas CRIS-121 x Cyto.51 and BH-124 x CIM-448 were among the top two rankers. Regarding earliness, the hybrids CRIS-121 x Cyto. 51 gave the highest boll opening percent and next in order was the hybrid VH-137 x DNH-49. Our results thus generally suggest that although the best three hybrids were desirable for other traits, the choice of the hybrids may be made on the priority for characters to be bred. (author)

  1. Genome-wide comparative transcriptome analysis of CMS-D2 and its maintainer and restorer lines in upland cotton.

    Science.gov (United States)

    Wu, Jianyong; Zhang, Meng; Zhang, Bingbing; Zhang, Xuexian; Guo, Liping; Qi, Tingxiang; Wang, Hailin; Zhang, Jinfa; Xing, Chaozhu

    2017-06-08

    Cytoplasmic male sterility (CMS) conferred by the cytoplasm from Gossypium harknessii (D2) is an important system for hybrid seed production in Upland cotton (G. hirsutum). The male sterility of CMS-D2 (i.e., A line) can be restored to fertility by a restorer (i.e., R line) carrying the restorer gene Rf1 transferred from the D2 nuclear genome. However, the molecular mechanisms of CMS-D2 and its restoration are poorly understood. In this study, a genome-wide comparative transcriptome analysis was performed to identify differentially expressed genes (DEGs) in flower buds among the isogenic fertile R line and sterile A line derived from a backcross population (BC 8 F 1 ) and the recurrent parent, i.e., the maintainer (B line). A total of 1464 DEGs were identified among the three isogenic lines, and the Rf1-carrying Chr_D05 and its homeologous Chr_A05 had more DEGs than other chromosomes. The results of GO and KEGG enrichment analysis showed differences in circadian rhythm between the fertile and sterile lines. Eleven DEGs were selected for validation using qRT-PCR, confirming the accuracy of the RNA-seq results. Through genome-wide comparative transcriptome analysis, the differential expression profiles of CMS-D2 and its maintainer and restorer lines in Upland cotton were identified. Our results provide an important foundation for further studies into the molecular mechanisms of the interactions between the restorer gene Rf1 and the CMS-D2 cytoplasm.

  2. Improving food and agricultural production. Thailand. Breeding for resistance to diseases in cotton

    International Nuclear Information System (INIS)

    Wallace, T.P.

    1992-01-01

    This document reports the results of a 20-day mission to Thailand within the framework of the project ''Improving food and agricultural production with nuclear and related technology''. The expert discussed the status of cotton breeding, production practices and problems with personnel of the Department of Agriculture in Bangkok, and travelled to cotton-producing regions of the central and northern areas of the country to discuss current research, pest problems and social factors affecting cotton production

  3. [Genetic improvement of cotton varieties in Huang-Huai region in China since 1950's. III. Improvement on agronomy properties, disease resistance and stability].

    Science.gov (United States)

    Jiang, B G; Kong, F L; Zhang, Q Y; Yang, F X; Jiang, R Q

    2000-01-01

    Data from a set of 5-location and 2-year experiments on 10 representative historical cotton varieties and the data of Huang-Huai Regional Cotton Trials from 1973 to 1996 were analyzed to estimate the effects of genetic improvement in agronomy properties, disease resistance and stability of cotton in Huang-Huai Region in China. The results indicated that a great genetic progress of earliness and disease resistance had been achieved by breeding programs since 1950's. The maturity was shortened 3-5 days; The rate of preforst yield was increased about 7 percentages. The problem of resistance to Fususium wilt has been solved and the resistance to Verticillum wilt was improving. Some progress in stability of cotton varieties also has been achieved by breeding programs since 1950.

  4. Induced resistance by cresotic acid (3-hydroxy-4-methyl methylbenzoic acid) against wilt disease of melon and cotton

    International Nuclear Information System (INIS)

    Dong, H.; Li, Z.; Zhang, D.; Li, W.; Tang, W.

    2004-01-01

    Cresotic acid (3-hydroxy-4-methylbenzoic acid) was proved be active in controlling wilt diseases of melon and cotton plants grown in the house. Soil drench with 200-1000 ppm cresotic acid induced 62-77 %, 69-79 % and 50-60 % protection against Fusarium oxysporum f.sp melonis (FOM) in melon, Fusarium oxysporum f.sp vasinfectum (FOV) and Verticillium dahliae in cotton, respectively. Since no inhibitory effect of cresotic acid on mycelial growth of these three fungual pathogens was observed in vitro, it is suggested that control of these wilt diseases with cresotic acid resulted from induced resistance. Cresotic acid induced resistance in melon plants not only against race 0, race 1, race 2 and race 1,2, but also against a mixture of these four races of FOM, suggesting a non-race- specific resistance. Level of induced resistance by cresotic acid against FOM depended on inoculum pressure applied to melon plants. At 25 day after inoculation with FOM, percentage protection induced by cresotic acid under low inoculum pressure retained a level of 51 %, while under high inoculum pressure percentage protection decreased to only 10 %. High concentrations of cresotic acid significantly reduced plant growth. Reduction in fresh weight of melon (36-51%) and cotton (42-71%) was obtained with 500-1000 ppm cresotic acid, while only less than 8% reduction occurred with 100-200 ppm. (author)

  5. Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Nan-Yang Li

    2018-02-01

    Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

  6. Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

    2016-06-15

    Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

  7. Non-recessive Bt toxin resistance conferred by an intracellular cadherin mutation in field-selected populations of cotton bollworm.

    Directory of Open Access Journals (Sweden)

    Haonan Zhang

    Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins have been planted widely to control insect pests, yet evolution of resistance by the pests can reduce the benefits of this approach. Recessive mutations in the extracellular domain of toxin-binding cadherin proteins that confer resistance to Bt toxin Cry1Ac by disrupting toxin binding have been reported previously in three major lepidopteran pests, including the cotton bollworm, Helicoverpa armigera. Here we report a novel allele from cotton bollworm with a deletion in the intracellular domain of cadherin that is genetically linked with non-recessive resistance to Cry1Ac. We discovered this allele in each of three field-selected populations we screened from northern China where Bt cotton producing Cry1Ac has been grown intensively. We expressed four types of cadherin alleles in heterologous cell cultures: susceptible, resistant with the intracellular domain mutation, and two complementary chimeric alleles with and without the mutation. Cells transfected with each of the four cadherin alleles bound Cry1Ac and were killed by Cry1Ac. However, relative to cells transfected with either the susceptible allele or the chimeric allele lacking the intracellular domain mutation, cells transfected with the resistant allele or the chimeric allele containing the intracellular domain mutation were less susceptible to Cry1Ac. These results suggest that the intracellular domain of cadherin is involved in post-binding events that affect toxicity of Cry1Ac. This evidence is consistent with the vital role of the intracellular region of cadherin proposed by the cell signaling model of the mode of action of Bt toxins. Considered together with previously reported data, the results suggest that both pore formation and cell signaling pathways contribute to the efficacy of Bt toxins.

  8. Survival and Development of Spodoptera frugiperda and Chrysodeixis includens (Lepidoptera: Noctuidae) on Bt Cotton and Implications for Resistance Management Strategies in Brazil.

    Science.gov (United States)

    Sorgatto, Rodrigo J; Bernardi, Oderlei; Omoto, Celso

    2015-02-01

    In Brazil, Spodoptera frugiperda (J. E. Smith) and Chrysodeixis includens (Walker) are important cotton pests and target of control of Bollgard II (Cry1Ac/Cry2Ab2) and WideStrike (Cry1Ac/Cry1F) cotton technologies. To subsidize an insect resistance management program, we conducted laboratory studies to evaluate the toxicity of these Bt cotton plants throughout larval development of S. frugiperda and C. includens. In bioassays with leaf disc, the efficacy of both Bt cotton plants against neonates was >80% for S. frugiperda and 100% for C. includens. However, S. frugiperda larvae that survived on Bt cotton had >76% of growth inhibition and stunting. In bioassays with S. frugiperda and C. includens larvae fed on non-Bt near-isoline during different time period (from 3 to 18 d) and then transferred to Bollgard II or WideStrike leaves showed that larval susceptibility decreased as larval age increased. For Bollgard II cotton, in all S. frugiperda instars, there were larvae that reached the pupal and adult stages. In contrast, on WideStrike cotton, a few larvae in fifth and sixth instar completed the biological cycle. For C. includens, some larvae in sixth instar originated adults in both Bt cotton plants. In conclusion, Bollgard II and WideStrike cotton technologies showed high efficacy against neonates of S. frugiperda and C. includens. However, the mortality of these species decreases as larval age increase, allowing insect survival in a possible seed mixture environment and favoring the resistance evolution. © The Author 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Effect of heat-treatment with raw cotton seed oil on decay resistance and dimensional stability of Beech (Fagus orientalis

    Directory of Open Access Journals (Sweden)

    مریم قربانی

    2015-05-01

    Full Text Available This research was conducted to determine the effect of heat-treatment with raw cotton seed oil on decay resistance and dimensional stability of beech according to EN113 and ASTM-D1037 standards respectively. The heat treatment with raw cotton seed oil was carried out in the cylinder at the temperatures of 130 and 170oC for 30 and 60 minutes. Oil uptake, density, volumetric swelling, water absorption and weight loss exposed to decay were measured. Oil uptake at 30 and 60 min were determined 10.5 and 13.3 Kg/cm3 respectively. Oil-heat treated samples at 30min and 130°C indicated the maximum density with 87.7% increase. According to results, oil-heat treatment improved water repellency and dimensional stability. Water absorption in 130°C and 60 minutes decreased 76% in comparison with control. Decay resistance of oil soaked samples for 60minutes was 80.2% more than control samples. Oil-heat treatment compared with oil treatment improved decay resistance, this effect was significant at 30 min. The temperature rise of oil–heat treatment at 30 minutes improved decay resistance, but the improvement under same level of temperature with increase time was not significant.

  10. Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

    Science.gov (United States)

    An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

  11. The Improvement of the Resistance to Candida albicans and Trichophyton interdigitale of Some Woven Fabrics Based on Cotton

    Science.gov (United States)

    Stelescu, Maria Daniela; Manaila, Elena; Nicula, Gheorghe; Iordache, Ovidiu; Dinca, Laurentiu Christian; Berechet, Mariana-Daniela; Vamesu, Mariana; Gurau, Dana

    2014-01-01

    This paper presents the improvement of the antimicrobial character of woven fabrics based on cotton. The woven fabrics were cleaned in oxygen plasma and treated by padding with silver chloride and titanium dioxide particles. The existence of silver and titanium on woven fabrics was evidenced by electronic microscope images (SEM, EDAX) and by flame atomic absorption spectrophotometry. The antimicrobial tests were performed with two fungi: Candida albicans and Trichophyton interdigitale. The obtained antimicrobial effect was considerably higher compared to the raw fabrics. Treatment of dyed fabrics with a colloidal solution based on silver chloride and titanium dioxide particles does not considerably influence colour resistance of dyes. PMID:25276112

  12. Improving Fire Resistance of Cotton Fabric through Layer-by-Layer Assembled Graphene Multilayer Nanocoating

    Science.gov (United States)

    Jang, Wonjun; Chung, Il Jun; Kim, Junwoo; Seo, Seongmin; Park, Yong Tae; Choi, Kyungwho

    2018-05-01

    In this study, thin films containing poly(vinyl alcohol) (PVA) and graphene nanoplatelets (GNPs), stabilized with poly(4-styrene-sulfonic acid) (PSS), were assembled by a simple and cost-effective layer-by-layer (LbL) technique in order to introduce the anti-flammability to cotton. These antiflammable layers were characterized by using UV-vis spectrometry and quartz crystal microbalance as a function of the number of bilayers deposited. Scanning electron microscopy was used to visualize the morphology of the thin film coatings on the cotton fabric. The graphene-polymer thin films introduced anti-flammable properties through thermally stable carbonaceous layers at a high temperature. The thermal stability and flame retardant property of graphene-coated cotton was demonstrated by thermogravimetric analysis, cone calorimetry, and vertical flame test. The results indicate that LbL-assembled graphene-polymer thin films can be applied largely in the field of flame retardant.

  13. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  14. Evaluation of disease resistance in cotton plants with reduced levels of methylated phytoalexins

    Science.gov (United States)

    The production of sesquiterpenoids in cotton tissues contribute to the plant’s constitutive and inducible defense against pathogens. In roots, gossypol (G), desoxyhemigossypol (dHG), hemigossypol (HG), and their methylated derivatives MG, DMG, dMHG, and MHG are the main defense compounds. dHG is ...

  15. Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...

  16. Methylation-sensitive amplified polymorphism analysis of Verticillium wilt-stressed cotton (Gossypium).

    Science.gov (United States)

    Wang, W; Zhang, M; Chen, H D; Cai, X X; Xu, M L; Lei, K Y; Niu, J H; Deng, L; Liu, J; Ge, Z J; Yu, S X; Wang, B H

    2016-10-06

    In this study, a methylation-sensitive amplification polymorphism analysis system was used to analyze DNA methylation level in three cotton accessions. Two disease-sensitive near-isogenic lines, PD94042 and IL41, and one disease-resistant Gossypium mustelinum accession were exposed to Verticillium wilt, to investigate molecular disease resistance mechanisms in cotton. We observed multiple different DNA methylation types across the three accessions following Verticillium wilt exposure. These included hypomethylation, hypermethylation, and other patterns. In general, the global DNA methylation level was significantly increased in the disease-resistant accession G. mustelinum following disease exposure. In contrast, there was no significant difference in the disease-sensitive accession PD94042, and a significant decrease was observed in IL41. Our results suggest that disease-resistant cotton might employ a mechanism to increase methylation level in response to disease stress. The differing methylation patterns, together with the increase in global DNA methylation level, might play important roles in tolerance to Verticillium wilt in cotton. Through cloning and analysis of differently methylated DNA sequences, we were also able to identify several genes that may contribute to disease resistance in cotton. Our results revealed the effect of DNA methylation on cotton disease resistance, and also identified genes that played important roles, which may shed light on the future cotton disease-resistant molecular breeding.

  17. Preferência de Bemisia tabaci biótipo B em linhagens mutantes de algodoeiro Bemisia tabaci biotype B preference in mutant cotton lines

    Directory of Open Access Journals (Sweden)

    Francisco das Chagas Vidal Neto

    2008-02-01

    Full Text Available Os efeitos de caracteres mutantes morfológicos do algodoeiro (Gossypium hirsutum L. r. latifolium Hutch.: folha okra, bráctea frego e planta vermelha, em relação à resistência à mosca-branca (Bemisia tabaci biótipo B Hemiptera: Aleyrodidae, foram avaliados em experimentos com ou sem chance de escolha. Os experimentos foram conduzidos em casa-de-vegetação, no delineamento de blocos ao acaso, em fatorial 23 + 1, com quatro repetições. O mutante com a característica planta vermelha foi menos atrativo e menos preferido para oviposição, em relação à planta verde, em ambos os ensaios, com ou sem escolha. Não houve preferência quanto à forma da folha e ao tipo de bráctea.The effects of cotton lines (Gossypium hirsutum L. r. latifolium Hutch. with mutants morphologic characteristics: okra leaf, frego bract and red plant in relation to host plant resistance to whitefly (Bemisia tabaci bioyipe B Hemiptera: Aleyrodidae, were evaluated in choice or no choice assays. The assays were carried out in the greenhouse conditions, according to a completely randomized block design, in a 23 + 1 in a factorial arrangement with four replications. The mutant with red plant characteristic was less attractive and less preferred for oviposition than the normal green plant does, in both, whit or without choice tests. It did not have preference in relation to the form of the leaf and bract type.

  18. Overexpression of MIC-3 indicates a direct role for the MIC gene family in mediating Upland cotton (Gossypium hirsutum) resistance to root-knot nematode (Meloidogyne incognita)

    Science.gov (United States)

    Major quantitative trait loci (QTL) have been mapped to Upland cotton (Gossypium hirsutum L.) chromosomes 11 and 14 that govern the highly resistant phenotype in response to infection by root-knot nematode (RKN; Meloidogyne incognita Chitwood & White); however, nearly nothing is known regarding the ...

  19. Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

    NARCIS (Netherlands)

    Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

    2011-01-01

    Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

  20. Comparison of growth, yield and fiber quality of the obsolete SA30 yellow leaf with four sets of modern yellow and green leaf near isogenic cotton (Gossypium hirsutum L.) lines

    Science.gov (United States)

    The Virescent Yellow leaf cotton line Seed Accession 30 (SA30) was crossed with four modern parental lines (DP5690, DES119, SG747 and MD51ne) to develop four sets of near isogenic lines (NILs) segregating for green and yellow leaves. Comparisons of these lines were made in the field in a two year re...

  1. Construction of a Bacterial Artificial Chromosome Library of TM-1, a Standard Line for Genetics and Genomics in Upland Cotton

    Institute of Scientific and Technical Information of China (English)

    Yan Hu; Wang-Zhen Guo; Tian-Zhen Zhang

    2009-01-01

    A bacterial artificial chromosome (BAC) library was constructed for Gossyplum hirsutum acc. TM-1, a genetic and genomic standard line for Upland cotton. The library consists of 147 456 clones with an average insert size of 122.8 kb ranging from 97 to 240 kb. About 96.0% of the clones have inserts over 100 kb. Therefore, this library represents theoretically 7.4 haploid genome equivalents based on an AD genome size of 2 425 Mb. Clones were stored in 384 384- well plates and arrayed into multiplex pools for rapid and reliable library screening. BAC screening was carded out by four-round polymerase chain reactions using 23 simple sequence repeats (SSR) markers, three sequence-related amplified polymorphism markers and one pair of pdmere for a gene associated with fiber development to test the quality of the library. Correspondingly, in total 92 positive BAC clones were Identified with an average four positive clones per SSR marker, ranging from one to eight hits. Additionally, since these SSR markers have been localized to chromosome 12 (A12) and 26 (D12) according to the genetic map, these BAC clonee are expected to serve as seeds for the physical mapping of these two homologous chromosomes, sequentially map-based cloning of quantitative trait loci or genes associated with Important agronomic traits.

  2. The cotton MAPK kinase GhMPK20 negatively regulates resistance to Fusarium oxysporum by mediating the MKK4-MPK20-WRKY40 cascade.

    Science.gov (United States)

    Wang, Chen; He, Xiaowen; Li, Yuzhen; Wang, Lijun; Guo, Xulei; Guo, Xingqi

    2017-11-02

    Fusarium wilt is one of the most serious diseases affecting cotton. However, the pathogenesis and mechanism by which Fusarium oxysporum overcomes plant defence responses are unclear. Here, a new group D mitogen-activated protein kinase (MAPK) gene, GhMPK20, was identified and functionally analysed in cotton. GhMPK20 expression was significantly induced by F. oxysporum. Virus-induced gene silencing (VIGS) of GhMPK20 in cotton increased the tolerance to F. oxysporum, whereas ectopic GhMPK20 overexpression in Nicotiana benthamiana reduced F. oxysporum resistance via disruption of the salicylic acid (SA)-mediated defence pathway. More importantly, an F. oxysporum-induced MAPK cascade pathway composed of GhMKK4, GhMPK20 and GhWRKY40 was identified. VIGS of GhMKK4 and GhWRKY40 also enhanced F. oxysporum resistance in cotton, and the function of GhMKK4-GhMPK20 was shown to be essential for F. oxysporum-induced GhWRKY40 expression. Together, our results indicate that the GhMKK4-GhMPK20-GhWRKY40 cascade in cotton plays an important role in the pathogenesis of F. oxysporum. This research broadens our knowledge of the negative role of the MAPK cascade in disease resistance in cotton and provides an important scientific basis for the formulation of Fusarium wilt prevention strategies. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  3. Exploring pima and upland cross-combinations to identify fusarium oxysporum f. sp. vasinfectum race 4 resistant cottons by combining ability of superior cultivars

    Science.gov (United States)

    A cotton breeding program strives to identify the best performance cultivars or breeding lines which can be used as parents in crosses. Multi-cross combinations provide the means of performance of each parent and assess the combining ability or productivity of parents through the hybridization proce...

  4. Resistance of Advanced Soybean Lines to Pod Borrer (Etiella zinckenella

    Directory of Open Access Journals (Sweden)

    Heru Kuswantoro

    2017-07-01

    Full Text Available The increasing and stabilizing of soybean product in Indonesia face many limitations. One of the limiting factors is pod borrer (Etiella zinckenella Treitschke infestation that is able to cause yield loss up to 80%. Objective of the research was to find out some advanced soybean lines that resistant to pod borrer. Design was randomized complete block with three replications. Soybean lines were grown gradualy to ensure the simultanously flowering. The plants were caged at 35 days after planting (DAT and infested with the imago of E. zinckenella at 56 DAT. Results showed that different soybean lines affected imago population, eggs population, larvae population, infected pods and infected seeds. Some genotypes were consistantly resistant to E. zinckenella. The resistance of those genotypes were non preference resistance based on eggs population, larvae population, infected pod and infected seeds. This study discovered nine soybean lines that is resistant to E. zinckenella, so that it can be beneficial for improving soybean resistance to this pest through releasing as a new resistant pod borer variety after tested further in potential yield and genetic x environment interaction trials. In addition, there were three varieties and two germplasm accessions that can be used as gene sources for improving the resistance of the varieties. The three varieties are able to be cultivated directly in field to decrease the E. zinckenella occurrence. 

  5. Research on cotton anther development of three male-sterile lines

    International Nuclear Information System (INIS)

    Dou Liping; Tang Canming; Yue Jieyu; Wang Qingya

    2009-01-01

    Pollens of Sumian 22 were irradiated by 60 Co γ-rays at a dose of 20Gy, then fertilized to pistil and harvested seed. Three male-sterile lines were selected from M 1 plants, their anther observed by paraffin slice technique. Although there were some different characteristics during the abortion anther development, the abortion was consistent: the abortion stage from the development periods of pollen mother cells to microspore, pollen mother cells, tapetum, middle layer cells and the shape of anther were affected, the results contained micronucleus and double nucleus, cytoplasm expansion during the period of meiosis, tapetum and middle layer cells and so on were abnormal. (authors)

  6. Effects of genetically modified cotton stalks on antibiotic resistance genes, intI1, and intI2 during pig manure composting.

    Science.gov (United States)

    Duan, Manli; Gu, Jie; Wang, Xiaojuan; Li, Yang; Zhang, Sheqi; Yin, Yanan; Zhang, Ranran

    2018-01-01

    Genetically modified (GM) cotton production generates a large yield of stalks and their disposal is difficult. In order to study the feasibility of using GM cotton stalks for composting and the changes that occur in antibiotic resistance genes (ARGs) during composting, we supplemented pig manure with GM or non-GM cotton stalks during composting and we compared their effects on the absolute abundances (AA) of intI1, intI2, and ARGs under the two treatments. The compost was mature after processing based on the germination index and C/N ratio. After composting, the AAs of ARGs, intI1, and intI2 were reduced by 41.7% and 45.0% in the non-GM and GM treatments, respectively. The ARG profiles were affected significantly by temperature and ammonia nitrogen. In addition, excluding tetC, GM cotton stalks had no significant effects on ARGs, intI1, and intI2 compared with the non-GM treatment (p composting with livestock manure, and the AAs of ARGs can be reduced. Furthermore, the results of this study provide a theoretical basis for the harmless utilization of GM cotton stalks. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Cottonseed protein, oil, and mineral status in near-isogenic Gossypium hirsutum cotton lines expressing fuzzy/linted and fuzzless/linted seed phenotypes under field conditions

    Directory of Open Access Journals (Sweden)

    Nacer eBellaloui

    2015-03-01

    Full Text Available Cotton is an important crop in the world and is a major source of oil for human consumption and cotton meal for livestock. Cottonseed nutrition (seed composition: protein, oil, and minerals determine the quality of seeds. Therefore, maintaining optimum levels of cottonseed nutrition is critical. Physiological and genetic mechanisms controlling the levels of these constituents in cottonseed are still largely unknown. Our previous research conducted under greenhouse conditions showed that seed and leaf nutrition differed between fuzzless and fuzzy seed isolines. Therefore, the objective of this research was to investigate the seed fuzz phenotype (trait effects on seed protein, oil, N, C, S, and minerals in five sets of near-isogenic mutant cotton lines for seed fuzz in a two-year experiment under field condition to evaluate the stability of the effect of the trait on seed nutrition. The isolines (genotypes in each set differ for the seed fuzz trait (fuzzless/linted seed line, N lines, and fuzzy/linted seed line, F lines. Results showed that seed protein was higher in the fuzzy genotype in all sets, but seed oil was higher in fuzzless genotype in all sets. The concentrations of seed Ca and C were higher in all fuzzless genotypes, but N, S, B, Fe, and Zn were higher in most of the fuzzy genotypes. Generally, minerals were higher in leaves of F lines, suggesting the translocation of minerals from leaves to seeds was limited. The research demonstrated that fiber development could be involved in cottonseed composition. This may be due to the involvement of fiber development in carbon and nitrogen metabolism, and the mobility of nutrients from leaves (source to seed (sink. This information is beneficial to breeders to consider fuzzless cottonseed for potential protein and oil use and select for higher oil or higher protein content, and to physiologists to further understand the mobility of minerals to increase the quality of cottonseed nutrition for

  8. Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

    NARCIS (Netherlands)

    Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

    2013-01-01

    A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

  9. Transcriptomic analysis of fiber strength in upland cotton chromosome introgression lines carrying different Gossypium barbadense chromosomal segments.

    Directory of Open Access Journals (Sweden)

    Lei Fang

    Full Text Available Fiber strength is the key trait that determines fiber quality in cotton, and it is closely related to secondary cell wall synthesis. To understand the mechanism underlying fiber strength, we compared fiber transcriptomes from different G. barbadense chromosome introgression lines (CSILs that had higher fiber strengths than their recipient, G. hirsutum acc. TM-1. A total of 18,288 differentially expressed genes (DEGs were detected between CSIL-35431 and CSIL-31010, two CSILs with stronger fiber and TM-1 during secondary cell wall synthesis. Functional classification and enrichment analysis revealed that these DEGs were enriched for secondary cell wall biogenesis, glucuronoxylan biosynthesis, cellulose biosynthesis, sugar-mediated signaling pathways, and fatty acid biosynthesis. Pathway analysis showed that these DEGs participated in starch and sucrose metabolism (328 genes, glycolysis/gluconeogenesis (122 genes, phenylpropanoid biosynthesis (101 genes, and oxidative phosphorylation (87 genes, etc. Moreover, the expression of MYB- and NAC-type transcription factor genes were also dramatically different between the CSILs and TM-1. Being different to those of CSIL-31134, CSIL-35431 and CSIL-31010, there were many genes for fatty acid degradation and biosynthesis, and also for carbohydrate metabolism that were down-regulated in CSIL-35368. Metabolic pathway analysis in the CSILs showed that different pathways were changed, and some changes at the same developmental stage in some pathways. Our results extended our understanding that carbonhydrate metabolic pathway and secondary cell wall biosynthesis can affect the fiber strength and suggested more genes and/or pathways be related to complex fiber strength formation process.

  10. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  11. Characterisation and Manipulation of Docetaxel Resistant Prostate Cancer Cell Lines

    LENUS (Irish Health Repository)

    O'Neill, Amanda J

    2011-10-07

    Abstract Background There is no effective treatment strategy for advanced castration-resistant prostate cancer. Although Docetaxel (Taxotere®) represents the most active chemotherapeutic agent it only gives a modest survival advantage with most patients eventually progressing because of inherent or acquired drug resistance. The aims of this study were to further investigate the mechanisms of resistance to Docetaxel. Three Docetaxel resistant sub-lines were generated and confirmed to be resistant to the apoptotic and anti-proliferative effects of increasing concentrations of Docetaxel. Results The resistant DU-145 R and 22RV1 R had expression of P-glycoprotein and its inhibition with Elacridar partially and totally reversed the resistant phenotype in the two cell lines respectively, which was not seen in the PC-3 resistant sublines. Resistance was also not mediated in the PC-3 cells by cellular senescence or autophagy but multiple changes in pro- and anti-apoptotic genes and proteins were demonstrated. Even though there were lower basal levels of NF-κB activity in the PC-3 D12 cells compared to the Parental PC-3, docetaxel induced higher NF-κB activity and IκB phosphorylation at 3 and 6 hours with only minor changes in the DU-145 cells. Inhibition of NF-κB with the BAY 11-7082 inhibitor reversed the resistance to Docetaxel. Conclusion This study confirms that multiple mechanisms contribute to Docetaxel resistance and the central transcription factor NF-κB plays an immensely important role in determining docetaxel-resistance which may represent an appropriate therapeutic target.

  12. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Liping Ke

    Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  13. Effect of chitosan on resist printing of cotton fabrics with reactive dyes

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... levels may cause the dyes to form a partial covalent bond with chitosan, thereby diminishing the resist-printing effect. In such a case, the resist printing would not be linear as a function of chitosan concentration. Red 184 exhibited the highest resist-printing effect, followed by. Blue 204 and Yellow 143.

  14. Lodging resistant pea line derived after mutagenic treatment

    International Nuclear Information System (INIS)

    Naidenova, N.; Vassilevska-Ivanova, R.

    2006-01-01

    Line 1/502 is a new lodging resistant pea ( Pisum sativum L.) developed for the Bulgarian field pea industry. This line is a direct chlorophyll mutant, which originates after treatment of the initial line, cultivar Auralia, with 150 Gy 60 Co γ - radiation. In regional evaluation trials conducted in Sofia over seven successive seasons 1/502 has revealed improved standing ability that most probably is a result from modification of the architecture of the plants appearing in reduction of plant height. The agronomic and morphological characteristics of the mutant line were reported. The upright plant habit and resistance to lodging is especially beneficial for production of high quality peas because pods are held above the soil surface during crop development and during maturity which aids in keeping the peas clean and free of pathogens that can cause discoloration and rotting. (authors)

  15. Resistivity tomography using line electrode; Sendenryugen wo tsukatta hiteiko tomography

    Energy Technology Data Exchange (ETDEWEB)

    Sugimoto, Y [Dia Consultants Company, Tokyo (Japan)

    1996-10-01

    Resistivity tomography (RT) using line electrode was studied. Although line electrode is available even for RT, in casing line electrode, only one kind of electrode data is obtained. The calculation method of potential and sensitivity distributions based on line electrode is not yet established. Since various data in various measurement arrangements are required for analysis of RT, the new measurement method was devised which measures resistivities while successively changing the tip depth of line electrode. Until now, although potential has been calculated under the assumption that outflow current per unit length of line electrode is uniform, this assumption is incorrect. The new potential distribution calculation method was thus proposed. Sensitivity distribution calculation for inverse analysis is also described. RT using line electrode could precisely obtain deep information which couldn`t be obtained only by measurement along the surface measuring line. Although RT is poorer in accuracy than the previous point electrode method, it will be probably improved by 3-electrode arrangement. RT is also useful in the case difficult to apply point electrode method. 3 refs., 10 figs.

  16. Coupling of MIC-3 overexpression with the chromosome 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton...

    Science.gov (United States)

    High levels of resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. We had previously determined that MIC-3 expression played a direct role in suppressing RKN egg...

  17. Application of an automatic yarn dismantler to track changes in cotton fibre properties during processing on a miniature spinning line

    CSIR Research Space (South Africa)

    Fassihi, A

    2014-11-01

    Full Text Available . The results obtained on different Upland cottons have clearly demonstrated the practical value of the yarn dismantler in enabling yarns to be automatically dismantled into their constituent fibres, which can then be tested by instrument, such as the AFIS...

  18. Molecular cloning of alpha-amylases from cotton boll weevil, Anthonomus grandis and structural relations to plant inhibitors: an approach to insect resistance.

    Science.gov (United States)

    Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Franco, Octávio L; Falcão, Rosana; Fragoso, Rodrigo R; Mello, Luciane V; dos Santos, Roseane C; Grossi-de-Sá, Maria F

    2003-01-01

    Anthonomus grandis, the cotton boll weevil, causes severe cotton crop losses in North and South America. Here we demonstrate the presence of starch in the cotton pollen grains and young ovules that are the main A. grandis food source. We further demonstrate the presence of alpha-amylase activity, an essential enzyme of carbohydrate metabolism for many crop pests, in A. grandis midgut. Two alpha-amylase cDNAs from A. grandis larvae were isolated using RT-PCR followed by 5' and 3' RACE techniques. These encode proteins with predicted molecular masses of 50.8 and 52.7kDa, respectively, which share 58% amino acid identity. Expression of both genes is induced upon feeding and concentrated in the midgut of adult insects. Several alpha-amylase inhibitors from plants were assayed against A. grandis alpha-amylases but, unexpectedly, only the BIII inhibitor from rye kernels proved highly effective, with inhibitors generally active against other insect amylases lacking effect. Structural modeling of Amylag1 and Amylag2 showed that different factors seem to be responsible for the lack of effect of 0.19 and alpha-AI1 inhibitors on A. grandis alpha-amylase activity. This work suggests that genetic engineering of cotton to express alpha-amylase inhibitors may offer a novel route to A. grandis resistance.

  19. Photosynthesis of cotton leaves under a range of environmental conditions in relation to internal and external diffusive resistances

    Energy Technology Data Exchange (ETDEWEB)

    Bierhuizen, J F; Slatyer, R O

    1964-01-01

    Experiments have been described in which photosynthesis of cotton leaves enclosed in a leaf chamber was measured under various conditions of light intensity (1000-6000 f.c., corresponding to 3 x 8 x 10/sup 4/-22 x 5 10/sup 4/ erg cm/sup -2/ sec/sup -1/), CO/sub 2/ concentration (200-2000 p.p.m.), temperature (30-40/sup 0/C), relative humidity (40-80%), and windspeed (0 x 6-3 x 1) cm sec/sup -1/). The plants were well watered in order to minimize water stress. The experiments conducted so far indicate that, with the conditions employed, CO/sub 2/ and light were the main factors limiting photosynthesis. At all light intensities there was an almost linear response to CO/sub 2/ concentration up to values of 600-800 p.p.m. CO/sub 2/ above which there appeared to be effective CO/sub 2/ saturation. The response to light was of particular interest. It appeared that, under limiting CO/sub 2/ conditions, an increase in light intensity increased photosynthesis not only by decreasing stomatal resistance, hence resulting in increased CO/sub 2/ diffusion through the stomata, but also by increasing the liquid phase permeability of the mesophyll cell walls to CO/sub 2/ transport. Total resistance in the diffusion pathway, the sum of r', averaged 22 sec cm/sup -1/ at 1000 f.c. for a range of windspeed, CO/sub 2/, temperature, and humidity conditions, and declined progressively to about 7 sec cm/sup -1/ at 6000 f.c. The contribution of the gaseous diffusion resistances (r'/sub a/ + r'/sub al/) decreased, at the same time, from about 8 to 4 sec cm/sup -1/. 26 references, 5 figures, 1 table.

  20. Identification and Functional Analysis of microRNAs Involved in the Anther Development in Cotton Genic Male Sterile Line Yu98-8A

    Directory of Open Access Journals (Sweden)

    Xiaojie Yang

    2016-10-01

    Full Text Available Hybrid vigor contributes in a large way to the yield and quality of cotton (Gossypium hirsutum fiber. Although microRNAs play essential regulatory roles in flower induction and development, it is still unclear if microRNAs are involved in male sterility, as the regulatory molecular mechanisms of male sterility in cotton need to be better defined. In this study, two independent small RNA libraries were constructed and sequenced from the young buds collected from the sporogenous cell formation to the meiosis stage of the male sterile line Yu98-8A and the near-isogenic line. Sequencing revealed 1588 and 1536 known microRNAs and 347 and 351 novel miRNAs from male sterile and male fertile libraries, respectively. MicroRNA expression profiles revealed that 49 conserved and 51 novel miRNAs were differentially expressed. Bioinformatic and degradome analysis indicated the regulatory complexity of microRNAs during flower induction and development. Further RT-qPCR and physiological analysis indicated that, among the different Kyoto Encyclopedia Gene and Genomes pathways, indole-3-acetic acid and gibberellic acid signaling transduction pathways may play pivotal regulatory functions in male sterility.

  1. Mutantes morfológicos de algodoeiro herbáceo como fonte de resistência ao bicudo Morphological mutants of upland cotton as source of boll weevil resistance

    Directory of Open Access Journals (Sweden)

    Francisco das Chagas Vidal Neto

    2005-02-01

    Full Text Available Este trabalho teve como objetivo avaliar os efeitos de três características morfológicas mutantes de linhagens de algodoeiro herbáceo (Gossypium hirsutum L. r. latifolium Hutch., isoladas ou combinadas no mesmo genótipo, como fonte de resistência ao bicudo, Anthonomus grandis Boheman, 1843 (Coleoptera, Curculionidae. O experimento foi conduzido em campo, sob infestação natural, com delineamento de blocos ao acaso e arranjo fatorial 2´3 com um tratamento adicional, com quatro repetições. Em teste com chance de escolha, a característica bráctea frego foi a que apresentou maior redução no dano de oviposição pelo bicudo (34,71%, em relação ao equivalente normal. A folha "okra" reduziu o dano apenas quando associada à bráctea frego (40%. A combinação das três características mutantes na mesma planta proporcionou a menor porcentagem de botões com dano de oviposição (23,13%.This work aimed to evaluate the effects of three morphological mutants of upland cotton lines (Gossypium hirsutm L. r. latifolium Hutch., isolated or in combination in the same cotton genotype, as a source of resistance to boll weevil, Anthonomus grandis Boheman, 1843 (Coleoptera, Curculionidae. The experiment was carried out in the field, under natural infestation, with a completely randomized block design arranged in a factorial 2´3 plus an additional treatment, with four replications. In a multiple choice test, the character mutant frego bract presented the higher reduction on boll weevil oviposition damage (34.71%, in relation to the normal equivalent. The okra leaf reduced the boll weevil damage only when associated with frego bract (40%. The combination of the three mutant characters in the same plant presented the least square percent with oviposition damage (23.13%.

  2. Effect of mutagens on the quality characters and disease resistant genes of diploid cotton (Gossypium arboreum L.)

    International Nuclear Information System (INIS)

    Haidar, S.; Khan, I.A.; Mansoor, S.

    2002-01-01

    In both M1 and M2 plant height decreased with the increase in dose for both the mutagens. The 15 Krad and 0.15M EMS doses increased 122.7 and 128.3 gm seed cotton yield as compared to control respectively while all other doses of both mutagens decreased the yield of seed cotton. The EMS dose 0.10 M drastically decreased 184 gm seed cotton yield as compared to control. There was no larger effect of both mutagens on GOT % whereas staple length was slightly increased and micronaire value decreased as compared to control for all the doses of both mutagens. It was observed in M2 that mutation dose 10 Krad increased 165.6 gm seed cotton yield as compared to control but slight reduction in GOT % was observed. In M2 GOT were increased 3.5 % with 15 Krad and 3.6 % with EMS 0.10 M as compared to control. There were no larger effects for both mutagens in case of staple length, micronaire and uniformity ratio for all the doses as compared to control. respectively. In both M1 and M2 no plant was observed susceptible to cotton leaf curl virus and bacterial blight diseases of cotton

  3. The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton.

    Science.gov (United States)

    Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

    2017-04-04

    Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.

  4. Multidrug resistance in tumour cells: characterisation of the multidrug resistant cell line K562-Lucena 1

    Directory of Open Access Journals (Sweden)

    VIVIAN M. RUMJANEK

    2001-03-01

    Full Text Available Multidrug resistance to chemotherapy is a major obstacle in the treatment of cancer patients. The best characterised mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein. However, the resistance process is multifactorial. Studies of multidrug resistance mechanisms have relied on the analysis of cancer cell lines that have been selected and present cross-reactivity to a broad range of anticancer agents. This work characterises a multidrug resistant cell line, originally selected for resistance to the Vinca alkaloid vincristine and derived from the human erythroleukaemia cell K562. This cell line, named Lucena 1, overexpresses P-glycoprotein and have its resistance reversed by the chemosensitisers verapamil, trifluoperazine and cyclosporins A, D and G. Furthermore, we demonstrated that methylene blue was capable of partially reversing the resistance in this cell line. On the contrary, the use of 5-fluorouracil increased the resistance of Lucena 1. In addition to chemotherapics, Lucena 1 cells were resistant to ultraviolet A radiation and hydrogen peroxide and failed to mobilise intracellular calcium when thapsigargin was used. Changes in the cytoskeleton of this cell line were also observed.A resistência a múltiplos fármacos é o principal obstáculo no tratamento de pacientes com câncer. O mecanismo responsável pela resistência múltipla mais bem caracterizado envolve a expressão do produto do gene MDR-1, a glicoproteína P. Entretanto, o processo de resistência tem fatores múltiplos. Estudos de mecanismos de resistência m��ltipla a fármacos têm dependido da análise de linhagens celulares tumorais que foram selecionadas e apresentam reatividade cruzada a uma ampla faixa de agentes anti-tumorais. Este trabalho caracteriza uma linhagem celular com múltipla resistência a fármacos, selecionada originalmente pela resistência ao alcalóide de Vinca vincristina e derivado

  5. Integrated Palmer Amaranth Management in Glufosinate-Resistant Cotton: I. Soil-Inversion, High-Residue Cover Crops and Herbicide Regimes

    Directory of Open Access Journals (Sweden)

    Michael G. Patterson

    2012-11-01

    Full Text Available A three year field experiment was conducted to evaluate the role of soil-inversion, cover crops and herbicide regimes for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. The main plots were two soil-inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. The subplots were three cover crop treatments: crimson clover, cereal rye and winter fallow; and sub subplots were four herbicide regimes: preemergence (PRE alone, postemergence (POST alone, PRE + POST and a no herbicide check (None. The PRE herbicide regime consisted of a single application of pendimethalin at 0.84 kg ae ha−1 plus fomesafen at 0.28 kg ai ha−1. The POST herbicide regime consisted of a single application of glufosinate at 0.60 kg ai ha−1 plus S-metolachlor at 0.54 kg ai ha−1 and the PRE + POST regime combined the prior two components. At 2 weeks after planting (WAP cotton, Palmer amaranth densities, both BR and WR, were reduced ≥90% following all cover crop treatments in the IT. In the NIT, crimson clover reduced Palmer amaranth densities >65% and 50% compared to winter fallow and cereal rye covers, respectively. At 6 WAP, the PRE and PRE + POST herbicide regimes in both IT and NIT reduced BR and WR Palmer amaranth densities >96% over the three years. Additionally, the BR density was reduced ≥59% in no-herbicide (None following either cereal rye or crimson clover when compared to no-herbicide in the winter fallow. In IT, PRE, POST and PRE + POST herbicide regimes controlled Palmer amaranth >95% 6 WAP. In NIT, Palmer amaranth was controlled ≥79% in PRE and ≥95% in PRE + POST herbicide regimes over three years. POST herbicide regime following NIT was not very consistent. Averaged across three years, Palmer amaranth controlled ≥94% in PRE and PRE + POST herbicide regimes regardless of cover crop. Herbicide regime effect on cotton yield was highly significant; the maximum cotton yield was

  6. Genetic diversity in upland cotton for cotton leaf curl virus disease, earliness and fiber quality

    International Nuclear Information System (INIS)

    Saeed, F.; Farooq, J.; Mahmood, A.; Hussain, T.

    2014-01-01

    In Pakistan during last two decades the major factor limiting cotton production is cotton leaf curl virus disease (CLCuD). For estimation of genetic diversity regarding CLCuD tolerance, fiber quality and some yield contributing traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like days taken to 1 square and days taken to 1 flower had positive correlation with each other and both these traits also showed their positive association with ginning out turn. The negative significant correlation of CLCuD was obtained with monopodial branches, sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st cluster 1 only showed reasonable values for days to 1 square and flower, sympodia per plant, ginning out turn, staple length and fiber fineness and the genotypes in cluster 5 showed promising values for the traits like cotton leaf curl virus, ginning out turn and fiber fineness. The genotypes in cluster 1 and 5 may be combined to obtain desirable traits related to earliness and better disease tolerance. Scatter plot and tree diagrams demonstrated sufficient diversity among the cotton accessions for various traits and some extent of association between various clusters. It is concluded that diversity among the genotypes could be utilized for the development of CLCuD resistant lines with increased seed

  7. A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

    Science.gov (United States)

    Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

    2004-09-01

    Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

  8. Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

    2015-01-01

    Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

  9. The improvement of cotton plant in mutation breeding dry climate areas at NTB

    International Nuclear Information System (INIS)

    Lilik Harsanti

    2015-01-01

    The opportunity of cotton plant to become a major crop in Indonesia is widely opened due to its extensive adaptability, productivity, efficiency of nutrient intake, and relatively resistant against pests and plant diseases. Generally, cotton plant is an important industrial crop in textile manufacture. Cotton plant has been known and planted for a long time ago by the local farmer, especially at Java, NTB and NTT. Plant mutation breeding have the mutant lines genetic for plant. The mutant lines of cotton plant, which originally come from embryogenic tissue culture (embryo axis, NIAB-999), were irradiated with dose of 20 Gy. Gamma Chamber 4000-A with source of 60 Cobalt was used for the irradiation treatment. The experiments were done at Citayam by designed by randomized Block design with five replications. Both of mutant lines were planted in the plot with size of 8 × 7 m 2 and 10 × 100 cm of spacing. Kanesia 15 variety was used as a control. The parameters observed were the days of maturity, plant height, number of generative branches, number of fruit/plant, weight of 100 cotton boll per plot. As the results, CN 2A has the biggest productivity, shown by the weight of the cotton fiber per plot, which is 447.510 kg compared to Kanesia 15 and NIAB 999 is control national and control mother. (author)

  10. Both point mutations and low expression levels of the nicotinic acetylcholine receptor β1 subunit are associated with imidacloprid resistance in an Aphis gossypii (Glover) population from a Bt cotton field in China.

    Science.gov (United States)

    Chen, Xuewei; Li, Fen; Chen, Anqi; Ma, Kangsheng; Liang, Pingzhuo; Liu, Ying; Song, Dunlun; Gao, Xiwu

    2017-09-01

    Aphis gossypii Glover is a destructive pest of numerous crops throughout the world. Although the expansion of Bt cotton cultivation has helped to control some insect pests, the damage from cotton aphids has not been mitigated. The evolution of aphid resistance to imidacloprid has made its chemical control more difficult since its introduction in 1991. Field populations of A. gossypii that were collected from different transgenic (Bt) cotton planting areas of China in 2014 developed different levels of resistance to imidacloprid. The IMI_R strain has developed high resistance to imidacloprid with the resistance ratio >1200-fold. Compared with the susceptible IMI_S strain, the IMI_R strain also developed a high level cross resistance to sulfoxaflor and acetamiprid. The limited synergism with either PBO or DEF suggests that resistance may be due to the site mutation of molecular target rather than to enhanced detoxification. Three target-site mutations within the nicotinic acetylcholine receptor (nAChR) β1 subunit were detected in the IMI_R strain. The R81T mutation has been reported to be responsible for imidacloprid resistance in A. gossypii and M. persicae. Both V62I and K264E were first detected in A. gossypii. These point mutations are also present in field populations, suggesting that they play a role in the resistance to imidacloprid. Furthermore, the expression level of transcripts encoding β1 subunit was decreased significantly in the IMI_R strain compared with the IMI_S strain, suggesting that both point mutations and the down-regulation of nAChR β1 subunit expression may be involved in the resistance mechanism for imidacloprid in A. gossypii. These results should be useful for the management of imidacloprid-resistant cotton aphids in Bt cotton fields in China. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Development of Elite BPH-Resistant Wide-Spectrum Restorer Lines for Three and Two Line Hybrid Rice.

    Science.gov (United States)

    Fan, Fengfeng; Li, Nengwu; Chen, Yunping; Liu, Xingdan; Sun, Heng; Wang, Jie; He, Guangcun; Zhu, Yingguo; Li, Shaoqing

    2017-01-01

    Hybrid rice has contributed significantly to the world food security. Breeding of elite high-yield, strong-resistant broad-spectrum restorer line is an important strategy for hybrid rice in commercial breeding programs. Here, we developed three elite brown planthopper (BPH)-resistant wide-spectrum restorer lines by pyramiding big-panicle gene Gn8.1 , BPH-resistant genes Bph6 and Bph9 , fertility restorer genes Rf3, Rf4, Rf5 , and Rf6 through molecular marker assisted selection. Resistance analysis revealed that the newly developed restorer lines showed stronger BPH-resistance than any of the single-gene donor parent Luoyang-6 and Luoyang-9. Moreover, the three new restorer lines had broad spectrum recovery capabilities for Honglian CMS, Wild abortive CMS and two-line GMS sterile lines, and higher grain yields than that of the recurrent parent 9,311 under nature field conditions. Importantly, the hybrid crosses also showed good performance for grain yield and BPH-resistance. Thus, the development of elite BPH-resistant wide-spectrum restorer lines has a promising future for breeding of broad spectrum BPH-resistant high-yield varieties.

  12. Evolution of insect pest and disease resistant, high-yielding and improved quality varieties of cotton by use of ionizing radiation. Part of a coordinated programme on the use of induced mutations for disease resistance in crop plants

    International Nuclear Information System (INIS)

    Vasti, S.M.

    1981-06-01

    Disease resistant, high yielding and higher quality cotton varieties were developed. 42 interspecific hybrid progenies of earlier crosses between Gossypium barbadense and Gossypium tomentosum or Gossypium barbadense and Gossypium hirsutum were included. Out of these, 22 progenies in F 3 generation were irradiated by gamma radiation doses of 20 and 25 kR. A list is given of interspecific hybrid progenies, as are the lists of boll rot susceptible and resistant plants in the irradiated and non-irradiated populations and/or successful crosses made between 1977 and 1978

  13. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  14. Evidence that agricultural use of pesticides selects pyrethroid resistance within Anopheles gambiae s.l. populations from cotton growing areas in Burkina Faso, West Africa.

    Directory of Open Access Journals (Sweden)

    Aristide Sawdetuo Hien

    Full Text Available Many studies have shown the role of agriculture in the selection and spread of resistance of Anopheles gambiae s.l. to insecticides. However, no study has directly demonstrated the presence of insecticides in breeding sources as a source of selection for this resistance. It is in this context that we investigated the presence of pesticide residues in breeding habitats and their formal involvement in vector resistance to insecticides in areas of West Africa with intensive farming. This study was carried out from June to November 2013 in Dano, southwest Burkina Faso in areas of conventional (CC and biological cotton (BC growing. Water and sediment samples collected from breeding sites located near BC and CC fields were submitted for chromatographic analysis to research and titrate the residual insecticide content found there. Larvae were also collected in these breeding sites and used in toxicity tests to compare their mortality to those of the susceptible strain, Anopheles gambiae Kisumu. All tested mosquitoes (living and dead were analyzed by PCR for species identification and characterization of resistance genes. The toxicity analysis of water from breeding sites showed significantly lower mortality rates in breeding site water from biological cotton (WBC growing sites compared to that from conventional cotton (WCC sites respective to both An. gambiae Kisumu (WBC: 80.75% vs WCC: 92.75% and a wild-type strain (49.75% vs 66.5%. The allele frequencies L1014F, L1014S kdr, and G116S ace -1R mutations conferring resistance, respectively, to pyrethroids and carbamates / organophosphates were 0.95, 0.4 and 0.12. Deltamethrin and lambda-cyhalothrin were identified in the water samples taken in October/November from mosquitoes breeding in the CC growing area. The concentrations obtained were respectively 0.0147ug/L and 1.49 ug/L to deltamethrin and lambdacyhalothrin. Our results provided evidence by direct analysis (biological and chromatographic tests

  15. Screening of ten advanced chickpea lines for blight and wilt resistance

    International Nuclear Information System (INIS)

    Jamil, F.F.; Haq, I.; Sarwar, N.; Alam, S.S.; Khan, J.A.; Hanif, M.; Khan, I.A.; Sarwar, M.; Haq, M.A.

    2002-01-01

    Ten advanced chickpea lines developed at NIAB were screened for resistance to Ascochyta blight and Fusarium wilt diseases in different sets of experiments conducted under controlled environment. Inoculation of plants by spore suspension of virulent strains of Ascochyta rabiei revealed that one line (97313) was resistant tolerant, two lines (97305, 97392) were tolerant, six lines (97306, 97310, 97311, 97303, 97302, 97393) were tolerant/susceptible and one line (97301) was susceptible. Screening of the same lines against Fusarium wilt by water culture method showed that two lines (97301, 97313) were moderately resistant, four lines (97302, 97303, 97306, 97393) were tolerant and the remaining four lines were susceptible. Screening through phytotoxic culture filtrates revealed that two lines (97302, 97313) were less sensitive to culture filtrates of Ascochyta rabiei and Fusarium oxysporum than the resistant check (CM88). These lines were also analyzed spectrophotometrically for peroxidase enzyme activity. Maximum enzyme activity was detected after 48 hours of inoculation with A. rabiei in three lines (97305, 97311, 97313) and resistant check (CM88) while enzyme activity in the remaining lines reached its maximum after 72 hours of inoculation which was comparable to the susceptible check (Pb-1). These studies lead to the conclusion that one line (97313) exhibited resistance against both the diseases and can be used as a source of resistance for further improvement of chickpea germplasm. (author)

  16. Characterization and evaluation of rice blast resistance of Chinese indica hybrid rice parental lines

    Directory of Open Access Journals (Sweden)

    Yunyu Wu

    2017-12-01

    Full Text Available The development of resistant varieties and hybrid combinations has been the most effective and economical strategy to control blast disease caused by Magnaporthe oryzae. However, the distribution of major R genes and blast resistance characterization in hybrid rice parents has not been well investigated, resulting in their limited use in hybrid rice blast-resistance breeding. In the present study, 88 elite indica hybrid rice parental lines were evaluated with 30 isolates of M. oryzae collected from the main planting area of indica hybrid rice in China and were characterized for the presence of 11 major resistance genes using molecular markers. The pathogenicity assays showed that four types of hybrid rice parent line showed some resistance to M. oryzae. However, the proportions of highly resistant lines and the mean resistance frequency (RF varied among the four types, with resistance in decreasing order shown by three-line restorer lines, three-line maintainer lines, two-line sterile lines, and two-line restorer lines. All 88 hybrid rice parental lines carried more than one R gene, but none carried the R genes Pi1 and Pi2. Although Pid3 and Pi9 were present only in three-line restorer lines and Pigm only in three-line maintainer lines, the remaining six R genes (Pib, Pid2, Pi5, Pia, Pi54, and Pita were present in the four types of hybrid rice parent with significantly different distribution frequencies. The correlation between R genes and resistance reactions was investigated. The results are expected to provide useful information for rational utilization of major R genes in hybrid rice breeding programs. Keywords: Hybrid rice parental lines, Magnaporthe oryzae, Pi genes, Resistance evaluation, Molecular markers

  17. Genetic engineering of cotton with a novel cry2AX1 gene to impart insect resistance against Helicoverpa armigera

    Directory of Open Access Journals (Sweden)

    Karunamurthy Dhivya

    2016-09-01

    Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.

  18. Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

    Science.gov (United States)

    Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

    2017-03-01

    An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

  19. Cotton contamination

    CSIR Research Space (South Africa)

    Van der Sluijs, MHJ

    2018-05-01

    Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...

  20. A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

    Science.gov (United States)

    Zhen, Congai; Gao, Xiwu

    2016-02-01

    In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Mutation breeding for downy mildew resistance in pearl millet. Nucleo-cytoplasmic interactions in disease-resistant lines

    International Nuclear Information System (INIS)

    Murty, B.R.; Thakur, S.R.; Prakash, N.; Mehta, S.L.; Bhakta, S.T.

    1983-01-01

    Under the need to rescue hybrid pearl millet cultivation in India from devastating damage by downy mildew, a mutation induction project was started in 1971 to make the commonly used male sterile parent Tift 23A resistant to the disease. Simultaneously sources of resistance from West Africa were used in crossbreeding by which climatic adaptation and male sterility had to be transferred. A number of mildew-resistant hybrids were developed, both from induced mutation and introduction. The resistant male sterile lines were further examined as to their common features and differences from susceptible lines. A strong evidence for nuclear-cytoplasmic interaction was obtained by biochemical and ultrastructural investigations. (author)

  2. Resist Parameter Extraction from Line-and-Space Patterns of Chemically Amplified Resist for Extreme Ultraviolet Lithography

    Science.gov (United States)

    Kozawa, Takahiro; Oizumi, Hiroaki; Itani, Toshiro; Tagawa, Seiichi

    2010-11-01

    The development of extreme ultraviolet (EUV) lithography has progressed owing to worldwide effort. As the development status of EUV lithography approaches the requirements for the high-volume production of semiconductor devices with a minimum line width of 22 nm, the extraction of resist parameters becomes increasingly important from the viewpoints of the accurate evaluation of resist materials for resist screening and the accurate process simulation for process and mask designs. In this study, we demonstrated that resist parameters (namely, quencher concentration, acid diffusion constant, proportionality constant of line edge roughness, and dissolution point) can be extracted from the scanning electron microscopy (SEM) images of patterned resists without the knowledge on the details of resist contents using two types of latest EUV resist.

  3. Evaluation of sugarcane introgression lines for resistance to brown rust disease caused by Puccinia melanocephala

    OpenAIRE

    Wang, Xiao-Yan; Wen-Feng, Li; Ying-Kun, Huang; Xin, Lu; Zhi-Ming, Luo; Jiong, Yin; Hong-Li, Shan; Rong-Yue, Zhang

    2013-01-01

    Sugarcane brown rust disease caused by Puccinia melanocephala is one of the important fungal diseases affecting sugarcane yield around the world. Cultivar resistance is the most appropriate control method for this disease. In this study, 62 introgression lines chosen from the crossing Saccharum officinarum L. cv. Ludashi x Erianthus rockii Yunnan 95-19 were evaluated for brown rust resistance using artificial inoculation. More than 30% of the introgression lines were identified as resistant. ...

  4. Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

    OpenAIRE

    Zhang Ping; Zhang Zhiyuan; Zhou Xiaojian; Qiu Weiliu; Chen Fangan; Chen Wantao

    2006-01-01

    Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differe...

  5. Role of free radicals in an adriamycin-resistant human small cell lung cancer cell line

    NARCIS (Netherlands)

    Meijer, C.; Mulder, N H; Timmer-Bosscha, H; Zijlstra, J G; de Vries, E G

    1987-01-01

    In two Adriamycin (Adr) resistant sublines (GLC4-Adr1 and GLC4-Adr2) of a human small cell lung carcinoma cell line, GLC4, cross-resistance for radiation was found. GLC4-Adr1 has an acquired Adr resistance factor of 44 after culturing without Adr for 20 days and GLC4-Adr2, the same subline cultured

  6. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...

  7. Cabazitaxel as second-line or third-line therapy in patients with metastatic castration-resistant prostate cancer

    DEFF Research Database (Denmark)

    Kongsted, Per; Svane, Inge M; Lindberg, Henriette

    2016-01-01

    To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...

  8. Improvement of Verticillium Wilt Resistance by Applying Arbuscular Mycorrhizal Fungi to a Cotton Variety with High Symbiotic Efficiency under Field Conditions

    Science.gov (United States)

    Zhang, Qiang; Gao, Xinpeng; Ren, Yanyun; Ding, Xinhua; Qiu, Jiajia; Li, Ning; Zeng, Fanchang

    2018-01-01

    Arbuscular mycorrhizal fungi (AMF) play an important role in nutrient cycling processes and plant stress resistance. To evaluate the effect of Rhizophagus irregularis CD1 on plant growth promotion (PGP) and Verticillium wilt disease, the symbiotic efficiency of AMF (SEA) was first investigated over a range of 3% to 94% in 17 cotton varieties. The high-SEA subgroup had significant PGP effects in a greenhouse. From these results, the highest-SEA variety of Lumian 1 was selected for a two-year field assay. Consistent with the performance from the greenhouse, the AMF-mediated PGP of Lumian 1 also produced significant results, including an increased plant height, stem diameter, number of petioles, and phosphorus content. Compared with the mock treatment, AMF colonization obviously inhibited the symptom development of Verticillium dahliae and more strongly elevated the expression of pathogenesis-related genes and lignin synthesis-related genes. These results suggest that AMF colonization could lead to the mycorrhiza-induced resistance (MIR) of Lumian 1 to V. dahliae. Interestingly, our results indicated that the AMF endosymbiont could directly inhibit the growth of phytopathogenic fungi including V. dahliae by releasing undefined volatiles. In summary, our results suggest that stronger effects of AMF application result from the high-SEA. PMID:29342876

  9. Improvement of Verticillium Wilt Resistance by Applying Arbuscular Mycorrhizal Fungi to a Cotton Variety with High Symbiotic Efficiency under Field Conditions

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2018-01-01

    Full Text Available Arbuscular mycorrhizal fungi (AMF play an important role in nutrient cycling processes and plant stress resistance. To evaluate the effect of Rhizophagus irregularis CD1 on plant growth promotion (PGP and Verticillium wilt disease, the symbiotic efficiency of AMF (SEA was first investigated over a range of 3% to 94% in 17 cotton varieties. The high-SEA subgroup had significant PGP effects in a greenhouse. From these results, the highest-SEA variety of Lumian 1 was selected for a two-year field assay. Consistent with the performance from the greenhouse, the AMF-mediated PGP of Lumian 1 also produced significant results, including an increased plant height, stem diameter, number of petioles, and phosphorus content. Compared with the mock treatment, AMF colonization obviously inhibited the symptom development of Verticillium dahliae and more strongly elevated the expression of pathogenesis-related genes and lignin synthesis-related genes. These results suggest that AMF colonization could lead to the mycorrhiza-induced resistance (MIR of Lumian 1 to V. dahliae. Interestingly, our results indicated that the AMF endosymbiont could directly inhibit the growth of phytopathogenic fungi including V. dahliae by releasing undefined volatiles. In summary, our results suggest that stronger effects of AMF application result from the high-SEA.

  10. Use of Phenols, Peroxidase and Polyphenoloxidase of Seed to Quantify Resistance of Cotton Genotypes to Damping-off Incited by Fusarium oxysporum

    Directory of Open Access Journals (Sweden)

    Heba I. Mohamed

    2014-03-01

    Full Text Available A greenhouse test was conducted in 2011 and 2012 growing seasons at Giza Agricultural Research Station to evaluate the reaction of six cotton genotypes to damping-off incited by Fusarium oxysporum. Damping-off incidence on the genotypes ranged from 70-88%. In general, the genotypes could be divided into highly susceptible, susceptible, and moderately susceptible. Data for damping-off incidence and level or activity of some biochemical components (phenols, peroxidase, and polyphenoloxidase were entered into a computerized linear regression analysis. The analysis contrasted seven predictive models by using the biochemical components, singly or in combination, as biochemical predictors. It was evident that models nos. 2 and 6 were the best models for predicting incidence of damping-off. The superiority of these models was attributed to their high RІ values (0.748 and 0.902, respectively and the significance of their F. values (P = 0.026 and P = 0.031, respectively. The results of the present study suggest that peroxidase alone or both peroxidase and polyphenoloxidase, which may or may not parts of damping-off resistance mechanisms, can be used as biochemical markers to predict resistance to damping-off incited by F. oxysporum.

  11. Selection of wheat lines with resistance to Fusarium graminearum by somaclonal variation

    International Nuclear Information System (INIS)

    Sun Guangzu

    1997-10-01

    The screening wheat new lines which have the resistance to Fusarium graminearum were completed by in vitro induced mutation and cell screening. Four new lines with resistance to Fusarium graminearum were obtained. The field inoculating determination in 1990∼1996 showed that their resistance was 1∼2 degree higher than that of parents, and there were variations in main agronomic traits between the new lines and their parents. Changes of the defensive enzymes (SOD, POD), sugar-protein on cell surface, and ultrastructure were investigated by using new lines and their parents under the action of toxin of Fusarium graminearum. The new lines under the action of toxin of Fusarium graminearum have the ability to increase the defensive enzyme activity and thickness of sugarprotein on cell surface and to reduce the damage of cell membrane system that would result in resistance increasing. (8 refs., 3 figs., 3 tabs.)

  12. Comportamento de progênies oriundas de raças primitivas de algodão herbáceo frente ao ataque do bicudo Behavior of lines from cotton primitive race stocks to attack of the boll weevil

    Directory of Open Access Journals (Sweden)

    Francisco José Correia Farias

    1999-12-01

    Full Text Available Com o objetivo de obter linhagens resistentes ao bicudo-do-algodoeiro (Anthonomus grandis Boheman, a Embrapa-Centro Nacional de Pesquisa de Algodão vem testando progênies oriundas de raças primitivas de algodoeiro herbáceo (Gossypium hirsutum L. originárias do México e da América Central, que apresentam níveis aceitáveis de resistência ao bicudo. Em 1991 e 1992, as progênies em BC1F5 e BC1F6 oriundas das linhagens Texas 277, Texas 326 e Texas 1180, Texas 297, Texas 339, Texas 766 e Texas 1134, foram avaliadas com relação à resistência ao bicudo. O delineamento experimental utilizado foi o de blocos ao acaso, com seis repetições. A unidade experimental foi constituída por duas fileiras de 5 m, sob um espaçamento de 0,75 m x 0,20 m. As parcelas foram infestadas com adultos do bicudo recém-emergidos, a uma taxa de 10.000 adultos/ha. Aos seis dias após a liberação dos adultos, as parcelas foram pulverizadas com Cipermethrim, sendo realizadas em intervalos semanais. Foram procedidas cinco avaliações através da coleta de 33 botões florais ao acaso, por parcela. Os maiores níveis de resistência ao bicudo foram obtidos pelas progênies Texas 326-95-1, Texas 277-87-5, Texas 1180-99-2, Texas 297 e Texas 339, com redução de ataque de 44,0, 41,2, 32,0, 40,4 e 36,4%, respectivamente, em relação à testemunha CNPA 6H.The goal of the boll weevil (Anthonomus grandis Boheman resistance program of Embrapa-Centro Nacional de Pesquisa de Algodão is to obtain cultivars that give 80% suppression when compared to commercial cultivars. The primitive cottons (Gossypium hirsutum L. from Mexico and Central America have been known to show measurable levels of resistance to the boll weevil. In 1991 and 1992, the lines in BC1F5 and BC1F6 from Texas 277, Texas 326, Texas 1180, Texas 297, Texas 339, Texas 766 and Texas 1134 were evaluated to boll weevil resistance. The experiment was carried out at Campina Grande, PB, Brazil. The trial

  13. The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

    Directory of Open Access Journals (Sweden)

    Peng Wan

    Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

  14. Thwarting one of cotton's nemeses

    International Nuclear Information System (INIS)

    Senft, D.

    1991-01-01

    There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

  15. The end of the line? A case of drug resistance to third-line ...

    African Journals Online (AJOL)

    Here, we describe the first reported case of acquired resistance to the integrase strand transfer inhibitors in South Africa. This case illustrates the dilemma of treatment in the context of inadequate adherence and poor psychosocial support and highlights the potential risk of transmission of multidrug-resistant virus.

  16. Proteomic analysis of cell lines to identify the irinotecan resistance ...

    Indian Academy of Sciences (India)

    MADHU

    was selected from the wild-type LoVo cell line by chronic exposure to irinotecan ... dose–effect curves of anticancer drugs were drawn on semilogarithm .... alcohol metabolites daunorubicinol (Forrest and Gonzalez. 2000; Mordente et al. ..... Chen L, Huang C and Wei Y 2007 Proteomic analysis of liver cancer cells treated ...

  17. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  18. Red leaf lettuce breeding line with resistance to corky root, 06-810

    Science.gov (United States)

    The Agricultural Research Service, United States Department of Agriculture (USDA) announces the release of a breeding line of red leaf lettuce (Lactuca sativa L.), 06-810. The line may be suitable for commercial production, and is suitable for use as a source of resistance to corky root disease in t...

  19. USVL-380, A zucchini yellow mosaic virus resistant watermelon breeding line

    Science.gov (United States)

    We report the development of a novel watermelon line ‘USVL-380’ [Citrullus lanatus (Thunb.) Matsum. & Nakai] resistant to the zucchini yellow mosaic virus-Florida strain (ZYMV-FL). This breeding line is homozygous for the recessive eukaryotic elongation factor eIF4E allele associated with ZYMV-resis...

  20. Genomic and transcriptomic alterations in Leishmania donovani lines experimentally resistant to antileishmanial drugs.

    Science.gov (United States)

    Rastrojo, Alberto; García-Hernández, Raquel; Vargas, Paola; Camacho, Esther; Corvo, Laura; Imamura, Hideo; Dujardin, Jean-Claude; Castanys, Santiago; Aguado, Begoña; Gamarro, Francisco; Requena, Jose M

    2018-04-13

    Leishmaniasis is a serious medical issue in many countries around the World, but it remains largely neglected in terms of research investment for developing new control and treatment measures. No vaccines exist for human use, and the chemotherapeutic agents currently used are scanty. Furthermore, for some drugs, resistance and treatment failure are increasing to alarming levels. The aim of this work was to identify genomic and trancriptomic alterations associated with experimental resistance against the common drugs used against VL: trivalent antimony (Sb III , S line), amphotericin B (AmB, A line), miltefosine (MIL, M line) and paromomycin (PMM, P line). A total of 1006 differentially expressed transcripts were identified in the S line, 379 in the A line, 146 in the M line, and 129 in the P line. Also, changes in ploidy of chromosomes and amplification/deletion of particular regions were observed in the resistant lines regarding the parental one. A series of genes were identified as possible drivers of the resistance phenotype and were validated in both promastigotes and amastigotes from Leishmania donovani, Leishmania infantum and Leishmania major species. Remarkably, a deletion of the gene LinJ.36.2510 (coding for 24-sterol methyltransferase, SMT) was found to be associated with AmB-resistance in the A line. In the P line, a dramatic overexpression of the transcripts LinJ.27.T1940 and LinJ.27.T1950 that results from a massive amplification of the collinear genes was suggested as one of the mechanisms of PMM resistance. This conclusion was reinforced after transfection experiments in which significant PMM-resistance was generated in WT parasites over-expressing either gene LinJ.27.1940 (coding for a D-lactate dehydrogenase-like protein, D-LDH) or gene LinJ.27.1950 (coding for an aminotransferase of branched-chain amino acids, BCAT). This work allowed to identify new drivers, like SMT, the deletion of which being associated with resistance to AmB, and the tandem D

  1. Sensitivity to ionizing radiation and chemotherapeutic agents in gemcitabine-resistant human tumor cell lines

    International Nuclear Information System (INIS)

    Bree, Chris van; Kreder, Natasja Castro; Loves, Willem J.P.; Franken, Nicolaas A.P.; Peters, Godefridus J.; Haveman, Jaap

    2002-01-01

    Purpose: To determine cross-resistance to anti-tumor treatments in 2',2'difluorodeoxycytidine (dFdC, gemcitabine)-resistant human tumor cells. Methods and Materials: Human lung carcinoma cells SW-1573 (SWp) were made resistant to dFdC (SWg). Sensitivity to cisplatin (cDDP), paclitaxel, 5-fluorouracil (5-FU), methotrexate (MTX), cytarabine (ara-C), and dFdC was measured by a proliferation assay. Radiosensitivity and radioenhancement by dFdC of this cell panel and the human ovarian carcinoma cell line A2780 and its dFdC-resistant variant AG6000 were determined by clonogenic assay. Bivariate flowcytometry was performed to study cell cycle changes. Results: In the SWg, a complete deoxycytidine kinase (dCK) deficiency was found on mRNA and protein level. This was accompanied by a 10-fold decrease in dCK activity which resulted in the >1000-fold resistance to dFdC. Sensitivity to other anti-tumor drugs was not altered, except for ara-C (>100-fold resistance). Radiosensitivity was not altered in the dFdC-resistant cell lines SWg and AG6000. High concentrations (50-100 μM dFdC) induced radioenhancement in the dFdC-resistant cell lines similar to the radioenhancement obtained at lower concentrations (10 nM dFdC) in the parental lines. An early S-phase arrest was found in all cell lines after dFdC treatment where radioenhancement was achieved. Conclusions: In the dFdC-resistant lung tumor cell line SWg, the deficiency in dCK is related to the resistance to dFdC and ara-C. No cross-resistance was observed to other anti-tumor drugs used for the treatment in lung cancer. Sensitivity to ionizing radiation was not altered in two different dFdC-resistant cell lines. Resistance to dFdC does not eliminate the ability of dFdC to sensitize cells to radiation

  2. Hypoxia-induced resistance to doxorubicin and methotrexate in human melanoma cell lines in vitro.

    Science.gov (United States)

    Sanna, K; Rofstad, E K

    1994-07-15

    Rodent cell lines can develop resistance to doxorubicin and methotrexate during hypoxic stress. This has so far not been observed in human tumor cell lines. The purpose of our communication is to show that doxorubicin and methotrexate resistance can also develop in human melanoma cells during exposure to hypoxia. Four cell lines (BEX-c, COX-c, SAX-c, WIX-c) have been studied. Cells were exposed to hypoxia (O2 concentration WIX-c. BEX-c and SAX-c were sensitive to methotrexate without hypoxia pre-treatment, whereas COX-c and WIX-c were resistant initially. Hypoxia-induced drug resistance was present immediately after reoxygenation and tended to decrease with time but remained statistically significant even 42 hr after reoxygenation.

  3. Resurrection of glyphosate resistant palmer amaranth control in conservation tillage dicamba tolerant cotton; soil health salvation using herbicide technology

    Science.gov (United States)

    Conservation agriculture hecterage in the mid-south and southeastern US has decreased because of herbicide resistant and other hard to control weeds. Producers have increasingly utilized tillage, the majority either using a moldboard plow to deeply bury weed seed and decrease emergence, or ‘vertica...

  4. Superamphiphobic cotton fabrics with enhanced stability

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

    2015-11-30

    Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

  5. Diversity of arthropod community in transgenic poplar-cotton ecosystems.

    Science.gov (United States)

    Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

    2015-12-02

    Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

  6. Resistance Evaluation of Radish (Raphanus sativus L. Inbred Lines against Turnip mosaic virus

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2017-03-01

    Full Text Available Leaves of twenties radish (Raphanus sativus L. inbred lines were mechanically inoculated with Turnip mosaic virus (TuMV strain HY to evaluate TuMV resistance of the radish inbred lines. The inoculated radish plants were incubated at 22°C±3°C and resistance assessment was examined using symptom development for 4 weeks. Based on the reactions of differential radish inbred lines, 16 radish lines were produced mild mosaic, mottling, mosaic and severe mosaic symptoms by TuMV infection. These results were confirmed by RT-PCR analysis of TuMV coat protein gene, suggesting that TuMV is responsible for the disease symptoms. Four resistant radish lines did not induce systemic mosaic symptoms on upper leaves and chlorosis in stem tissues for 4 weeks, showing they were symptomless by 8 weeks. Further examination of TuMV infection in the 4 radish lines showed no TuMV infection in all systemic leaves. These results suggest that the 4 radish lines are highly resistant to TuMV.

  7. Evaluation of rice mutant lines for resistance to brown planthopper, nilaparvata lugens stall

    International Nuclear Information System (INIS)

    Mugiono

    1985-01-01

    The most important and common insect in rice cultivation in South East Asia is brown planthopper, nilaparvata lugens stall. Seven rice mutant lines produced by the National Atomic Energy Agency, Indonesia, were tested at IRRI, the Philippines for resistance to brown planthopper. Those mutant lines were Atomita 1, 627/10-3/PsJ, Atomita 2 and 627/4-E/PsJ originated from Pelita 1/1 which was irradiated with 0.2 kGy of gamma rays and A227/2/PsJ, A227/3/PsJ and A227/5/PsJ, originated from early maturing mutant A23/PsJ/72K from irradiated Pelita 1/1 which was irradiated with 0.1 kGy of gamma rays. Evaluation of resistance was carried out by seedling bulk screening, honeydew excretion, survival and population build up tests by using brown planthopper biotype 1, 2 and 3. Results of these tests showed that the seven tested mutant lines were resistant to biotype 1 but susceptible to biotype 2. Reaction to biotype 3 showed that six mutant lines tested were moderately resistant and only one mutant of 627/4-E/PsJ was susceptible. Reactions of the mutant lines to biotype 1, 2 and 3 were different from the resistant varieties, Mudgo or ASD-7. This indicated that mutant lines might have gene(s) for resistance which differed from those of resistant varieties. The results showed that resistance to brown planthopper is possible to be introduced in Indonesian rice varieties by means of mutations. (author)

  8. [Establishment of human multidrug-resistant lung carcinoma cell line (D6/MVP)].

    Science.gov (United States)

    Ma, Sheng-lin; Feng, Jian-guo; Gu, Lin-hui; Ling, Yu-tian

    2003-03-01

    To establish human multidrug-resistant lung carcinoma cell line (D6/MVP) with its characteristics studied. Intermittent administration of high-dose MMC, VDS and DDP (MVP) was used to induce human lung carcinoma cell line (D6) to a multidrug-resistant variety (D6/MVP). MTT assay was used to study the multidrug resistance of D6/MVP to multianticarcinogen. Flow cytometry was used to study the cell cycle distribution and the expression of P-gp, multidrug resistance-associated protein (MRP) and GSH/GST. 1. D6/MVP was resistant to many anti-tumor agents, with the IC(50) 13.3 times higher and the drug resistance 2 - 6 times higher than D6, 2. The multiplication time of D6/MVP was prolonged and the cell number of S-phase decreased while that of G1- and G(2)-phase increased and 3. The expression of P-gp and MRP was enhanced significantly (96.2% vs 51.7%), but the expression of GSH/GST kept stable. D6/MVP is a multidrug-resistant cell line possessing the basic characteristics of drug-resistance.

  9. Characterization and drug resistance patterns of Ewing's sarcoma family tumor cell lines.

    Directory of Open Access Journals (Sweden)

    William A May

    Full Text Available Despite intensive treatment with chemotherapy, radiotherapy and surgery, over 70% of patients with metastatic Ewing's Sarcoma Family of Tumors (EFT will die of their disease. We hypothesize that properly characterized laboratory models reflecting the drug resistance of clinical tumors will facilitate the application of new therapeutic agents to EFT. To determine resistance patterns, we studied newly established EFT cell lines derived from different points in therapy: two established at diagnosis (CHLA-9, CHLA-32, two after chemotherapy and progressive disease (CHLA-10, CHLA-25, and two at relapse after myeloablative therapy and autologous bone marrow transplantation (post-ABMT (CHLA-258, COG-E-352. The new lines were compared to widely studied EFT lines TC-71, TC-32, SK-N-MC, and A-673. These lines were extensively characterized with regard to identity (short tandem repeat (STR analysis, p53, p16/14 status, and EWS/ETS breakpoint and target gene expression profile. The DIMSCAN cytotoxicity assay was used to assess in vitro drug sensitivity to standard chemotherapy agents. No association was found between drug resistance and the expression of EWS/ETS regulated genes in the EFT cell lines. No consistent association was observed between drug sensitivity and p53 functionality or between drug sensitivity and p16/14 functionality across the cell lines. Exposure to chemotherapy prior to cell line initiation correlated with drug resistance of EFT cell lines in 5/8 tested agents at clinically achievable concentrations (CAC or the lower tested concentration (LTC: (cyclophosphamide (as 4-HC and doxorubicin at CAC, etoposide, irinotecan (as SN-38 and melphalan at LTC; P<0.1 for one agent, and P<0.05 for four agents. This panel of well-characterized drug-sensitive and drug-resistant cell lines will facilitate in vitro preclinical testing of new agents for EFT.

  10. Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens

    Science.gov (United States)

    2011-01-01

    Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301

  11. Early antiretroviral therapy and potent second-line drugs could decrease HIV incidence of drug resistance.

    Science.gov (United States)

    Shen, Mingwang; Xiao, Yanni; Rong, Libin; Meyers, Lauren Ancel; Bellan, Steven E

    2017-06-28

    Early initiation of antiretroviral therapy (ART) reduces the risk of drug-sensitive HIV transmission but may increase the transmission of drug-resistant HIV. We used a mathematical model to estimate the long-term population-level benefits of ART and determine the scenarios under which earlier ART (treatment at 1 year post-infection, on average) could decrease simultaneously both total and drug-resistant HIV incidence (new infections). We constructed an infection-age-structured mathematical model that tracked the transmission rates over the course of infection and modelled the patients' life expectancy as a function of ART initiation timing. We fitted this model to the annual AIDS incidence and death data directly, and to resistance data and demographic data indirectly among men who have sex with men (MSM) in San Francisco. Using counterfactual scenarios, we assessed the impact on total and drug-resistant HIV incidence of ART initiation timing, frequency of acquired drug resistance, and second-line drug effectiveness (defined as the combination of resistance monitoring, biomedical drug efficacy and adherence). Earlier ART initiation could decrease the number of both total and drug-resistant HIV incidence when second-line drug effectiveness is sufficiently high (greater than 80%), but increase the proportion of new infections that are drug resistant. Thus, resistance may paradoxically appear to be increasing while actually decreasing. © 2017 The Author(s).

  12. Dictionary of Cotton

    Science.gov (United States)

    The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

  13. Resistance to Wheat Curl Mite in Arthropod-Resistant Rye-Wheat Translocation Lines

    Directory of Open Access Journals (Sweden)

    Lina Maria Aguirre-Rojas

    2017-11-01

    Full Text Available The wheat curl mite, Aceria toschiella (Keifer, and a complex of viruses vectored by A. toschiella substantially reduce wheat yields in every wheat-producing continent in the world. The development of A. toschiella-resistant wheat cultivars is a proven economically and ecologically viable method of controlling this pest. This study assessed A. toschiella resistance in wheat genotypes containing the H13, H21, H25, H26, H18 and Hdic genes for resistance to the Hessian fly, Mayetiola destructor (Say and in 94M370 wheat, which contains the Dn7 gene for resistance to the Russian wheat aphid, Diuraphis noxia (Kurdjumov. A. toschiella populations produced on plants containing Dn7 and H21 were significantly lower than those on plants of the susceptible control and no different than those on the resistant control. Dn7 resistance to D. noxia and H21 resistance to M. destructor resulted from translocations of chromatin from rye into wheat (H21—2BS/2RL, Dn7—1BL/1RS. These results provide new wheat pest management information, indicating that Dn7 and H21 constitute resources that can be used to reduce yield losses caused by A. toschiella, M. destructor, D. noxia, and wheat streak mosaic virus infection by transferring multi-pest resistance to single sources of germplasm.

  14. Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

    Science.gov (United States)

    Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

    2015-01-01

    Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

  15. Evaluation of fall armyworm resistance in maize germplasm lines using visual leaf injury rating and predator survey

    Science.gov (United States)

    After examining ear-colonizing pest resistance, 20 maize lines from the USDA-ARS germplasm enhancement of Maize (GEM) Program were evaluated for whorl-feeding fall armyworm (FAW) (Spodoptera frugiperda) resistance using four maize inbred lines as the resistant and susceptible controls. Both FAW inju...

  16. Parallel Evolution under Chemotherapy Pressure in 29 Breast Cancer Cell Lines Results in Dissimilar Mechanisms of Resistance

    DEFF Research Database (Denmark)

    Tegze, Balint; Szallasi, Zoltan Imre; Haltrich, Iren

    2012-01-01

    Background: Developing chemotherapy resistant cell lines can help to identify markers of resistance. Instead of using a panel of highly heterogeneous cell lines, we assumed that truly robust and convergent pattern of resistance can be identified in multiple parallel engineered derivatives of only...

  17. Negative resists for i-line lithography utilizing acid-catalyzed intramolecular dehydration reaction

    Science.gov (United States)

    Ueno, Takumi; Uchino, Shou-ichi; Hattori, Keiko T.; Onozuka, Toshihiko; Shirai, Seiichiro; Moriuchi, Noboru; Hashimoto, Michiaki; Koibuchi, S.

    1994-05-01

    Chemical amplification negative resist system composed of a novolak resin, a carbinol and an acid generator is investigated for i-line phase-shift lithography. The reaction in this resist is based on an acid-catalyzed intramolecular dehydration reaction. The dehydration products act as aqueous-base dissolution inhibitors, and carbinol compounds in unexposed areas work as dissolution promoters. The resist composed of a novolak resin, 1,4-bis((alpha) -hydroxyisopropyl) benzene (DIOL-1) and 2- naphthoylmethyltetramethylenesulfonium triflate (PAG-2) gives the best lithographic performance in terms of sensitivity and resolution. Line-and-space patterns of 0.275 micrometers are obtained using an i-line stepper (NA:0.45) in conjunction with a phase shifting mask.

  18. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  19. Screening of gamma radiation-induced pathogen resistance rice lines against Xanthomonas oryzae pv. oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Ahmad, Raza; Moon, Jae Sun; Kwon, Suk Yoon [Korea Research Institute of Beoscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Dong Sub [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-09-15

    Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M{sub 3}, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M{sub 4} generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo.

  20. Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

    International Nuclear Information System (INIS)

    Zhang, Ping; Zhang, Zhiyuan; Zhou, Xiaojian; Qiu, Weiliu; Chen, Fangan; Chen, Wantao

    2006-01-01

    Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differentiated tongue squamous cell carcinoma. Global gene expression in this resistant cell line and its sensitive parent cell line was analyzed using Affymetrix HG-U95Av2 microarrays. Candidate genes involved in DNA repair, the MAP pathway and cell cycle regulation were chosen to validate the microarray analysis results. Cell cycle distribution and apoptosis following cisplatin exposure were also investigated. Cisplatin resistance in Tca/cisplatin cells was stable for two years in cisplatin-free culture medium. The IC50 for cisplatin in Tca/cisplatin was 6.5-fold higher than that in Tca8113. Microarray analysis identified 38 genes that were up-regulated and 25 that were down-regulated in this cell line. Some were novel candidates, while others are involved in well-characterized mechanisms that could be relevant to cisplatin resistance, such as RECQL for DNA repair and MAP2K6 in the MAP pathway; all the genes were further validated by Real-time PCR. The cell cycle-regulated genes CCND1 and CCND3 were involved in cisplatin resistance; 24-hour exposure to 10 μM cisplatin induced a marked S phase block in Tca/cisplatin cells but not in Tca8113 cells. The Tca8113 cell line and its stable drug-resistant variant Tca/cisplatin provided a useful model for identifying candidate genes responsible for the mechanism of cisplatin resistance in oral squamous cell carcinoma. Our data provide a useful basis for screening candidate targets for early diagnosis and further intervention in cisplatin resistance

  1. Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

    Directory of Open Access Journals (Sweden)

    Zhang Ping

    2006-09-01

    Full Text Available Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differentiated tongue squamous cell carcinoma. Global gene expression in this resistant cell line and its sensitive parent cell line was analyzed using Affymetrix HG-U95Av2 microarrays. Candidate genes involved in DNA repair, the MAP pathway and cell cycle regulation were chosen to validate the microarray analysis results. Cell cycle distribution and apoptosis following cisplatin exposure were also investigated. Results Cisplatin resistance in Tca/cisplatin cells was stable for two years in cisplatin-free culture medium. The IC50 for cisplatin in Tca/cisplatin was 6.5-fold higher than that in Tca8113. Microarray analysis identified 38 genes that were up-regulated and 25 that were down-regulated in this cell line. Some were novel candidates, while others are involved in well-characterized mechanisms that could be relevant to cisplatin resistance, such as RECQL for DNA repair and MAP2K6 in the MAP pathway; all the genes were further validated by Real-time PCR. The cell cycle-regulated genes CCND1 and CCND3 were involved in cisplatin resistance; 24-hour exposure to 10 μM cisplatin induced a marked S phase block in Tca/cisplatin cells but not in Tca8113 cells. Conclusion The Tca8113 cell line and its stable drug-resistant variant Tca/cisplatin provided a useful model for identifying candidate genes responsible for the mechanism of cisplatin resistance in oral squamous cell carcinoma. Our data provide a useful basis for screening candidate targets for early diagnosis

  2. Pentobarbital Sleep Time in Mouse Lines Selected for Resistance and Susceptibility to Fescue Toxicosis

    OpenAIRE

    Arthur, Kimberly Ann

    2002-01-01

    In previous work with mouse lines selected for resistance (R) and susceptibility (S) to fescue toxicosis, R mice had higher activities of Phase II liver enzymes glutathione S-transferase and uridine diphosphate glucuronosyl-transferase than S mice. Objectives of this study were: 1. to determine whether selection for toxicosis response had also caused divergence between lines in hepatic Phase I enzyme activity (as assessed by sleep time following sodium pentobarbital anesthesia), 2. to determi...

  3. Behavior of grape breeding lines with distinct resistance alleles to downy mildew (Plasmopara viticola)

    OpenAIRE

    Sánchez-Mora, Fernando D.; Saifert, Luciano; Zanghelini, Jean; Assumpção, Wilson T.; Guginski-Piva, Cláudia A.; Giacometti, Renan; Novak, Eduardo I.; Klabunde, Gustavo H.; Eibach, Rudolf; Dal Vesco, Lirio; Nodari, Rubens O.; Welter, Leocir J.

    2017-01-01

    Abstract Downy mildew (Plasmopara viticola) is the main grapevine disease in humid regions. In the present investigation, marker-assisted selection (MAS) was used to develop grapevine lines homozygous in loci Rpv1 and Rpv3 for resistance against P. viticola. The experimental populations UFSC-2013-1 (n = 420) and UFSC-2013-2 (n = 237) were obtained by self-pollination of two full-sib plants, originated from a cross between two distinct breeding lines containin...

  4. Understanding the relationship between cotton fiber properties and non-cellulosic cell wall polysaccharides

    DEFF Research Database (Denmark)

    Rajasundaram, Dhivyaa; Runavot, Jean-Luc; Guo, Xiaoyuan

    2014-01-01

    cotton fibers, which are of both biological and industrial importance. To this end, we attempted to study cotton fiber characteristics together with glycan arrays using regression based approaches. Taking advantage of the comprehensive microarray polymer profiling technique (CoMPP), 32 cotton lines from...... different cotton species were studied. The glycan array was generated by sequential extraction of cell wall polysaccharides from mature cotton fibers and screening samples against eleven extensively characterized cell wall probes. Also, phenotypic characteristics of cotton fibers such as length, strength...

  5. The genetic variance of resistance in M3 lines of rice against leaf blight disease

    International Nuclear Information System (INIS)

    Mugiono

    1979-01-01

    Seeds of Pelita I/1 rice variety were irradiated with 20, 30, 40 and 50 krad of gamma rays from a 60 Co source. Plants of M 3 lines were inoculated with bacterial leaf blight, Xanthomonas oryzae (Uzeda and Ishiyama) Downson, using clipping method. The coefficient of genetic variability of resistance against leaf blight disease increased with increasing dose. Highly significant difference in the genetic variance of resistance were found between the treated samples and the control. Dose of 20 krad gave good probability for selection of plants resistant against leaf blight disease. (author)

  6. Raman spectroscopy differentiates between sensitive and resistant multiple myeloma cell lines

    Science.gov (United States)

    Franco, Domenico; Trusso, Sebastiano; Fazio, Enza; Allegra, Alessandro; Musolino, Caterina; Speciale, Antonio; Cimino, Francesco; Saija, Antonella; Neri, Fortunato; Nicolò, Marco S.; Guglielmino, Salvatore P. P.

    2017-12-01

    Current methods for identifying neoplastic cells and discerning them from their normal counterparts are often nonspecific and biologically perturbing. Here, we show that single-cell micro-Raman spectroscopy can be used to discriminate between resistant and sensitive multiple myeloma cell lines based on their highly reproducible biomolecular spectral signatures. In order to demonstrate robustness of the proposed approach, we used two different cell lines of multiple myeloma, namely MM.1S and U266B1, and their counterparts MM.1R and U266/BTZ-R subtypes, resistant to dexamethasone and bortezomib, respectively. Then, micro-Raman spectroscopy provides an easily accurate and noninvasive method for cancer detection for both research and clinical environments. Characteristic peaks, mostly due to different DNA/RNA ratio, nucleic acids, lipids and protein concentrations, allow for discerning the sensitive and resistant subtypes. We also explored principal component analysis (PCA) for resistant cell identification and classification. Sensitive and resistant cells form distinct clusters that can be defined using just two principal components. The identification of drug-resistant cells by confocal micro-Raman spectroscopy is thus proposed as a clinical tool to assess the development of resistance to glucocorticoids and proteasome inhibitors in myeloma cells.

  7. Resistance of a soybean cell line to oxyfluorfen by overproduction of mitochondrial protoporphyrinogen oxidase.

    Science.gov (United States)

    Warabi, E; Usui, K; Tanaka, Y; Matsumoto, H

    2001-08-01

    The diphenyl ether herbicide oxyfluorfen (2-chloro-4-trifluoromethylphenyl 3-ethoxy-4-nitrophenyl ether) inhibits protoporphyrinogen oxidase (Protox) which catalyzes the oxidation of protoporphyrinogen IX (Protogen) to protoporphyrin IX (Proto IX), the last step of the common pathway to chlorophyll and haeme biosynthesis. We have selected an oxyfluorfen-resistant soybean cell line by stepwise selection methods, and the resistance mechanism has been investigated. No growth inhibition was observed in resistant cells at a concentration of 10(-7) M oxyfluorfen, a concentration at which normal cells did not survive. While the degree of inhibition of total extractable Protox by oxyfluorfen was the same in both cell types, the enzyme activity in the mitochondrial fraction from non-treated resistant cells was about nine-fold higher than that from normal cells. Northern analysis of mitochondrial Protox revealed that the concentration of mitochondrial Protox mRNA was much higher in resistant cells than that in normal cells. There were no differences in the absorption and metabolic breakdown of oxyfluorfen. The growth of resistant cells was also insensitive to oxadiazon [5-tert-butyl-3-(2,4-dichloro-5-isopropoxyphenyl)-1,3,4-oxadiazol-2-(3H)- one], the other chemical class of Protox inhibitor. Therefore, the resistance of the selected soybean cell line to oxyfluorfen is probably mainly due to the overproduction of mitochondrial Protox.

  8. Functional Marker Assisted Improvement of Stable Cytoplasmic Male Sterile Lines of Rice for Bacterial Blight Resistance

    Directory of Open Access Journals (Sweden)

    Jegadeesan Ramalingam

    2017-06-01

    Full Text Available Bacterial blight (BB, caused by Xanthomonas oryzae pv.oryzae is one among the major diseases in rice, which in severe condition cause losses up to 60% in total yield. Marker assisted pyramiding of three broad spectrum BB resistance genes (xa5, xa13, and Xa21 in prominent rice varieties is the most economical and effective strategy for the management of the BB disease. We report here the pyramiding of three genes (xa5, xa13, and Xa21 in maintainer lines (CO 2B, CO 23B, and CO 24B of three promising wild abortive cytoplasmic male sterile lines (CO 2A, CO 23A, and CO 24A through functional markers assisted back cross breeding. IRBB60 with xa5, xa13, and Xa21 genes is used as a donor parent. BC2F1 and BC2F2 generations from a cross of CO 2B, CO 23B, and CO 24B with IRBB60 were evaluated for bacterial blight and non-fertility restoration. In BC2F1, plants with all three resistance genes (xa5, xa13, and Xa21 and high parent genome recovery was identified. In BC2F2, plants with all resistance genes and without fertility restorer (Rf3 and Rf4 were selected. Based on agronomic traits, BB resistance and maintenance of sterility, two plants each in CO 2B × IRBB60, CO 24B × IRBB60 and one plant in CO 23B × IRBB60 combinations were identified. The identified lines were crossed with respective male sterile lines for conversion of improved B line into CMS line through back-crossing, in addition to selfing. The plants with high recurrent genome and phenotypically similar to parental lines and sterile are being used for the hybrid rice development program. Currently, using these lines (improved CMS line, test crosses were made to develop new rice hybrids. Hybrids combinations viz., CO 23A × AD08009R and CO 24A × IET20898R were found to be stable at different locations with high yield. The R line used in this study has been introgressed with xa5, xa13, and Xa21 genes in a separate breeding program. These new hybrids with resistance against bacterial blight

  9. Loss and stabilization of resistance to aminopterin in mouse cell lines

    International Nuclear Information System (INIS)

    Safronov, V.V.; Kapitsa, O.S.; Sapegina, M.B.; Gorodetskii, S.I.

    1986-01-01

    Using step-wise selection, lines of mouse L-cells were obtained (clones B-82, TK-), resistance to aminopterin (AP) of which exceeds resistance of parental cells by 10 3 -5 x 10 4 times. Increased resistance is the result of amplification of the gene for dihydrofolate reductase (DHFR), which was established according to increase in enzyme activity by 15-120 times and by cytogenetic methods. Development and disappearance of resistance to AP was studied and karyological analysis of lines obtained was conducted. Two types of karylogical changes were revealed: the presence of double microchromosomes (DM) and of a marker chromosome having homogeneously staining regions (HSR). The localization of the DHFR and HSR genes was demonstrated using in situ hybridization. At early stages of the development of resistance and for a long time, an extrachromosomal localization of amplified genes in the structure of DM, which determine unstable resistance to toxin, is fundamental. The possibility was demonstrated of the long-term existence of cells in which DM and HSR are present simultaneously. Change in number of copies of the DHFR gene in lines of such cells occurs through change in the number of DM, while size and localization of HSR are constant in different conditions of cell culturing. The presence of HSR determines stable resistance to AP. Data were obtained in support of an intermediate relative stabilization of resistance, which is caused by temporary insertion of copies of the DHFR gene into other sections of chromosomes, in addition to HSR dispersed variously through the genome

  10. Inheritance and molecular mapping of anthracnose resistance gene present in the differential line PI533918

    Science.gov (United States)

    Anthracnose (Collectrotichum sublineolum) is considered one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) because it infects all aerial tissues of the plant. The best strategy to control the disease is the incorporation of resistance genes. At present, eighteen sorghum line...

  11. Identification of resistance to Maize rayado fino virus in maize inbred lines

    Science.gov (United States)

    Maize rayado fino virus (MRFV) is one of the most important virus diseases of maize in America. Severe yield losses, ranging from 10 to 50% in landraces to nearly 100% in contemporary cultivars, have been reported. Resistance has been reported in populations, but few inbred lines have been identifie...

  12. Overexpression of c-Jun contributes to sorafenib resistance in human hepatoma cell lines.

    Directory of Open Access Journals (Sweden)

    Yuki Haga

    Full Text Available Despite recent advances in treatment strategies, it is still difficult to cure patients with hepatocellular carcinoma (HCC. Sorafenib is the only approved multiple kinase inhibitor for systemic chemotherapy in patients with advanced HCC. The majority of advanced HCC patients are resistant to sorafenib. The mechanisms of sorafenib resistance are still unknown.The expression of molecules involved in the mitogen-activated protein kinase (MAPK signaling pathway in human hepatoma cell lines was examined in the presence or absence of sorafenib. Apoptosis of human hepatoma cells treated with sorafenib was investigated, and the expression of Jun proto-oncogene (c-Jun was measured.The expression and phosphorylation of c-Jun were enhanced in human hepatoma cell lines after treatment with sorafenib. Inhibiting c-Jun enhanced sorafenib-induced apoptosis. The overexpression of c-Jun impaired sorafenib-induced apoptosis. The expression of osteopontin, one of the established AP-1 target genes, was enhanced after treatment with sorafenib in human hepatoma cell lines.The protein c-Jun plays a role in sorafenib resistance in human hepatoma cell lines. The modulation and phosphorylation of c-Jun could be a new therapeutic option for enhancing responsiveness to sorafenib. Modulating c-Jun may be useful for certain HCC patients with sorafenib resistance.

  13. Resistance of common bean breeding lines to Phaeoisariopsis griseola isolates from Honduras

    Science.gov (United States)

    Angular leaf spot (ALS) disease caused by Phaeoisariopsis griseola Sacc. Ferraris, is currently one of the most important factors limiting bean productivity in Central America. The development of breeding lines which combine resistance to ALS and Bean Golden Yellow Mosaic Virus (BGYMV) and tolerance...

  14. Detection of underground mined voids using line electrode resistivity technique - case study

    Energy Technology Data Exchange (ETDEWEB)

    Peng, S.S.; Ziaie, F. (West Virginia University, Morgantown, WV (USA))

    1991-06-01

    A new resistivity method was developed and tested in three phases; simulated model, similitude model, and field survey. This resistivity method was a combination of the Bristow arrangement and line electrode method. Three line electrodes were chosen so that the sinkhole electrode was emplaced at a far distance from the other two electrodes. Any of the two electrodes and the sinkhole electrode were activated and several resistivity profiles perpendicular to the line electrode prepared for different electrodes activation. Subsurface cavities caused resistivity anomalies which were interpreted to locate their sources (cavities) and estimate the depths and dimension of the cavities. A coal mine site employing the room and pillar mining system was selected to confirm the results of the laboratory. The results of the interpretation indicated that the entry with a dimension of 135 cm high and 5.40 m wide at a depth of 25.50 m can be detected by this method. The resolution of the detectability of this method proved a great success when compared to other resistivity techniques. 6 refs., 6 figs.

  15. Endogenous superoxide dismutase and catalase activities and radiation resistance in mouse cell lines

    International Nuclear Information System (INIS)

    Davy, C.A.; Tesfay, Z.; Jones, J.; Rosenberg, R.C.; McCarthy, C.; Ostrand-Rosenberg, S.

    1988-01-01

    The relationship between the endogenous cytoplasmic levels of the enzymes superoxide dismutase and catalase and the inhibition of cell proliferation by γ-radiation has been studied in 11 mouse cell lines. The resistance of these mouse cell lines to radiation was found to vary by over 25-fold. No correlation was found between the cytoplasmic level of CuZn-superoxide dismutase or catalase and the resistance to radiation as measured by extrapolation number (EN), quasi-threshold dose (Dsub(q)), or Dsub(o). None of the cell lines had detectable cytoplasmic Mn-superoxide dismutase. The apparent Ksub(i) of potassium cyanide for mouse CuZn-superoxide dismutase was determined (Ksub(i) = 6.5 μmol dm -3 ). (author)

  16. A first-line antiretroviral therapy-resistant HIV patient with rhinoentomophthoromycosis

    Directory of Open Access Journals (Sweden)

    Rachita Dhurat

    2018-01-01

    Full Text Available The Conidiobolus coronatus-related rhinoentomophthoromycosis in immunocompetent and immunocompromised (HIV negative individuals has been treated successfully with antifungal drugs. However, C. coronatus infections in first-line antiretroviral therapy (ART-resistant (HIV infected individuals particularly with rhinoentomophthoromycosis have not been reported previously. Here, we describe a case of itraconazole non-responding rhinoentomophthoromycosis in an HIV-infected patient with first-line antiretroviral (ART drug resistance which was successfully managed through systematic diagnostic and therapeutic approaches in dermatologic setting. A 32-year-old HIV-1-infected man presented with painless swelling, nasal redness and respiratory difficulty. The patient was receiving first-line ART and had a history of traumatic injury before the onset of nasopharyngeal manifestations. The patient's previous history included oral candidiasis and pulmonary tuberculosis.

  17. Behavior of grape breeding lines with distinct resistance alleles to downy mildew (Plasmopara viticola

    Directory of Open Access Journals (Sweden)

    Fernando D. Sánchez-Mora

    2017-04-01

    Full Text Available Downy mildew (Plasmopara viticola is the main grapevine disease in humid regions. In the present investigation, marker-assisted selection (MAS was used to develop grapevine lines homozygous in loci Rpv1 and Rpv3 for resistance against P. viticola. The experimental populations UFSC-2013-1 (n = 420 and UFSC-2013-2 (n = 237 were obtained by self-pollination of two F1 full-sib plants, originated from a cross between two distinct breeding lines containing the downy mildew resistance loci Rpv1 and Rpv3 in heterozygosity. The two experimental populations were genotyped with four microsatellite markers flanking the two downy mildew resistance loci. Among 637 genotyped plants, 300 (48.2% were homozygous for at least one resistance locus and 10 (1.57% were homozygous for both Rpv1 and Rpv3 loci. These 10 plants challenged with P. viticola inoculum showed a clearly enhanced level of resistance. These plants have a great potential as resistance donors in grapevine breeding.

  18. Resistive effects on line-tied magnetohydrodynamic modes in cylindrical geometry

    International Nuclear Information System (INIS)

    Delzanno, Gian Luca; Evstatiev, E. G.; Finn, John M.

    2007-01-01

    An investigation of the effect of resistivity on the linear stability of line-tied magnetohydrodynamic (MHD) modes is presented in cylindrical geometry, based on the method recently developed in the paper by Evstatiev et al. [Phys. Plasmas 13, 072902 (2006)]. The method uses an expansion of the full solution of the problem in one-dimensional radial eigenfunctions. This method is applied to study sausage modes (m=0, m being the poloidal wavenumber), kink modes (m=1), and m=2 modes. All these modes can be resistively unstable. It is found that m≠0 modes can be unstable below the ideal MHD threshold due to resistive diffusion of the field lines, with growth rates proportional to resistivity. For these resistive modes, there is no indication of tearing, i.e., current sheets or boundary layers due to ideal MHD singularities. That is, resistivity acts globally on the whole plasma column and not in layers. Modes with m=0, on the other hand, can exist as tearing modes if the equilibrium axial magnetic field reverses sign within the plasma

  19. Second line drug susceptibility testing to inform the treatment of rifampin-resistant tuberculosis: a quantitative perspective

    Directory of Open Access Journals (Sweden)

    Emily A. Kendall

    2017-03-01

    Full Text Available Treatment failure and resistance amplification are common among patients with rifampin-resistant tuberculosis (TB. Drug susceptibility testing (DST for second-line drugs is recommended for these patients, but logistical difficulties have impeded widespread implementation of second-line DST in many settings. To provide a quantitative perspective on the decision to scale up second-line DST, we synthesize literature on the prevalence of second-line drug resistance, the expected clinical and epidemiologic benefits of using second-line DST to ensure that patients with rifampin-resistant TB receive effective regimens, and the costs of implementing (or not implementing second-line DST for all individuals diagnosed with rifampin-resistant TB. We conclude that, in most settings, second-line DST could substantially improve treatment outcomes for patients with rifampin-resistant TB, reduce transmission of drug-resistant TB, prevent amplification of drug resistance, and be affordable or even cost-saving. Given the large investment made in each patient treated for rifampin-resistant TB, these payoffs would come at relatively small incremental cost. These anticipated benefits likely justify addressing the real challenges faced in implementing second-line DST in most high-burden settings.

  20. Parallel evolution under chemotherapy pressure in 29 breast cancer cell lines results in dissimilar mechanisms of resistance.

    Directory of Open Access Journals (Sweden)

    Bálint Tegze

    Full Text Available BACKGROUND: Developing chemotherapy resistant cell lines can help to identify markers of resistance. Instead of using a panel of highly heterogeneous cell lines, we assumed that truly robust and convergent pattern of resistance can be identified in multiple parallel engineered derivatives of only a few parental cell lines. METHODS: Parallel cell populations were initiated for two breast cancer cell lines (MDA-MB-231 and MCF-7 and these were treated independently for 18 months with doxorubicin or paclitaxel. IC50 values against 4 chemotherapy agents were determined to measure cross-resistance. Chromosomal instability and karyotypic changes were determined by cytogenetics. TaqMan RT-PCR measurements were performed for resistance-candidate genes. Pgp activity was measured by FACS. RESULTS: All together 16 doxorubicin- and 13 paclitaxel-treated cell lines were developed showing 2-46 fold and 3-28 fold increase in resistance, respectively. The RT-PCR and FACS analyses confirmed changes in tubulin isofom composition, TOP2A and MVP expression and activity of transport pumps (ABCB1, ABCG2. Cytogenetics showed less chromosomes but more structural aberrations in the resistant cells. CONCLUSION: We surpassed previous studies by parallel developing a massive number of cell lines to investigate chemoresistance. While the heterogeneity caused evolution of multiple resistant clones with different resistance characteristics, the activation of only a few mechanisms were sufficient in one cell line to achieve resistance.

  1. Field screening of experimental corn hybrids and inbred lines for multiple ear-feeding insect resistance.

    Science.gov (United States)

    Ni, Xinzhi; Xu, Wenwei; Krakowsky, Matthew D; Buntin, G David; Brown, Steve L; Lee, R Dewey; Coy, Anton E

    2007-10-01

    Identifying and using native insect resistance genes is the core of integrated pest management. In this study, 10 experimental corn, Zea mays L., hybrids and 10 inbred lines were screened for resistance to major ear-feeding insects in the southeastern Coastal Plain region of the United States during 2004 and 2005. Ear-feeding insect damage was assessed at harvest by visual damage rating for the corn earworm, Helicoverpa zea (Boddie), and by the percentage of kernels damaged by the maize weevil, Sitophilus zeamais Motschulsky, and stink bugs [combination of Euschistus servus (Say) and southern green stink bug, Nezara viridula (L.)]. Among the eight inbred lines and two control populations examined, C3S1B73-5b was resistant to corn earworm, maize weevil, and stink bugs. In contrast, C3S1B73-4 was resistant to corn earworm and stink bugs, but not to maize weevil. In a similar manner, the corn hybrid S1W*CML343 was resistant to all three ear-feeding insects, whereas hybrid C3S1B73-3*Tx205 was resistant to corn earworm and maize weevil in both growing seasons, but susceptible to stink bugs in 2005. The silk-feeding bioassay showed that corn earworm developed better on corn silk than did fall armyworm. Among all phenotypic traits examined (i.e., corn ear size, husk extension, and husk tightness), only corn ear size was negatively correlated to corn earworm damage in the inbred lines examined, whereas only husk extension (i.e., coverage) was negatively correlated to both corn earworm and maize weevil damage on the experimental hybrids examined. Such information could be used to establish a baseline for developing agronomically elite corn germplasm that confers multiple ear-feeding insect resistance.

  2. Radiation response of drug-resistant variants of a human breast cancer cell line

    International Nuclear Information System (INIS)

    Lehnert, S.; Greene, D.; Batist, G.

    1989-01-01

    The radiation response of drug-resistant variants of the human tumor breast cancer cell line MCF-7 has been investigated. Two sublines, one resistant to adriamycin (ADRR) and the other to melphalan (MLNR), have been selected by exposure to stepwise increasing concentrations of the respective drugs. ADRR cells are 200-fold resistant to adriamycin and cross-resistant to a number of other drugs and are characterized by the presence of elevated levels of selenium-dependent glutathione peroxidase and glutathione-S-transferase. MLNR cells are fourfold resistant to melphalan and cross-resistant to some other drugs. The only mechanism of drug resistance established for MLNR cells to date is an enhancement of DNA excision repair processes. While the spectrum of drug resistance and the underlying mechanisms differ for the two sublines, their response to radiation is qualitatively similar. Radiation survival curves for ADRR and MLNR cells differ from that for wild-type cells in a complex manner with, for the linear-quadratic model, a decrease in the size of alpha and an increase in the size of beta. There is a concomitant decrease in the size of the alpha/beta ratio which is greater for ADRR cells than for MLNR cells. Analysis of results using the multitarget model gave values of D0 of 1.48, 1.43, and 1.67 Gy for MCF-7 cells are not a consequence of cell kinetic differences between these sublines. Results of split-dose experiments indicated that for both drug-resistant sublines the extent of sublethal damage repair reflected the width of the shoulder on the single-dose survival curve. For MCF-7 cells in the stationary phase of growth, the drug-resistant sublines did not show cross-resistance to radiation; however, delayed subculture following irradiation of stationary-phase cultures increased survival to a greater extent for ADRR and MLNR cells than for wild-type cells

  3. Application of cotton as a solid phase extraction sorbent for on-line preconcentration of copper in water samples prior to inductively coupled plasma optical emission spectrometry determination.

    Science.gov (United States)

    Faraji, Mohammad; Yamini, Yadollah; Shariati, Shahab

    2009-07-30

    Copper, as a heavy metal, is toxic for many biological systems. Thus, the determination of trace amounts of copper in environmental samples is of great importance. In the present work, a new method was developed for the determination of trace amounts of copper in water samples. The method is based on the formation of ternary Cu(II)-CAS-CTAB ion-pair and adsorption of it into a mini-column packed with cotton prior applying inductively coupled plasma optical emission spectrometry (ICP-OES). The experimental parameters that affected the extraction efficiency of the method such as pH, flow rate and volume of the sample solution, concentration of chromazurol S (CAS) and cethyltrimethylammonium bromide (CTAB) as well as type and concentration of eluent were investigated and optimized. The ion-pair (Cu(II)-CAS-CTAB) was quantitatively retained on the cotton under the optimum conditions, then eluted completely using a solution of 25% (v/v) 1-propanol in 0.5 mol L(-1) HNO(3) and directly introduced into the nebulizer of the ICP-OES. The detection limit (DL) of the method for copper was 40 ng L(-1) (V(sample)=100mL) and the relative standard deviation (R.S.D.) for the determination of copper at 10 microg L(-1) level was found to be 1.3%. The method was successfully applied to determine the trace amounts of copper in tap water, deep well water, seawater and two different mineral waters, and suitable recoveries were obtained (92-106%).

  4. Mutant lines of currant tomato, valuable germplasm with multiple disease resistance

    International Nuclear Information System (INIS)

    Govorova, G.F.; Khrustaleva, V.V.; Shcherbakov, V.K.

    1987-01-01

    Studies were carried out for two years on eight mutant lines of currant tomato at the Krymsk Experimental Breeding Station of the N.I. Vavilov All-Union Scientific Research Institute of Plant-Growing (VIR). The station is situated in an area of commercial field tomato growing (Krasnodar region). The mutant lines of currant tomato (VIR specimen No. k-4053) were obtained through chronic gamma-irradiation. A disease resistance evaluation of the mutants was carried out for Verticillium wilt (Verticillium albo-atrum Rein. and Berth.), for black bacterial spotting (Xanthomonas vesicatoria Dows.), for tobacco mosaic virus Nicotiana 1 Smith), for streak virus (Nicotiana 1), for the combination TMV with X and Y potato viruses, for cucumber virus (Cucumis 1), and also for top rot. Fifty plants of each mutant line were evaluated and checks were made three times in each season. A comparison of the currant tomato mutants with the standard tomato varieties demonstrates the better resistance shown by the mutant germplasm to the main pathogens. The degree to which some currant tomato mutants were affected by Verticillium was lower than that of the most VerticiIlium-resistant samples of tomato evaluated between 1975 and 1981. The mutants of currant tomato should therefore be of interest as germplasm in breeding tomatoes for improved multiple disease resistance

  5. Stability of rust resistance and yield potential of some icarda bread wheat lines in Pakistan

    International Nuclear Information System (INIS)

    Shah, S.J.A.; Khan, A.J.; Azam, F.; Mirza, J.I.; Atiq-ur-Rehman

    2003-01-01

    Thirty bread wheat lines resistant to Yellow rust (Yr) were selected after careful screening from two ICARDA nurseries during 1998 - 1999, Rabi season at Nuclear Institute for Food and Agriculture (NIFA), Tarnab, Peshawar under severe disease pressure. In the following crop cycle, these selections were again field evaluated for stability and effectiveness of Yr resistance at multilocations while their yield potential was ascertained at Tarnab in two different trials with Tatara as commercial check. Results revealed that uniformity was found in the potential behavior of 23 lines (77%) in both the cropping seasons against Yr. This included some high yielding (up to 7067 kg/ ha) and low yielding lines (up to 4333 kg / ha) when compared with the check (6089 kg / ha). Yield potential of some high yielding lines with stable Yr resistance should be further evaluated over sites and seasons for wide adaptability, under national uniform testing in order to select and deploy future varieties to combat Yr for acquiring food security in Pakistan.(author)

  6. Resistively detected NMR line shapes in a quasi-one-dimensional electron system

    Science.gov (United States)

    Fauzi, M. H.; Singha, A.; Sahdan, M. F.; Takahashi, M.; Sato, K.; Nagase, K.; Muralidharan, B.; Hirayama, Y.

    2017-06-01

    We observe variation in the resistively detected nuclear magnetic resonance (RDNMR) line shapes in quantum Hall breakdown. The breakdown occurs locally in a gate-defined quantum point contact (QPC) region. Of particular interest is the observation of a dispersive line shape occurring when the bulk two-dimensional electron gas (2DEG) set to νb=2 and the QPC filling factor to the vicinity of νQPC=1 , strikingly resemble the dispersive line shape observed on a 2D quantum Hall state. This previously unobserved line shape in a QPC points to a simultaneous occurrence of two hyperfine-mediated spin flip-flop processes within the QPC. Those events give rise to two different sets of nuclei polarized in the opposite direction and positioned at a separate region with different degrees of electronic spin polarization.

  7. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  8. Effectiveness of the Ty-3 Introgression for Conferring Resistance in Recombinant Inbred Lines of Tomato to Bipartite Begomoviruses in Guatemala

    Science.gov (United States)

    Management of begomovirus-incited diseases on tomatoes in Guatemala continues to be a challenge and there continues to be a need to better understand the genetics of resistance to begomoviruses. In this study, the resistant line, Gh13, was crossed with the susceptible line, HUJ-VF, that lacked the ...

  9. Main agronomic traits and resistance to rice blast of space-induced mutant lines of Zhong-er-ruan-zhan

    International Nuclear Information System (INIS)

    Xiao Wuming; Wang Hui; Liu Yongzhu; Guo Tao; Chen Zhiqiang; Yang Qiyun; Zhu Xiaoyuan

    2012-01-01

    The main agronomic traits and resistance to rice blast of 34 space-induced lines from an elite rice cultivar, Zhong-er-ruan-zhan were evaluated at their SP 4 . The resistance to blast of the mutant lines had been tested by two blast isolates previously. It was found that the mutant lines showed significant difference in plant height, effective panicles, panicle length and grains per panicle etc. from their parent. The range of variation in 1000-grain weight the largest, followed by the seed-setting rate, and that of effective panicles was the least among all the traits. Except for the line Z34, 33 mutant lines had broader resistance spectra than the wild-type based on the test with 38 different blast isolates, and all the 33 lines were also resistant to the panicle blast in the field. The result confirmed that selection for resistant to blast in lower generations was reliable. Taking account of agronomic traits and blast resistance, promising lines with resistance to blast and good agronomic characters could be selected from those mutant lines. Therefore, the elite rice germplasm with enhanced disease resistance can be produced. (authors)

  10. Problems and achievements of cotton (Gossypium Hirsutum L. weeds control

    Directory of Open Access Journals (Sweden)

    T. Barakova

    2017-09-01

    Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.

  11. Patterns of HIV-1 Drug Resistance After First-Line Antiretroviral Therapy (ART) Failure in 6 Sub-Saharan African Countries: Implications for Second-Line ART Strategies

    NARCIS (Netherlands)

    Hamers, Raph L.; Sigaloff, Kim C. E.; Wensing, Annemarie M.; Wallis, Carole L.; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E.; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S.; Rinke de Wit, Tobias F.; Schuurman, Rob; Siwale, M.; Njovu, C.; Labib, M.; Menke, J.; Botes, M. E.; Conradie, F.; Ive, P.; Sanne, I.; Wallis, C. L.; Letsoalo, E.; Stevens, W. S.; Hardman, M.; Wellington, M.; Luthy, R.; Mandaliya, K.; Abdallah, S.; Jao, I.; Dolan, M.; Namayanja, G.; Nakatudde, L.; Nankya, I.; Kiconco, M.; Abwola, M.; Mugyenyi, P.; Osibogun, A.; Akanmu, S.; Schuurman, R.; Wensing, A. M.; Straatsma, E.; Wit, F. W.; Dekker, J.; van Vugt, M.; Lange, J. M.

    2012-01-01

    Background. Human immunodeficiency virus type 1 (HIV-1) drug resistance may limit the benefits of antiretroviral therapy (ART). This cohort study examined patterns of drug-resistance mutations (DRMs) in individuals with virological failure on first-line ART at 13 clinical sites in 6 African

  12. Optical scatterometry system for detecting specific line edge roughness of resist gratings subjected to detector noises

    International Nuclear Information System (INIS)

    Lee, Yen-Min; Li, Jia-Han; Cheng, Hsin-Hung; Wang, Fu-Min; Shen, Yu-Tian; Tsai, Kuen-Yu; Shieh, Jason J; Chen, Alek C

    2014-01-01

    The Fourier scatterometry model was used to measure the ZEP 520A electron beam resist lines with specific line edge roughness (LER). By obtaining the pupils via an objective lens, the angle-resolved diffraction spectrum was collected efficiently without additional mechanical scanning. The concavity of the pupil was considered as the weight function in specimen recognition. A series of white noises was examined in the model, and the tolerant white noise levels for different system numerical apertures (NAs) were reported. Our numerical results show that the scatterometry model of a higher NA can identify a target with a higher white noise level. Moreover, the fabricated ZEP 520A electron beam resist gratings with LER were measured by using our model, and the fitting results were matched with scanning electron microscope measurements. (paper)

  13. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia

    OpenAIRE

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

    2014-01-01

    Introduction: First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods: We investigated patterns and factors associated with multi-NRTI RAMs at first-line failu...

  14. Superoleophobic cotton textiles

    NARCIS (Netherlands)

    Leng, B.; Shao, Z.; With, de G.; Ming, W.

    2009-01-01

    Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we

  15. Cotton trends in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...

  16. The "Cotton Problem"

    OpenAIRE

    Baffes, John

    2005-01-01

    Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...

  17. Phosphoproteome and Transcriptome of RA-Responsive and RA-Resistant Breast Cancer Cell Lines.

    Directory of Open Access Journals (Sweden)

    Marilyn Carrier

    Full Text Available Retinoic acid (RA, the main active vitamin A metabolite, controls multiple biological processes such as cell proliferation and differentiation through genomic programs and kinase cascades activation. Due to these properties, RA has proven anti-cancer capacity. Several breast cancer cells respond to the antiproliferative effects of RA, while others are RA-resistant. However, the overall signaling and transcriptional pathways that are altered in such cells have not been elucidated. Here, in a large-scale analysis of the phosphoproteins and in a genome-wide analysis of the RA-regulated genes, we compared two human breast cancer cell lines, a RA-responsive one, the MCF7 cell line, and a RA-resistant one, the BT474 cell line, which depicts several alterations of the "kinome". Using high-resolution nano-LC-LTQ-Orbitrap mass spectrometry associated to phosphopeptide enrichment, we found that several proteins involved in signaling and in transcription, are differentially phosphorylated before and after RA addition. The paradigm of these proteins is the RA receptor α (RARα, which was phosphorylated in MCF7 cells but not in BT474 cells after RA addition. The panel of the RA-regulated genes was also different. Overall our results indicate that RA resistance might correlate with the deregulation of the phosphoproteome with consequences on gene expression.

  18. Resistance to Phytophthora in mutant lines of currant tomato and in their original forms

    International Nuclear Information System (INIS)

    Khrustaleva, V.V.; Shcherbakov, V.K.

    1987-01-01

    Information on the production of currant tomato mutants is contained in a previous report. Evaluation of fruit resistance against Phytophthora infestans (Mont.) de Bary was carried out with pathotypes T 0 and T 1 . For artificial infection we used mainly a culture of T 1 (isolate 275), supplied by the Byelorussian Scientific Research Institute of Potato, Fruit and Vegetable Growing at Samokhvalovich. As inoculum for T 0 , a local population of the potato pathotype from the village of Shebantsevo, Moscow province was used. The standard variety 'Gruntovyj gribovskij 1180' was used as the control. Green fruits were taken from the first or second raceme of 20 plants. They were inoculated by spraying in plastic cuvettes with moist filter paper. The cuvettes were covered with glass and maintained at temperature of 18-20 deg. C. The results were checked 5, 9 and 12 days after inoculation. Under natural conditions, each of the 20 plants was also evaluated. As result, three lines with increased resistance to Phytophthora were selected from the original wild-type of currant tomato. Induced mutant forms were tested in the same way for resistance to Phytophthora. Data is presented from 4 years study. Of 26 mutant lines studied, we identified seven whose fruit displayed a stable and enhanced resistance to Phytophthora under both laboratory and field conditions. With regard to leaf infection of these lines, positive results were not obtained. There appears to be no direct relationship between resistance to Phytophthora of the fruit and the leaves. The mutant lines are of determinate type with early and medium ripening time. The average fruit weight is 5-33 g; in the case of the original specimen, it is only 0.9-1.7 g. The fruits have a pleasant sour-sweet taste and a thick skin. It is noteworthy that the mutant lines selected on the basis of their suitability for cultivation not only showed the resistance selected from the wild-type, but in a number of cases even turned out to

  19. Resistance of some early mutant lines of soybean to rust fungus (Phakospora pachyrhizi Syd)

    International Nuclear Information System (INIS)

    Ratma, Rivaie

    1984-01-01

    A trial for resistance to rust fungus (Phakospora pachyrhizi Syd.) was conducted on 11 early mutant lines of soybean M6 (derived from Orba variety with a dose of 0.4 kGy of Co-60) at Citayam Experimental Station, Bogor, in the wet season of 80/81. Based on IWGSR rating system, soybean mutant lines number M6/40/6 was moderately susceptible to rust fungus (Phakospora pachyrhizi Syd). While 10 other soybean mutant lines M6/40/1, M6/40/2, M6/40/3, M6/40/4, M6/40/5, M6/40/7, M6/40/8, M6/40/9, M6/40/10 and M6/40/11 were susceptible to rust fungus. Significant differences in yield were observed between the early mutant lines M6/40/6 (moderate susceptible), 10 other mutant lines (susceptible) and ringgit variety (susceptible). However, a significant lower yield was produced by those mutant lines compared with the yield of orba variety. (author)

  20. Multidrug resistance and retroviral transduction potential in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Theilade, M D; Gram, G J; Jensen, P B

    1999-01-01

    Multidrug resistance (MDR) remains a major problem in the successful treatment of small cell lung cancer (SCLC). New treatment strategies are needed, such as gene therapy specifically targeting the MDR cells in the tumor. Retroviral LacZ gene-containing vectors that were either pseudotyped...... for the gibbon ape leukemia virus (GALV-1) receptor or had specificity for the amphotropic murine leukemia virus (MLV-A) receptor were used for transduction of five SCLC cell lines differing by a range of MDR mechanisms. Transduction efficiencies in these cell lines were compared by calculating the percentage...... of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...

  1. Estimating the Condition of the Heat Resistant Lining in an Electrical Reduction Furnace

    Directory of Open Access Journals (Sweden)

    Jan G. Waalmann

    1988-01-01

    Full Text Available This paper presents a system for estimating the condition of the heat resistant lining in an electrical reduction furnace for ferrosilicon. The system uses temperature measured with thermocouples placed on the outside of the furnace-pot. These measurements are used together with a mathematical model of the temperature distribution in the lining in a recursive least squares algorithm to estimate the position of 'the transformation front'. The system is part of a monitoring system which is being developed in the AIP-project: 'Condition monitoring of strongly exposed process equipment in thc ferroalloy industry'. The estimator runs on-line, and results arc presented in colour-graphics on a display unit. The goal is to locate the transformation front with an accuracy of +- 5cm.

  2. Quantitative proteomics identifies central players in erlotinib resistance of the non-small cell lung cancer cell line HCC827

    DEFF Research Database (Denmark)

    Jacobsen, Kirstine; Lund, Rikke Raaen; Beck, Hans Christian

    Background: Erlotinib (Tarceva®, Roche) has significantly changed the treatment of non-small cell lung cancer (NSCLC) as 70% of patients show significant tumor regression when treated. However, all patients relapse due to development of acquired resistance, which in 43-50% of cases are caused...... by a secondary mutation (T790M) in EGFR. Importantly, a majority of resistance cases are still unexplained. Our aim is to identify novel resistance mechanisms in erlotinib-resistant subclones of the NSCLC cell line HCC827. Materials & Methods: We established 3 erlotinib-resistant subclones (resistant to 10, 20...... or other EGFR or KRAS mutations, potentiating the identification of novel resistance mechanisms. We identified 2875 cytoplasmic proteins present in all 4 cell lines. Of these 87, 56 and 23 are upregulated >1.5 fold; and 117, 72 and 32 are downregulated >1.5 fold, respectively, in the 3 resistant clones...

  3. [A novel chemo-resistant gene MSX2 discovered by establishment of two pancreatic cancer drug resistant cell lines JF305/CDDP and PANC-1/GEM].

    Science.gov (United States)

    Yuan, W; Sui, C G; Ma, X; Ma, J

    2018-05-23

    Objective: To explore new multidrug resistant genes of pancreatic cancer by establishment and characterization of chemo-resistant cell lines. Methods: The cisplatin-resistant cell line JF305/CDDP and the gemcitabine-resistant cell line PANC-1/GEM were induced by high-dose intermittent treatment. CCK-8 assay was used to detect the 50% inhibiting concentration (IC(50)), drug resistance index (R), cross-resistance, and growth difference of different cells. The changes of cell cycle and migration ability of drug-resistant cells were determined by flow cytometry and transwell assay, respectively. And then real-time fluorescence quantitative PCR was used to detect the expression of multidrug resistance-related genes. Results: The drug resistance indexes of JF305/CDDP and PANC-1/GEM were 15.3 and 27.31, respectively, and there was cross-resistance. Compared with the parental cells, the proliferation rate of JF305/CDDP was decreased by 40% on the fourth day ( P PANC-1 cells upregulated MRP2 level ( P PANC-1/GEM, were successfully established. MSX2 might be a new drug resistance related gene in pancreatic cancer cells by up-regulation of MRP2 expression.

  4. Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance.

    Science.gov (United States)

    Wai, T; Grumet, R

    1995-09-01

    The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

  5. Dictionary of cotton: Picking & ginning

    Science.gov (United States)

    Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

  6. Heterosis and correlation in interspecific and intraspecific hybrids of cotton.

    Science.gov (United States)

    Munir, S; Hussain, S B; Manzoor, H; Quereshi, M K; Zubair, M; Nouman, W; Shehzad, A N; Rasul, S; Manzoor, S A

    2016-06-24

    Interspecific and intraspecific hybrids show varying degrees of heterosis for yield and yield components. Yield-component traits have complex genetic relationships with each other. To determine the relationship of yield-component traits and fiber traits with seed cotton yield, six lines (Bt. CIM-599, CIM-573, MNH-786, CIM-554, BH-167, and GIZA-7) and three test lines (MNH-886, V4, and CIM-557) were crossed in a line x tester mating design. Heterosis was observed for seed cotton yield, fiber traits, and for other yield-component traits. Heterosis in interspecific hybrids for seed cotton yield was more prominent than in intraspecific hybrids. The interspecific hybrid Giza-7 x MNH-886 had the highest heterosis (114.77), while among intraspecific hybrids, CIM-554 x CIM-557 had the highest heterosis (61.29) for seed cotton yield. A major trait contributing to seed cotton yield was bolls/plant followed by boll weight. Correlation studies revealed that bolls/plant, boll weight, lint weight/boll, lint index, seed index, lint/seed, staple length, and staple strength were significantly and positively associated with seed cotton yield. Selection based on boll weight, boll number, lint weight/boll, and lint index will be helpful for improving cotton seed yield.

  7. Selection and evaluation of soybean lines derived from gamma irradiation for rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    In 1979, seeds of 11 soybean cultivars were gamma irradiated with 15 and 30 krad. Treated and control seeds of each cultivar were planted in the rainy season. In the rainy season of 1980, M 3 populations were screened for rust resistance in Nong Hoi Valley and Mae Joe Experiment Station, both in Chiang Main province. The IWGSR rust rating system was used. Based upon the slow growth of rust on soybean plants, 6 and 115 plants were selected from 2,802 control plants and from 28,824 treated plants, respectively. Selected lines were evaluated in Nong Hoi Valley in the rainy season of 1981. Sixteen selections with average good seed yield per plant and low percentage of shrivelled seeds were obtained. Among them, two lines, namely G8586/Line number 81-1-072 and S.J. 4/Line number 81-1-037 gave the higher average seed yield per plant than other lines. They are at present in a preliminary yield trial in Chiang Mai. Chiang Mai. (author)

  8. The identification of new genes related to cisplatin resistance in ovarian adenocarcinoma cell line A2780

    International Nuclear Information System (INIS)

    Solar, P.; Fedorocko, P.; Sytkowski, A.; Hodorova, I.

    2006-01-01

    Ovarian cancer cells are usually sensitive to platinum-based chemotherapy, such as cisplatin (CDDP), initially but typically become resistant to the drug over time. The phenomenon of clinical drug resistance represents a serious problem for successful disease treatment, and the molecular mechanism(s) are not fully understood. In search of novel mechanisms that may lead to the development of CDDP chemoresistance we have applied subtractive hybridization based on the PCR-select cDNA subtraction. In current study we have used subtractive hybridization to identify differentially-expressed genes in CDDP resistant CP70 and C200 cells versus CDDP-sensitive A2780 human ovarian adenocarcinoma cells. We have analyzed 256 randomly selected clones. Subtraction efficiency was determined by dot blot and DNA sequencing. Confirmation of differentially expressed cDNAs was done by virtual northern blot analysis, and 17 genes that were differentially expressed in both CDDP resistant cell lines versus CDDP sensitive A2780 cells were identified. The expression of 10 of these genes was undetectable or detected with low expression in sensitive A2780 cells in comparison to resistant ones. These genes included ARHGDIB, RANBP2, ASPH, PRTFDC1, SSX2IP, MBNL1, DNAJC15, MMP10, TCTE1L and one unidentified sequence. Additional 7 genes that were more highly expressed in resistant CP70 and C200 vs. A2780 cells included ANXA2, USP8, HSPCA, TRA1, CNAP1, ATP2B1 and COX2. Interestingly, multi-drug resistance associated p-glycoprotein (p170) was not detected by the western blot in CDDP resistant CP70 and C200 cells. Our identified genes are involved in diverse processes, such as stress response, chromatin condensation, protection from protein degradation, invasiveness of cells, alterations of Ca 2+ homeostasis and others which may contribute to CDDP resistance of ovarian adenocarcinoma cells. Further characterization of these genes and gene products should yield important insights into the biology of

  9. Quantitative proteomics as a tool to identify resistance mechanisms in erlotinib-resistant subclones of the non-small cell lung cancer cell line HCC827

    DEFF Research Database (Denmark)

    Jacobsen, Kirstine

    , which in 43-50% of cases are caused by a secondary mutation (T790M) in EGFR. Importantly, a majority of resistance cases are still unexplained (Lin & Bivona, 2012). Our aim is to identify novel resistance mechanisms – and potentially new drug targets - in erlotinib-resistant subclones of the NSCLC cell...... of erlotinib, and in biological triplicates on a Q-Exactive mass spectrometer. Only proteins identified with minimum 2 unique peptides and in minimum 2 of 3 replicates were accepted. Results: Importantly, the resistant clones did not acquire the T790M or other EGFR or KRAS mutations, potentiating...... the identification of novel resistance mechanisms. We identified 2875 cytoplasmic proteins present in all 4 cell lines. Of these 87, 56 and 23 are upregulated >1.5 fold; and 117, 72 and 32 are downregulated >1.5 fold, respectively, in the 3 resistant clones compared to the parental cell line. By network analysis, we...

  10. Investigating a signature of temozolomide resistance in GBM cell lines using metabolomics.

    Science.gov (United States)

    St-Coeur, Patrick-Denis; Poitras, Julie J; Cuperlovic-Culf, Miroslava; Touaibia, Mohamed; Morin, Pier

    2015-10-01

    Glioblastoma multiforme (GBM) is the most common form of malignant glioma. Current therapeutic approach to treat this malignancy involves a combination of surgery, radiotherapy and chemotherapy with temozolomide. Numerous mechanisms contributing to inherent and acquired resistance to this chemotherapeutic agent have been identified and can lead to treatment failure. This study undertook a metabolomics-based approach to characterize the metabolic profiles observed in temozolomide-sensitive and temozolomide-resistant GBM cell lines as well as in a small sub-set of primary GBM tumors. This approach was also utilized to explore the metabolic changes modulated upon cell treatment with temozolomide and lomeguatrib, an MGMT inhibitor with temozolomide-sensitizing potential. Metabolites previously explored for their potential role in chemoresistance including glucose, citrate and isocitrate demonstrated elevated levels in temozolomide-resistant GBM cells. In addition, a signature of metabolites comprising alanine, choline, creatine and phosphorylcholine was identified as up-regulated in sensitive GBM cell line across different treatments. These results present the metabolic profiles associated with temozolomide response in selected GBM models and propose interesting leads that could be leveraged for the development of therapeutic or diagnostic tools to impact temozolomide response in GBMs.

  11. Effect of pentoxifylline on P-glycoprotein mediated vincristine resistance of L1210 mouse leukemic cell line

    International Nuclear Information System (INIS)

    Breier, A.; Uhrik, B.; Barancik, M.; Stefankova, Z.; Tribulova, N.

    1994-01-01

    Effect of pentoxifylline (PTX) on vincristine (VCR) resistance of multidrug resistant L1210/VCR mouse leukemic cell line was studied. Reversal effect of PTX (in concentration 50-150 mg dm -3 ) on vincristine resistance, i.e. potentiation of vincristine cytotoxicity on L1210/VCR cells by PTX was found. PTX alone in the above concentration did not exert any significant effect on sensitive or resistant cell lines in the absence of vincristine. Resistance of L1210/VCR cell line was found previously to be accompanied with overexpression of drug transporting P-glycoprotein. Indeed, lower level of 3 H-vincristine accumulation by resistant L1210/VCR cell line in comparison with sensitive L1210 cell line was observed. Accumulation of 3 H-vincristine by L1210/VCR cell line was significantly increased in the presence of PTX. PTX in the same condition did not exert any considerable effect on accumulation of 3 H-vincristine by nonresistant L1210 cells. Observable morphological damage was observed in 1210/VCR cells cultivated in medium containing vincristine (0.2 mg dm -3 ) and pentoxifylline (100 mg dm -3 ) in comparison with the non-damaged cells in the presence of vincristine or pentoxifylline alone. The results obtained indicate that pentoxifylline may be considered as a reversal agent in multidrug resistance. (author)

  12. Insulin receptor internalization defect in an insulin-resistant mouse melanoma cell line

    International Nuclear Information System (INIS)

    Androlewicz, M.J.; Straus, D.S.; Brandenburg, D.F.

    1989-01-01

    Previous studies from this laboratory demonstrated that the PG19 mouse melanoma cell line does not exhibit a biological response to insulin, whereas melanoma x mouse embryo fibroblast hybrids do respond to insulin. To investigate the molecular basis of the insulin resistance of the PG19 melanoma cells, insulin receptors from the insulin-resistant melanoma cells and insulin-sensitive fibroblast x melanoma hybrid cells were analyzed by the technique of photoaffinity labeling using the photoprobe 125 I-NAPA-DP-insulin. Photolabeled insulin receptors from the two cell types have identical molecular weights as determined by SDS gel electrophoresis under reducing and nonreducing conditions, indicating that the receptors on the two cell lines are structurally similar. Insulin receptor internalization studies revealed that the hybrid cells internalize receptors to a high degree at 37 degree C, whereas the melanoma cells internalize receptors to a very low degree or not at all. The correlation between ability to internalize insulin receptors and sensitivity to insulin action in this system suggests that uptake of the insulin-receptor complex may be required for insulin action in these cells. Insulin receptors from the two cell lines autophosphorylate in a similar insulin-dependent manner both in vitro and in intact cells, indicating that insulin receptors on the melanoma and hybrid cells have functional tyrosine protein kinase activity. Therefore, the block in insulin action in the PG19 melanoma cells appears to reside at a step beyond insulin-stimulated receptor autophosphorylation

  13. Transepithelial resistance and claudin expression in trout RTgill-W1 cell line

    DEFF Research Database (Denmark)

    T. Trubitt, Rebecca; Rabeneck, D. Brett; Bujak, Joanna

    2015-01-01

    In the present study, we examined the trout gill cell line RTgill-W1 as a possible tool for in vitro investigation of epithelial gill function in fish. After seeding in transwells, transepithelial resistance (TER) increased until reaching a plateau after 1–2 days (20–80 Ω⋅cm2), which was then mai......In the present study, we examined the trout gill cell line RTgill-W1 as a possible tool for in vitro investigation of epithelial gill function in fish. After seeding in transwells, transepithelial resistance (TER) increased until reaching a plateau after 1–2 days (20–80 Ω⋅cm2), which...... was then maintained for more than 6 days. Tetrabromocinnamic acid, a known stimulator of TER via casein kinase II inhibition, elevated TER in the cell line to 125% of control values after 2 and 6 h. Treatment with ethylenediaminetetraacetic acid induced a decrease in TER to b15% of pre-treatment level. Cortisol...... detected Cldn-10e and Cldn-30 immunoreactive proteins of expected molecular weight in samples from rainbow trout gills but not from RTgill-W1 cultures, possibly due to low expression levels. Collectively, these results show that the RTgill-W1 cell layers have tight junctions between cells, are sensitive...

  14. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. [The role of Cd-binding proteins and phytochelatins in the formation of cadmium resistance in Nicotiana plumbaginifolia cell lines].

    Science.gov (United States)

    Fenik, S I; Solodushko, V G; Kaliniak, T B; Blium, Ia B

    2007-01-01

    Nicotiana plumbaginifolia callus lines with the equal resistance to cadmium have been produced under different selective conditions--either without inhibition of the phytochelatin synthesis (line Cd-R) or in the presence of the inhibitor butionine sulfoximine (line Cd-Ri). The level of phytochelatin synthesis in the line Cd-R five-fold exceeded the control value and in the line Cd-Ri it was twice as much as in the control. It was shown that in the control line mainly three cadmium-binding proteins are expressed of the molecular weihgts 41, 34 and 19 kD. The common feature of the both resistant lines is the expression of the cadmium-binding proteins of 40, 37 and 19 kD. The resistant lines differ with respect to the synthesis of relatively low-molecular cadmium-binding proteins. The proteins of the molecular weights 12.5, 11.5 and 9 kD are expressed in the line Cd-R, while the proteins of 13 and 10 kD are expressed in the line Cd-Ri. It was supposed that both the phytochelatins and the Cd-binding proteins contribute to the resisitance of N. plumbaginifolia callus lines to cadmium and the lack of the phytochelatins can be equilibrated by the changes in the low-molecular Cd-binding protein synthesis.

  16. Imidacloprid does not induce Cyp genes involved in insecticide resistance of a mutant Drosophila melanogaster line.

    Science.gov (United States)

    Kalajdzic, Predrag; Markaki, Maria; Oehler, Stefan; Savakis, Charalambos

    2013-10-01

    Certain xenobiotics have the capacity to induce the expression of genes involved in various biological phenomena, including insecticide resistance. The induction potential of different chemicals, among them different insecticides, has been documented for a number of insect species. In this study, we have analyzed the induction potential of Imidacloprid, a widely used member of the neonicotinoid insecticide family. Genes Cyp6g1 and Cyp6a2, known to be involved in the resistance of mutant Drosophila melanogaster line MiT[W⁻]3R2 to Imidacloprid and DDT were included in the analyzed sample. We find that Imidacloprid does not induce expression of the analyzed genes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Life without water: cross-resistance of anhydrobiotic cell line to abiotic stresses

    Science.gov (United States)

    Gusev, Oleg

    2016-07-01

    Anhydrobiosis is an intriguing phenomenon of natural ability of some organisms to resist water loss. The larvae of Polypedilum vanderplanki, the sleeping chironomid is the largest and most complex anhydrobionts known to date. The larvae showed ability to survive variety of abiotic stresses, including outer space environment. Recently cell line (Pv11) derived from the embryonic mass of the chironomid was established. Initially sensitive to desiccation cells, are capable to "induced" anhydrobiosis, when the resistance to desiccation can be developed by pre-treatment of the cells with trehalose followed by quick desiccation. We have further conducted complex analysis of the whole genome transcription response of Pv11 cells to different abiotic stresses, including oxidative stress and irradiation. Comparative analysis showed that the gene set, responsible for formation of desiccation resistance (ARID regions in the genome) is also activated in response to other types of stresses and likely to contribute to general enhancing of the resistance of the cells to harsh environment. We have further demonstrated that the cells are able to protect recombinant proteins from harmful effect of desiccation

  18. Comparison of transcriptome profiles by Fusarium oxysporum inoculation between Fusarium yellows resistant and susceptible lines in Brassica rapa L.

    Science.gov (United States)

    Miyaji, Naomi; Shimizu, Motoki; Miyazaki, Junji; Osabe, Kenji; Sato, Maho; Ebe, Yusuke; Takada, Satoko; Kaji, Makoto; Dennis, Elizabeth S; Fujimoto, Ryo; Okazaki, Keiichi

    2017-12-01

    Resistant and susceptible lines in Brassica rapa have different immune responses against Fusarium oxysporum inoculation. Fusarium yellows caused by Fusarium oxysporum f. sp. conglutinans (Foc) is an important disease of Brassicaceae; however, the mechanism of how host plants respond to Foc is still unknown. By comparing with and without Foc inoculation in both resistant and susceptible lines of Chinese cabbage (Brassica rapa var. pekinensis), we identified differentially expressed genes (DEGs) between the bulked inoculated (6, 12, 24, and 72 h after inoculation (HAI)) and non-inoculated samples. Most of the DEGs were up-regulated by Foc inoculation. Quantitative real-time RT-PCR showed that most up-regulated genes increased their expression levels from 24 HAI. An independent transcriptome analysis at 24 and 72 HAI was performed in resistant and susceptible lines. GO analysis using up-regulated genes at 24 HAI indicated that Foc inoculation activated systemic acquired resistance (SAR) in resistant lines and tryptophan biosynthetic process and responses to chitin and ethylene in susceptible lines. By contrast, GO analysis using up-regulated genes at 72 HAI showed the overrepresentation of some categories for the defense response in susceptible lines but not in the resistant lines. We also compared DEGs between B. rapa and Arabidopsis thaliana after F. oxysporum inoculation at the same time point, and identified genes related to defense response that were up-regulated in the resistant lines of Chinese cabbage and A. thaliana. Particular genes that changed expression levels overlapped between the two species, suggesting that they are candidates for genes involved in the resistance mechanisms against F. oxysporum.

  19. Long-term persistence of acquired resistance to 5-fluorouracil in the colon cancer cell line SW620

    Energy Technology Data Exchange (ETDEWEB)

    Tentes, I.K., E-mail: itentes@med.duth.gr [Department of Biochemistry, Medical School, Democritus University of Thrace, 6th km Alexandroupolis-Komotini (Dragana), 68100 Alexandroupolis (Greece); Schmidt, W.M. [Center for Anatomy and Cell Biology, Waehringer Strasse 13, 1090 Vienna (Austria); Krupitza, G. [Institute of Clinical Pathology, Medical University of Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria); Steger, G.G.; Mikulits, W. [Department of Medicine I, Medical University of Vienna, Medical University of Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria); Kortsaris, A. [Department of Biochemistry, Medical School, Democritus University of Thrace, 6th km Alexandroupolis-Komotini (Dragana), 68100 Alexandroupolis (Greece); Mader, R.M. [Department of Medicine I, Medical University of Vienna, Medical University of Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria)

    2010-11-15

    Treatment resistance to antineoplastic drugs represents a major clinical problem. Here, we investigated the long-term stability of acquired resistance to 5-fluorouracil (FU) in an in vitro colon cancer model, using four sub-clones characterised by increasing FU-resistance derived from the cell line SW620. The resistance phenotype was preserved after FU withdrawal for 15 weeks ({approx} 100 cell divisions) independent of the established level of drug resistance and of epigenetic silencing. Remarkably, resistant clones tolerated serum deprivation, adopted a CD133{sup +} CD44{sup -} phenotype, and further exhibited loss of membrane-bound E-cadherin together with predominant nuclear {beta}-catenin localisation. Thus, we provide evidence for a long-term memory of acquired drug resistance, driven by multiple cellular strategies (epithelial-mesenchymal transition and selective propagation of CD133{sup +} cells). These resistance phenomena, in turn, accentuate the malignant phenotype.

  20. Celecoxib decreases growth and angiogenesis and promotes apoptosis in a tumor cell line resistant to chemotherapy

    Directory of Open Access Journals (Sweden)

    Carlos Rosas

    2014-01-01

    Full Text Available BACKGROUND: During the last few years it has been shown in several laboratories that Celecoxib (Cx, a non-steroidal anti-inflammatory agent (NSAID normally used for pain and arthritis, mediates antitumor and antiangiogenic effects. However, the effects of this drug on a tumor cell line resistant to chemotherapeutical drugs used in cancer have not been described. Herein we evaluate the angiogenic and antitumor effects of Cx in the development of a drug-resistant mammary adenocarcinoma tumor (TA3-MTXR. RESULTS: Cx reduces angiogenesis in the chick embryonic chorioallantoic membrane assay (CAM, inhibits the growth and microvascular density of the murine TA3-MTXR tumor, reduces microvascular density of tumor metastases, promotes apoptosis and reduces vascular endothelial growth factor (VEGF production and cell proliferation in the tumor. CONCLUSION: The antiangiogenic and antitumor Cx effects correlate with its activity on other tumor cell lines, suggesting that Prostaglandins (PGs and VEGF production are involved. These results open the possibility of using Celecoxib combined with other experimental therapies, ideally aiming to get synergic effects.

  1. Enhancing wear resistance of working bodies of grinder through lining crushed material

    Science.gov (United States)

    Romanovich, A. A.; Annenko, D. M.; Romanovich, M. A.; Apukhtina, I. V.

    2018-03-01

    The article presents the analysis of directions of increasing wear resistance of working surfaces of rolls. A technical solution developed at the level of the invention is proposed, which is simple to implement in production conditions and which makes it possible to protect the roll surface from heavy wear due to surfacing of wear-resistant mesh material, cells of which are filling with grinding material in the process of work. Retaining them enables one to protect the roll surface from wear. The paper dwells on conditions of pressing materials in cells of eccentric rolls on the working surface with a grid of rectangular shape. The paper presents an equation for calculation of the cell dimension that provides the lining of the working surface by a mill material with respect to its properties. The article presents results of comparative studies on the grinding process of a press roller grinder (PRG) between rolls with and without a fusion-bonded mesh. It is clarified that the lining of rolls working surface slightly reduces the quality of the grinding, since the material thickness in the cell is small and has a finely divided and compacted structure with high strength.

  2. WNT4 mediates estrogen receptor signaling and endocrine resistance in invasive lobular carcinoma cell lines.

    Science.gov (United States)

    Sikora, Matthew J; Jacobsen, Britta M; Levine, Kevin; Chen, Jian; Davidson, Nancy E; Lee, Adrian V; Alexander, Caroline M; Oesterreich, Steffi

    2016-09-20

    Invasive lobular carcinoma (ILC) of the breast typically presents with clinical biomarkers consistent with a favorable response to endocrine therapies, and over 90 % of ILC cases express the estrogen receptor (ER). However, a subset of ILC cases may be resistant to endocrine therapies, suggesting that ER biology is unique in ILC. Using ILC cell lines, we previously demonstrated that ER regulates a distinct gene expression program in ILC cells, and we hypothesized that these ER-driven pathways modulate the endocrine response in ILC. One potential novel pathway is via the Wnt ligand WNT4, a critical signaling molecule in mammary gland development regulated by the progesterone receptor. The ILC cell lines MDA-MB-134-VI, SUM44PE, and BCK4 were used to assess WNT4 gene expression and regulation, as well as the role of WNT4 in estrogen-regulated proliferation. To assess these mechanisms in the context of endocrine resistance, we developed novel ILC endocrine-resistant long-term estrogen-deprived (ILC-LTED) models. ILC and ILC-LTED cell lines were used to identify upstream regulators and downstream signaling effectors of WNT4 signaling. ILC cells co-opted WNT4 signaling by placing it under direct ER control. We observed that ER regulation of WNT4 correlated with use of an ER binding site at the WNT4 locus, specifically in ILC cells. Further, WNT4 was required for endocrine response in ILC cells, as WNT4 knockdown blocked estrogen-induced proliferation. ILC-LTED cells remained dependent on WNT4 for proliferation, by either maintaining ER function and WNT4 regulation or uncoupling WNT4 from ER and upregulating WNT4 expression. In the latter case, WNT4 expression was driven by activated nuclear factor kappa-B signaling in ILC-LTED cells. In ILC and ILC-LTED cells, WNT4 led to suppression of CDKN1A/p21, which is critical for ILC cell proliferation. CDKN1A knockdown partially reversed the effects of WNT4 knockdown. WNT4 drives a novel signaling pathway in ILC cells, with a

  3. Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.

    Directory of Open Access Journals (Sweden)

    Yun Chen

    Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

  4. P-glycoprotein inhibition of drug resistant cell lines by nanoparticles.

    Science.gov (United States)

    Singh, Manu Smriti; Lamprecht, Alf

    2016-01-01

    Several pharmaceutical excipients are known for their ability to interact with cell membrane lipids and reverse the phenomenon of multidrug resistance (MDR) in cancer. Interestingly, many excipients act as stabilizers and are key ingredients in a variety of nano-formulations. In this study, representatives of ionic and non-ionic excipients were used as surface active agents in nanoparticle (NP) formulations to utilize their MDR reversing potential. In-vitro assays were performed to elucidate particle-cell interaction and accumulation of P-glycoprotein (P-gp) substrates-rhodamine-123 and calcein AM, in highly drug resistant glioma cell lines. Chemosensitization achieved using NPs and their equivalent dose of free excipients was assessed with the co-administered anti-cancer drug doxorubicin. Among the excipients used, non-ionic surfactant, Cremophor® EL, and cationic surfactant, cetyltrimethylammonuium bromide (CTAB), demonstrated highest P-gp modulatory activity in both free solution form (up to 7-fold lower IC50) and as a formulation (up to 4.7-fold lower IC50) as compared to doxorubicin treatment alone. Solutol® HS15 and Tween® 80 exhibited considerable chemosensitization as free solution but not when incorporated into a formulation. Sodium dodecyl sulphate (SDS)-based nanocarriers resulted in slightly improved cytotoxicity. Overall, the results highlight and envisage the usage of excipient in nano-formulations in a bid to improve chemosensitization of drug resistant cancer cells towards anti-cancer drugs.

  5. Molecular characterization of irinotecan (SN-38) resistant human breast cancer cell lines

    DEFF Research Database (Denmark)

    Jandu, Haatisha; Aluzaite, Kristina; Fogh, Louise

    2016-01-01

    Background: Studies in taxane and/or anthracycline refractory metastatic breast cancer (mBC) patients have shown approximately 30 % response rates to irinotecan. Hence, a significant number of patients will experience irinotecan-induced side effects without obtaining any benefit. The aim of this ......Background: Studies in taxane and/or anthracycline refractory metastatic breast cancer (mBC) patients have shown approximately 30 % response rates to irinotecan. Hence, a significant number of patients will experience irinotecan-induced side effects without obtaining any benefit. The aim...... or an initial high dose of SN-38 (the active metabolite of irinotecan), respectively. The resistant cell lines were analyzed for cross-resistance to other anti-cancer drugs, global gene expression, growth rates, TOP1 and TOP2A gene copy numbers and protein expression, and inhibition of the breast cancer...... of the BCRP in breast cancer patients scheduled for irinotecan treatment. Moreover, LMP400 should be tested in a clinical setting in breast cancer patients with resistance to irinotecan....

  6. Effects of extra virgin olive oil phenols on HL60 cell lines sensitive and resistant to anthracyclines

    Directory of Open Access Journals (Sweden)

    M. Crescimanno

    2009-01-01

    Full Text Available The aim of our study was to evaluate the capability of a crude extract of phenols from extra virgin olive oil of Moraiolo cultivar to induce apoptosis and/or differentiation in sensitive and resistant HL60 cell lines to anticancer drugs (Typical Multidrug Resistance. Our data highlight that the crude extract is able to induce apoptosis on both sensitive and resistant cells, whereas the exposure to a number of anticancer drugs does not induce apoptosis in resistant cells. In differentiation experiments we investigated the capability of crude extract of phenols to induce the expression of CD11 granulocytic or CD14 monocytic cell surface antigen in sensitive and resistant HL60 cell lines. At IC50 dose level (17 ug/ml and 32 ug/ml respectively for sensitive and resistant cell lines, the crude extract induced differentiation associated with the expression of CD14 monocytic cell lines but not that of CD11 granulocityc cell surface antigen. Further investigations are in progress to better clarify the mechanism by which olive oil phenols induce diffentiation on this cell line.

  7. Density-independent population projection trajectories of chromosome-substituted lines resistant and susceptible to organophosphate insecticides in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Miyo Takahiro

    2004-11-01

    Full Text Available Abstract Background Seasonal fluctuations in susceptibility to organophosphate insecticides were observed in the Katsunuma population of Drosophila melanogaster for two consecutive years; susceptibility to three organophosphates tended to increase in the fall. To examine the hypothesis that variation in fitness among resistant and susceptible genotypes could trigger the change of genetic constitution within the fall population, we investigated density-independent population projection trajectories starting from single adult females with characteristics of chromosome-substituted lines resistant and susceptible to the three organophosphates. Results Density-independent population projection trajectories, expressed as the ratios of the number of each chromosome-substituted line to that of line SSS, for which all chromosomes were derived from the susceptible line, showed significant declines in numbers with time for all the resistant chromosome-substituted lines. Conclusion The declining tendency in the density-independent population projection trajectories of the resistant chromosome-substituted lines could explain the simultaneous decline in the levels of resistance to the three organophosphates, observed in the Katsunuma population in the fall.

  8. Response of sensitive human ataxia and resistant T-1 cell lines to accelerated heavy ions

    International Nuclear Information System (INIS)

    Tobias, C.A.; Blakely, E.A.; Chang, P.Y.; Lommel, L.; Roots, R.

    1983-07-01

    The radiation dose responses of fibroblast from a patient with Ataxia telangiectasis (AT-2SF) and an established line of human T-1 cells were studied. Nearly monoenergetic accelerated neon and argon ions were used at the Berkeley Bevalac with various residual range values. The LET of the particles varied from 30 keV/μm to over 1000 keV/μm. All Ataxia survival curves were exponential functions of the dose. Their radiosensitivity reached peak values at 100 to 200 keV/μm. Human T-1 cells have effective sublethal damage repair as has been evidenced by split dose experiments, and they are much more resistant to low LET than to high LET radiation. The repair-misrepair model has been used to interpret these results. We have obtained mathematical expressions that describe the cross sections and inactivation coefficients for both human cell lines as a function of the LET and the type of particle used. The results suggest either that high-LET particles induce a greater number of radiolesions per track or that heavy-ions at high LET induce lesions that kill cells more effectively and that are different from those produced at low LET. We assume that the lesions induced in T-1 and Ataxia cells are qualitatively similar and that each cell line attempts to repair these lesions. The result in most irradiated Ataxia cells, however, is either lethal misrepair or incomplete repair leading to cell death. 63 references, 10 figures, 1 table

  9. The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

    Directory of Open Access Journals (Sweden)

    Muhammad Sajjad Ali

    2013-07-01

    Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

  10. Breast cancer resistance protein is localized at the plasma membrane in mitoxantrone- and topotecan-resistant cell lines

    NARCIS (Netherlands)

    Scheffer, GL; Maliepaard, M; Pijnenborg, ACLM; van Gastelen, MA; Schroeijers, AB; Allen, JD; Ross, DD; van der Valk, P; Dalton, WS; Schellens, JHM; Scheper, RJ; de Jong, MC

    2000-01-01

    Tumor cells may display a multidrug resistant phenotype by overexpression of ATP-binding cassette transporters such as multidrug resistance (,MDR1) P-glycoprotein, multidrug resistance protein 1 (MRP1), and breast cancer resistance protein (BCRP). The presence of BCRP has thus far been reported

  11. Characterization of HIV-1 antiretroviral drug resistance after second-line treatment failure in Mali, a limited-resources setting

    Science.gov (United States)

    Maiga, Almoustapha Issiaka; Fofana, Djeneba Bocar; Cisse, Mamadou; Diallo, Fodié; Maiga, Moussa Youssoufa; Traore, Hamar Alassane; Maiga, Issouf Alassane; Sylla, Aliou; Fofana, Dionke; Taiwo, Babafemi; Murphy, Robert; Katlama, Christine; Tounkara, Anatole; Calvez, Vincent; Marcelin, Anne-Geneviève

    2012-01-01

    Objectives We describe the outcomes of second-line drug resistance profiles and predict the efficacy of drugs for third-line therapy in patients monitored without the benefit of plasma HIV-1 RNA viral load (VL) or resistance testing. Methods We recruited 106 HIV-1-infected patients after second-line treatment failure in Mali. VL was determined by the Abbott RealTime system and the resistance by the ViroSeq HIV-1 genotyping system. The resistance testing was interpreted using the latest version of the Stanford algorithm. Results Among the 106 patients, 93 had isolates successfully sequenced. The median age, VL and CD4 cells were respectively 35 years, 72 000 copies/mL and 146 cells/mm3. Patients were exposed to a median of 4 years of treatment and to six antiretrovirals. We found 20% of wild-type viruses. Resistance to etravirine was noted in 38%, to lopinavir in 25% and to darunavir in 12%. The duration of prior nucleos(t)ide reverse transcriptase inhibitor exposure was associated with resistance to abacavir (P < 0.0001) and tenofovir (P = 0.0001), and duration of prior protease inhibitor treatment with resistance to lopinavir (P < 0.0001) and darunavir (P = 0.06). Conclusion Long duration of therapy prior to failure was associated with high levels of resistance and is directly related to limited access to VL monitoring and delayed switches to second-line treatment, precluding efficacy of drugs for third-line therapy. This study underlines the need for governments and public health organizations to recommend the use of VL monitoring and also the availability of darunavir and raltegravir for third-line therapies in the context of limited-resource settings. PMID:22888273

  12. Comparison of the multi-drug resistant human hepatocellular carcinoma cell line Bel-7402/ADM model established by three methods

    Directory of Open Access Journals (Sweden)

    Zhong Xingguo

    2010-08-01

    Full Text Available Abstract Background To compare the biological characteristics of three types of human hepatocellular carcinoma multi-drug resistant cell sub-lines Bel-7402/ADM models established by three methods. Methods Established human hepatocellular carcinoma adriamycin (ADM multi-drug resistant cell sub-lines models Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS by three methods of in vitro concentration gradient increased induction, nude mice liver-implanted induction and subcutaneous-implanted induction respectively. Phase contrast microscopy was used to observe the cells and the MTT (methyl thiazolyl tetrazolium method was used to detect drug resistance of the three different sub-lines of cells. Results The three groups of drug resistant cells, Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS generated cross-resistance to ADM and CDDP (cis-Diaminedichloroplatinum, but showed a significant difference in resistance to Bel-7402 IC50 value (P V, 46 h (Bel-7402/ADML, and 45 h (Bel-7402/ADMS. The excretion rates of ADM were significantly increased compared with the parent cell (34.14% line and were 81.06% (Bel-7402/ADMV, 66.56% (Bel-7402/ADML and 61.56% (Bel-7402/ADMS. Expression of P-gp and MRP in the three groups of resistant cells was significantly enhanced (P P > 0.05. Conclusions Stable resistance was involved in the resistant cell line model established by the above three methods. Liver implantation was a good simulation of human hepatocellular and proved to be an ideal model with characteristics similar to human hepatocellular biology and the pharmacokinetics of anticancer drugs.

  13. Cost-effectiveness of HIV drug resistance testing to inform switching to second line antiretroviral therapy in low income settings

    DEFF Research Database (Denmark)

    Phillips, Andrew; Cambiano, Valentina; Nakagawa, Fumiyo

    2014-01-01

    BACKGROUND: To guide future need for cheap resistance tests for use in low income settings, we assessed cost-effectiveness of drug resistance testing as part of monitoring of people on first line ART - with switching from first to second line ART being conditional on NNRTI drug resistance mutations...... being identified. METHODS: An individual level simulation model of HIV transmission, progression and the effect of ART which accounts for adherence and resistance development was used to compare outcomes of various potential monitoring strategies in a typical low income setting in sub-Saharan Africa....... Underlying monitoring strategies considered were based on clinical disease, CD4 count or viral load. Within each we considered a strategy in which no further measures are performed, one with a viral load measure to confirm failure, and one with both a viral load measure and a resistance test. Predicted...

  14. QTL mapping of fruit rot resistance to the plant pathogen Phytophthora capsici in a recombinant inbred line Capsicum annuum population.

    Science.gov (United States)

    Naegele, R P; Ashrafi, H; Hill, T A; Chin-Wo, S Reyes; Van Deynze, A E; Hausbeck, M K

    2014-05-01

    Phytophthora capsici is an important pepper (Capsicum annuum) pathogen causing fruit and root rot, and foliar blight in field and greenhouse production. Previously, an F6 recombinant inbred line population was evaluated for fruit rot susceptibility. Continuous variation among lines and partial and isolate-specific resistance were found. In this study, Phytophthora fruit rot resistance was mapped in the same F6 population between Criollo del Morelos 334 (CM334), a landrace from Mexico, and 'Early Jalapeno' using a high-density genetic map. Isolate-specific resistance was mapped independently in 63 of the lines evaluated and the two parents. Heritability of the resistance for each isolate at 3 and 5 days postinoculation (dpi) was high (h(2) = 0.63 to 0.68 and 0.74 to 0.83, respectively). Significant additive and epistatic quantitative trait loci (QTL) were identified for resistance to isolates OP97 and 13709 (3 and 5 dpi) and 12889 (3 dpi only). Mapping of fruit traits showed potential linkage with few disease resistance QTL. The partial fruit rot resistance from CM334 suggests that this may not be an ideal source for fruit rot resistance in pepper.

  15. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  16. Identification of resistance mechanisms in erlotinib-resistant subclones of the non-small cell lung cancer cell line HCC827 by exome sequencing

    DEFF Research Database (Denmark)

    Jacobsen, Kirstine; Alcaraz, Nicolas; Lund, Rikke Raaen

    the SeqCap EZ Human Exome Library v3.0 kit and whole-exome sequencing of these (100 bp paired-end) were performed on an Illumina HiSeq 2000 platform. Using a recently developed in-house analysis pipeline the sequencing data were analyzed. The analysis pipeline includes quality control using Trim......Background: Erlotinib (Tarceva®, Roche) has significantly changed the treatment of non-small cell lung cancer (NSCLC) as 70% of patients show significant tumor regression upon treatment (Santarpia et. al., 2013). However, all patients relapse due to development of acquired resistance, which...... mutations in erlotinib-resistant subclones of the NSCLC cell line, HCC827. Materials & Methods: We established 3 erlotinib-resistant subclones (resistant to 10, 20, 30 µM erlotinib, respectively). DNA libraries of each subclone and the parental HCC827 cell line were prepared in biological duplicates using...

  17. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  18. The split-cross-bridge resistor for measuring the sheet resistance, linewidth, and line spacing of conducting layers

    Science.gov (United States)

    Buehler, M. G.; Hershey, C. W.

    1986-01-01

    A new test structure was developed for evaluating the line spacing between conductors on the same layer using an electrical measurement technique. This compact structure can also be used to measure the sheet resistance, linewidth, and line pitch of the conducting layer. Using an integrated-circuit fabrication process, this structure was fabricated in diffused polycrystalline silicon and metal layers and measured optically and electrically. For the techniques used, the optical measurements were typically one-quarter micron greater than the electrical measurements. Most electrically measured line pitch values were within 2 percent of the designed value. A small difference between the measured and designed line pitch is used to validate sheet resistance, linewidth, and line spacing values.

  19. Construction of a complete set of alien chromosome addition lines from Gossypium australe in Gossypium hirsutum: morphological, cytological, and genotypic characterization.

    Science.gov (United States)

    Chen, Yu; Wang, Yingying; Wang, Kai; Zhu, Xiefei; Guo, Wangzhen; Zhang, Tianzhen; Zhou, Baoliang

    2014-05-01

    We report the first complete set of alien addition lines of G. hirsutum . The characterized lines can be used to introduce valuable traits from G. australe into cultivated cotton. Gossypium australe is a diploid wild cotton species (2n = 26, GG) native to Australia that possesses valuable characteristics unavailable in the cultivated cotton gene pool, such as delayed pigment gland morphogenesis in the seed and resistances to pests and diseases. However, it is very difficult to directly transfer favorable traits into cultivated cotton through conventional gene recombination due to the absence of pairing and crossover between chromosomes of G. australe and Gossypium hirsutum (2n = 52, AADD). To enhance the transfer of favorable genes from wild species into cultivated cotton, we developed a set of hirsutum-australe monosomic alien chromosome addition lines (MAAL) using a combination of morphological survey, microsatellite marker-assisted selection, and molecular cytogenetic analysis. The amphidiploid (2n = 78, AADDGG) of G. australe and G. hirsutum was consecutively backcrossed with upland cotton to develop alien addition lines of individual G. australe chromosomes in G. hirsutum. From these backcross progeny, we generated the first complete set of chromosome addition lines in cotton; 11 of 13 lines are monosomic additions, and chromosomes 7G(a) and 13G(a) are multiple additions. MAALs of 1G(a) and 11G(a) were the first to be isolated. The chromosome addition lines can be employed as bridges for the transfer of desired genes from G. australe into G. hirsutum, as well as for gene assignment, isolation of chromosome-specific probes, flow sorting and microdissection of chromosome, development of chromosome-specific ''paints'' for fluorochrome-labeled DNA fragments, physical mapping, and selective isolation and mapping of cDNAs for a particular G. australe chromosome.

  20. Introgression of chromosome segments from multiple alien species in wheat breeding lines with wheat streak mosaic virus resistance.

    Science.gov (United States)

    Ali, N; Heslop-Harrison, Js Pat; Ahmad, H; Graybosch, R A; Hein, G L; Schwarzacher, T

    2016-08-01

    Pyramiding of alien-derived Wheat streak mosaic virus (WSMV) resistance and resistance enhancing genes in wheat is a cost-effective and environmentally safe strategy for disease control. PCR-based markers and cytogenetic analysis with genomic in situ hybridisation were applied to identify alien chromatin in four genetically diverse populations of wheat (Triticum aestivum) lines incorporating chromosome segments from Thinopyrum intermedium and Secale cereale (rye). Out of 20 experimental lines, 10 carried Th. intermedium chromatin as T4DL*4Ai#2S translocations, while, unexpectedly, 7 lines were positive for alien chromatin (Th. intermedium or rye) on chromosome 1B. The newly described rye 1RS chromatin, transmitted from early in the pedigree, was associated with enhanced WSMV resistance. Under field conditions, the 1RS chromatin alone showed some resistance, while together with the Th. intermedium 4Ai#2S offered superior resistance to that demonstrated by the known resistant cultivar Mace. Most alien wheat lines carry whole chromosome arms, and it is notable that these lines showed intra-arm recombination within the 1BS arm. The translocation breakpoints between 1BS and alien chromatin fell in three categories: (i) at or near to the centromere, (ii) intercalary between markers UL-Thin5 and Xgwm1130 and (iii) towards the telomere between Xgwm0911 and Xbarc194. Labelled genomic Th. intermedium DNA hybridised to the rye 1RS chromatin under high stringency conditions, indicating the presence of shared tandem repeats among the cereals. The novel small alien fragments may explain the difficulty in developing well-adapted lines carrying Wsm1 despite improved tolerance to the virus. The results will facilitate directed chromosome engineering producing agronomically desirable WSMV-resistant germplasm.

  1. Evaluation of maize inbred lines for resistance to pre-harvest aflatoxin and fumonisin contamination in the field

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2017-06-01

    Full Text Available Two important mycotoxins, aflatoxin and fumonisin, are among the most potent naturally occurring carcinogens, contaminating maize (Zea mays and affecting crop yield and quality. Resistance of maize to pre-harvest mycotoxin contamination, specifically aflatoxin produced by Aspergillus flavus and fumonisin produced by Fusarium verticillioides, is a goal in breeding programs that screen for these important traits with the aim of developing resistant commercial hybrids. We conducted two years of field evaluations on 87 inbred lines originating primarily in China and Mexico and not previously screened for resistance. The objectives of our study were to identify resistant germplasm for breeding purposes and to examine possible relationships between resistances to the two mycotoxins. Aflatoxin and fumonisin were present in samples harvested from all lines in both years. Concentrations of total aflatoxin ranged from 52.00 ± 20.00 to 1524.00 ± 396.00 μg kg−1, while those of fumonisin ranged from 0.60 ± 0.06 to 124.00 ± 19.50 mg kg−1. The inbred lines TUN15, TUN61, TUN37, CY2, and TUN49 showed the lowest aflatoxin accumulation and CN1, GT601, TUN09, TUN61, and MP717 the lowest fumonisin accumulation. TUN61 showed the lowest accumulation of both mycotoxins. This study confirmed previous observations that high levels of aflatoxin can coexist with fumonisin, with 55 maize lines showing a positive correlation coefficient between the concentrations of aflatoxin and fumonisin and 32 lines showing a negative correlation coefficient. These selected lines, particularly TUN61, may provide sources of resistance to mycotoxin contamination in breeding programs. However, the mechanism of resistance in this germplasm remains to be identified. Future research should also address factors that influence the fungus–plant interaction, such as herbivory and environmental stress.

  2. Correlations and Correlated Responses in Upland Cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Echekwu, CA.

    2001-01-01

    Full Text Available Plant breeders must be concerned with the total array of economic characters in their efforts to develop a crop variety acceptable to farmers. Their selection endeavours must therefore take into consideration how changes in one trait affect, simultaneously changes in other economic attributes. The importance of correlations and correlated responses is therefore self evident in plant breeding endeavours. In this study F3 progenies from a cross between two cotton lines SAMCOT-9 x Y422 were evaluated for two years and performance data were used to obtain correlations between nine agronomic and fibre quality traits in upland cotton. The results indicated that plant helght was significantly and positively correlated with seed cotton yield, number of sympodial and monopodial branches, seed index, fibre length and micronaire index. Positive and significant correlations were also obtained between : seed cotton yield, tint percent and fibre strength and fibre length. Significant negative correlations were obtained between : plant height and lint percent ; number of monopodial branches, sympodial branches and lint percent ; fibre length, fibre strength and micronaire index. The correlated responses in the other eight traits when selection was practiced for seed cotton yield in the present study shows that it might be more profitable to practice direct selection for seed cotton yield compared to selecting for seed cotton yield through any of the other traits.

  3. Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

    International Nuclear Information System (INIS)

    Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

    2017-01-01

    Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

  4. Biotransformation of the Mycotoxin Deoxynivalenol in Fusarium Resistant and Susceptible Near Isogenic Wheat Lines

    Science.gov (United States)

    Kluger, Bernhard; Bueschl, Christoph; Lemmens, Marc; Michlmayr, Herbert; Malachova, Alexandra; Koutnik, Andrea; Maloku, Imer; Berthiller, Franz; Adam, Gerhard; Krska, Rudolf; Schuhmacher, Rainer

    2015-01-01

    In this study, a total of nine different biotransformation products of the Fusarium mycotoxin deoxynivalenol (DON) formed in wheat during detoxification of the toxin are characterized by liquid chromatography—high resolution mass spectrometry (LC-HRMS). The detected metabolites suggest that DON is conjugated to endogenous metabolites via two major metabolism routes, namely 1) glucosylation (DON-3-glucoside, DON-di-hexoside, 15-acetyl-DON-3-glucoside, DON-malonylglucoside) and 2) glutathione conjugation (DON-S-glutathione, “DON-2H”-S-glutathione, DON-S-cysteinyl-glycine and DON-S-cysteine). Furthermore, conjugation of DON to a putative sugar alcohol (hexitol) was found. A molar mass balance for the cultivar ‘Remus’ treated with 1 mg DON revealed that under the test conditions approximately 15% of the added DON were transformed into DON-3-glucoside and another 19% were transformed to the remaining eight biotransformation products or irreversibly bound to the plant matrix. Additionally, metabolite abundance was monitored as a function of time for each DON derivative and was established for six DON treated wheat lines (1 mg/ear) differing in resistance quantitative trait loci (QTL) Fhb1 and/or Qfhs.ifa-5A. All cultivars carrying QTL Fhb1 showed similar metabolism kinetics: Formation of DON-Glc was faster, while DON-GSH production was less efficient compared to cultivars which lacked the resistance QTL Fhb1. Moreover, all wheat lines harboring Fhb1 showed significantly elevated D3G/DON abundance ratios. PMID:25775425

  5. Diallel crosses among maize lines with emphasis on resistance to foliar diseases

    Directory of Open Access Journals (Sweden)

    Maria Elisa Ayres Guidetti Zagatto Paterniani

    2000-06-01

    Full Text Available Ten elite maize (Zea mays L. lines were crossed in a complete diallel scheme and the single-cross hybrids obtained were assessed at four experimental stations of the Agronomic Institute of Campinas, in São Paulo State, Brazil. The experiments were set up in a randomized complete block design with three replications, including four commercial checks. The experimental plots consisted of two 5-m rows spaced at 0.9 m, with a total of 50 plants. The traits assessed included: days to mid-tassel pollen shed (DPS, plant height (PH, ear height (EH, grain yield, corrected for a 50-plant stand and 14% moisture (GY corr., and resistance to Phaeosphaeria maydis and Puccinia polysora. General and specific combining ability effects (GCA and SCA were determined. There was extensive genetic variability among hybrids with the best hybrids (HS 04 x 10 and HS 10 x 11 not differing from the commercial checks. The lines with the greatest potential for hybrid synthesis included: L 10, L 11 and L 13, because they had higher GCA for yield, moderate resistance to P. maydis and reduced EH. The greatest contribution to reduction of the Phaeosphaeria stain was obtained with L 5. The magnitude of the GCA relative to the total variation indicated that additive effects predominated for resistance to P. maydis and P. polysora. Significant SCA (P Cruzaram-se dez linhagens-elite de milho em esquema dialélico completo e os híbridos simples obtidos foram avaliados em quatro Núcleos Experimentais do Instituto Agronômico de Campinas, SP, Brasil. Os ensaios foram instalados sob delineamento de blocos casualizados com três repetições, incluindo quatro testemunhas comerciais. As parcelas consistiram em duas linhas de 5 m espaçadas por 0,90 m, contendo 50 plantas. Avaliaram-se os caracteres: dias para o florescimento masculino (DPS, altura da planta (PH e da espiga (EH, produtividade de grãos corrigida para estande ideal de 50 plantas e 14% de umidade (GY corr. e resistência a

  6. Gone with transgenic cotton cropping in the USA. A perception of the presentations and interactions at the Beltwide Cotton Conferences, New Orleans (Louisiana, USA, 4-7/01/2010

    Directory of Open Access Journals (Sweden)

    Fok, M.

    2011-01-01

    Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.

  7. Hemibody irradiation. An effective second-line therapy in drug-resistance multiple myeloma

    International Nuclear Information System (INIS)

    Singer, C.R.; Tobias, J.S.; Giles, F.; Rudd, G.N.; Blackman, G.M.; Richards, J.D.

    1989-01-01

    The authors report the results of treatment of 41 patients with melphalan-resistant multiple myeloma using single half-body irradiation (HBI) or double half-body irradiation (DHBI). Patients were grouped using prognostic classification reported by the Medical Research Council. Patients in group I and II showed the best response to therapy with reduction in serum of urinary paraprotein and improvement in symptoms, most notably a marked reduction in bone pain. In these groups five patients have survived over 2 years after therapy. The therapeutic response appeared better in those patients who received DHBI as opposed to those whom treated with single HBI. Patients in group III did not achieve prolonged survival but effective relief of bone pain was a consistent finding in these patients also. Thus HBI represents an alternative to combination chemotherapy as second-line treatment of patients with melphalan-resistant multiple myeloma. A comparative study of HBI versus combination chemotherapy is now indicated to establish which therapeutic approach is most effective

  8. Calculation of Local Stress and Fatigue Resistance due to Thermal Stratification on Pressurized Surge Line Pipe

    Science.gov (United States)

    Bandriyana, B.; Utaja

    2010-06-01

    Thermal stratification introduces thermal shock effect which results in local stress and fatique problems that must be considered in the design of nuclear power plant components. Local stress and fatique calculation were performed on the Pressurize Surge Line piping system of the Pressurize Water Reactor of the Nuclear Power Plant. Analysis was done on the operating temperature between 177 to 343° C and the operating pressure of 16 MPa (160 Bar). The stagnant and transient condition with two kinds of stratification model has been evaluated by the two dimensional finite elements method using the ANSYS program. Evaluation of fatigue resistance is developed based on the maximum local stress using the ASME standard Code formula. Maximum stress of 427 MPa occurred at the upper side of the top half of hot fluid pipe stratification model in the transient case condition. The evaluation of the fatigue resistance is performed on 500 operating cycles in the life time of 40 years and giving the usage value of 0,64 which met to the design requirement for class 1 of nuclear component. The out surge transient were the most significant case in the localized effects due to thermal stratification.

  9. A zinc-resistant human epithelial cell line is impaired in cadmium and manganese import

    International Nuclear Information System (INIS)

    Rousselet, Estelle; Richaud, Pierre; Douki, Thierry; Chantegrel, Jocelyne Garcia; Favier, Alain; Bouron, Alexandre; Moulis, Jean-Marc

    2008-01-01

    A human epithelial cell line (HZR) growing with high zinc concentrations has been analyzed for its ability to sustain high cadmium concentrations. Exposure to up to 200 μM of cadmium acetate for 24 h hardly impacted viability, whereas most of parental HeLa cells were killed by less than 10 μM of cadmium. Upon challenge by 35 fold higher cadmium concentrations than HeLa cells, HZR cells did not display increased DNA damage, increased protein oxidation, or changed intracellular cadmium localization. Rather, the main cause of resistance against cadmium was by avoiding cadmium entry into cells, which differs from that against zinc as the latter accumulates inside cells. The zinc-resistant phenotype of these cells was shown to also impair extracellular manganese uptake. Manganese and cadmium competed for entry into HeLa cells. Probing formerly identified cadmium or manganese transport systems in different animal cells did not evidence any significant change between HeLa and HZR cells. These results reveal zinc adaptation influences manganese and cadmium cellular traffic and they highlight previously unknown connections among homeostasis of divalent metals

  10. Characterization of DNA topoisomerase I in three SN-38 resistant human colon cancer cell lines reveals a new pair of resistance-associated mutations

    DEFF Research Database (Denmark)

    Jensen, Niels Frank; Agama, Keli; Roy, Amit

    2016-01-01

    gene copy gain and a loss of chromosome 20, respectively. One resistant cell line harbored a pair of yet unreported TOP1 mutations (R364K and G717R) in close proximity to the drug binding site. Mutant TOP1 was expressed at a markedly higher level than wild-type TOP1. None or very small reductions were...... mechanisms for Top1-targeting chemotherapeutic drugs. Importantly, two yet unreported TOP1 mutations were identified, and it was underlined that cross-resistance to the new indenoisoquinoline drugs depends on the specific underlying molecular mechanism of resistance to SN-38....

  11. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  12. Colorectal cancer cell lines made resistant to SN38-and Oxaliplatin: Roles of altered ion transporter function in resistance?

    DEFF Research Database (Denmark)

    Sandra, Christensen; Jensen, Niels Frank; Stoeckel, Johanne Danmark

    2013-01-01

    , respectively. Studies are ongoing to assess glutamate uptake in parental and resistant CRC cells and the effect of inhibition/knockdown of SLC1A1 and -3 on SN38- and Oxp resistance. In conclusion, SN38-and Oxp-resistance in CRC cells is associated with SLC1A1 and -3 dysregulation. As these transporters have...

  13. Study of some resistance mechanisms to Orobanche spp. infestation in faba bean (Vicia faba L. breeding lines in Tunisia

    Directory of Open Access Journals (Sweden)

    Imen Trabelsi

    2016-10-01

    Full Text Available The behavior of seven faba bean breeding lines toward Orobanche foetida and Orobanche crenata infestation was examined under field, pots, and in vitro conditions and compared to reference cultivars. The breeding lines presented resistance reaction to Orobanche spp. in different experiment conditions. In infested field by O. foetida, the grain yield reduction ranged from 55.7 to 83% for the breeding lines compared to 97% for the susceptible cultivar Badï. Lines L6 and L7 were the less affected by Orobanche parasitism considering severity, number of emerged Orobanche, and yield. In pots, the number of attachments varied from .6 to 3.4 and from 1.4 to 6.4 for the breeding lines against 10.4 and 12.3 for Badï inoculated, respectively, by O. foetida and O. crenata. In Petri dish experiment, Orobanche germination reached the highest rates; 69.9 and 59.7%, respectively, with O. crenata and O. foetida for Badï. For the breeding lines, it ranged from 6.3 to 44.9% for O. crenata and from 4.8 to 40.8% for O. foetida. Moreover, all breeding lines showed low tubercles number and delay in Orobanche attachments as compared to Badï. All breeding lines, except L5, maintained an acceptable level of resistance to Orobanche species manifested by a reduced Orobanche germination rate, low Orobanche number and dry weight, delay of attachments, and higher grain production compared to Badï. L5 seems to be less resistant even it behaves better than Badï in different culture conditions. The studied breeding lines could be recommended as resistance sources or candidates for varieties registrations.

  14. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line.

    Science.gov (United States)

    Hou, Liyuan; Zhang, Xiaojun; Li, Xin; Jia, Juqing; Yang, Huizhen; Zhan, Haixian; Qiao, Linyi; Guo, Huijuan; Chang, Zhijian

    2015-07-28

    Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68-0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  15. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line

    Directory of Open Access Journals (Sweden)

    Liyuan Hou

    2015-07-01

    Full Text Available Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt, is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68–0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  16. Evaluation of ear rot (Fusarium verticillioides resistance and fumonisin accumulation in Italian maize inbred lines

    Directory of Open Access Journals (Sweden)

    Carlotta BALCONI

    2014-05-01

    Full Text Available Mycotoxin contamination of maize (Zea mays L. grain is a global threat to the safety of both human food and animal feed. Hence, the development of maize genotypes with reduced mycotoxin accumulation in grain is of major importance. In order to find maize germplasm sources of resistance to Fusarium ear rot, 34 Italian and six public inbred lines were evaluated by means of artificial inoculation in field experiments during 2009 and 2010. Relationships between ear rot and fumonisin concentration in the ears were investigated. Primary ears were challenged with a mixture of two Fusarium verticillioides isolates from Northern Italy, through kernel inoculation, and ear rot severity was assessed.The average number of visibly infected kernels per ear, after inoculation, ranged from 2 to 68 in 2009 and from 0 to 120 in 2010. Fumonisin concentrations in the inoculated ears were greater than in the experimental controls for both years. Variability was found between the inbred lines: fumonisin accumulation ranged from 0.56 to 240.83 mg kg-1 in 2009 and from 1.09 to 190.60 mg kg-1 in 2010. In both years, six inbred lines showed high fumonisin content (≥100 mg kg-1, while the other genotypes were almost equally split into two groups, low (≤10 mg kg-1 and medium (from 11 to 100 mg kg-1 fumonisin content. The number of infected kernels after artificial inoculation correlated with fumonisin concentration both in 2009 (r = 0.94; P≤0.01 and 2010 (r = 0.67; P≤0.01. Additionally, the percentage of internally infected kernels correlated positively with fumonisin concentration (r = 0.37; P≤0.01 and with the number of infected kernels (r = 0.29; P≤0.05. This research has demonstrated that Italian maize germplasm is a valid source of resistance to Fusarium ear rot. Furthermore, there is a strong association of visible Fusarium symptoms with fumonisin concentration, suggesting that selection in maize for reduced visible moulds should reduce the risk of

  17. Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

    Science.gov (United States)

    Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

    2017-12-10

    Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected

  18. The influence of plastic deformation and chemical environment on the resistively of al-alloy overhead lines

    Directory of Open Access Journals (Sweden)

    Nowak-Woźny D.

    2005-01-01

    Full Text Available The electrical resistively and intensity of X-ray diffraction reflexes were determined for overhead line wires deformed plastically and immersed at different solutions. Immersing (chemical ageing was performed by plastic deformation along the wire axis. During chemical ageing the samples were exposed to the action of the Cl-, SO4 2-, and SO3 2- ions. Resistively was measured at room temperature and at liquid nitrogen temperature. After the X-ray and resistively measurement data were compared, it was found that three processes could take place: the flow of ions through the boundary between a sample and environment; the mechanical relaxation of vacancies near a line of dislocations, and the ordering of microstructure. These effects can lead to the anisotropy of resistively.

  19. An empirical evaluation of competency requirements for first-line managers to deal with resistance to change.

    OpenAIRE

    2007-01-01

    The point of departure of this study is that first-line managers play a pivotal role in the facilitation of change initiatives in organisations world-wide. Resistance to change is one of the primary reasons why change interventions fail or why success is not achieved in the change process. More specific, the inability of first-line managers to deal with resistance to change has been cited as a primary cause for change projects to fail. There is no evidence that any research has been conducted...

  20. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  1. Effects of 1,1-Dimethylpiperidinium Chloride on the Pests and Allelochemicals of Cotton and Pecan.

    Science.gov (United States)

    P. A. Hedin; J. N. Jenkins; J. C. McCarty; J. E. Mulrooney; W. L. Parrott; A. Borazjani; C. H. Graves; T. H. Filer

    1984-01-01

    The growth regulator, PIX (mepiquat chloride - 1,1-dimethyl-piperdinium chloride), when applied to cotton (Gossypium hirsutum L.) and pecan (Carya illinoensis Koch), caused internode shortening. PIX did not elicit an increase in resistance in cotton to the tobacco budworm (Heliothis virescens (Fab.)], or in pecan...

  2. cotton fabric 51

    African Journals Online (AJOL)

    DR. AMINU

    1Department of Chemistry, Federal College of Education, Kano – Nigeria. 2Department of ... its versatility were examined taken into consideration, the molecular structure. ... hemicelluloses, pectin, coloring matter and ash ... temperature for a fixed period of time. These processes rendered the cotton 99% cellulose in nature.

  3. Cotton, Prof. Frank Albert

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Fellowship. Fellow Profile. Elected: 1985 Honorary. Cotton, Prof. Frank Albert. Date of birth: 9 April 1930. Date of death: 20 February 2007. Last known address: Department of Chemistry, Texas A & M University, College Station, TX 77843, U.S.A..

  4. Cotton regeneration in vitro

    Science.gov (United States)

    H. F. Sakhanokho and K. Rajasekaran Over the years, plant breeders have improved cotton via conventional breeding methods, but these methods are time-consuming. To complement classical breeding and, at times, reduce the time necessary for new cultivar development, breeders have turned to in vitro ...

  5. Patterns of HIV-1 drug resistance after first-line antiretroviral therapy (ART) failure in 6 sub-Saharan African countries: implications for second-line ART strategies.

    Science.gov (United States)

    Hamers, Raph L; Sigaloff, Kim C E; Wensing, Annemarie M; Wallis, Carole L; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E; Wellington, Maureen; Osibogun, Akin; Stevens, Wendy S; Rinke de Wit, Tobias F; Schuurman, Rob

    2012-06-01

    Human immunodeficiency virus type 1 (HIV-1) drug resistance may limit the benefits of antiretroviral therapy (ART). This cohort study examined patterns of drug-resistance mutations (DRMs) in individuals with virological failure on first-line ART at 13 clinical sites in 6 African countries and predicted their impact on second-line drug susceptibility. A total of 2588 antiretroviral-naive individuals initiated ART consisting of different nucleoside reverse transcriptase inhibitor (NRTI) backbones (zidovudine, stavudine, tenofovir, or abacavir, plus lamivudine or emtricitabine) with either efavirenz or nevirapine. Population sequencing after 12 months of ART was retrospectively performed if HIV RNA was >1000 copies/mL. The 2010 International Antiviral Society-USA list was used to score major DRMs. The Stanford algorithm was used to predict drug susceptibility. HIV-1 sequences were generated for 142 participants who virologically failed ART, of whom 70% carried ≥1 DRM and 49% had dual-class resistance, with an average of 2.4 DRMs per sequence (range, 1-8). The most common DRMs were M184V (53.5%), K103N (28.9%), Y181C (15.5%), and G190A (14.1%). Thymidine analogue mutations were present in 8.5%. K65R was frequently selected by stavudine (15.0%) or tenofovir (27.7%). Among participants with ≥1 DRM, HIV-1 susceptibility was reduced in 93% for efavirenz/nevirapine, in 81% for lamivudine/emtricitabine, in 59% for etravirine/rilpivirine, in 27% for tenofovir, in 18% for stavudine, and in 10% for zidovudine. Early failure detection limited the accumulation of resistance. After stavudine failure in African populations, zidovudine rather than tenofovir may be preferred in second-line ART. Strategies to prevent HIV-1 resistance are a global priority.

  6. Cellular response to 5-fluorouracil (5-FU in 5-FU-resistant colon cancer cell lines during treatment and recovery

    Directory of Open Access Journals (Sweden)

    Kravik Katherine L

    2006-05-01

    Full Text Available Abstract Background Treatment of cells with the anti-cancer drug 5-fluorouracil (5-FU causes DNA damage, which in turn affects cell proliferation and survival. Two stable wild-type TP53 5-FU-resistant cell lines, ContinB and ContinD, generated from the HCT116 colon cancer cell line, demonstrate moderate and strong resistance to 5-FU, respectively, markedly-reduced levels of 5-FU-induced apoptosis, and alterations in expression levels of a number of key cell cycle- and apoptosis-regulatory genes as a result of resistance development. The aim of the present study was to determine potential differential responses to 8 and 24-hour 5-FU treatment in these resistant cell lines. We assessed levels of 5-FU uptake into DNA, cell cycle effects and apoptosis induction throughout treatment and recovery periods for each cell line, and alterations in expression levels of DNA damage response-, cell cycle- and apoptosis-regulatory genes in response to short-term drug exposure. Results 5-FU treatment for 24 hours resulted in S phase arrests, p53 accumulation, up-regulation of p53-target genes on DNA damage response (ATF3, GADD34, GADD45A, PCNA, cell cycle-regulatory (CDKN1A, and apoptosis-regulatory pathways (FAS, and apoptosis induction in the parental and resistant cell lines. Levels of 5-FU incorporation into DNA were similar for the cell lines. The pattern of cell cycle progression during recovery demonstrated consistently that the 5-FU-resistant cell lines had the smallest S phase fractions and the largest G2(/M fractions. The strongly 5-FU-resistant ContinD cell line had the smallest S phase arrests, the lowest CDKN1A levels, and the lowest levels of 5-FU-induced apoptosis throughout the treatment and recovery periods, and the fastest recovery of exponential growth (10 days compared to the other two cell lines. The moderately 5-FU-resistant ContinB cell line had comparatively lower apoptotic levels than the parental cells during treatment and recovery

  7. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  8. Molecular cytogenetic characterization of a new wheat-rye 4R chromosome translocation line resistant to powdery mildew.

    Science.gov (United States)

    An, Diaoguo; Zheng, Qi; Zhou, Yilin; Ma, Pengtao; Lv, Zhenling; Li, Lihui; Li, Bin; Luo, Qiaoling; Xu, Hongxing; Xu, Yunfeng

    2013-07-01

    Rye is an important and valuable gene resource for wheat improvement. However, due to extensive growing of cultivars with disease resistance genes from short arm of rye chromosome 1R and coevolution of pathogen virulence and host resistance, these cultivars successively lost resistance to pathogens. Identification and deployment of new resistance gene sources in rye are, therefore, of especial importance and urgency. A new wheat-rye line, designated as WR41-1, was produced through distant hybridization and chromosome engineering protocols between common wheat cultivar Xiaoyan 6 and rye cultivar German White. It was proved to be a new wheat-rye T4BL·4RL and T7AS·4RS translocation line using sequential genomic in situ hybridization (GISH), multicolor fluorescence in situ hybridization (mc-FISH), and expressed sequence tag-simple sequence repeat (EST-SSR) marker analysis. WR41-1 showed high levels of resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) pathogens prevalent in China at the adult growth stage and 13 of 23 Bgt isolates tested at the seedling stage. According to its resistant pattern to 23 different Bgt isolates, WR41-1 may possess new gene(s) for resistance to powdery mildew, which differed from previously identified and known powdery mildew genes from rye (Pm7, Pm8, Pm17, and Pm20). In addition, WR41-1 was cytologically stable, had a desirable fertility, and is expected to be useful in wheat improvement.

  9. Heavy metal incorporated helium ion active hybrid non-chemically amplified resists: Nano-patterning with low line edge roughness

    Directory of Open Access Journals (Sweden)

    Pulikanti Guruprasad Reddy

    2017-08-01

    Full Text Available Helium (He ion lithography is being considered as one of the most promising and emerging technology for the manufacturing of next generation integrated circuits (ICs at nanolevel. However, He-ion active resists are rarely reported. In this context, we are introducing a new non-chemically amplified hybrid resist (n-CAR, MAPDSA-MAPDST, for high resolution He-ion beam lithography (HBL applications. In the resist architecture, 2.15 % antimony is incorporated as heavy metal in the form of antimonate. This newly developed resists has successfully used for patterning 20 nm negative tone features at a dose of 60 μC/cm2. The resist offered very low line edge roughness (1.27±0.31 nm for 20 nm line features. To our knowledge, this is the first He-ion active hybrid resist for nanopatterning. The contrast (γ and sensitivity (E0 of this resist were calculated from the contrast curve as 0.73 and 7.2 μC/cm2, respectively.

  10. Heavy metal incorporated helium ion active hybrid non-chemically amplified resists: Nano-patterning with low line edge roughness

    Science.gov (United States)

    Reddy, Pulikanti Guruprasad; Thakur, Neha; Lee, Chien-Lin; Chien, Sheng-Wei; Pradeep, Chullikkattil P.; Ghosh, Subrata; Tsai, Kuen-Yu; Gonsalves, Kenneth E.

    2017-08-01

    Helium (He) ion lithography is being considered as one of the most promising and emerging technology for the manufacturing of next generation integrated circuits (ICs) at nanolevel. However, He-ion active resists are rarely reported. In this context, we are introducing a new non-chemically amplified hybrid resist (n-CAR), MAPDSA-MAPDST, for high resolution He-ion beam lithography (HBL) applications. In the resist architecture, 2.15 % antimony is incorporated as heavy metal in the form of antimonate. This newly developed resists has successfully used for patterning 20 nm negative tone features at a dose of 60 μC/cm2. The resist offered very low line edge roughness (1.27±0.31 nm) for 20 nm line features. To our knowledge, this is the first He-ion active hybrid resist for nanopatterning. The contrast (γ) and sensitivity (E0) of this resist were calculated from the contrast curve as 0.73 and 7.2 μC/cm2, respectively.

  11. Drug resistance in colorectal cancer cell lines is partially associated with aneuploidy status in light of profiling gene expression

    DEFF Research Database (Denmark)

    Guo, Jiao; Xu, Shaohang; Huang, Xuanlin

    2016-01-01

    A priority in solving the problem of drug resistance is to understand the molecular mechanism of how a drug induces the resistance response within cells. Because many cancer cells exhibit chromosome aneuploidy, we explored whether changes of aneuploidy status result in drug resistance. Two typical...... colorectal cancer cells, HCT116 and LoVo, were cultured with the chemotherapeutic drugs irinotecan (SN38) or oxaliplatin (QxPt), and the non- and drug-resistant cell lines were selected. Whole exome sequencing (WES) was employed to evaluate the aneuploidy status of these cells, and RNAseq and LC-MS/MS were...... the aneuploidy status in cancer cells, which was partially associated with the acquired drug resistance....

  12. Expression and activity of multidrug resistance protein 1 in a murine thymoma cell line

    Science.gov (United States)

    Echevarria-Lima, Juliana; Kyle-Cezar, Fernanda; Leite, Daniela F P; Capella, Luiz; Capella, Márcia A M; Rumjanek, Vivian M

    2005-01-01

    Multidrug resistance proteins [MRPs and P-glycoprotein (Pgp)] are members of the family of ATP-binding cassette (ABC) transport proteins, originally described as being involved in the resistance against anti-cancer agents in tumour cells. These proteins act as ATP-dependent efflux pumps and have now been described in normal cells where they exert physiological roles. The aim of this work was to investigate the expression and activity of MRP and Pgp in the thymoma cell line, EL4. It was observed that EL4 cells expressed mRNA for MRP1, but not for MRP2, MRP3 or Pgp. The activity of ABC transport proteins was evaluated by using the efflux of the fluorescent probes carboxy-2′-7′-dichlorofluorescein diacetate (CFDA) and rhodamine 123 (Rho 123). EL4 cells did not retain CFDA intracellularly, and MRP inhibitors (probenecid, indomethacin and MK 571) decreased MRP1 activity in a concentration-dependent manner. As expected, EL4 cells accumulated Rho 123, and the presence of cyclosporin A and verapamil did not modify this accumulation. Most importantly, when EL4 cells were incubated in the presence of the MRP1 inhibitors indomethacin and MK 571 for 6 days, they started to express CD4 and CD8 molecules on their surface, producing double-positive cells and CD8 single-positive cells. Our results suggest that MRP activity is important for the maintenance of the undifferentiated state in this cell type. This finding might have implications in the physiological process of normal thymocyte maturation. PMID:15804283

  13. Molecular characterization and functional analysis of pteridine reductase in wild-type and antimony-resistant Leishmania lines.

    Science.gov (United States)

    de Souza Moreira, Douglas; Ferreira, Rafael Fernandes; Murta, Silvane M F

    2016-01-01

    Pteridine reductase (PTR1) is an NADPH-dependent reductase that participates in the salvage of pteridines, which are essential to maintain growth of Leishmania. In this study, we performed the molecular characterization of ptr1 gene in wild-type (WTS) and SbIII-resistant (SbR) lines from Leishmania guyanensis (Lg), Leishmania amazonensis (La), Leishmania braziliensis (Lb) and Leishmania infantum (Li), evaluating the chromosomal location, mRNA levels of the ptr1 gene and PTR1 protein expression. PFGE results showed that the ptr1 gene is located in a 797 kb chromosomal band in all Leishmania lines analyzed. Interestingly, an additional chromosomal band of 1070 kb was observed only in LbSbR line. Northern blot results showed that the levels of ptr1 mRNA are increased in the LgSbR, LaSbR and LbSbR lines. Western blot assays using the polyclonal anti-LmPTR1 antibody demonstrated that PTR1 protein is more expressed in the LgSbR, LaSbR and LbSbR lines compared to their respective WTS counterparts. Nevertheless, no difference in the level of mRNA and protein was observed between the LiWTS and LiSbR lines. Functional analysis of PTR1 enzyme was performed to determine whether the overexpression of ptr1 gene in the WTS L. braziliensis and L. infantum lines would change the SbIII-resistance phenotype of transfected parasites. Western blot results showed that the expression level of PTR1 protein was increased in the transfected parasites compared to the non-transfected ones. IC50 analysis revealed that the overexpression of ptr1 gene in the WTS L. braziliensis line increased 2-fold the SbIII-resistance phenotype compared to the non-transfected counterpart. Furthermore, the overexpression of ptr1 gene in the WTS L. infantum line did not change the SbIII-resistance phenotype. These results suggest that the PTR1 enzyme may be implicated in the SbIII-resistance phenotype in L. braziliensis line. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Neutron and photon clonogenic survival curves of two chemotherapy resistant human intermediate-grade non-Hodgkin lymphoma cell lines

    International Nuclear Information System (INIS)

    Aref, Amr; Yudelev, Mark; Mohammad, Ramzi; Choudhuri, Rajani; Orton, Colin; Al-Katib, Ayad

    1999-01-01

    Background: The potential role of neutron therapy in the management of intermediate-grade non-Hodgkin lymphoma (IGNHL) has not been examined because of the belief that the anticipated radiobiological effectiveness (RBE) would be uniformly very low. Purpose: To determine the fast neutron RBE for two chemotherapy-resistant IGNHL cell lines. Methods and Materials: Conventional soft agar clonogenic survival curves following irradiation by 60 Co and fast neutron were established for two IGNHL cell lines. These cell lines, WSU-DLCL2 and SK-DHL2B, were found in previous studies to be able to repair sublethal damage, and were also resistant to L-Pam and doxorubicin chemotherapy. Results: When the surviving fraction after 2 Gy photon was chosen as the biological endpoint, the RBE for WSU-DLCL2 and SK-DHL2B measured 3.34 and 3.06. Similarly, when 10% survival was considered, the RBE for these two cell lines measured 2.54 and 2.59. The RBE, as measured by the ratios α neutron/α photon, for WSU-DLCL2, SK-DHL2B cell lines are 6.67 and 5.65, respectively. These results indicate that the RBE for these IGNHL cell lines is higher than the average RBE for cell lines of other histological types. Conclusion: Fast neutron irradiation may be of potential value in treating selected cases of IGNHL

  15. Grain Yield and Fusarium Ear Rot of Maize Hybrids Developed From Lines With Varying Levels of Resistance

    Science.gov (United States)

    Fusarium ear rot, caused by Fusarium verticillioides and other Fusarium spp. is found in all U.S. maize growing regions. Affected grain often contains carcinogenic mycotoxins called fumonisins. We tested the hypothesis that inbred lines with greater resistance to fumonisin contamination would pro...

  16. Radiation mutagenesis in development of genetic fundamentals of cotton selection

    International Nuclear Information System (INIS)

    Musaev, D.A.; Almatov, A.S.

    1987-01-01

    Some results of investigations on preparation and genetic analysis of mutants in inbreeding lines of genetic collections of cotton plants, as well as problems on mutant application in practical selection are covered. The results show that the scientific authenticity and efficiency of fundamental and applied investigations in the field of experimental mutagenesis of cotton plants,being a facultative self-polinator, depend on keeping necessary methodical requirements. Application of inbreeding lines of genetic collection with marker features as the initial material, isolation of plants usinng self-polination of flowers on all stages of investigation are related to these requirements. Several methodical recommendations on genetic-selective investigations are developed

  17. Determination of Tolerance Levels of Cotton Genotypes Obtained from F6-F7 Generation against Verticillium Wilt Disease Caused by Verticillium dahliae Kleb.

    OpenAIRE

    Oktay EROĞAN; Emine KARADEMIR; Çetin KARADEMIR; Aydın UNAY

    2013-01-01

    The susceptibility of cotton genotypes obtained from F6 and F7 generations to Verticillium wilt (VW) disease (Verticillium dahliae Kleb.), was studied under artificial and natural infestation during 2009 and 2010 growing seasons at the Cotton Research Institute’s, Nazilli, Aydın, Turkey. In this study, fifteen cotton breeding lines and two control varieties were used as plant material. During the cotton growing season, foliar disease index (FDI), vascular disease index (VDI) and pot disease i...

  18. Screening Pakistani cotton for drought tolerance

    International Nuclear Information System (INIS)

    Soomro, M.H.; Markhand, G.S.

    2011-01-01

    The drought is one of the biggest abiotic stresses for crop production in arid and semi-arid agriculture. Thus it is a challenge for plant scientists to screen and develop the drought tolerant cotton lines. In this study, 31 cotton genotypes/cultivars were evaluated under two irrigation regimes i. e., seven irrigations (Control) and two irrigations (Stress), using split plot design with four replications. The crop growth, yield and some physiological parameters were studied. There were high inter-varietal differences for all the parameters under control as well as drought stress. Although all the varieties for all parameters were significantly affected by drought but however, CRIS-9, MARVI, CRIS-134, CRIS-126, CRIS-337, CRIS-355 and CRIS-377 maintained highest performance for all the parameters studied under high drought conditions. (author)

  19. Hypothyroidism during second-line treatment of multidrug-resistant tuberculosis: a prospective study.

    Science.gov (United States)

    Bares, R; Khalid, N; Daniel, H; Dittmann, H; Reimold, M; Gallwitz, B; Schmotzer, C

    2016-07-01

    Hypothyroidism is an adverse effect of certain anti-tuberculosis drugs. This is a prospective study of the frequency and possible pathomechanisms associated with hypothyroidism due to second-line treatment of multidrug-resistant tuberculosis. Fifty human immunodeficiency virus negative patients and 20 controls were included. All participants underwent ultrasonography of the thyroid and measurement of thyroid stimulating hormone (TSH). TSH levels were checked every 3 months. If hypothyroidism was present, T3, T4 and thyroid peroxidase autoantibodies were measured, and imaging extended to scintigraphy and repeated ultrasonography. Before treatment, 7 patients (14%) and 1 control (5%) were hypothyreotic. During the first 6 months of treatment, TSH levels increased in 41 patients (82%), 39 (78%) had values above the normal range and 19 (38%) had overt hypothyroidism. As none of the patients had signs of autoimmune thyroiditis, interaction with anti-tuberculosis drugs was assumed to be the cause of hypothyroidism. Nine patients died during treatment, all of whom had developed hypothyroidism. In seven, the metabolic situation at their death was known, and they had become euthyreotic following levothyroxine substitution. TSH levels should be checked before initiating anti-tuberculosis treatment and after 3 and 6 months to start timely replacement of levothyroxine. Further studies are needed to elucidate the exact pathomechanism involved in hypothyroidism and whether hypothyroidism can be used as predictor of treatment failure.

  20. Identification of tomato introgression lines with enhanced susceptibility or resistance to infection by parasitic giant dodder (Cuscuta reflexa).

    Science.gov (United States)

    Krause, Kirsten; Johnsen, Hanne R; Pielach, Anna; Lund, Leidulf; Fischer, Karsten; Rose, Jocelyn K C

    2018-02-01

    The parasitic flowering plant genus Cuscuta (dodder) is a parasitic weed that infects many important crops. Once it winds around the shoots of potential host plants and initiates the development of penetration organs, called haustoria, only a few plant species have been shown to deploy effective defense mechanisms to ward off Cuscuta parasitization. However, a notable exception is Solanum lycopersicum (tomato), which exhibits a local hypersensitive reaction when attacked by giant dodder (Cuscuta reflexa). Interestingly, the closely related wild desert tomato, Solanum pennellii, is unable to stop the penetration of its tissue by the C. reflexa haustoria. In this study, we observed that grafting a S. pennellii scion onto the rootstock of the resistant S. lycopersicum did not change the susceptibility phenotype of S. pennellii. This suggests that hormones, or other mobile substances, produced by S. lycopersicum do not induce a defense reaction in the susceptible tissue. Screening of a population of introgression lines harboring chromosome fragments from S. pennellii in the genome of the recurrent parent S. lycopersicum, revealed that most lines exhibit the same defense reaction as shown by the S. lycopersicum parental line. However, several lines showed different responses and exhibited either susceptibility, or cell death that extended considerably beyond the infection site. These lines will be valuable for the future identification of key loci involved in the perception of, and resistance to, C. reflexa and for developing strategies to enhance resistance to infection in crop species. © 2017 Scandinavian Plant Physiology Society.

  1. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    Science.gov (United States)

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  2. Genetic parameters and selection for resistance to bacterial spot in recombinant F6 lines of Capsicum annuum

    Directory of Open Access Journals (Sweden)

    Messias Gonzaga Pereira

    2009-01-01

    Full Text Available This study aimed to advance generations and select superior sweet pepper genotypes with resistance tobacterial spot, using the breeding method Single Seed Descent (SSD based on the segregating population derived from thecross between Capsicum annuum L. UENF 1421 (susceptible, non-pungent and UENF 1381 (resistant, pungent. Thesegregating F3 generation was grown in pots in a greenhouse until the F5 generation. The F6 generation was grown in fieldconditions. The reaction to bacterial spot was evaluated by inoculation with isolate ENA 4135 of Xanthomonas campestris pv.vesicatoria, based on a score scale and by calculating the area under the disease progress curve (AUDPC. The presence orabsence of capsaicin was also assessed. Eighteen F6 lines were bacterial leaf spot-resistant. Since no capsaicin was detectedin the F6 lines 032, 316, 399, 434, and 517, these will be used in the next steps of the sweet pepper breeding program.

  3. Fabrication of superhydrophobic cotton fabrics using crosslinking polymerization method

    Science.gov (United States)

    Jiang, Bin; Chen, Zhenxing; Sun, Yongli; Yang, Huawei; Zhang, Hongjie; Dou, Haozhen; Zhang, Luhong

    2018-05-01

    With the aim of removing and recycling oil and organic solvent from water, a facile and low-cost crosslinking polymerization method was first applied on surface modification of cotton fabrics for water/oil separation. Micro-nano hierarchical rough structure was constructed by triethylenetetramine (TETA) and trimesoyl chloride (TMC) that formed a polymeric layer on the surface of the fabric and anchored Al2O3 nanoparticles firmly between the fabric surface and the polymer layer. Superhydrophobic property was further obtained through self-assembly grafting of hydrophobic groups on the rough surface. The as-prepared cotton fabric exhibited superoleophilicity in atmosphere and superhydrophobicity both in atmosphere and under oil with the water contact angle of 153° and 152° respectively. Water/oil separation test showed that the as-prepared cotton fabric can handle with various oil-water mixtures with a high separation efficiency over 99%. More importantly, the separation efficiency remained above 98% over 20 cycles of reusing without losing its superhydrophobicity which demonstrated excellent reusability in oil/water separation process. Moreover, the as-prepared cotton fabric possessed good contamination resistance ability and self-cleaning property. Simulation washing process test showed the superhydrophobic cotton fabric maintained high value of water contact angle above 150° after 100 times washing, indicating great stability and durability. In summary, this work provides a brand-new way to surface modification of cotton fabric and makes it a promising candidate material for oil/water separation.

  4. DNA sequences from two SSRs (CIR316 and MUCS088) linked to root-knot nematode resistance genes from diverse cottons (Gossypium spp).

    Science.gov (United States)

    We investigated DNA sequencing information from alleles (DNA amplified fragments) of two previously reported SSR markers (CIR316 and MUCS088) linked to root-knot nematode (RKN) resistance genes. Markers based on electrophoretic differences, including RFLPs, AFLPs and SSRs can sometimes mask underlyi...

  5. Evaluation of cotton stalks destroyers

    OpenAIRE

    Bianchini, Aloisio; Borges, Pedro H. de M.

    2013-01-01

    The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...

  6. Combining ability of summer-squash lines with different degrees of parthenocarpy and PRSV-W resistance.

    Science.gov (United States)

    Nogueira, Douglas Willian; Maluf, Wilson Roberto; Dos Reis Figueira, Antonia; Maciel, Gabriel Mascarenhas; Gomes, Luiz Antonio Augusto; Benavente, Cesar Augusto Ticona

    2011-10-01

    The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain). The hybrids were obtained using a partial diallel cross design (4 × 4). The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G-77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-bulk, and of group II, 1' = ABX-037G-77-03-05-04-08-bulk, 2' = ABX-037G-77-03-05-02-11-bulk, 3' = Clarice and 4' = Caserta. The 16 hybrids and eight parental lines were evaluated for PRSV-W resistance, parthenocarpic expression and yield in randomized complete-block designs, with three replications. Parthenocarpy and the resistance to PRSV-W were rated by means of a scale from 1 to 5, where 1 = non-parthenocarpic or high resistance to PRSV-W, and 5 = parthenocarpic or high susceptibility to PRSV-W. Both additive and non-additive gene effects were important in the expression of parthenocarpy and resistance to PRSV-W. Whereas estimates of heterosis in parthenocarpy usually tended towards a higher degree, resistance to PRSV-W was towards higher susceptibility. At least one F(1) hybrid was identified with a satisfactory degree of parthenocarpy, resistance to PRSV-W and high fruit-yield.

  7. Combining ability of summer-squash lines with different degrees of parthenocarpy and PRSV-W resistance

    Directory of Open Access Journals (Sweden)

    Douglas Willian Nogueira

    2011-01-01

    Full Text Available The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain. The hybrids were obtained using a partial diallel cross design (4 x 4. The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-bulk, and of group II, 1' = ABX-037G-77-03-05-04-08-bulk, 2' = ABX-037G-77-03-05-02-11-bulk, 3' = Clarice and 4' = Caserta. The 16 hybrids and eight parental lines were evaluated for PRSV-W resistance, parthenocarpic expression and yield in randomized complete-block designs, with three replications. Parthenocarpy and the resistance to PRSV-W were rated by means of a scale from 1 to 5, where 1 = non-parthenocarpic or high resistance to PRSV-W, and 5 = parthenocarpic or high susceptibility to PRSV-W. Both additive and non-additive gene effects were important in the expression of parthenocarpy and resistance to PRSV-W. Whereas estimates of heterosis in parthenocarpy usually tended towards a higher degree, resistance to PRSV-W was towards higher susceptibility. At least one F1 hybrid was identified with a satisfactory degree of parthenocarpy, resistance to PRSV-W and high fruit-yield.

  8. Development and characterization of japonica rice lines carrying the brown planthopper-resistance genes BPH12 and BPH6.

    Science.gov (United States)

    Qiu, Yongfu; Guo, Jianping; Jing, Shengli; Zhu, Lili; He, Guangcun

    2012-02-01

    The brown planthopper (Nilaparvata lugens Stål; BPH) has become a severe constraint on rice production. Identification and pyramiding BPH-resistance genes is an economical and effective solution to increase the resistance level of rice varieties. All the BPH-resistance genes identified to date have been from indica rice or wild species. The BPH12 gene in the indica rice accession B14 is derived from the wild species Oryza latifolia. Using an F(2) population from a cross between the indica cultivar 93-11 and B14, we mapped the BPH12 gene to a 1.9-cM region on chromosome 4, flanked by the markers RM16459 and RM1305. In this population, BPH12 appeared to be partially dominant and explained 73.8% of the phenotypic variance in BPH resistance. A near-isogenic line (NIL) containing the BPH12 locus in the background of the susceptible japonica variety Nipponbare was developed and crossed with a NIL carrying BPH6 to generate a pyramid line (PYL) with both genes. BPH insects showed significant differences in non-preference in comparisons between the lines harboring resistance genes (NILs and PYL) and Nipponbare. BPH growth and development were inhibited and survival rates were lower on the NIL-BPH12 and NIL-BPH6 plants compared to the recurrent parent Nipponbare. PYL-BPH6 + BPH12 exhibited 46.4, 26.8 and 72.1% reductions in population growth rates (PGR) compared to NIL-BPH12, NIL-BPH6 and Nipponbare, respectively. Furthermore, insect survival rates were the lowest on the PYL-BPH6 + BPH12 plants. These results demonstrated that pyramiding different BPH-resistance genes resulted in stronger antixenotic and antibiotic effects on the BPH insects. This gene pyramiding strategy should be of great benefit for the breeding of BPH-resistant japonica rice varieties.

  9. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia

    Science.gov (United States)

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick CK; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher KC; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

    2014-01-01

    Introduction First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. Methods We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance – Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥2 TAMs; or M184V+≥1 TAM. Virological suppression was defined as viral load (VL) Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥2 TAMs; and 32 with M184V+≥1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤200 cells/µL at genotyping (OR=4.43, 95% CI [1.59–12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39–16.36], p<0.001). Among 87/105 patients with available VL at 12 months after switch to second-line ART, virological suppression was achieved in 85%. The median genotypic susceptibility score (GSS) for the second-line regimen was 2.00. Patients with ART adherence ≥95% were more likely to be virologically suppressed (OR=9.33, 95% CI (2.43–35.81), p=0.001). Measures of patient resistance to second-line ART, including the GSS, were not significantly associated with virological outcome. Conclusions Multi-NRTI RAMs at first-line failure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving

  10. HIV multi-drug resistance at first-line antiretroviral failure and subsequent virological response in Asia.

    Science.gov (United States)

    Jiamsakul, Awachana; Sungkanuparph, Somnuek; Law, Matthew; Kantor, Rami; Praparattanapan, Jutarat; Li, Patrick C K; Phanuphak, Praphan; Merati, Tuti; Ratanasuwan, Winai; Lee, Christopher K C; Ditangco, Rossana; Mustafa, Mahiran; Singtoroj, Thida; Kiertiburanakul, Sasisopin

    2014-01-01

    First-line antiretroviral therapy (ART) failure often results from the development of resistance-associated mutations (RAMs). Three patterns, including thymidine analogue mutations (TAMs), 69 Insertion (69Ins) and the Q151M complex, are associated with resistance to multiple-nucleoside reverse transcriptase inhibitors (NRTIs) and may compromise treatment options for second-line ART. We investigated patterns and factors associated with multi-NRTI RAMs at first-line failure in patients from The TREAT Asia Studies to Evaluate Resistance - Monitoring study (TASER-M), and evaluated their impact on virological responses at 12 months after switching to second-line ART. RAMs were compared with the IAS-USA 2013 mutations list. We defined multi-NRTI RAMs as the presence of either Q151M; 69Ins; ≥ 2 TAMs; or M184V+≥ 1 TAM. Virological suppression was defined as viral load (VL) failure and (2) factors associated with virological suppression after 12 months on second-line. A total of 105 patients from 10 sites in Thailand, Hong Kong, Indonesia, Malaysia and Philippines were included. There were 97/105 (92%) patients harbouring ≥ 1 RAMs at first-line failure, 39/105 with multi-NRTI RAMs: six with Q151M; 24 with ≥ 2 TAMs; and 32 with M184V+≥ 1 TAM. Factors associated with multi-NRTI RAMs were CD4 ≤ 200 cells/µL at genotyping (OR=4.43, 95% CI [1.59-12.37], p=0.004) and ART duration >2 years (OR=6.25, 95% CI [2.39-16.36], pfailure were associated with low CD4 level and longer duration of ART. With many patients switching to highly susceptible regimens, good adherence was still crucial in achieving virological response. This emphasizes the importance of continued adherence counselling well into second-line therapy.

  11. Impacts of transgenic poplar-cotton agro-ecosystems upon target pests and non-target insects under field conditions.

    Science.gov (United States)

    Zhang, D J; Liu, J X; Lu, Z Y; Li, C L; Comada, E; Yang, M S

    2015-07-27

    Poplar-cotton agro-ecosystems are the main agricultural planting modes of cotton fields in China. With increasing acres devoted to transgenic insect-resistant poplar and transgenic insect-resistant cotton, studies examining the effects of transgenic plants on target and non-target insects become increasingly important. We systematically surveyed populations of both target pests and non-target insects for 4 different combinations of poplar-cotton eco-systems over 3 years. Transgenic Bt cotton strongly resisted the target insects Fall webworm moth [Hyphantria cunea (Drury)], Sylepta derogata Fabrieius, and American bollworm (Heliothis armigera), but no clear impact on non-target insect cotton aphids (Aphis gossypii). Importantly, intercrops containing transgenic Pb29 poplar significantly increased the inhibitory effects of Bt cotton on Fall webworm moth in ecosystem IV. Highly resistant Pb29 poplar reduced populations of the target pests Grnsonoma minutara Hubner and non-target insect poplar leaf aphid (Chaitophorus po-pulialbae), while Fall webworm moth populations were unaffected. We determined the effects of Bt toxin from transgenic poplar and cotton on target and non-target pests in different ecosystems of cotton-poplar intercrops and identified the synergistic effects of such combinations toward both target and non-target insects.

  12. On-line monitoring of resistance of aqueous solutions at high temperature

    International Nuclear Information System (INIS)

    Hu Shilin; Zhang Pingzhu; Shang Weiguo

    1999-01-01

    The coulostatic measurement is a fast speed electrochemical test method. By this technology, analyzing Δ E(t)- T curves recorded under coulostatic perturbation, the solution resistance R l , resistance of coated film R f , capacity of coated film C f , Polarization resistance R p and double layer capacity C d are obtained. The resistance variety of 0.05N KCl is measured from room temperature up to 255 deg. C under saturation steam pressure. (author)

  13. Flavonoid biosynthesis controls fiber color in naturally colored cotton

    Directory of Open Access Journals (Sweden)

    Hai-Feng Liu

    2018-04-01

    Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

  14. Multiple disease resistance to fungal and oomycete pathogens using a recombinant inbred line population in pepper

    Science.gov (United States)

    Incorporating disease resistance into cultivars is a primary focus of modern breeding programs. Resistance to pathogens is often introgressed from landrace or wild individuals with poor fruit quality into commercial-quality cultivars. Sites of multiple disease resistance (MDR) are regions or “hotspo...

  15. Sensitivity to ionizing radiation and chemotherapeutic agents in gemcitabine-resistant human tumor cell lines

    NARCIS (Netherlands)

    van Bree, Chris; Castro Kreder, Natasja; Loves, Willem J. P.; Franken, Nicolaas A. P.; Peters, Godefridus J.; Haveman, Jaap

    2002-01-01

    Purpose: To determine cross-resistance to anti-tumor treatments in 2',2'difluorodeoxycytidine (dFdC, gemcitabine)-resistant human tumor cells. Methods and Materials: Human lung carcinoma cells SW-1573 (SWp) were made resistant to dFdC (SWg). Sensitivity to cisplatin (cDDP), paclitaxel,

  16. Molecular cytogenetic identification of a novel wheat-Agropyron elongatum chromosome translocation line with powdery mildew resistance.

    Science.gov (United States)

    Li, Xiaojun; Jiang, Xiaoling; Chen, Xiangdong; Song, Jie; Ren, Cuicui; Xiao, Yajuan; Gao, Xiaohui; Ru, Zhengang

    2017-01-01

    Agropyron elongatum (Host.) Neviski (synonym, Thinopyrum ponticum Podp., 2n = 70) has been used extensively as a valuable source for wheat breeding. Numerous chromosome fragments containing valuable genes have been successfully translocated into wheat from A. elongatum. However, reports on the transfer of powdery mildew resistance from A. elongatum to wheat are rare. In this study, a novel wheat-A. elongatum translocation line, 11-20-1, developed and selected from the progenies of a sequential cross between wheat varieties (Lankaoaizaoba, Keyu 818 and BainongAK 58) and A. elongatum, was evaluated for disease resistance and characterized using molecular cytogenetic methods. Cytological observations indicated that 11-20-1 had 42 chromosomes and formed 21 bivalents at meiotic metaphase I. Genomic in situ hybridization analysis using whole genomic DNA from A. elongatum as a probe showed that the short arms of a pair of wheat chromosomes were replaced by a pair of A. elongatum chromosome arms. Fluorescence in situ hybridization, using wheat D chromosome specific sequence pAs1 as a probe, suggested that the replaced chromosome arms of 11-20-1 were 5DS. This was further confirmed by wheat SSR markers specific for 5DS. EST-SSR and EST-STS multiple loci markers confirmed that the introduced A. elongatum chromosome arms belonged to homoeologous group 5. Therefore, it was deduced that 11-20-1 was a wheat-A. elongatum T5DL∙5AgS translocation line. Both resistance observation and molecular marker analyses using two specific markers (BE443538 and CD452608) of A. elongatum in a F2 population from a cross between line 11-20-1 and a susceptible cultivar Yannong 19 verified that the A. elongatum chromosomes were responsible for the powdery mildew resistance. This work suggests that 11-20-1 likely contains a novel resistance gene against powdery mildew. We expect this line to be useful for the genetic improvement of wheat.

  17. Characterization of a New Pm2 Allele Conferring Powdery Mildew Resistance in the Wheat Germplasm Line FG-1

    Science.gov (United States)

    Ma, Pengtao; Xu, Hongxng; Li, Lihui; Zhang, Hongxia; Han, Guohao; Xu, Yunfeng; Fu, Xiaoyi; Zhang, Xiaotian; An, Diaoguo

    2016-01-01

    Powdery mildew has a negative impact on wheat production. Novel host resistance increases the diversity of resistance genes and helps to control the disease. In this study, wheat line FG-1 imported from France showed a high level of powdery mildew resistance at both the seedling and adult stages. An F2 population and F2:3 families from the cross FG-1 × Mingxian 169 both fit Mendelian ratios for a single dominant resistance gene when tested against multiple avirulent Blumeria tritici f. sp. tritici (Bgt) races. This gene was temporarily designated PmFG. PmFG was mapped on the multi-allelic Pm2 locus of chromosome 5DS using seven SSR, 10 single nucleotide polymorphism (SNP)-derived and two SCAR markers with the flanking markers Xbwm21/Xcfd81/Xscar112 (distal) and Xbwm25 (proximal) at 0.3 and 0.5 cM being the closest. Marker SCAR203 co-segregated with PmFG. Allelism tests between PmFG and documented Pm2 alleles confirmed that PmFG was allelic with Pm2. Line FG-1 produced a significantly different reaction pattern compared to other lines with genes at or near Pm2 when tested against 49 Bgt isolates. The PmFG-linked marker alleles detected by the SNP-derived markers revealed significant variation between FG-1 and other lines with genes at or near Pm2. It was concluded that PmFG is a new allele at the Pm2 locus. Data from seven closely linked markers tested on 31 wheat cultivars indicated opportunities for marker-assisted pyramiding of this gene with other genes for powdery mildew resistance and additional traits. PMID:27200022

  18. High discordance in blood and genital tract HIV-1 drug resistance in Indian women failing first-line therapy.

    Science.gov (United States)

    Saravanan, Shanmugam; Gomathi, Selvamurthi; Delong, Allison; Kausalya, Bagavathi; Sivamalar, Sathasivam; Poongulali, Selvamuthu; Brooks, Katherine; Kumarasamy, Nagalingeswaran; Balakrishnan, Pachamuthu; Solomon, Sunil S; Cu-Uvin, Susan; Kantor, Rami

    2018-05-24

    Examine HIV-1 plasma viral load (PVL) and genital tract (GT) viral load (GVL) and drug resistance in India. At the YRG Centre for AIDS Research and Education, Chennai, we tested: PVL in women on first-line ART for ≥6 months; GVL when PVL >2000 copies/mL; and plasma, genital and proviral reverse transcriptase drug resistance when GVL >2000 copies/mL. Wilcoxon rank-sum and Fisher's exact tests were used to identify failure and resistance associations. Pearson correlations were calculated to evaluate PVL-GVL associations. Inter-compartmental resistance discordance was evaluated using generalized estimating equations. Of 200 women, 37% had detectable (>400 copies/mL) PVL and 31% had PVL >1000 copies/mL. Of women with detectable PVL, 74% had PVL >2000 copies/mL, of which 74% had detectable GVL. Higher PVL was associated with higher GVL. Paired plasma and genital sequences were available for 21 women; mean age of 34 years, median ART duration of 33 months, median CD4 count of 217 cells/mm3, median PVL of 5.4 log10 copies/mL and median GVL of 4.6 log10 copies/mL. Drug resistance was detected in 81%-91% of samples and 67%-76% of samples had dual-class resistance. Complete three-compartment concordance was seen in only 10% of women. GT-proviral discordance was significantly larger than plasma-proviral discordance. GT or proviral mutations discordant from plasma led to clinically relevant resistance in 24% and 30%, respectively. We identified high resistance and high inter-compartmental resistance discordance in Indian women, which might lead to unrecognized resistance transmission and re-emergence compromising treatment outcomes, particularly relevant to countries like India, where sexual HIV transmission is predominant.

  19. A Variant PfCRT Isoform Can Contribute to Plasmodium falciparum Resistance to the First-Line Partner Drug Piperaquine

    Directory of Open Access Journals (Sweden)

    Satish K. Dhingra

    2017-05-01

    Full Text Available Current efforts to reduce the global burden of malaria are threatened by the rapid spread throughout Asia of Plasmodium falciparum resistance to artemisinin-based combination therapies, which includes increasing rates of clinical failure with dihydroartemisinin plus piperaquine (PPQ in Cambodia. Using zinc finger nuclease-based gene editing, we report that addition of the C101F mutation to the chloroquine (CQ resistance-conferring PfCRT Dd2 isoform common to Asia can confer PPQ resistance to cultured parasites. Resistance was demonstrated as significantly higher PPQ concentrations causing 90% inhibition of parasite growth (IC90 or 50% parasite killing (50% lethal dose [LD50]. This mutation also reversed Dd2-mediated CQ resistance, sensitized parasites to amodiaquine, quinine, and artemisinin, and conferred amantadine and blasticidin resistance. Using heme fractionation assays, we demonstrate that PPQ causes a buildup of reactive free heme and inhibits the formation of chemically inert hemozoin crystals. Our data evoke inhibition of heme detoxification in the parasite’s acidic digestive vacuole as the primary mode of both the bis-aminoquinoline PPQ and the related 4-aminoquinoline CQ. Both drugs also inhibit hemoglobin proteolysis at elevated concentrations, suggesting an additional mode of action. Isogenic lines differing in their pfmdr1 copy number showed equivalent PPQ susceptibilities. We propose that mutations in PfCRT could contribute to a multifactorial basis of PPQ resistance in field isolates.

  20. Tenofovir-based regimens associated with less drug resistance in HIV-1-infected Nigerians failing first-line antiretroviral therapy.

    Science.gov (United States)

    Etiebet, Mary-Ann A; Shepherd, James; Nowak, Rebecca G; Charurat, Man; Chang, Harry; Ajayi, Samuel; Elegba, Olufunmilayo; Ndembi, Nicaise; Abimiku, Alashle; Carr, Jean K; Eyzaguirre, Lindsay M; Blattner, William A

    2013-02-20

    In resource-limited settings, HIV-1 drug resistance testing to guide antiretroviral therapy (ART) selection is unavailable. We retrospectively conducted genotypic analysis on archived samples from Nigerian patients who received targeted viral load testing to confirm treatment failure and report their drug resistance mutation patterns. Stored plasma from 349 adult patients on non-nucleoside reverse transcriptase inhibitor (NNRTI) regimens was assayed for HIV-1 RNA viral load, and samples with more than 1000 copies/ml were sequenced in the pol gene. Analysis for resistance mutations utilized the IAS-US 2011 Drug Resistance Mutation list. One hundred and seventy-five samples were genotyped; the majority of the subtypes were G (42.9%) and CRF02_AG (33.7%). Patients were on ART for a median of 27 months. 90% had the M184V/I mutation, 62% had at least one thymidine analog mutation, and 14% had the K65R mutation. 97% had an NNRTI resistance mutation and 47% had at least two etravirine-associated mutations. In multivariate analysis tenofovir-based regimens were less likely to have at least three nucleoside reverse transcriptase inhibitor (NRTI) mutations after adjusting for subtype, previous ART, CD4, and HIV viral load [P < 0.001, odds ratio (OR) 0.04]. 70% of patients on tenofovir-based regimens had at least two susceptible NRTIs to include in a second-line regimen compared with 40% on zidovudine-based regimens (P = 0.04, OR = 3.4). At recognition of treatment failure, patients on tenofovir-based first-line regimens had fewer NRTI drug-resistant mutations and more active NRTI drugs available for second-line regimens. These findings can inform strategies for ART regimen sequencing to optimize long-term HIV treatment outcomes in low-resource settings.

  1. Proteomic Differences in Feline Fibrosarcomas Grown Using Doxorubicin-Sensitive and -Resistant Cell Lines in the Chick Embryo Model

    Directory of Open Access Journals (Sweden)

    Katarzyna Zabielska-Koczywąs

    2018-02-01

    Full Text Available Proteomic analyses are rapid and powerful tools that are used to increase the understanding of cancer pathogenesis, discover cancer biomarkers and predictive markers, and select and monitor novel targets for cancer therapy. Feline injection-site sarcomas (FISS are aggressive skin tumours with high recurrence rates, despite treatment with surgery, radiotherapy, and chemotherapy. Doxorubicin is a drug of choice for soft tissue sarcomas, including FISS. However, multidrug resistance is one of the major causes of chemotherapy failure. The main aim of the present study was to identify proteins that differentiate doxorubicin-resistant from doxorubicin-sensitive FISS using two-dimensional gel electrophoresis (2DE, followed by matrix-assisted laser desorption ionisation time-of-flight mass spectrometry (MALDI-TOF MS analysis. Using the three-dimensional (3D preclinical in ovo model, which resembles features of spontaneous fibrosarcomas, three significantly (p ≤ 0.05 differentially expressed proteins were identified in tumours grown from doxorubicin-resistant fibrosarcoma cell lines (FFS1 and FFS3 in comparison to the doxorubicin-sensitive one (FFS5: Annexin A5 (ANXA5, Annexin A3 (ANXA3, and meiosis-specific nuclear structural protein 1 (MNS1. Moreover, nine other proteins were significantly differentially expressed in tumours grown from the high doxorubicin-resistant cell line (FFS1 in comparison to sensitive one (FFS5. This study may be the first proteomic fingerprinting of FISS reported, identifying potential candidates for specific predictive biomarkers and research targets for doxorubicin-resistant FISS.

  2. Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

    Science.gov (United States)

    Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

    2018-02-27

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

  3. Plant breeding by using radiation mutation - Selection of herbicide-resistant cell lines by using {gamma}-rays

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyo Yeon [Sunchun University, Sunchun (Korea); Seo, Yong Weon [Korea University, Seoul (Korea)

    2000-04-01

    In order to develop the herbicide resistant cell lines, micro calli derived from rice anther culture and mature seed of wheat cultivars were irradiated with gamma rays. 1) The callus was dedifferentiated by 7 or 21 day pretreatment at 7 deg. C in two rice cultivars, Ilpumbyeo ad Dongjinbyeo. 2) To check the optimum concentration of herbicide, three herbicides were tested with micro calli. 3) The optimum dose of gamma ray to seeds of wheat seemed to be from 100 to 150 Gy. 4) AFLP and RAPD technique were established to develope herbicide resistant molecular marker in rice. 34 refs., 10 figs., 5 tabs. (Author)

  4. Distribution and Potential Impact of Feral Cotton on the ...

    African Journals Online (AJOL)

    Transgenic Bt cotton with insecticidal properties presents a potential solution to the bollworm infestation in Tanzania. However, concerns associated with transgenic crops viz.; transgene flow to wild and feral relatives, increased potential for resistance evolution, need to be addressed prior to adoption of any transgenic crop.

  5. Activation of ErbB3, EGFR and Erk is essential for growth of human breast cancer cell lines with acquired resistance to fulvestrant

    DEFF Research Database (Denmark)

    Frogne, Thomas; Benjaminsen, Rikke; Sonne-Hansen, Katrine

    2008-01-01

    cell lines concomitant with inhibition of Erk and unaltered Akt activation. In concert, inhibition of Erk with U0126 preferentially reduced growth of resistant cell lines. Treatment with ErbB3 neutralizing antibodies inhibited ErbB3 activation and resulted in a modest but statistically significant...... activation was observed only in the parental MCF-7 cells. The downstream kinases pAkt and pErk were increased in five of seven and in all seven resistant cell lines, respectively. Treatment with the EGFR inhibitor gefitinib preferentially inhibited growth and reduced the S phase fraction in the resistant...... growth inhibition of two resistant cell lines. These data indicate that ligand activated ErbB3 and EGFR, and Erk signaling play important roles in fulvestrant resistant cell growth. Furthermore, the decreased level of ErbB4 in resistant cells may facilitate heterodimerization of ErbB3 with EGFR and ErbB2...

  6. A rapid seedling resistance assay identifies wild tomato lines that are resistant to Psuedomonas syringe pv. tomato race 1

    Science.gov (United States)

    Bacterial speck caused by Pseudomonas syringae has historically been controlled by the Pto/Prf gene cluster. Emerging strains like P. syringae pv. tomato race 1 overcome resistance conferred by Pto/Prf, and can cause serious crop loss under appropriate environmental conditions. We developed a rapid ...

  7. Ability of polymer-bound P-glycoprotein inhibitor ritonavir to overcome multidrug resistance in various resistant neuroblastoma cell lines

    Czech Academy of Sciences Publication Activity Database

    Koziolová, Eva; Chytil, Petr; Etrych, Tomáš; Janoušková, Olga

    2017-01-01

    Roč. 28, č. 10 (2017), s. 1126-1130 ISSN 0959-4973 R&D Projects: GA MŠk(CZ) LO1507 Institutional support: RVO:61389013 Keywords : drug-delivery polymers * multidrug resistance * N-(2-hydroxypropyl) methacrylamide Subject RIV: CD - Macromolecular Chemistry OBOR OECD: Polymer science Impact factor: 2.320, year: 2016

  8. Combining ability of summer-squash lines with different degrees of parthenocarpy and PRSV-W resistance

    OpenAIRE

    Nogueira, Douglas Willian; Maluf, Wilson Roberto; Figueira, Antonia dos Reis; Maciel, Gabriel Mascarenhas; Gomes, Luiz Antonio Augusto; Benavente, Cesar Augusto Ticona

    2011-01-01

    The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain). The hybrids were obtained using a partial diallel cross design (4 ? 4). The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G-77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-...

  9. Transgenic Cotton Plants Expressing Double-stranded RNAs Target HMG-CoA Reductase (HMGR) Gene Inhibits the Growth, Development and Survival of Cotton Bollworms.

    Science.gov (United States)

    Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia

    2015-01-01

    RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control.

  10. GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5.

    Science.gov (United States)

    Guo, Ying-Hui; Yu, Yue-Ping; Wang, Dong; Wu, Chang-Ai; Yang, Guo-Dong; Huang, Jin-Guang; Zheng, Cheng-Chao

    2009-01-01

    * Zinc finger proteins are a superfamily involved in many aspects of plant growth and development. However, CCCH-type zinc finger proteins involved in plant stress tolerance are poorly understood. * A cDNA clone designated Gossypium hirsutum zinc finger protein 1 (GhZFP1), which encodes a novel CCCH-type zinc finger protein, was isolated from a salt-induced cotton (G. hirsutum) cDNA library using differential hybridization screening and further studied in transgenic tobacco Nicotiana tabacum cv. NC89. Using yeast two-hybrid screening (Y2H), proteins GZIRD21A (GhZFP1 interacting and responsive to dehydration protein 21A) and GZIPR5 (GhZFP1 interacting and pathogenesis-related protein 5), which interacted with GhZFP1, were isolated. * GhZFP1 contains two typical zinc finger motifs (Cx8Cx5Cx3H and Cx5Cx4Cx3H), a putative nuclear export sequence (NES) and a potential nuclear localization signal (NLS). Transient expression analysis using a GhZFP1::GFP fusion gene in onion epidermal cells indicated a nuclear localization for GhZFP1. RNA blot analysis showed that the GhZFP1 transcript was induced by salt (NaCl), drought and salicylic acid (SA). The regions in GhZFP1 that interact with GZIRD21A and GZIPR5 were identified using truncation mutations. * Overexpression of GhZFP1 in transgenic tobacco enhanced tolerance to salt stress and resistance to Rhizoctonia solani. Therefore, it appears that GhZFP1 might be involved as an important regulator in plant responses to abiotic and biotic stresses.

  11. Superhydrophobic cotton by fluorosilane modification

    CSIR Research Space (South Africa)

    Erasmus, E

    2009-12-01

    Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...

  12. The performance of cutinase and pectinase in cotton scouring

    NARCIS (Netherlands)

    Agrawal, Pramod

    2005-01-01

    Advances in biotechnology and enzymology have brought new lines of research and have accelerated the development of enzymatic applications in wet textile processing for now nearly one decade. Amongst the various stages of cotton preparation, wet textile processing is a highly energy, water and

  13. Effects of solidified microstructures on J-R fracture resistances of the surge line pipe welds

    International Nuclear Information System (INIS)

    Youn, J. H.; Lee, B. S.; Yoo, W.

    2003-01-01

    The cause of the difference in J-R fracture resistances of AISI Type 347 GTAW welds which had almost same amounts of chromium carbides were investigated by the microstructural observations. As a result, the difference in the fracture resistances with the morphologies of the retained δ-ferrites in Type 347 welds were observed. The fracture resistance of the weld which had mostly vermicular type δ-ferrites was inferior to the weld which has lacy and acicular mixed type δ-ferrites. Therefore, it was deduced that the morphology of δ-ferrites affected the J-R fracture resistances of Type 347 welds

  14. Fabrication of recyclable superhydrophobic cotton fabrics

    Science.gov (United States)

    Han, Sang Wook; Park, Eun Ji; Jeong, Myung-Geun; Kim, Il Hee; Seo, Hyun Ook; Kim, Ju Hwan; Kim, Kwang-Dae; Kim, Young Dok

    2017-04-01

    Commercial cotton fabric was coated with SiO2 nanoparticles wrapped with a polydimethylsiloxane (PDMS) layer, and the resulting material surface showed a water contact angle greater than 160°. The superhydrophobic fabric showed resistance to water-soluble contaminants and maintained its original superhydrophobic properties with almost no alteration even after many times of absorption-washing cycles of oil. Moreover, superhydrophobic fabric can be used as a filter to separate oil from water. We demonstrated a simple method of fabrication of superhydrophobic fabric with potential interest for use in a variety of applications.

  15. Genome-wide mutagenesis and multi-drug resistance in American trypanosomes induced by the front-line drug benznidazole

    KAUST Repository

    Campos, Mônica C.

    2017-10-25

    Chagas disease is caused by the protozoan parasite Trypanosoma cruzi and affects 5–8 million people in Latin America. Although the nitroheterocyclic compound benznidazole has been the front-line drug for several decades, treatment failures are common. Benznidazole is a pro-drug and is bio-activated within the parasite by the mitochondrial nitroreductase TcNTR-1, leading to the generation of reactive metabolites that have trypanocidal activity. To better assess drug action and resistance, we sequenced the genomes of T. cruzi Y strain (35.5 Mb) and three benznidazole-resistant clones derived from a single drug-selected population. This revealed the genome-wide accumulation of mutations in the resistant parasites, in addition to variations in DNA copy-number. We observed mutations in DNA repair genes, linked with increased susceptibility to DNA alkylating and inter-strand cross-linking agents. Stop-codon-generating mutations in TcNTR-1 were associated with cross-resistance to other nitroheterocyclic drugs. Unexpectedly, the clones were also highly resistant to the ergosterol biosynthesis inhibitor posaconazole, a drug proposed for use against T. cruzi infections, in combination with benznidazole. Our findings therefore identify the highly mutagenic activity of benznidazole metabolites in T. cruzi, demonstrate that this can result in multi-drug resistance, and indicate that vigilance will be required if benznidazole is used in combination therapy.

  16. Lines of resistance: evoking and configuring the theme of resistance in museum displays in Britain around the bicentenary of 1807

    Directory of Open Access Journals (Sweden)

    Geoffrey Cubitt

    2010-11-01

    Full Text Available On the basis of an extensive survey of museum displays and exhibitions dealing with slavery and abolition, put on at the time of the 2007 Bicentenary of the Act of Abolition, this article explores, and suggests ways of analysing, the ways in which museums in Britain presented, evoked and interpreted the theme of resistance or rebellion by the enslaved. By recognising the importance of resistance, museums aimed to affirm the agency of the enslaved and to counterbalance the celebratory tendencies of abolitionist historiography; they were also, in some cases, seeking to position themselves less as authoritative purveyors of knowledge than as arenas for the articulation of competing narratives and the negotiation of social and cultural identities. Yet museums’ efforts to foreground the theme of resistance were often limited in character: the importance of the theme was announced, but treatments of it were brief and schematic, dependent on a limited range of materials, and not always convincingly woven into the larger narratives of the exhibition. The article explores some of the reasons for this, before analysing in more detail the presentational strategies of a number of exhibitions which did develop a larger or more complex handling of the theme of resistance. Here the analysis uses a distinction between ‘gestural’ and ‘expository’ presentational emphases to map similarities and differences between these displays, and in particular between the strategies two new and major permanent exhibits opened in 2007: the International Slavery Museum in Liverpool and the re-designed Wilberforce House Museum in Hull.

  17. Biological Activity of Carbazole Alkaloids and Essential Oil of Murraya koenigii Against Antibiotic Resistant Microbes and Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Thilahgavani Nagappan

    2011-11-01

    Full Text Available A total of three carbazole alkaloids and essential oil from the leaves of Murraya koenigii (Rutaceae were obtained and examined for their effects on the growth of five antibiotic resistant pathogenic bacteria and three tumor cell lines (MCF-7, P 388 and Hela. The structures of these carbazoles were elucidated based on spectroscopy data and compared with literature data, hence, were identified as mahanine (1, mahanimbicine (2 and mahanimbine (3. The chemical constituents of the essential oil were identified using Gas Chromatography-Mass Spectroscopy (GCMS. These compounds exhibited potent inhibition against antibiotic resistant bacteria such as Staphylococcus aureus (210P JTU, Psedomonas aeruginosa (ATCC 25619, Klebsiella pneumonia (SR1-TU, Escherchia coli (NI23 JTU and Streptococcus pneumoniae (SR16677-PRSP with significant minimum inhibition concentration (MIC values (25.0–175.0 mg/mL and minimum bacteriacidal concentrations (MBC (100.0–500.0 mg/mL. The isolated compounds showed significant antitumor activity against MCF-7, Hela and P388 cell lines. Mahanimbine (3 and essential oil in particular showed potent antibacteria and cytotoxic effect with dose dependent trends (≤5.0 μg/mL. The findings from this investigation are the first report of carbazole alkaloids’ potential against antibiotic resistant clinical bacteria, MCF-7 and P388 cell lines.

  18. Comparative effectiveness of fourth-line anti-hypertensive agents in resistant hypertension: A systematic review and meta-analysis.

    Science.gov (United States)

    Sinnott, Sarah-Jo; Tomlinson, Laurie A; Root, Adrian A; Mathur, Rohini; Mansfield, Kathryn E; Smeeth, Liam; Douglas, Ian J

    2017-02-01

    Aim We assessed the effectiveness of fourth-line mineralocorticoid receptor antagonists in comparison with other fourth-line anti-hypertensive agents in resistant hypertension. Methods and results We systematically searched Medline, EMBASE and the Cochrane library from database inception until January 2016. We included randomised and non-randomised studies that compared mineralocorticoid receptor antagonists with other fourth-line anti-hypertensive agents in patients with resistant hypertension. The outcome was change in systolic blood pressure, measured in the office, at home or by ambulatory blood pressure monitoring. Secondary outcomes were changes in serum potassium and occurrence of hyperkalaemia. We used random effects models and assessed statistical heterogeneity using the I 2 test and corresponding 95% confidence intervals. From 2,506 records, 5 studies met our inclusion criteria with 755 included patients. Two studies were randomised and three were non-randomised. Comparative fourth-line agents included bisoprolol, doxazosin, furosemide and additional blockade of the renin angiotensin-aldosterone system. Using data from randomised studies, mineralocorticoid receptor antagonists reduced blood pressure by 7.4 mmHg (95%CI 3.2 - 11.6) more than the active comparator. When limited to non-randomised studies, mineralocorticoid receptor antagonists reduced blood pressure by 11.9 mmHg (95% CI 9.3 - 14.4) more than the active comparator. Conclusion On the basis of this meta-analysis, mineralocorticoid receptor antagonists reduce blood pressure more effectively than other fourth-line agents in resistant hypertension. Effectiveness stratified by ethnicity and comorbidities, in addition to information on clinical outcomes such as myocardial infarction and stroke, now needs to be determined.

  19. Technetium-99m sestamibi uptake in human breast carcinoma cell lines displaying glutathione-associated drug-resistance

    International Nuclear Information System (INIS)

    Kabasakal, L.; Oezker, K.; Hayward, M.; Akansel, G.; Griffith, O.; Isitman, A.T.; Hellman, R.; Collier, D.

    1996-01-01

    An in vitro study was designed to evaluate the uptake of sestamibi (MIBI) in P-glycoprotein (Pgp) and glutathione-associated (GSH) multidrug-resistant (MDR) cell lines. MIBI uptake was studied in various human breast carcinoma cell lines, i.e. in wild-type (MCF7/wt) cells, in adriamycin-resistant (MCF7/adr) cells which express Pgp and in melphalan-resistant (MCF7/mph) cells with increased levels of GSH. The effects of buthiomine sulphoximine (BSO) and verapamil on MIBI uptake were also studied in the MCF7/mph and MCF7/adr cells respectively. The cells were incubated for 1 h with a dose of 0.1 MBq thallium-201 and technetium-99m MIBI. Both BIBI and 201 Tl uptakes were higher for MCF7/mph cells than for the other cells studied. The mean MIBI uptake in MCF7/adr cells was significantly lower than that in MCF7/wt cells (1.9%±0.5% vs 3.1%.0.6%; P 0.1). This study suggests that the uptake of MIBI is not diminished by glutathione-associated drug resistance and that MIBI uptake in a tumour sample does not necessarly indicate that a cancer is sensitive to drugs. (orig.)

  20. Effect of pretreatment HIV-1 drug resistance on immunological, virological, and drug-resistance outcomes of first-line antiretroviral treatment in sub-Saharan Africa: a multicentre cohort study

    NARCIS (Netherlands)

    Hamers, Raph L.; Schuurman, Rob; Sigaloff, Kim C. E.; Wallis, Carole L.; Kityo, Cissy; Siwale, Margaret; Mandaliya, Kishor; Ive, Prudence; Botes, Mariette E.; Wellington, Maureen; Osibogun, Akin; Wit, Ferdinand W.; van Vugt, Michèle; Stevens, Wendy S.; de Wit, Tobias F. Rinke

    2012-01-01

    Background The effect of pretreatment HIV-1 drug resistance on the response to first-line combination antiretroviral therapy (ART) in sub-Saharan Africa has not been assessed. We studied pretreatment drug resistance and virological, immunological, and drug-resistance treatment outcomes in a large

  1. A population-based study of first and second-line drug-resistant tuberculosis in a high-burden area of the Mexico/United States border

    Directory of Open Access Journals (Sweden)

    Pola Becerril-Montes

    2013-04-01

    Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

  2. Inheritance and molecular mapping of anthracnose resistance genes present in sorghum line SC112-14

    Science.gov (United States)

    Anthracnose (Colletotrichum sublineolum) is one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) affecting all aerial tissues of the plant. The most effective strategy for its control is the incorporation of resistance genes. Therefore, the anthracnose resistance response pr...

  3. In vitro phenotypic, genomic and proteomic characterization of a cytokine-resistant murine β-TC3 cell line.

    Directory of Open Access Journals (Sweden)

    Antonina Coppola

    Full Text Available Type 1 diabetes mellitus (T1DM is caused by the selective destruction of insulin-producing β-cells. This process is mediated by cells of the immune system through release of nitric oxide, free radicals and pro-inflammatory cytokines, which induce a complex network of intracellular signalling cascades, eventually affecting the expression of genes involved in β-cell survival.The aim of our study was to investigate possible mechanisms of resistance to cytokine-induced β-cell death. To this purpose, we created a cytokine-resistant β-cell line (β-TC3R by chronically treating the β-TC3 murine insulinoma cell line with IL-1β + IFN-γ. β-TC3R cells exhibited higher proliferation rate and resistance to cytokine-mediated cell death in comparison to the parental line. Interestingly, they maintained expression of β-cell specific markers, such as PDX1, NKX6.1, GLUT2 and insulin. The analysis of the secretory function showed that β-TC3R cells have impaired glucose-induced c-peptide release, which however was only moderately reduced after incubation with KCl and tolbutamide. Gene expression analysis showed that β-TC3R cells were characterized by downregulation of IL-1β and IFN-γ receptors and upregulation of SOCS3, the classical negative regulator of cytokines signaling. Comparative proteomic analysis showed specific upregulation of 35 proteins, mainly involved in cell death, stress response and folding. Among them, SUMO4, a negative feedback regulator in NF-kB and JAK/STAT signaling pathways, resulted hyper-expressed. Silencing of SUMO4 was able to restore sensitivity to cytokine-induced cell death in β-TC3R cells, suggesting it may play a key role in acquired cytokine resistance by blocking JAK/STAT and NF-kB lethal signaling.In conclusion, our study represents the first extensive proteomic characterization of a murine cytokine-resistant β-cell line, which might represent a useful tool for studying the mechanisms involved in resistance to

  4. MicroRNA signature of cis-platin resistant vs. cis-platin sensitive ovarian cancer cell lines

    Directory of Open Access Journals (Sweden)

    Kumar Smriti

    2011-09-01

    Full Text Available Abstract Background Ovarian cancer is the leading cause of death from gynecologic cancer in women worldwide. According to the National Cancer Institute, ovarian cancer has the highest mortality rate among all the reproductive cancers in women. Advanced stage diagnosis and chemo/radio-resistance is a major obstacle in treating advanced ovarian cancer. The most commonly employed chemotherapeutic drug for ovarian cancer treatment is cis-platin. As with most chemotherapeutic drugs, many patients eventually become resistant to cis-platin and therefore, diminishing its effect. The efficacy of current treatments may be improved by increasing the sensitivity of cancer cells to chemo/radiation therapies. Methods The present study is focused on identifying the differential expression of regulatory microRNAs (miRNAs between cis-platin sensitive (A2780, and cis-platin resistant (A2780/CP70 cell lines. Cell proliferation assays were conducted to test the sensitivity of the two cell lines to cis-platin. Differential expression patterns of miRNA between cis-platin sensitive and cis-platin resistant cell lines were analyzed using novel LNA technology. Results Our results revealed changes in expression of 11 miRNAs out of 1,500 miRNAs analyzed. Out of the 11 miRNAs identified, 5 were up-regulated in the A2780/CP70 cell line and 6 were down regulated as compared to cis-platin sensitive A2780 cells. Our microRNA data was further validated by quantitative real-time PCR for these selected miRNAs. Ingenuity Pathway Analysis (IPA and Kyoto Encyclopedia of Genes and Genomes (KEGG analysis was performed for the selected miRNAs and their putative targets to identify the potential pathways and networks involved in cis-platin resistance. Conclusions Our data clearly showed the differential expression of 11 miRNAs in cis-platin resistant cells, which could potentially target many important pathways including MAPK, TGF-β signaling, actin cytoskeleton, ubiquitin mediated

  5. Notice of release of iceberg, romaine, and leaf lettuce breeding lines with improved disease resistance

    Science.gov (United States)

    The Agricultural Research Service, U.S. Department of Agriculture announces the release of sixteen breeding lines of lettuce (Lactuca sativa L.). Five (SM13-Il, SM13-I2, SM13-I3, SM13-I4, and SM13-I5) of the six iceberg breeding lines can be used for whole head or salad blend production; the sixth i...

  6. Evaluation of the Impact of Genetically Modified Cotton After 20 Years of Cultivation in Mexico

    Directory of Open Access Journals (Sweden)

    Martha G. Rocha-Munive

    2018-06-01

    Full Text Available For more than 20 years cotton has been the most widely sown genetically modified (GM crop in Mexico. Its cultivation has fulfilled all requirements and has gone through the different regulatory stages. During the last 20 years, both research-institutions and biotech-companies have generated scientific and technical information regarding GM cotton cultivation in Mexico. In this work, we collected data in order to analyze the environmental and agronomic effects of the use of GM cotton in Mexico. In 1996, the introduction of Bt cotton made it possible to reactivate this crop, which in previous years was greatly reduced due to pest problems, production costs and environmental concerns. Bt cotton is a widely accepted tool for cotton producers and has proven to be efficient for the control of lepidopteran pests. The economic benefits of its use are variable, and depend on factors such as the international cotton-prices and other costs associated with its inputs. So far, the management strategies used to prevent development of insect resistance to GM cotton has been successful, and there are no reports of insect resistance development to Bt cotton in Mexico. In addition, no effects have been observed on non-target organisms. For herbicide tolerant cotton, the prevention of herbicide resistance has also been successful since unlike other countries, the onset of resistance weeds is still slow, apparently due to cultural practices and rotation of different herbicides. Environmental benefits have been achieved with a reduction in chemical insecticide applications and the subsequent decrease in primary pest populations, so that the inclusion of other technologies—e.g., use of non-Bt cotton- can be explored. Nevertheless, control measures need to be implemented during transport of the bolls and fiber to prevent dispersal of volunteer plants and subsequent gene flow to wild relatives distributed outside the GM cotton growing areas. It is still necessary to

  7. Impact of Bollgard cotton on Indian cotton production and Income of ...

    Indian Academy of Sciences (India)

    Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.

  8. Assessing the Economic Impact of inversion tillage, cover crops, and herbicide regimes in palmer amaranth (Amaranthus palmeri) infested cotton

    Science.gov (United States)

    Cotton (Gossypium hirsutum L.) producers in Alabama and across the Cotton Belt are faced with a rapidly expanding problem that decreases yields and increases production costs: herbicide-resistant weeds. Producers are increasingly relying on production methods that raise production costs, such as add...

  9. THE POTENTIAL IMPACTS OF THE PORT OF SALVADOR IMPROVEMENTS ON THE BRAZILIAN COTTON INDUSTRY

    Directory of Open Access Journals (Sweden)

    Rafael Costa

    2015-01-01

    Full Text Available A spatial price equilibrium model of the international cotton sector was used to analyze the impacts of the Port of Salvador improvements on the Brazilian cotton industry and world cotton trade. The port of Salvador is undergoing relevant improvements in its facilities and physical structure. As a result of these improvements, the port of Salvador is expected to become more competitive and attract ocean shipping companies which are willing to export products directly to Asian importing markets. Scenarios with different reduction in export cost for the port of Salvador were examined. For all scenarios, the new direct ocean shipping lines were found to be important for the cotton exporters in Brazil, especially for the producers in the state of Bahia. In addition, results suggested that the state of Bahia would have the potential of becoming the largest cotton exporting state in Brazil.

  10. In vitro stemness characterization of radio-resistant clones isolated from a medulloblastoma cell line ONS-76

    International Nuclear Information System (INIS)

    Sun, Lue; Suzuki, Kenshi; Gerelchuluun, Ariungerel; Hong, Zhengshan; Moritake, Takashi; Zenkoh, Junko; Tsuboi, Koji; Zheng, Yun-Wen; Taniguchi, Hideki

    2013-01-01

    One-third of patients with medulloblastoma die due to recurrence after various treatments including radiotherapy. Although it has been postulated that cancer stem-like cells are radio-resistant and play an important role in tumor recurrence, the 'stemness' of medulloblastoma cells surviving irradiation has not yet been elucidated. Using a medulloblastoma cell line ONS-76, cells that survived gamma irradiation were investigated on their 'stemness' in vitro. From 10 500 cells, 20 radio-resistant clones were selected after gamma ray irradiation (5 Gy x two fractions) using the replica micro-well technique. These 20 resistant clones were screened for CD133 positivity by flow cytometry followed by side population assay, tumor sphere formation assay and clonogenic survival assay. Results revealed CD133 fractions were significantly elevated in three clones, which also exhibited significantly increased levels of tumor sphere formation ability and side population fraction. Clonogenic survival assay demonstrated that their radio-resistance was significantly higher than the parental ONS-76. This may support the hypothesis that a small number of cancer stem-like cells (CSCs) are the main culprits in local recurrence after radiotherapy, and disruption of the resistance mechanism of these CSCs is a critical future issue in improving the outcome of patients with medulloblastoma. (author)

  11. Extensively and Pre-Extensively Drug Resistant Tuberculosis in Clinical Isolates of Multi-Drug Resistant Tuberculosis Using Classical Second Line Drugs (Levofloxacin and Amikacin)

    International Nuclear Information System (INIS)

    Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.

    2015-01-01

    Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)

  12. Regulation of Multidrug Resistance Proteins by Genistein in a Hepatocarcinoma Cell Line: Impact on Sorafenib Cytotoxicity

    OpenAIRE

    Rigalli, Juan Pablo; Ciriaci, Nadia; Arias, Agostina; Ceballos, Mar?a Paula; Villanueva, Silvina Stella Maris; Luquita, Marcelo Gabriel; Mottino, Aldo Domingo; Ghanem, Carolina In?s; Catania, Viviana Alicia; Ruiz, Mar?a Laura

    2015-01-01

    Hepatocellular carcinoma (HCC) is the fifth most frequent cancer worldwide. Sorafenib is the only drug available that improves the overall survival of HCC patients. P-glycoprotein (P-gp), Multidrug resistance-associated proteins 2 and 3 (MRP2 and 3) and Breast cancer resistance protein (BCRP) are efflux pumps that play a key role in cancer chemoresistance. Their modulation by dietary compounds may affect the intracellular accumulation and therapeutic efficacy of drugs that are substrates of t...

  13. Rectangular Schlumberger resistivity arrays for delineating vadose zone clay-lined fractures in shallow tuff

    International Nuclear Information System (INIS)

    Miele, M.; Laymon, D.; Gilkeson, R.; Michelotti, R.

    1996-01-01

    Rectangular Schlumberger arrays can be used for 2-dimensional lateral profiling of apparent resistivity at a unique current electrode separation, hence single depth of penetration. Numerous apparent resistivity measurements are collected moving the potential electrodes (fixed MN spacing) within a rectangle of defined dimensions. The method provides a fast, cost-effective means for the collection of dense resistivity data to provide high-resolution information on subsurface hydrogeologic conditions. Several rectangular Schlumberger resistivity arrays were employed at Los Alamos National Laboratory (LANL) from 1989 through 1995 in an area adjacent to and downhill from an outfall pipe, septic tank, septic drainfield, and sump. Six rectangular arrays with 2 AB spacings were used to delineate lateral low resistivity anomalies that may be related to fractures that contain clay and/or vadose zone water. Duplicate arrays collected over a three year time period exhibited very good data repeatability. The properties of tritium make it an excellent groundwater tracer. Because tritium was present in discharged water from all of the anthropogenic sources in the vicinity it was used for this purpose. One major low resistivity anomaly correlates with relatively high tritium concentrations in the tuff. This was determined from borehole samples collected within and outside of the anomalous zone. The anomaly is interpreted to be due to fractures that contain clay from the soil profile. The clay was deposited in the fractures by aeolian processes and by surface water infiltration. The fractures likely served as a shallow vadose zone groundwater pathway

  14. Antimicrobial susceptibility testing before first-line treatment for Helicobacter pylori infection in patients with dual or triple antibiotic resistance.

    Science.gov (United States)

    Cosme, Angel; Montes, Milagrosa; Ibarra, Begoña; Tamayo, Esther; Alonso, Horacio; Mendarte, Usua; Lizasoan, Jacobo; Herreros-Villanueva, Marta; Bujanda, Luis

    2017-05-14

    To evaluate the efficacy of antimicrobial susceptibility-guided therapy before first-line treatment for infection in patients with dual or triple antibiotic resistance. A total of 1034 patients infected by Helicobacter pylori ( H. pylori ) during 2013-2014 were tested for antimicrobial susceptibility. 157 of 1034 (15%) patients showed resistance to two (127/1034; 12%) and to three (30/1034; 3%) antibiotics. Sixty-eight patients with dual H. pylori -resistance (clarithromycin, metronidazole or levofloxacin) were treated for 10 d with triple therapies: OAL (omeprazole 20 mg b.i.d., amoxicillin 1 g b.i.d., and levofloxacin 500 mg b.i.d.) 43 cases, OAM (omeprazole 20 mg b.i.d., amoxicillin 1 g b.i.d., and metronidazole 500 mg b.i.d.) 12 cases and OAC (omeprazole 20 mg b.id., amoxicillin 1 g b.i.d., and clarithromycin 500 mg b.i.d.) 13 cases based on the antimicrobial susceptibility testing. Twelve patients showed triple H. pylori -resistance (clarithromycin, metronidazole and levofloxacin) and received for 10 d triple therapy with OAR (omeprazole 20 mg b.id., amoxicillin 1 g b.i.d., and rifabutin 150 mg b.i.d.). Eradication was confirmed by 13C-urea breath test. Adverse effects and compliance were assessed by a questionnaire. Intention-to-treat eradication rates were: OAL (97.6%), OAM (91.6%), OAC (92.3%) and OAR (58.3%). Cure rate was significantly higher in naïve patients treated with OAR-10 compared to patients who had two or three previous treatment failures (83% vs 33%). Adverse events rates for OAL, OAM, OAC and OAR were 22%, 25%, 23% and 17%, respectively, all of them mild-moderate. Antimicrobial susceptibility-guided triple therapies during 10 d for first-line treatment leads to an eradication rate superior to 90% in patients with dual antibiotic H. pylori resistance.

  15. Molecular Cytogenetic Identification of a New Wheat-Rye 6R Chromosome Disomic Addition Line with Powdery Mildew Resistance.

    Directory of Open Access Journals (Sweden)

    Diaoguo An

    Full Text Available Rye (Secale cereale L. possesses many valuable genes that can be used for improving disease resistance, yield and environment adaptation of wheat (Triticum aestivum L.. However, the documented resistance stocks derived from rye is faced severe challenge due to the variation of virulent isolates in the pathogen populations. Therefore, it is necessary to develop desirable germplasm and search for novel resistance gene sources against constantly accumulated variation of the virulent isolates. In the present study, a new wheat-rye line designated as WR49-1 was produced through distant hybridization and chromosome engineering protocols between common wheat cultivar Xiaoyan 6 and rye cultivar German White. Using sequential GISH (genomic in situ hybridization, mc-FISH (multicolor fluorescence in situ hybridization, mc-GISH (multicolor GISH and EST (expressed sequence tag-based marker analysis, WR49-1 was proved to be a new wheat-rye 6R disomic addition line. As expected, WR49-1 showed high levels of resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici, Bgt pathogens prevalent in China at the adult growth stage and 19 of 23 Bgt isolates tested at the seedling stage. According to its reaction pattern to different Bgt isolates, WR49-1 may possess new resistance gene(s for powdery mildew, which differed from the documented powdery mildew gene, including Pm20 on chromosome arm 6RL of rye. Additionally, WR49-1 was cytologically stable, had improved agronomic characteristics and therefore could serve as an important bridge for wheat breeding and chromosome engineering.

  16. Genetic Analysis of Fusarium Head Blight Resistance in CIMMYT Bread Wheat Line C615 Using Traditional and Conditional QTL Mapping.

    Science.gov (United States)

    Yi, Xin; Cheng, Jingye; Jiang, Zhengning; Hu, Wenjing; Bie, Tongde; Gao, Derong; Li, Dongsheng; Wu, Ronglin; Li, Yuling; Chen, Shulin; Cheng, Xiaoming; Liu, Jian; Zhang, Yong; Cheng, Shunhe

    2018-01-01

    Fusarium head blight (FHB) is a destructive wheat disease present throughout the world, and host resistance is an effective and economical strategy used to control FHB. Lack of adequate resistance resource is still a main bottleneck for FHB genetics and wheat breeding research. The synthetic-derived bread wheat line C615, which does not carry the Fhb1 gene, is a promising source of FHB resistance for breeding. A population of 198 recombinant inbred lines (RILs) produced by crossing C615 with the susceptible cultivar Yangmai 13 was evaluated for FHB response using point and spray inoculations. As the disease phenotype is frequently complicated by other agronomic traits, we used both traditional and multivariate conditional QTL mapping approaches to investigate the genetic relationships (at the individual QTL level) between FHB resistance and plant height (PH), spike compactness (SC), and days to flowering (FD). A linkage map was constructed from 3,901 polymorphic SNP markers, which covered 2,549.2 cM. Traditional and conditional QTL mapping analyses found 13 and 22 QTL for FHB, respectively; 10 were identified by both methods. Among these 10, three QTL from C615 were detected in multiple years; these QTL were located on chromosomes 2AL, 2DS, and 2DL. Conditional QTL mapping analysis indicated that, at the QTL level, SC strongly influenced FHB in point inoculation; whereas PH and SC contributed more to FHB than did FD in spray inoculation. The three stable QTL ( QFhbs-jaas.2AL, QFhbp-jaas.2DS , and QFhbp-jaas.2DL ) for FHB were partly affected by or were independent of the three agronomic traits. The QTL detected in this study improve our understanding of the genetic relationships between FHB response and related traits at the QTL level and provide useful information for marker-assisted selection for the improvement of FHB resistance in breeding.

  17. Genetic Analysis of Fusarium Head Blight Resistance in CIMMYT Bread Wheat Line C615 Using Traditional and Conditional QTL Mapping

    Science.gov (United States)

    Yi, Xin; Cheng, Jingye; Jiang, Zhengning; Hu, Wenjing; Bie, Tongde; Gao, Derong; Li, Dongsheng; Wu, Ronglin; Li, Yuling; Chen, Shulin; Cheng, Xiaoming; Liu, Jian; Zhang, Yong; Cheng, Shunhe

    2018-01-01

    Fusarium head blight (FHB) is a destructive wheat disease present throughout the world, and host resistance is an effective and economical strategy used to control FHB. Lack of adequate resistance resource is still a main bottleneck for FHB genetics and wheat breeding research. The synthetic-derived bread wheat line C615, which does not carry the Fhb1 gene, is a promising source of FHB resistance for breeding. A population of 198 recombinant inbred lines (RILs) produced by crossing C615 with the susceptible cultivar Yangmai 13 was evaluated for FHB response using point and spray inoculations. As the disease phenotype is frequently complicated by other agronomic traits, we used both traditional and multivariate conditional QTL mapping approaches to investigate the genetic relationships (at the individual QTL level) between FHB resistance and plant height (PH), spike compactness (SC), and days to flowering (FD). A linkage map was constructed from 3,901 polymorphic SNP markers, which covered 2,549.2 cM. Traditional and conditional QTL mapping analyses found 13 and 22 QTL for FHB, respectively; 10 were identified by both methods. Among these 10, three QTL from C615 were detected in multiple years; these QTL were located on chromosomes 2AL, 2DS, and 2DL. Conditional QTL mapping analysis indicated that, at the QTL level, SC strongly influenced FHB in point inoculation; whereas PH and SC contributed more to FHB than did FD in spray inoculation. The three stable QTL (QFhbs-jaas.2AL, QFhbp-jaas.2DS, and QFhbp-jaas.2DL) for FHB were partly affected by or were independent of the three agronomic traits. The QTL detected in this study improve our understanding of the genetic relationships between FHB response and related traits at the QTL level and provide useful information for marker-assisted selection for the improvement of FHB resistance in breeding. PMID:29780395

  18. Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.

    Science.gov (United States)

    Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

    2014-06-01

    Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.

  19. Piperlongumine inhibits the proliferation and survival of B-cell acute lymphoblastic leukemia cell lines irrespective of glucocorticoid resistance

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seong-Su, E-mail: seong-su-han@uiowa.edu [Division of Pediatric Hematology-Oncology, University of Iowa Carver College of Medicine, Iowa City, IA (United States); Han, Sangwoo [Health and Human Physiology, University of Iowa Carver College of Medicine, Iowa City, IA (United States); Kamberos, Natalie L. [Division of Pediatric Hematology-Oncology, University of Iowa Carver College of Medicine, Iowa City, IA (United States)

    2014-09-26

    Highlights: • PL inhibits the proliferation of B-ALL cell lines irrespective of GC-resistance. • PL selectively kills B-ALL cells by increasing ROS, but not normal counterpart. • PL does not sensitize majority of B-ALL cells to DEX. • PL represses the network of constitutively activated TFs and modulates their target genes. • PL may serve as a new therapeutic molecule for GC-resistant B-ALL. - Abstract: Piperlongumine (PL), a pepper plant alkaloid from Piper longum, has anti-inflammatory and anti-cancer properties. PL selectively kills both solid and hematologic cancer cells, but not normal counterparts. Here we evaluated the effect of PL on the proliferation and survival of B-cell acute lymphoblastic leukemia (B-ALL), including glucocorticoid (GC)-resistant B-ALL. Regardless of GC-resistance, PL inhibited the proliferation of all B-ALL cell lines, but not normal B cells, in a dose- and time-dependent manner and induced apoptosis via elevation of ROS. Interestingly, PL did not sensitize most of B-ALL cell lines to dexamethasone (DEX). Only UoC-B1 exhibited a weak synergistic effect between PL and DEX. All B-ALL cell lines tested exhibited constitutive activation of multiple transcription factors (TFs), including AP-1, MYC, NF-κB, SP1, STAT1, STAT3, STAT6 and YY1. Treatment of the B-ALL cells with PL significantly downregulated these TFs and modulated their target genes. While activation of AURKB, BIRC5, E2F1, and MYB mRNA levels were significantly downregulated by PL, but SOX4 and XBP levels were increased by PL. Intriguingly, PL also increased the expression of p21 in B-ALL cells through a p53-independent mechanism. Given that these TFs and their target genes play critical roles in a variety of hematological malignancies, our findings provide a strong preclinical rationale for considering PL as a new therapeutic agent for the treatment of B-cell malignancies, including B-ALL and GC-resistant B-ALL.

  20. Piperlongumine inhibits the proliferation and survival of B-cell acute lymphoblastic leukemia cell lines irrespective of glucocorticoid resistance

    International Nuclear Information System (INIS)

    Han, Seong-Su; Han, Sangwoo; Kamberos, Natalie L.

    2014-01-01

    Highlights: • PL inhibits the proliferation of B-ALL cell lines irrespective of GC-resistance. • PL selectively kills B-ALL cells by increasing ROS, but not normal counterpart. • PL does not sensitize majority of B-ALL cells to DEX. • PL represses the network of constitutively activated TFs and modulates their target genes. • PL may serve as a new therapeutic molecule for GC-resistant B-ALL. - Abstract: Piperlongumine (PL), a pepper plant alkaloid from Piper longum, has anti-inflammatory and anti-cancer properties. PL selectively kills both solid and hematologic cancer cells, but not normal counterparts. Here we evaluated the effect of PL on the proliferation and survival of B-cell acute lymphoblastic leukemia (B-ALL), including glucocorticoid (GC)-resistant B-ALL. Regardless of GC-resistance, PL inhibited the proliferation of all B-ALL cell lines, but not normal B cells, in a dose- and time-dependent manner and induced apoptosis via elevation of ROS. Interestingly, PL did not sensitize most of B-ALL cell lines to dexamethasone (DEX). Only UoC-B1 exhibited a weak synergistic effect between PL and DEX. All B-ALL cell lines tested exhibited constitutive activation of multiple transcription factors (TFs), including AP-1, MYC, NF-κB, SP1, STAT1, STAT3, STAT6 and YY1. Treatment of the B-ALL cells with PL significantly downregulated these TFs and modulated their target genes. While activation of AURKB, BIRC5, E2F1, and MYB mRNA levels were significantly downregulated by PL, but SOX4 and XBP levels were increased by PL. Intriguingly, PL also increased the expression of p21 in B-ALL cells through a p53-independent mechanism. Given that these TFs and their target genes play critical roles in a variety of hematological malignancies, our findings provide a strong preclinical rationale for considering PL as a new therapeutic agent for the treatment of B-cell malignancies, including B-ALL and GC-resistant B-ALL

  1. Inheritance and effectiveness of two transgenes determining PVY resistance in progeny from crossing independently transformed tobacco lines.

    Science.gov (United States)

    Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa

    2017-05-01

    Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.

  2. Resistência de soja a insetos: VIII. IAC 78-2318, linhagem com resistência múltipla Resistance of soybean to insects: VIII. IAC 78-2318 line with multiple insect resistance

    Directory of Open Access Journals (Sweden)

    André Luiz Lourenção

    1987-01-01

    Full Text Available Estudou-se, em comparação com outros genótipos de soja, o comportamento da linhagem IAC 78-2318, em relação à oviposição e colonização da mosca-branca Bemisia tabaci (Genn. e à área foliar consumida por besouros crisomelídeos e lagartas. Em Campinas, SP, em 1981, em casa de vegetação, submeteram-se os cultivares Santa Rosa, Paraná, BR-1, Bossier, IAC 8 e IAC 12 e as linhagens IAC 73-228, IAC 78-2318, D72-9601-1, PI 171451, PI 229358 e PI 274454 à infestação artificial de adultos da mosca-branca. IAC 78-2318, embora apresentando alto número de ovos, teve colonização baixa, próxima aos materiais mais resistentes (PI 171451 e PI 229358. Em Santo Antonio de Posse, SP, em 1985, em campo, IAC 78-2318, quando comparado com IAC 80-596-2, 'Santa Rosa', 'IAC 8' e 'IAC 11', mostrou a menor perda de área foliar devida à alimentação de coleópteros crisomelídeos, principalmente Cerotoma arcuata (Oliv. e Diphaulaca viridipennis Clark, e de lagartas, com predominância de Anticarsia gemmatalis (Hubn.. Como já havia sido registrado anteriormente baixo dano de Epinotia aporema (Wals. e de percevejos pentatomideos em IAC 78-2318, com as observações presentes essa linhagem fica caracterizada como portadora de resistência múltipla a insetos.The performance of the soybean line IAC 78-2318 in relation to oviposition and colonization by the whitefly Bemisia tabaci (Genn. and to defoliation by caterpillars and chrysomelidae was studied in comparison to other varieties. At Campinas, State of São Paulo - Brazil, in greenhouse, the cultivars Santa Rosa, Paraná, BR-1, Bossier, IAC 8 and IAC 12, and the lines IAC 73-228, IAC 78-2318, D72-9601-1, PI 171451, PI 229358 e PI 274454 were submitted to artificial infestation of whitefly adults from tomato plants highly infested. Despite the high number of eggs in the IAC 78-2318 folioles, this line had a low colonization, comparable to the more resistants lines (PI 171451 and PI 229358. At Santo

  3. Accelerated Senescence and Enhanced Disease Resistance in Hybrid Chlorosis Lines Derived from Interspecific Crosses between Tetraploid Wheat and Aegilops tauschii

    Science.gov (United States)

    Tosa, Yukio; Yoshida, Kentaro; Park, Pyoyun; Takumi, Shigeo

    2015-01-01

    Hybrid chlorosis, a type of hybrid incompatibility, has frequently been reported in inter- and intraspecific crosses of allopolyploid wheat. In a previous study, we reported some types of growth abnormalities such as hybrid necrosis and observed hybrid chlorosis with mild or severe abnormalities in wheat triploids obtained in crosses between tetraploid wheat cultivar Langdon and four Ae. tauschii accessions and in their derived synthetic hexaploids. However, the molecular mechanisms underlying hybrid chlorosis are not well understood. Here, we compared cytology and gene expression in leaves to characterize the abnormal growth in wheat synthetics showing mild and severe chlorosis. In addition, we compared disease resistance to wheat blast fungus. In total 55 and 105 genes related to carbohydrate metabolism and 53 and 89 genes for defense responses were markedly up-regulated in the mild and severe chlorosis lines, respectively. Abnormal chloroplasts formed in the mesophyll cells before the leaves yellowed in the hybrid chlorosis lines. The plants with mild chlorosis showed increased resistance to wheat blast and powdery mildew fungi, although significant differences only in two, third internode length and maturation time, out of the examined agricultural traits were found between the wild type and plants showing mild chlorosis. These observations suggest that senescence might be accelerated in hybrid chlorosis lines of wheat synthetics. Moreover, in wheat synthetics showing mild chlorosis, the negative effects on biomass can be minimized, and they may show substantial fitness under pathogen-polluted conditions. PMID:25806790

  4. Accelerated senescence and enhanced disease resistance in hybrid chlorosis lines derived from interspecific crosses between tetraploid wheat and Aegilops tauschii.

    Directory of Open Access Journals (Sweden)

    Hiroki Nakano

    Full Text Available Hybrid chlorosis, a type of hybrid incompatibility, has frequently been reported in inter- and intraspecific crosses of allopolyploid wheat. In a previous study, we reported some types of growth abnormalities such as hybrid necrosis and observed hybrid chlorosis with mild or severe abnormalities in wheat triploids obtained in crosses between tetraploid wheat cultivar Langdon and four Ae. tauschii accessions and in their derived synthetic hexaploids. However, the molecular mechanisms underlying hybrid chlorosis are not well understood. Here, we compared cytology and gene expression in leaves to characterize the abnormal growth in wheat synthetics showing mild and severe chlorosis. In addition, we compared disease resistance to wheat blast fungus. In total 55 and 105 genes related to carbohydrate metabolism and 53 and 89 genes for defense responses were markedly up-regulated in the mild and severe chlorosis lines, respectively. Abnormal chloroplasts formed in the mesophyll cells before the leaves yellowed in the hybrid chlorosis lines. The plants with mild chlorosis showed increased resistance to wheat blast and powdery mildew fungi, although significant differences only in two, third internode length and maturation time, out of the examined agricultural traits were found between the wild type and plants showing mild chlorosis. These observations suggest that senescence might be accelerated in hybrid chlorosis lines of wheat synthetics. Moreover, in wheat synthetics showing mild chlorosis, the negative effects on biomass can be minimized, and they may show substantial fitness under pathogen-polluted conditions.

  5. Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis.

    Science.gov (United States)

    Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul

    2017-11-01

    A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.

  6. Study on character variation induced by introducing exogenous DNA into upland cotton with ion implantation

    International Nuclear Information System (INIS)

    Cheng Beijiu; Tian Qiuyuan; Li Zhan; Zhou Liren

    1996-01-01

    The exogenous DNAs of G. Bickll P. and H. Cannabinus were introduced into the upland cotton Si 2 by Ar + implantation and DNA solution trickling method. The results showed that the exogenous DNA introduction was promoted significantly and the types and frequencies of character variation in progeny were increased by Ar + implantation. Furthermore, most of the variation tend to be stable. Among the Ar + implantation doses tested, 2 x 10 15 Ar + /cm 2 was the best for introducing exogenous DNA and inducing character variation, the variation rate reached to 16.2%. Some new lines with character of resistance to wilt disease, early maturity, few gland in seed and fine fiber quality have been obtained

  7. Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

    Science.gov (United States)

    A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

  8. HIV drug resistance testing among patients failing second line antiretroviral therapy. Comparison of in-house and commercial sequencing.

    Science.gov (United States)

    Chimukangara, Benjamin; Varyani, Bhavini; Shamu, Tinei; Mutsvangwa, Junior; Manasa, Justen; White, Elizabeth; Chimbetete, Cleophas; Luethy, Ruedi; Katzenstein, David

    2017-05-01

    HIV genotyping is often unavailable in low and middle-income countries due to infrastructure requirements and cost. We compared genotype resistance testing in patients with virologic failure, by amplification of HIV pol gene, followed by "in-house" sequencing and commercial sequencing. Remnant plasma samples from adults and children failing second-line ART were amplified and sequenced using in-house and commercial di-deoxysequencing, and analyzed in Harare, Zimbabwe and at Stanford, U.S.A, respectively. HIV drug resistance mutations were determined using the Stanford HIV drug resistance database. Twenty-six of 28 samples were amplified and 25 were successfully genotyped. Comparison of average percent nucleotide and amino acid identities between 23 pairs sequenced in both laboratories were 99.51 (±0.56) and 99.11 (±0.95), respectively. All pairs clustered together in phylogenetic analysis. Sequencing analysis identified 6/23 pairs with mutation discordances resulting in differences in phenotype, but these did not impact future regimens. The results demonstrate our ability to produce good quality drug resistance data in-house. Despite discordant mutations in some sequence pairs, the phenotypic predictions were not clinically significant. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Influence of inoculation with ascochyta lentis on mineral contents (Na, Ca, Mg, Cu, and Fe) of susceptible and resistant lines of lentil (Lens culinaris medik.)

    International Nuclear Information System (INIS)

    Sahi, S.T.; Ghazanfar, M.U.; Habib, A.; Wakil, W.

    2010-01-01

    An experiment was conducted to determine the mineral contents of the healthy and inoculated plant of lentil and their relationship toward the Ascochyta lentis disease. The results revealed that magnesium, copper and zinc contents of un-inoculated lentil lines, included in susceptible group were higher than those included in resistant group whereas, sodium, calcium and iron contents were more in the resistant as compared to the susceptible group. Upon inoculation with Ascochyta lentis, the cause of lentil blight disease, sodium, calcium, zinc, copper and iron contents increased invariably in both the susceptible and resistant groups of lentil lines. On the other hand, magnesium contents increased in susceptible group but decreased in resistant group. The over all results proved that considerable variation exists in micro mineral contents of resistant and susceptible lines of lentil. (author)

  10. Investigation of antibacterial activity of cotton fabric incorporating nano silver colloid

    International Nuclear Information System (INIS)

    Ngo Vo Ke Thanh; Nguyen Thi Phuong Phong

    2009-01-01

    In this work, silver nanoparticles were prepared by polyol process with microwave heating and incorporated on cotton fabric surfaces. The antibacterial performance of the antibacterial cotton fabric was tested for different concentration of nano-sized silver colloid, contact time germs, and washing times. It was found that antibacterial activity increased with the increasing concentration of nano-sized silver colloid. The antibacterial fabric with 758 mg/kg of silver nanoparticles on surface cotton was highly effective in killing test bacteria and had excellent water resisting property.

  11. A new MCF-7 breast cancer cell line resistant to the arzoxifene metabolite desmethylarzoxifene

    DEFF Research Database (Denmark)

    Freddie, Cecilie T; Christensen, Gitte Lund; Lykkesfeldt, Anne E

    2004-01-01

    products increased towards parental MCF-7 level upon withdrawal from ARZm, concomitant with an increase in the sensitivity of MCF-7/ARZm(R)-1 cells to ARZm treatment. These data show that ARZm resistant cells remain sensitive to treatment with both tamoxifen and to ICI 182,780. Furthermore, the partial...

  12. Distributed voltage control and load sharing for inverter-interfaced microdrid with resistive lines

    DEFF Research Database (Denmark)

    Golsorkhi, Mohammad S.; Lu, D. D C; Shafiee, Q.

    2016-01-01

    This paper proposes a new distributed control method for coordination of distributed energy resources (DERs) in low-voltage resistive microgrids. The proposed framework consists of two level structure; primary and secondary control. Unlike the existing distributed control methods, the proposed me...

  13. Sources of stem rust resistance in wheat-alien introgression lines

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  14. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  15. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    Science.gov (United States)

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. High hRFI expression correlates with resistance to Fluoro pyrimidines in human colon cancer cell lines and in xenografts

    International Nuclear Information System (INIS)

    Sasaki, S.; Tokyo Univ., Tokyo; Watanabe, T.; Konishi, T.; Kitayama, J.; Nagawa, H.; Kobunai, T.

    2005-01-01

    We previously reported that the over-expression of hRFI, a protein preferentially expressed in the digestive tract regions of several cancers, exhibited a tendency to inhibit TNF-α induced apoptosis. In this study, we sought to determine the potential effect of hRFI expression on the sensitivity to 5-fluorouracil (5-FU) and/or other fluoro pyrimidines. For the whole lysates of 8 colon cancer cell lines, we performed Western blotting with anti-hRFI antibody and analyzed the correlations between the expression level of hRFI and the cell lines' sensitivity to 5-FU induced apoptosis. Furthermore, for a tissue micro array consisting of 32 xenograft derived human cancer cell lines, we examined the expression levels of hRFI and survivin by immunohistochemical staining, and analyzed the correlations between the expression of each protein and the sensitivity to several chemotherapeutic agents in the xenografts examined. Both in colon cancer cell lines and in xenografts, the expression level of hRFI was correlated with resistance to 5-FU and its derivatives. This evidence suggests that hRFI may be a marker predicting the response to fluorouracil derived chemotherapeutic agents and that the reduction of the expression level of hRFI might improve the outcome of chemotherapy

  17. Development of a novel Sinapis arvensis disomic addition line in Brassica napus containing the restorer gene for Nsa CMS and improved resistance to Sclerotinia sclerotiorum and pod shattering.

    Science.gov (United States)

    Wei, Wenhui; Li, Yunchang; Wang, Lijun; Liu, Shengyi; Yan, Xiaohong; Mei, Desheng; Li, Yinde; Xu, Yusong; Peng, Pengfei; Hu, Qiong

    2010-04-01

    An allo-cytoplasmic male sterile line, which was developed through somatic hybridization between Brassica napus and Sinapis arvensis (thus designated as Nsa CMS line), possesses high potential for hybrid production of rapeseed. In order to select for restorer lines, fertile plants derived from the same somatic hybridization combination were self-pollinated and testcrossed with the parental Nsa CMS line for six generations. A novel disomic alien addition line, B. napus-S. arvensis, has been successfully developed. GISH analysis showed that it contains one pair of chromosomes from S. arvensis and 19 pairs from B. napus, and retains stable and regular mitotic and meiotic processes. The addition line displays very strong restoration ability to Nsa CMS line, high resistance to Sclerotinia sclerotiorum and a low incidence of pod shattering. Because the addition line shares these very important agricultural characters, it is a valuable restorer to Nsa CMS line, and is named NR1 here (Nsa restorer no. 1).

  18. Molecular and Biochemical Characterization of Cotton Epicuticular Wax in Defense Against Cotton Leaf Curl Disease.

    Science.gov (United States)

    Khan, Muhammad Azmat Ullah; Shahid, Ahmad Ali; Rao, Abdul Qayyum; Bajwa, Kamran Shehzad; Samiullah, Tahir Rehman; Muzaffar, Adnan; Nasir, Idrees Ahmad; Husnain, Tayyab

    2015-12-01

    Gossypium arboreumis resistant to Cotton leaf curl Burewala virus and its cognate Cotton leaf curl Multan beta satellite ( CLCuBuV and CLCuMB ). However, the G. arboreum wax deficient mutant (GaWM3) is susceptible to CLCuV . Therefore, epicuticular wax was characterized both quantitatively and qualitatively for its role as physical barrier against whitefly mediated viral transmission and co-related with the titer of each viral component (DNA-A, alphasatellite and betasatellite) in plants. The hypothesis was the CLCuV titer in cotton is dependent on the amount of wax laid down on plant surface and the wax composition. Analysis of the presence of viral genes, namely alphasatellite, betasatellite and DNA-A, via real-time PCR in cotton species indicated that these genes are detectable in G. hirsutum , G. harknessii and GaWM3, whereas no particle was detected in G. arboreum . Quantitative wax analysis revealed that G. arboreum contained 183 μg.cm -2 as compared to GaWM3 with only 95 μg.cm -2 . G. hirsutum and G. harknessii had 130 μg.cm -2 and 146 μg.cm -2 , respectively. The GCMS results depicted that Lanceol, cis was 45% in G. harknessii . Heptadecanoic acid was dominant in G. arboreum with 25.6%. GaWM3 had 18% 1,2,-Benenedicarboxylic acid. G. hirsutum contained 25% diisooctyl ester. The whitefly feeding assay with Nile Blue dye showed no color in whiteflies gut fed on G. arboreum . In contrast, color was observed in the rest of whiteflies. From results, it was concluded that reduced quantity as well as absence of (1) 3-trifluoroacetoxytetradecane, (2) 2-piperidinone,n-|4-bromo-n-butyl|, (3) 4-heptafluorobutyroxypentadecane, (4) Silane, trichlorodocosyl-, (5) 6- Octadecenoic acid, methyl ester, and (6) Heptadecanoicacid,16-methyl-,methyl ester in wax could make plants susceptible to CLCuV , infested by whiteflies.

  19. Multidrug resistance and retroviral transduction potential in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Theilade, M D; Gram, G J; Jensen, P B

    1999-01-01

    of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...

  20. Proteomics of cancer cell lines resistant to microtubule-stabilizing agents

    DEFF Research Database (Denmark)

    Albrethsen, Jakob; Angeletti, Ruth H; Horwitz, Susan Band

    2014-01-01

    Despite the clinical success of microtubule-interacting agents (MIA), a significant challenge for oncologists is the inability to predict the response of individual patients with cancer to these drugs. In the present study, six cell lines were compared by 2D DIGE proteomics to investigate cellula...

  1. Virologic failure of protease inhibitor-based second-line antiretroviral therapy without resistance in a large HIV treatment program in South Africa.

    Directory of Open Access Journals (Sweden)

    Julie H Levison

    Full Text Available We investigated the prevalence of wild-type virus (no major drug resistance and drug resistance mutations at second-line antiretroviral treatment (ART failure in a large HIV treatment program in South Africa.HIV-infected patients ≥ 15 years of age who had failed protease inhibitor (PI-based second-line ART (2 consecutive HIV RNA tests >1000 copies/ml on lopinavir/ritonavir, didanosine, and zidovudine were identified retrospectively. Patients with virologic failure were continued on second-line ART. Genotypic testing for drug resistance was performed on frozen plasma samples obtained closest to and after the date of laboratory confirmed second-line ART failure. Of 322 HIV-infected patients on second-line ART, 43 were adults with confirmed virologic failure, and 33 had available plasma for viral sequencing. HIV-1 RNA subtype C predominated (n = 32, 97%. Mean duration on ART (SD prior to initiation of second-line ART was 23 (17 months, and time from second-line ART initiation to failure was 10 (9 months. Plasma samples were obtained 7(9 months from confirmed failure. At second-line failure, 22 patients (67% had wild-type virus. There was no major resistance to PIs found. Eleven of 33 patients had a second plasma sample taken 8 (5.5 months after the first. Median HIV-1 RNA and the genotypic resistance profile were unchanged.Most patients who failed second-line ART had wild-type virus. We did not observe evolution of resistance despite continuation of PI-based ART after failure. Interventions that successfully improve adherence could allow patients to continue to benefit from second-line ART therapy even after initial failure.

  2. Método de diagnóstico para el monitoreo de resistencia a insecticidas en poblaciones de "picudo del algodonero", Anthonomus grandis (Coleoptera: Curculionidae A diagnostic test for insecticide resistance monitoring in "cotton boll weevil" Anthonomus grandis (Coleoptera: Curculionidae populations

    Directory of Open Access Journals (Sweden)

    Teodoro Stadler

    2009-06-01

    Full Text Available El control de las poblaciones de Anthonomus grandis Boheman, por debajo de su umbral de daño económico durante el ciclo del cultivo del algodón, se realiza en forma efectiva hasta el momento, a través de insecticidas de síntesis. La presión selectiva de las aplicaciones extensivas e intensivas de insecticidas hace imperativa la detección temprana de focos de resistencia a los mismos, en función de un correcto manejo del fenómeno. Se desarrolló un método de diagnóstico de resistencia para A. grandis a partir de la técnica "vial test", que fue adaptada en forma de "kit" para el monitoreo rápido y sencillo de los focos de resistencia en el campo. La toxicidad (CL99, para calcular la concentración discriminante (CD del insecticida y la preparación del "kit", se obtiene a partir de bioensayos de laboratorio con una cepa normal susceptible de A. grandis. Se determinó la vida media de los insecticidas dentro de los viales por CIPAC MT 46, para establecer una fecha de vencimiento del "kit". La CD y el método en su conjunto fueron validados a través de ensayos a campo. El "kit", usado en el monitoreo de resistencia en el campo, fue especialmente diseñado para ser utilizado en las condiciones geográficas, económicas y socio-culturales presentes en la región algodonera argentina. La implementación de esta técnica permitirá conseguir la información necesaria, y así obtener una apropiada alternancia de insecticidas. Como consecuencia, se prevé una reducción de impacto ambiental de las prácticas agronómicas en el control de plagas en algodón.The in-season control of the cotton boll weevil Anthonomus grandis Boheman is done by insecticide application, which so far is the only effective way to reduce boll weevil populations to levels below economic significance. The extensive and intensive control actions with insecticides cause selective pressure on pest populations. Thus, to achieve an accurate insecticide resistance

  3. Developing fruit and shoot borer (FSB) resistant lines from eggplant cv. Dumaguete Long Purple (DLP) through seed irradiation

    International Nuclear Information System (INIS)

    Suratos, S.C.M.; Resamero, N.V.; Angeles, A.T.; Sandoval, F.R.

    2011-01-01

    Seeds of eggplant cv. DLP were irradiated with 10,20,30,40,50,60,70,80 gy gamma-rays from sup60Co to induce variation for resistance for FSB, a major pest in eggplant. The M1 populations was observed for germination seven days after sowing and plant survival was recorded 14,21 and 28 days from sowing. The seed germination of treated seeds ranged from 80-83% which is comparable to the untreated seed germination of 81%. A total of 8,529 M2 plants across irradiation dose were screened through natural infestation for field resistance to FSB. Plants without infestation up to 120 days after transplanting were considered as putatively resistant to FSB of the total M2 plants evaluated, 66 (0.8%)were identified to be putatively resistant. The highest number of resistant plants, 22 (1.6%) was generated from 70 gy, and the least, 3(0.3%), was from 40 to 50 gy. The m3 generation of the identified putative FSB resistant m2 plants is currently being evaluated further for stability of field resistance to FSB. The horticultural traits of the putative mutants, were also evaluated using 22 descriptors, where the mutants varied in 11 traits as compared with the wild type or progenitor, the original DLP. The degree of variation varied with traits as follows: leaf blade length and width, 7.6% and 47%, respectively; days to flowering and fruiting, 33.3% and 30.3%, respectively; numbers of flowers per inflorescence, 83.4%; fruit length/breadth ratio, 51.5%; curvature, 81.8%, number of seeds per fruit, 51.5%;seed color and size, 9.1% and 4.5%, respectively and 100 seed weight, 4.5%. This study targets to generate mutants with resistance to FSB and at the same time with acceptable horticultural traits. Among the selected mutants, a total of 55 lines (83.3%) manifested acceptable horticultural traits

  4. Structural coloration of chitosan-cationized cotton fabric using photonic crystals

    OpenAIRE

    Yavuz, Gonul; Zille, Andrea; Seventekin, N.; Souto, A. Pedro

    2017-01-01

    Abstract. In this work, poly (styrene-methyl methacrylate-acrylic acid) P(St-MMA-AA) composite nanospheres were deposited onto chitosan-cationized woven cotton fabrics followed by a second layer of chitosan. The deposited photonic crystals (PCs) on the fabrics were evaluated for coating efficiency and resistance, chemical analysis and color variation by optical and SEM microscopy, ATR-FTIR, diffuse reflectance spectroscopy and washing fastness. Chitosan deposition on cotton fab...

  5. Microarray Analysis in a Cell Death Resistant Glioma Cell Line to Identify Signaling Pathways and Novel Genes Controlling Resistance and Malignancy

    Energy Technology Data Exchange (ETDEWEB)

    Seznec, Janina; Naumann, Ulrike, E-mail: ulrike.naumann@uni-tuebingen.de [Laboratory of Molecular Neuro-Oncology, Department of General Neurology, Hertie-Institute for Clinical Brain Research and Center Neurology, University of Tuebingen, Otfried-Mueller-Str. 27, Tuebingen 72076 (Germany)

    2011-06-27

    Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies.

  6. Microarray Analysis in a Cell Death Resistant Glioma Cell Line to Identify Signaling Pathways and Novel Genes Controlling Resistance and Malignancy

    International Nuclear Information System (INIS)

    Seznec, Janina; Naumann, Ulrike

    2011-01-01

    Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies

  7. Factors determining sensitivity or resistance of tumor cell lines towards artesunate.

    Science.gov (United States)

    Sertel, Serkan; Eichhorn, Tolga; Sieber, Sebastian; Sauer, Alexandra; Weiss, Johanna; Plinkert, Peter K; Efferth, Thomas

    2010-04-15

    Clinical oncology is still challenged by the development of drug resistance of tumors that result in poor prognosis for patients. There is an urgent necessity to understand the molecular mechanisms of resistance and to develop novel therapy strategies. Artesunate (ART) is an anti-malarial drug, which also exerts profound cytotoxic activity towards cancer cells. We first applied a gene-hunting approach using cluster and COMPARE analyses of microarray-based transcriptome-wide mRNA expression profiles. Among the genes identified by this approach were genes from diverse functional groups such as structural constituents of ribosomes (RPL6, RPL7, RPS12, RPS15A), kinases (CABC1, CCT2, RPL41), transcriptional and translational regulators (SFRS2, TUFM, ZBTB4), signal transducers (FLNA), control of cell growth and proliferation (RPS6), angiogenesis promoting factors (ITGB1), and others (SLC25A19, NCKAP1, BST1, DBH, FZD7, NACA, MTHFD2). Furthermore, we applied a candidate gene approach and tested the role of resistance mechanisms towards established anti-cancer drugs for ART resistance. By using transfected or knockout cell models we found that the tumor suppressor p16(INK4A) and the anti-oxidant protein, catalase, conferred resistance towards ART, while the oncogene HPV-E6 conferred sensitivity towards ART. The tumor suppressor p53 and its downstream protein, p21, as well as the anti-oxidant manganese-dependent superoxide dismutase did not affect cellular response to ART. In conclusion, our pharmacogenomic approach revealed that response of tumor cells towards ART is multi-factorial and is determined by gene expression associated with either ART sensitivity or resistance. At least some of the functional groups of genes (e.g. angiogenesis promoting factors, cell growth and proliferation-associated genes signal transducers and kinases) are also implicated in clinical responsiveness of tumors towards chemotherapy. It merits further investigation, whether ART is responsive in

  8. Evolution of cell resistance, threshold voltage and crystallization temperature during cycling of line-cell phase-change random access memory

    NARCIS (Netherlands)

    Oosthoek, J. L. M.; Attenborough, K.; Hurkx, G. A. M.; Jedema, F. J.; Gravesteijn, D. J.; Kooi, B. J.

    2011-01-01

    Doped SbTe phase change (PRAM) line cells produced by e-beam lithography were cycled 100 million times. During cell cycling the evolution of many cell properties were monitored, in particular the crystalline and amorphous resistance, amorphous resistance drift exponent, time-dependent threshold

  9. Combined cytotoxic effects of tumor necrosis factor-alpha with various cytotoxic agents in tumor cell lines that are drug resistant due to mutated p53

    NARCIS (Netherlands)

    Sleijfer, S; Le, T. K. P.; de Jong, S.; Timmer-Bosscha, H; Withoff, S; Mulder, NH

    Several studies suggest that tumor necrosis factor-alpha (TNF) is able to overcome drug resistance in tumors. Whether TNF is able to do so in tumor cell lines that are drug resistant due to a mutation in the tumor suppressor gene p53 is unclear. Therefore, we studied the in vitro cytotoxic effects

  10. HYPERTHERMIC POTENTIATION OF CISPLATIN TOXICITY IN A HUMAN SMALL-CELL LUNG-CARCINOMA CELL-LINE AND A CISPLATIN-RESISTANT SUBLINE

    NARCIS (Netherlands)

    HETTINGA, JVE; LEMSTRA, W; MEIJER, C; MULDER, NH; KONINGS, AWT; DEVRIES, EGE; KAMPINGA, HH

    1994-01-01

    A human small cell lung carcinoma cell line (GLC4) and its subline with in vitro acquired cisplatin (cDDP) resistance (GLC4-cDDP) were used to study the applicability of hyperthermia to interfere with acquired cDDP resistance. GLC4 and GLC4-cDDP did not differ in heat sensitivity (clonogenic

  11. Determination of ABA-binding proteins contents in subcellular fractions isolated from cotton seedlings using radioimmunoanalysis

    International Nuclear Information System (INIS)

    Tursunkhodjayeva, F.M.

    2004-01-01

    Full text: Knowledge of plants' hormone receptor sites is essential to understanding of the principles of phytohormone action in cells and tissues. The hormone abscisic acid (ABA) takes part in many important physiological processes of plants, including water balance and resistance to salt stress. The detection of salt tolerance in the early stages of ontogenesis is desirable for effective cultivation of cotton. Usually such characteristics are determined visually after genetic analysis of hybrids over several generations. This classic method of genetics requires a long time to grow several generations of cotton plants. In this connection we study ABA-binding protein contents in subcellular fractions isolated from seedlings of several kinds of cotton with different tolerance to salt stress. The contents of ABA-binding protein in nuclei and chloroplasts fractions isolated from cotton seedlings were determined using radioimmunoanalysis. The subcellular fractions were prepared by ultracentrifugation in 0,25 - 2,2 M sucrose gradient. ABA-binding protein was isolated from cotton seedlings by affinity chromatography. The antibodies against ABA-binding protein of cotton were developed in rabbits according standard protocols. Than the antibodies were labelled by radioisotope J 125 according Greenwood et al. It was shown, that the nuclei and chloroplasts fractions isolated from cotton with high tolerance to salt stress contain ABA-binding protein up to 1,5-1,8 times more, than the same fractions from cotton with low tolerance to salt stress. So, the ABA-binding protein contents in cotton seedlings may be considered as a marker for screening of cotton kinds, which may potentially have high tolerance to salt stress

  12. On-line irradiation testing of a Giant Magneto-Resistive (GMR) sensor

    Energy Technology Data Exchange (ETDEWEB)

    Olfert, J.; Luloff, B.; MacDonald, D.; Lumsden, R., E-mail: jeff.olfert@cnl.ca [Canadian Nuclear Laboratories, Chalk River, Ontario (Canada)

    2016-06-15

    Magneto-resistive sensors are rapidly gaining favour for magnetic field sensing applications owing to their high sensitivity, small size, and low cost. Their metallic, nonsemiconductor construction makes them excellent candidates for use in the harsh environments present in nuclear and space applications. In this work, a commercially available magneto-resistive sensor was irradiated up to a total gamma dose of 2 MGy (200 Mrad), and online testing was performed to monitor the sensor throughout the irradiation to detect any degradation. No significant evidence of degradation of the sensor characteristics was observed. A very small (< 1%) change in the bridge balance of the sensor as a function of accumulated dose was detected. (author)

  13. Comparative study of on-line response time measurement methods for platinum resistance thermometer

    International Nuclear Information System (INIS)

    Zwingelstein, G.; Gopal, R.

    1979-01-01

    This study deals with the in site determination of the response time of platinum resistance sensor. In the first part of this work, two methods furnishing the reference response time of the sensors are studied. In the second part of the work, two methods obtaining the response time without dismounting of the sensor, are studied. A comparative study of the performances of these methods is included for fluid velocities varying from 0 to 10 m/sec, in both laboratory and plant conditions

  14. Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

    International Nuclear Information System (INIS)

    Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

    2015-01-01

    Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

  15. What are farmers really planting? Measuring the presence and effectiveness of Bt cotton in Pakistan.

    Directory of Open Access Journals (Sweden)

    David J Spielman

    Full Text Available Genetically modified, insect-resistant Bacillus thuringiensis (Bt cotton is cultivated extensively in Pakistan. Past studies, however, have raised concerns about the prevalence of Bt cotton varieties possessing weak or nonperforming insect-resistance traits conferred by the cry gene. We examine this issue using data drawn from a representative sample of cotton-growing households that were surveyed in six agroclimatic zones spanning 28 districts in Pakistan in 2013, as well as measurements of Cry protein levels in cotton tissue samples collected from the sampled households' main fields. The resultant dataset combines information from 593 sampled households with corresponding plant tissue diagnostics from 70 days after sowing, as well as information from 589 sampled households with corresponding diagnostics from 120 days after sowing. Our analysis indicates that 11 percent of farmers believed they were cultivating Bt cotton when, in fact, the Cry toxin was not present in the tested tissue at 70 days after sowing (i.e., a Type I error. The analysis further indicates that 5 percent of farmers believed they were cultivating non-Bt cotton when, in fact, the Cry toxin was present in the tested tissue (i.e., a Type II error. In addition, 17 percent of all sampled farmers were uncertain whether or not they were cultivating Bt cotton. Overall, 33 percent of farmers either did not know or were mistaken in their beliefs about the presence of the cry gene in the cotton they cultivated. Results also indicate that toxic protein levels in the plant tissue samples occurred below threshold levels for lethality in a significant percentage of cases, although these measurements may also be affected by factors related to tissue sample collection, handling, storage, and testing procedures. Nonetheless, results strongly suggest wide variability both in farmers' beliefs and in gene expression. Such variability has implications for policy and regulation in Pakistan

  16. Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

    Science.gov (United States)

    Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

  17. Comparison of oxidation resistance of copper treated by beam-line ion implantation and plasma immersion ion implantation

    International Nuclear Information System (INIS)

    An Quanzhang; Li Liuhe; Hu Tao; Xin Yunchang; Fu, Ricky K.Y.; Kwok, D.T.K.; Cai Xun; Chu, Paul K.

    2009-01-01

    Copper which has many favorable properties such as low cost, high thermal and electrical conductivity, as well as easy fabrication and joining is one of the main materials in lead frames, interconnects, and foils in flexible circuits. Furthermore, copper is one of the best antibacterial materials. However, unlike aluminum oxide or chromium oxide, the surface copper oxide layer does not render sufficient protection against oxidation. In this work, in order to improve the surface oxidation resistance of Cu, Al and N were introduced into copper by plasma immersion ion implantation (PIII) and beam-line ion implantation (BII). The implantation fluences of Al and N were 2 x 10 17 ions cm -2 and 5 x 10 16 ions cm -2 , respectively. The implanted and untreated copper samples were oxidized in air at 260 deg. C for 1 h. The X-ray diffraction (XRD), scanning electron microscopy (SEM), as well as X-ray photoelectron spectroscopy (XPS) results indicate that both implantation methods can enhance the oxidation resistance of copper but to different extent. PIII is superior to BII in enhancing the oxidation resistance of copper. The effects and possible mechanisms are discussed.

  18. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. Impact of efficient refuge policies for Bt cotton in India on world cotton trade

    OpenAIRE

    Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.

    2010-01-01

    India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...

  20. Expression of P-gp, MRP, LRP, GST-π and TopoIIα and intrinsic resistance in human lung cancer cell lines.

    Science.gov (United States)

    Wang, Jiarui; Zhang, Jinhui; Zhang, Lichuan; Zhao, Long; Fan, Sufang; Yang, Zhonghai; Gao, Fei; Kong, Ying; Xiao, Gary Guishan; Wang, Qi

    2011-11-01

    This study aimed to determine the relationship between the endogenous levels of P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP), lung resistance-related protein (LRP), glutathione-s-transferase-π (GST‑π) and topoisomerase IIα (TopoIIα) and intrinsic drug resistance in four human lung cancer cell lines, SK-MES-1, SPCA-1, NCI-H-460 and NCI-H-446, of different histological types. The expression of P-gp, MRP, LRP, GST-π and TopoIIα was measured by immunofluorescence, Western blotting and RT-PCR. Drug resistance to cisplatin, doxorubicin and VP-16 was determined using MTT assays. The correlation between expression of the resistance-related proteins and their roles in the resistance to drugs in these cancer cell lines was analyzed. We found that the endogenous levels of P-gp, MRP, LRP, GST-π and TopoIIα in the four cell lines varied. The level of GST-π in the SK-MES-1 cells was the highest, whereas the level of P-gp in the SPCA-1 cells was the lowest. The chemoresistance to cisplatin, doxorubicin and VP-16 in the four cell lines was different. The SPCA-1 cell line was most resistance to cisplatin; SK-MES-1 was most resistance to VP-16; whereas SK-MES-1 was most sensitive to doxorubicin. There was a positive correlation between GST-π expression and resistance to cisplatin, between TopoIIα expression and resistance to VP-16; and a negative correlation was noted between TopoIIα expression and resistance to doxorubicin. In summary, the endogenous expression of P-gp, MRP, LRP, GST-π and TopoIIα was different in the four human lung cancer cell lines of different histological types, and this variance may be associated with the variation in chemosensitivity to cisplatin, doxorubicin and VP-16. Among the related proteins, GST-π may be useful for the prediction of the intrinsic resistance to cisplatin, whereas TopoIIα may be useful to predict resistance to doxorubicin and VP-16 in human lung cancer cell lines.

  1. Improving Blast Resistance of a Thermo-Sensitive Genic Male Sterile Rice Line GD-8S by Molecular Marker-Assisted Selection

    Directory of Open Access Journals (Sweden)

    Wu-ge LIU

    2008-09-01

    Full Text Available The broad-spectrum blast resistance gene Pi-1, from donor line BL122, was introduced into a thermo-sensitive genic male sterile rice line GD-8S, which possessed good grain quality but high susceptibility to rice blast, by using backcross breeding and molecular marker-assisted selection. Five elite improved male sterile lines, RGD8S-1, RGD8S-2, RGD8S-3, RGD8S-4 and RGD8S-5, were selected based on the results of molecular marker analysis, spikelet sterility, recovery rate of genetic background and agronomic traits. Thirty-three representative blast isolates collected from Guangdong Province, China were used to inoculate the improved lines and the original line GD-8S artificially. The resistance frequencies of the improved lines ranged from 76.47% to 100%, much higher than that of the original line GD-8S (9.09%. On the agronomic characters, there were no significant differences between the improved lines and GD-8S except for flag leaf length and panicle number per plant. The improved lines could be used for breeding hybrid rice with high blast resistance.

  2. First and second line drug resistance among treatment naïve pulmonary tuberculosis patients in a district under Revised National Tuberculosis Control Programme (RNTCP in New Delhi

    Directory of Open Access Journals (Sweden)

    Vithal Prasad Myneedu

    2015-12-01

    Full Text Available There is limited information of level of drug resistance to first-line and second line anti-tuberculosis agents in treatment naïve pulmonary tuberculosis (PTB patients from the Indian region. Therefore, the present prospective study was conducted to determine the antimicrobial susceptibility to first-line and second line anti-TB drug resistance in such patients. Sputum samples from consecutive treatment naïve PTB cases registered in Lala Ram Sarup (LRS district, under RNTCP containing 12 Directly Observed Treatment Centre’s (DOTS, were enrolled using cluster sampling technology. A total of 453 samples were received from July 2011 to June 2012. All samples were cultured on solid medium followed by drug susceptibility to first and second line anti-tubercular drugs as per RNTCP guidelines. Primary multi-drug resistance (MDR was found to be 18/453; (4.0%. Extensively drug resistance (XDR was found in one strain (0.2%, which was found to be resistant to other antibiotics. Data of drug resistant tuberculosis among treatment naïve TB patients are lacking in India. The presence of XDR-TB and high MDR-TB in small population studied, calls for conducting systematic multi-centric surveillance across the country.

  3. Development and evaluation of near-isogenic lines for brown planthopper resistance in rice cv. 9311

    OpenAIRE

    Cong Xiao; Jie Hu; Yi-Ting Ao; Ming-Xing Cheng; Guan-Jun Gao; Qing-Lu Zhang; Guang-Cun He; Yu-Qing He

    2016-01-01

    Brown planthopper (BPH) is the most destructive pest of rice in Asia. To date 29 BPH resistance genes have been identified, but only a few genes are being used in breeding due to inefficient markers for marker-assisted selection (MAS) and little knowledge of the real effects of the genes. In this study we individually transferred 13 genes or QTLs (Bph14, QBph3, QBph4, Bph17, Bph15, Bph20, Bph24, Bph6, Bph3, Bph9, Bph10, Bph18 and Bph21) into cultivar 9311 by marker assisted backcross breeding...

  4. Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

    Directory of Open Access Journals (Sweden)

    Md. Mizanur Rahman

    2015-01-01

    Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

  5. Cotton fabrics with UV blocking properties through metal salts deposition

    International Nuclear Information System (INIS)

    Emam, Hossam E.; Bechtold, Thomas

    2015-01-01

    Graphical abstract: - Highlights: • Introducing metal salt based UV-blocking properties into cotton fabric. • A quite simple technique used to produce wash resistant UV-absorbers using different Cu-, Zn- and Ti-salts. • Good UPF was obtained after treatment with Cu and Ti salts, and ranged between 11.6 and 14. • The efficiency of the deposited metal oxides is compared on molar basis. - Abstract: Exposure to sunlight is important for human health as this increases the resistance to diverse pathogens, but the higher doses cause skin problems and diseases. Hence, wearing of sunlight protective fabrics displays a good solution for people working in open atmosphere. The current study offered quite simple and technically feasible ways to prepare good UV protection fabrics based on cotton. Metal salts including Zn, Cu and Ti were immobilized into cotton and oxidized cotton fabrics by using pad-dry-cure technique. Metal contents on fabrics were determined by AAS; the highest metal content was recorded for Cu-fabric and it was 360.6 mmol/kg after treatment of oxidized cotton with 0.5 M of copper nitrate. Ti contents on fabrics were ranged between 168.0 and 200.8 mmol/kg and it showed the lowest release as only 38.1–46.4% leached out fabrics after five laundry washings. Metal containing deposits were specified by scanning electron microscopy and energy dispersive X-ray spectroscopy. UV-transmission radiation over treated fabrics was measured and ultraviolet protection factor (UPF) was calculated. UPF was enhanced after treatment with Cu and Ti salts to be 11.6 and 14, respectively. After five washings, the amount of metal (Cu or Ti) retained indicates acceptable laundering durability.

  6. Interactions of tillage and cover crop on water, sediment, and pre-emergence herbicide loss in glyphosate-resistant cotton: implications for the control of glyphosate-resistant weed biotypes.

    Science.gov (United States)

    Krutz, L Jason; Locke, Martin A; Steinriede, R Wade

    2009-01-01

    The need to control glyphosate [N-(phosphonomethyl)glycine]-resistant weed biotypes with tillage and preemergence herbicides in glyphosate-resistant crops (GRCs) is causing a reduction in no-tillage hectarage thereby threatening the advances made in water quality over the past decade. Consequently, if environmental gains afforded by GRCs are to be maintained, then an in-field best management practice (BMP) compatible with tillage is required for hectarage infested with glyphosate-resistant weed biotypes. Thus, 1 d after a preemergent application of fluometuron [N,N-dimethyl-N'-(3-(trifluoromethyl)phenyl)urea] (1.02 kg ha(-1)) and metolachlor [2-chloro-N-(2-ethyl-6-methylphenyl)-N-(2-methoxy-1-methylethyl)acetamide] (1.18 kg ha(-1)) to a Dundee silt loam (fine-silty, mixed, active, thermic Typic Endoaqualf), simulated rainfall (60 mm h(-1)) was applied to 0.0002-ha microplots for approximately 1.25 h to elucidate tillage (no tillage [NT] and reduced tillage [RT])and cover crop (no cover [NC] and rye cover [RC]) effects on water, sediment, and herbicide loss in surface runoff. Regardless of tillage, RC delayed time-to-runoff 1.3-fold, reduced cumulative runoff volume 1.4-fold, and decreased cumulative sediment loss 4.7-fold. Cumulative fluometuron loss was not affected by tillage or cover crop. Conversely, total metolachlor loss was 1.3-fold lower in NT than RT and 1.4-fold lower in RC than NC. These data indicate that RC can be established in hectarage requiring tillage and potentially curtail water, sediment, and preemergence herbicide losses in the spring to levels equivalent to or better than that of NT, thereby protecting environmental gains provided by GRCs.

  7. Mechanisms associated with the expression of cisplatin resistance in a human ovarian tumor cell line following exposure to fractionated x-irradiation in vitro

    International Nuclear Information System (INIS)

    Dempke, W.C.M.; Shellard, S.A.; Hosking, L.K.; Hill, B.T.

    1992-01-01

    Interactions between cisplatin (CDDP) and irradiation are of potential significance for the combined modality treatment of cancer. To identify parameters associated with CDDP resistance, the human ovarian carcinoma cell line SK-OV-3/P was pre-exposed to fractionated X-irradiation in vitro. The resultant subline (SK-OV-3/DXR-10) proved 2-fold resistant to CDDP, but not to acute X-irradiation. Consistent with unaltered dihydrofolate reductase and thymidylate synthase activities, SK-OV-3/DXR-10 cells were neither cross-resistant to methotrexate nor to 5-fluorouracil. Verapamil significantly enhanced CDDP-induced cytotoxicity in the resistant DXR-10 subline, but not in the parental cells. Resistance in the SK-OV-3/DXR-10 cells was associated with significantly decreased cisplatin uptake. After an 18 h post-treatment incubation the parental cell line appeared proficient in the removal of the intrastrand adduct Pt-AG, but deficient in removing the major adduct Pt-GG and the difunctional Pt-(GMP) 2 lesion, whilst the DXR-10 resistant subline appeared proficient in removal of all four Pt-DNA adducts. DNA polymerases α and β activities, however, were comparable in both cell lines. These data implicate both enhanced repair and increased tolerance of DNA damage as mechanisms of resistance to CDDP resulting from in vitro exposure of a human ovarian carcinoma cell line to fractionated X-irradiation. (author)

  8. Resistance to bleomycin in cancer cell lines is characterized by prolonged doubling time, reduced DNA damage and evasion of G2/M arrest and apoptosis.

    Directory of Open Access Journals (Sweden)

    Qi Wang

    Full Text Available To establish, characterize and elucidate potential mechanisms of acquired bleomycin (BLM resistance using human cancer cell lines. Seven BLM-resistant cell lines were established by exposure to escalating BLM concentrations over a period of 16-24 months. IC50 values and cell doubling times were quantified using a real time cytotoxicity assay. COMET and γ-H2AX assays, cell cycle analysis, and apoptosis assessment further investigated the mechanisms of BLM resistance in these cell lines.Compared with parental cell lines, real time cytotoxicity assays revealed 7 to 49 fold increases in IC50 and a mean doubling time increase of 147 % (range 64 %-352% in BLM-resistant sub-clones (p<0.05 for both. Higher maintenance BLM concentrations were associated with higher IC50 and increased doubling times (p<0.05. Significantly reduced DNA damage (COMET and γ-H2AX assays, G2/M arrest, and apoptosis (p<0.05 for each set of comparison following high-dose acute BLM exposure was observed in resistant sub-clones, compared with their BLM-sensitive parental counterparts. Three weeks of BLM-free culturing resulted in a partial return to BLM sensitivity in 3/7 BLM-resistant sub-clones (p<0.05.Bleomycin resistance may be associated with reduced DNA damage after bleomycin exposure, resulting in reduced G2/M arrest, and reduced apoptosis.

  9. Cotton : Market setting, trade policies, and issues

    OpenAIRE

    Baffes, John

    2004-01-01

    The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...

  10. Multidrug Resistance Protein-4 Influences Aspirin Toxicity in Human Cell Line

    Directory of Open Access Journals (Sweden)

    Isabella Massimi

    2015-01-01

    Full Text Available Overexpression of efflux transporters, in human cells, is a mechanism of resistance to drug and also to chemotherapy. We found that multidrug resistance protein-4 (MRP4 overexpression has a role in reducing aspirin action in patients after bypass surgery and, very recently, we found that aspirin enhances platelet MRP4 levels through peroxisome proliferator activated receptor-α (PPARα. In the present paper, we verified whether exposure of human embryonic kidney-293 cells (Hek-293 to aspirin modifies MRP4 gene expression and its correlation with drug elimination and cell toxicity. We first investigated the effect of high-dose aspirin in Hek-293 and we showed that aspirin is able to increase cell toxicity dose-dependently. Furthermore, aspirin effects, induced at low dose, already enhance MRP4 gene expression. Based on these findings, we compared cell viability in Hek-293, after high-dose aspirin treatment, in MRP4 overexpressing cells, either after aspirin pretreatment or in MRP4 transfected cells; in both cases, a decrease of selective aspirin cell growth inhibition was observed, in comparison with the control cultures. Altogether, these data suggest that exposing cells to low nontoxic aspirin dosages can induce gene expression alterations that may lead to the efflux transporter protein overexpression, thus increasing cellular detoxification of aspirin.

  11. Heat Release Property and Fire Performance of the Nomex/Cotton Blend Fabric Treated with a Nonformaldehyde Organophosphorus System

    Directory of Open Access Journals (Sweden)

    Charles Q. Yang

    2016-09-01

    Full Text Available Blending Nomex® with cotton improves its affordability and serviceability. Because cotton is a highly flammable fiber, Nomex®/cotton blend fabrics containing more than 20% cotton require flame-retardant treatment. In this research, combination of a hydroxyl functional organophosphorus oligmer (HFPO and 1,2,3,4-butanetetracarboxylic acid (BTCA was used for flame retardant finishing of the 65/35 Nomex®/cotton blend woven fabric. The system contains HFPO as a flame retardant, BTCA as a bonding agent, and triethenolamine (TEA as a reactive additive used to enhance the performance of HFPO/BTCA. Addition of TEA improves the hydrolysis resistance of the HFPO/BTCA crosslinked polymeric network on the blend fabric. Additionally, TEA enhances HFPO’s flame retardant performance by reducing formation of calcium salts and also by providing synergistic nitrogen to the treated blend fabric. The Nomex®/cotton blend fabric treated with the HFPO/BTCA/TEA system shows high flame resistance and high laundering durability at a relatively low HFPO concentration of 8% (w/w. The heat release properties of the treated Nomex®/cotton blend fabric were measured using microscale combustion calorimetry. The functions of BTCA; HFPO and TEA on the Nomex®/cotton blend fabric were elucidated based on the heat release properties, char formation, and fire performance of the treated blend fabric.

  12. Developing Cotton IPM by Conserving Parasitoids and Predators of The Main Pest

    Directory of Open Access Journals (Sweden)

    Nurindah Nurindah

    2015-09-01

    Full Text Available On early development of intensive cotton program, insect pests were considered as an important aspect in cotton cultivation, so that it needed to be scheduled sprays. The frequency of sprays was 7 times used 12L of chemical insecticides per hectare per season. Development of cotton IPM was emphasized on non-chemical control methods through optimally utilize natural enemies of the cotton main pests (Amrasca biguttulla (IshidaHelicoverpa armigera (Hübner. Conservation of parasitoids and predators by providing the environment that support their population development is an act of supporting the natural enemies as an effective biotic mortality factor of the insect pests. The conservation could be done by improving the plant matter and cultivation techniques that include the use of resistant variety to leafhopper, intercropping cotton with secondary food plants, mulch utilization, using action threshold that considered the presence of natural enemies, and application of botanical insecticides, if needed. Conservation of parasitoids and predators in cotton IPM could control the insect pests without any insecticide spray in obtaining the production of cotton seed. As such, the use of IPM method would increase farmers’ income.

  13. Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

    Science.gov (United States)

    The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

  14. The water footprint of cotton consumption

    NARCIS (Netherlands)

    Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

    2005-01-01

    The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

  15. Possible accuracy of the Cotton-Mouton polarimetry in a sheared toroidal plasma conversion

    International Nuclear Information System (INIS)

    Kravtsov, Y.A.; Chrzanowski, J.

    2011-01-01

    The Cotton-Mouton effect in the sheared plasma with helical magnetic lines is studied, using the equation for the complex amplitude ratio (CAR). A simple model for helical magnetic lines in plasma of toroidal configuration is suggested. Equation for CAR is solved perturbatively, treating the shear angle variations as a small perturbation, caused by the spiral form of the magnetic lines. It is shown that the uncertainty of the polarization measurements in the toroidal plasma with a spiral form of the magnetic lines does not exceed 1.0-2.0%, which determines the limiting accuracy of the Cotton-Mouton polarimetry. It is furthermore pointed out that the method of a priori subtraction of the '' sheared '' term may significantly improve the accuracy of the Cotton-Mouton polarimetry. (authors)

  16. Mechanism of Resistance in two Bread Wheat (Triticum Aestivum L.) Lines to Russian Wheat Aphid (Diuraphis Noxia: Homoptra: Aphididae) in Kenya

    International Nuclear Information System (INIS)

    Malinga, J.N.

    2002-01-01

    Russian wheat aphid (Diuraphis noxia) is a recent pest of small cereals that is causing severe yield losses in farmers' fields and farmers have demanded a resistant wheat line. In wheat the pest causes both direct and indirect damage resulting in losses of up to 90%. Control of the aphid is a major constraint in the production of wheat in Kenya requiring the use of more than one systematic insecticide application.This cost is prohibitive.Breeding wheat for resistance to Russian wheat is the cheapest alternative and is the international trend. The use of Russian wheat aphid resistant cultivars may reduce the impact of these pest on cereal production. A study was therefore conducted in Kenya to understand and determine the genetics of inheritance pattern of D. noxia present in two new sources of resistance (RWA 8 and RWA 16). These two new sources would be potential donors of D. noxia resistance in breeding programmes. The two resistant donors with unknown resistance genes for Diuraphis noxia were crossed with susceptible Kenyan commercial wheat cultivar, Heroe. Resistant reaction of F 1 ,BC 1 and F2 indicated that resistance in the two lines differed. Resistant in RWA 8 may be controlled by a single dominant genes while RWA 16 by two incomplete dominant genes. It is unknown wether these genes are identical to any known, designated resistance genes. However, their resistance has been shown to be effective on the RWA population in Kenya. As studies continue on these genes at molecular level, it is recommended that resistant populations are carried on through the breeding programme to possibly identify and release a resistant variety for commercial production

  17. Comparison of imatinib, dasatinib, nilotinib and INNO-406 in imatinib-resistant cell lines.

    Science.gov (United States)

    Deguchi, Yasuyuki; Kimura, Shinya; Ashihara, Eishi; Niwa, Tomoko; Hodohara, Keiko; Fujiyama, Yoshihide; Maekawa, Taira

    2008-06-01

    We compared the growth-inhibitory effects and inhibition profile of the SRC family kinases (SFKs) of imatinib, dasatinib, nilotinib and INNO-406. Dasatinib exhibited the strongest potency against BCR-ABL with little selectivity over SFKs. Nilotinib exhibited a weaker affinity than the other inhibitors, but was highly specific for ABL and may be useful for the treatment of P-glycoprotein overexpressing leukemic cells. INNO-406 had an intermediate affinity for BCR-ABL between that of dasatinib and nilotinib, and inhibited only SFKs LCK and LYN among SFKs. Both nilotinib and INNO-406 were potent inhibitors of the dasatinib-resistant T315A, F317L and F317V BCR-ABL mutations.

  18. Mechanical Characterization of Cotton Fiber/Polyester Composite Material

    Directory of Open Access Journals (Sweden)

    Altaf Hussain Rajper

    2014-04-01

    Full Text Available Development of composite from natural fiber for lower structural application is growing for long-term sustainable perspective. Cotton fiber composite material has the added advantages of high specific strength, corrosion resistance, low cost and low weight compared to glass fiber on the expense of internal components of IC engines. The primary aim of the research study is to examine the effect of the cotton fiber on mechanical properties of lower structural applications when added with the polyester resin. In this paper composite material sample has been prepared by hand Lay-Up process. A mould is locally developed in the laboratory for test sample preparation. Initially samples of polyester resin with appropriate ratio of the hardener were developed and tested. At the second stage yarns of cotton fiber were mixed with the polyester resin and sample specimens were developed and tested. Relative effect of the cotton as reinforcing agent was examined and observed that developed composite specimen possess significant improvement in mechanical properties such as tensile strength was improved as 19.78 % and modulus of elasticity was increased up to 24.81%. Through this research it was also observed that developed composite material was of ductile nature and its density decreases up to 2.6%. Results from this study were compared with relevant available advanced composite materials and found improved mechanical properties of developed composite material

  19. Rapid first-line discrimination of methicillin resistant Staphylococcus aureus strains using MALDI-TOF MS

    DEFF Research Database (Denmark)

    Østergaard, Claus; Grønvall Kjær Hansen, Sanne; Møller, Jens K

    2015-01-01

    /z-values (peaks) and used a concept of arranging these peaks into pairs or small clusters within a small mass range, allowing for quality control of the spectra obtained. Using this concept we could reproducibly characterise and arrange the isolates into 26 MALDI-TOF groups, which strongly correlated with spa...... used for this purpose. These methods are all relatively time-consuming and not performed routinely in all laboratories. The aim of this study is to examine whether MALDI-TOF MS can be used as a fast, simple and easily implemented method for first-line discrimination of MRSA isolates. Mass spectra from...... 600 clinical MRSA isolates were included in the study, representing 89 spa types, associated with 16 different known clonal complexes. All spectra were obtained directly from colony material obtained from overnight cultures without prior protein extraction. We identified 43 useful discriminatory m...

  20. Nano-silica as the go material on heat resistant tunnel lining

    Science.gov (United States)

    Omar, Faizah; Osman, S. A.; Mutalib, A.

    2018-04-01

    This paper is concerned with passive fire protection method of protective concrete mix that is made up of fly ash, polypropylene fibre, and nano-silica. Nano-silica is focused on as the innovative material to be used in the composition of the protective concrete mix. The previous experimental studies which analyse the performance of passive fire protection on tunnels are discussed. This paper also discusses passive fire protection. The fire protection materials and behaviour analyses of tunnel structure are also presented. At the end of the paper, the recommendation of the optimum composition concrete material with fly ash, polypropylene fibre and nano-silica as tunnel lining fire protective materials is proposed.

  1. Use of induced mutations for cotton breeding in India

    International Nuclear Information System (INIS)

    Raut, R.N.

    1980-01-01

    A large number of studies have been reported in recent years on the use of induced mutations in the improvement of food crops and ornamentals. Similar investigations on fibre crops like cotton have, however, been relatively few. The fact that most of the economically useful characters in cotton are under polygenic control appears to be the main limiting factor. Inspite of this there are reports of radiation induced useful mutations used as commercial varieties. As early as 1950 a X-ray induced mutant variety of G. hirsutum cotton Indore-2 was released for commercial cultivation in Madhya Pradesh and covered more than one lac hectares. More recently an early maturing mutant variety MCU-7 was released for cultivation in summer rice fallows of Tamil Nadu and covers nearly 10,000 acres. Other promising mutant strains found suitable b.v large scale trials and recommended for cultivation under specific conditions are Okra leaf mutant, photoinsensitive mutant of MCU-5 (named Rasmi) and Jassid tolerant early maturing mutant 4-1 (Pusa Ageti). In addition improved varieties like Badnaawar-1, Khandwa-2 and M64 have been evolved by utilizing mutant lines in cross breeding. The scope of induced mutation method as a breeding technique for cotton improvement in India is very wide. (author)

  2. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  3. Cadmium induced changes in cell organelles: An ultrastructural study using cadmium sensitive and resistant muntjac fibroblast cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ord, M.J.; Chibber, R.; Bouffler, S.D.

    1988-09-01

    A detailed electron microscopy study of cadmium sensitive and resistant muntjac fibroblast cell lines has identified a wide range of intracellular damage following exposure to cadmium. Damaged organelles included cell membrane, mitochondria, Golgi cisternae and tubular network, chromatin, nucleoli, microfilaments and ribosomes. Although cell membrane damage was generally the earliest indication of adverse cadmium action, particularly with continuous cadmium exposures, cells could tolerate extensive membrane loss. Mitochondrial distortion and some damage to Golgi was also tolerated. The turning point at which cadmium became lethal was generally marked by a cascade of events which included damage to both nuclear and cytoplasmic components. These results for fibroblasts are discussed and compared with damage reported in other types of cells.

  4. Identification of SSR and RAPD markers linked to a resistance allele for angular leaf spot in the common bean (Phaseolus vulgaris line ESAL 550

    Directory of Open Access Journals (Sweden)

    Gilvan Ferreira da Silva

    2003-12-01

    Full Text Available The objective of this study was to identify RAPD and SSR markers associated with a resistant allele for angular leaf spot (Phaeoisariopsis griseola from the line 'ESAL 550', derived from the Andean 'Jalo EEP 558' cultivar, to assist selection of resistant genotypes. The resistant line 'ESAL 550' and the susceptible cultivar 'Carioca MG' were crossed to generate F1 and F2 populations. One hundred and twenty F2:3 families were evaluated. The DNA of the 12 most resistant families was bulked and the same was done with the DNA of the 10 most susceptible, generating two contrasting bulks. One RAPD and one SSR marker was found to be linked in coupling phase to the resistant allele. The SSR marker was amplified by the primer PV-atct001(282C, and its distance from the resistant allele was 7.6 cM. This is the most useful marker for indirect selection of resistant plants in segregating populations. The RAPD marker was amplified by the primer OPP07(857C linked in coupling phase to the resistant allele, and distant 24.4 cM. Therefore, this RAPD marker is not so useful in assisting selection because it is too far from the resistant allele.

  5. Development of disease-resistant lines of grain legumes through mutation breeding

    International Nuclear Information System (INIS)

    Bravo, A.

    1983-01-01

    Mutation breeding has been attempted for developing genotypes that may contain resistance to: (a) a necrotic strain of common mosaic virus in common bean (Phaseolus vulgaris L.); (b) soil fungi causing wilt in chickpea (Cicer arietinum L.); (c) the fungus Uromyces fabae that causes rust in lentil (Lens culinaris). Seeds of these three species were treated with gamma rays and planted in October 1979. Mature M 1 plants were harvested individually in March 1980. M 2 seeds were sown as single-row plant progenies in the fall (June) and spring (September) of 1980. Chickpea and lentil were planted in a soil naturally infested with soil-borne fungi (Fusarium sp. and Phytophthora sp.). Lentil plants were sprayed with a suspension of spores of the rust fungus on two occasions. Bean plants were sprayed with a suspension of virus particles mixed with carborundum. Symptomless plants were selected and harvested. There were 47 such plants of lentils and 246 of chickpea. Progenies of these plants will be tested again in replicated rows. None of the bean plants was free of virus symptoms. The least severely damaged ones were harvested. Some chickpea materials appear fairly promising. (author)

  6. Development of radiation-resistant magnet coils for high-intensity beam lines

    Science.gov (United States)

    Tanaka, K. H.; Yamanoi, Y.; Noumi, H.; Takasaki, M.; Saitoh, Y.; Kato, K.; Yokoi, T.; Tsukada, S.; Tanno, H.

    1994-07-01

    In connection with the Japanese Hadron Facility (JHF) project, the development of new types of radiation-resistant magnet coils has been continued at KEK. One major program is the design and production of a mineral insulation cable (MIC) with a larger maximum current. We have already developed a 2000A-class MIC having a square-cross-section hollow conductor. A sample magnet coil was fabricated with this MIC. Tests of its stability and reliability are under progress. We are now planning to develop a 3000A-class MIC. The other program is R/D work on a completely inorganic wrapping insulation material which can be used like the usual type glass-fiber tape pre-impregnated with epoxy-resin. After tests of the mechanical strength and electric insulation of many combinations of tapes and bonds, we found a pure (99%) alumina-fiber tape pre-impregnated with inorganic cement that is suitable for a magnet coil insulator after thermal curing.

  7. Effects of 5-fluorouracil on biological characteristics and drug resistance mechanisms of liver cancer cell line PLC/RAF/5

    Directory of Open Access Journals (Sweden)

    CHENG Kangwen

    2015-09-01

    Full Text Available ObjectiveTo study the changes in biological characteristics of a liver cancer cell line PLC/RAF/5 after repeated exposure to a chemotherapy drug, 5-fluorouraci (5-FU, and to investigate the relationship between drug-resistant liver cancer cells and liver cancer stem cells. MethodsA low concentration of 5-FU (1 μg/ml was used to treat the human liver cancer cell line PLC/RAF/5 repeatedly to establish the PLC/RAF/5/5-FU cell line. Morphological differences between the two types of cells were observed. The inhibitory effects of different concentrations of 5-FU (0, 0.25, 0.5, 1, 1.5, and 2 μg/ml on the proliferation of the two types of cells were determined using the CCK-8 assay. Apoptosis of the two types of cells after exposure to different concentrations of 5-FU (0.5, 1, and 2 μg/ml for 48 h was analyzed using flow cytometry. The proportions of side population cells in both types of cells were measured using flow cytometry. The colony-forming ability was compared between the two types of cells by the plate colony-forming assay. The expression of Bax, Bcl-2, ABCG2, and FoxM1 proteins in both types of cells was examined by Western blot. Between-group comparison was performed by t test. ResultsThe PLC/RAF/5/5-FU cell line was successfully established using the chemotherapy drug 5-FU. Compared with the PLC/RAF/5 cells, the PLC/RAF/5/5-FU cells had a larger volume, fewer protrusions, a changed shape of a long shuttle, and enhanced refractivity. Moreover, compared with the parent cells, the PLC/RAF/5/5-FU cells had a significantly lower sensitivity to the inhibitory effect of 5-FU on proliferation, a significantly lower proportion of cells at the G0/G1 phase of the cell cycle, significantly higher proportions of cells at the S and G2/M phases, significantly higher resistance to apoptosis, a significantly higher proportion of side population cells, and significantly enhanced proliferation (P<0.05. According to the results of Western blot assay, the

  8. Durable Superomniphobic Surface on Cotton Fabrics via Coating of Silicone Rubber and Fluoropolymers

    Directory of Open Access Journals (Sweden)

    Arsheen Moiz

    2018-03-01

    Full Text Available Performance textiles that protect human from different threats and dangers from environment are in high demand, and the advancement in functionalization technology together with employing advanced materials have made this an area of research focus. In this work, silicone rubber and environmentally friendly fluoropolymers have been employed to explore superomniphobic surface on cotton fabrics without compromising comfort much. It has been found that a cross-linked network between the rubber membrane and the fluoropolymers has been formed. The surface appearance, morphology, handle, thickness and chemical components of the surface of cotton fabrics have been changed. The coated fabrics showed resistance to water, aqueous liquid, oil, chemicals and soil. The comfort of the coated fabrics is different to uncoated cotton fabrics due to the existence of coated layers on the surface of cotton fabrics. This work would benefit the development and design of the next generation of performance textiles with balanced performance and comfort.

  9. Alleles conferring improved fiber quality from EMS mutagenesis of elite cotton genotypes

    Science.gov (United States)

    The elite gene pool of cotton (Gossypium spp.) has less diversity than those of most other major crops, making identification of novel alleles important to ongoing crop improvement. A total of 3,164 M5 lines resulting from ethyl methanesulfonate mutagenesis of two G. hirsutum breeding lines, TAM 94L...

  10. Incorporation of Ortho- and Meta-Tyrosine Into Cellular Proteins Leads to Erythropoietin-Resistance in an Erythroid Cell Line

    Directory of Open Access Journals (Sweden)

    Esztella Mikolás

    2014-04-01

    Full Text Available Background/Aims: Erythropoietin-resistance is an unsolved concern in the treatment of renal anaemia. We aimed to investigate the possible role of ortho- and meta-tyrosine - the hydroxyl free radical products of L-phenylalanine - in the development of erythropoietin-resistance. Methods: TF-1 erythroblast cell line was used. Cell concentration was determined on day 1; 2 and 3 by two independent observers simultaneously in Bürker cell counting chambers. Protein concentration was determined with colorimetric method. Para-, ortho- and meta-tyrosine levels were measured using reverse phase-HPLC with fluorescence detection. Using Western blot method activating phosphorylation of STAT5 and ERK1/2 were investigated. Results: We found a time- and concentration-dependent decrease of erythropoietin-induced proliferative activity in case of ortho- and meta-tyrosine treated TF-1 erythroblasts, compared to the para-tyrosine cultured cells. Decreased erythropoietin-response could be regained with a competitive dose of para-tyrosine. Proteins of erythroblasts treated by ortho- or meta-tyrosine had lower para-tyrosine and higher ortho- or meta-tyrosine content. Activating phosphorylation of ERK and STAT5 due to erythropoietin was practically prevented by ortho- or meta-tyrosine treatment. Conclusion: According to this study elevated ortho- and meta-tyrosine content of erythroblasts may lead to the dysfunction of intracellular signaling, resulting in erythropoietin-hyporesponsiveness.

  11. The BNCT resistant fraction of cancer cells. An in vitro morphologic and cytofluorimetric study on a rat coloncarcinoma cell line

    International Nuclear Information System (INIS)

    Ferrari, C.; Clerici, A.M.; Mazzini, G.

    2006-01-01

    Given the high efficacy of the BNCT treatment, recurrences reasonably depends on the failure of a cell fraction to uptake and retain adequate levels of boronated compounds. Aim of this study is to identify, quantify and characterize the resistant cell fraction relative to the delivered boron concentration. Experiments were performed on the DHD/K12/TRb line by means of cytofluorimetric DNA analysis, plating efficiency and morphologic observations. Cells were incubated with p-boronophenylalanine (BPA) concentrations ranging from 10 to 40 ppm for 18 h. Following neutron exposure, cells were reseeded for subsequent morphologic observations, counting and DNA analysis. Samples of irradiated cells not BPA enriched and non-irradiated cells with and without boron were compared with them. After 24 hs there were no differences among the four conditions, in terms of number of recovered cells, morphology and cell cycle distribution. Starting from 48 hs and up to 7 days BPA irradiated cells showed growth in dimensions, important cell number reduction and multiclonal DNA profile worsening with time. After 9 days normally sized cell clones appeared confirming the presence of a resistant cell fraction able to restore the original cell population after 21 days. The incidence of surviving cells turned out to be in the range 0,026-0,05%. (author)

  12. Heat Transfer Modeling of an Annular On-Line Spray Water Cooling Process for Electric-Resistance-Welded Steel Pipe.

    Science.gov (United States)

    Chen, Zejun; Han, Huiquan; Ren, Wei; Huang, Guangjie

    2015-01-01

    On-line spray water cooling (OSWC) of electric-resistance-welded (ERW) steel pipes can replace the conventional off-line heat treatment process and become an important and critical procedure. The OSWC process improves production efficiency, decreases costs, and enhances the mechanical properties of ERW steel pipe, especially the impact properties of the weld joint. In this paper, an annular OSWC process is investigated based on an experimental simulation platform that can obtain precise real-time measurements of the temperature of the pipe, the water pressure and flux, etc. The effects of the modes of annular spray water cooling and related cooling parameters on the mechanical properties of the pipe are investigated. The temperature evolutions of the inner and outer walls of the pipe are measured during the spray water cooling process, and the uniformity of mechanical properties along the circumferential and longitudinal directions is investigated. A heat transfer coefficient model of spray water cooling is developed based on measured temperature data in conjunction with simulation using the finite element method. Industrial tests prove the validity of the heat transfer model of a steel pipe undergoing spray water cooling. The research results can provide a basis for the industrial application of the OSWC process in the production of ERW steel pipes.

  13. Heat Transfer Modeling of an Annular On-Line Spray Water Cooling Process for Electric-Resistance-Welded Steel Pipe

    Science.gov (United States)

    Chen, Zejun; Han, Huiquan; Ren, Wei; Huang, Guangjie

    2015-01-01

    On-line spray water cooling (OSWC) of electric-resistance-welded (ERW) steel pipes can replace the conventional off-line heat treatment process and become an important and critical procedure. The OSWC process improves production efficiency, decreases costs, and enhances the mechanical properties of ERW steel pipe, especially the impact properties of the weld joint. In this paper, an annular OSWC process is investigated based on an experimental simulation platform that can obtain precise real-time measurements of the temperature of the pipe, the water pressure and flux, etc. The effects of the modes of annular spray water cooling and related cooling parameters on the mechanical properties of the pipe are investigated. The temperature evolutions of the inner and outer walls of the pipe are measured during the spray water cooling process, and the uniformity of mechanical properties along the circumferential and longitudinal directions is investigated. A heat transfer coefficient model of spray water cooling is developed based on measured temperature data in conjunction with simulation using the finite element method. Industrial tests prove the validity of the heat transfer model of a steel pipe undergoing spray water cooling. The research results can provide a basis for the industrial application of the OSWC process in the production of ERW steel pipes. PMID:26201073

  14. Hormone resistance in two MCF-7 breast cancer cell lines is associated with reduced mTOR signaling, decreased glycolysis and increased sensitivity to cytotoxic drugs

    Directory of Open Access Journals (Sweden)

    Euphemia Yee Leung

    2014-09-01

    Full Text Available The mTOR pathway is a key regulator of multiple cellular signaling pathways and is a potential target for therapy. We have previously developed two hormone-resistant sub-lines of the MCF-7 human breast cancer line, designated TamC3 and TamR3, which were characterized by reduced mTOR signaling, reduced cell volume and resistance to mTOR inhibition. Here we show that these lines exhibit increased sensitivity to carboplatin, oxaliplatin, 5-fluorouracil, camptothecin, doxorubicin, paclitaxel, docetaxel and hydrogen peroxide. The mechanisms underlying these changes have not yet been characterized but may include a shift from glycolysis to mitochondrial respiration. If this phenotype is found in clinical hormone-resistant breast cancers, conventional cytotoxic therapy may be a preferred option for treatment.

  15. China's Cotton Policy and the Impact of China's WTO Accession and Bt Cotton Adoption on the Chinese and U.S. Cotton Sectors

    OpenAIRE

    Cheng Fang; Bruce A. Babcock

    2003-01-01

    In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...

  16. Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance

    International Nuclear Information System (INIS)

    Abro, S.; Khan, M.A.; Sial, M.A.

    2015-01-01

    Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)

  17. Cocoa/Cotton Comparative Genomics

    Science.gov (United States)

    With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

  18. Cloning of resistance gene analogs located on the alien chromosome in an addition line of wheat-Thinopyrum intermedium.

    Science.gov (United States)

    Jiang, Shu-Mei; Hu, Jun; Yin, Wei-Bo; Chen, Yu-Hong; Wang, Richard R-C; Hu, Zan-Min

    2005-09-01

    Homology-based gene/gene-analog cloning method has been extensively applied in isolation of RGAs (resistance gene analogs) in various plant species. However, serious interference of sequences on homoeologous chromosomes in polyploidy species usually occurred when cloning RGAs in a specific chromosome. In this research, the techniques of chromosome microdissection combined with homology-based cloning were used to clone RGAs from a specific chromosome of Wheat-Thinopyrum alien addition line TAi-27, which was derived from common wheat and Thinopyrum intermedium with a pair of chromosomes from Th. intermedium. The alien chromosomes carry genes for resistance to BYDV. The alien chromosome in TAi-27 was isolated by a glass needle and digested with proteinase K. The DNA of the alien chromosome was amplified by two rounds of Sau3A linker adaptor-mediated PCR. RGAs were amplified by PCR with the degenerated primers designed based on conserved domains of published resistance genes (R genes) by using the alien chromosome DNA, genomic DNA and cDNA of Th. intermedium, TAi-27 and 3B-2 (a parent of TAi-27) as templates. A total of seven RGAs were obtained and sequenced. Of which, a constitutively expressed single-copy NBS-LRR type RGA ACR 3 was amplified from the dissected alien chromosome of TAi-27, TcDR 2 and TcDR 3 were from cDNA of Th. intermedium, AcDR 3 was from cDNA of TAi-27, FcDR 2 was from cDNA of 3B-2, AR 2 was from genomic DNA of TAi-27 and TR 2 was from genomic DNA of Th. intermedium. Sequence homology analyses showed that the above RGAs were highly homologous with known resistance genes or resistance gene analogs and belonged to NBS-LRR type of R genes. ACR 3 was recovered by PCR from genomic DNA and cDNA of Th. intermedium and TAi-27, but not from 3B-2. Southern hybridization using the digested genomic DNA of Th. intermedium, TAi-27 and 3B-2 as the template and ACR 3 as the probe showed that there is only one copy of ACR 3 in the genome of Th. intermedium and TAi

  19. Resistance to Fusarium verticillioides and fumonisin accumulation in maize inbred lines involves an earlier and enhanced expression of lipoxygenase (LOX) genes.

    Science.gov (United States)

    Maschietto, Valentina; Marocco, Adriano; Malachova, Alexandra; Lanubile, Alessandra

    2015-09-01

    Fusarium verticillioides causes ear rot in maize and contaminates the kernels with the fumonisin mycotoxins. It is known that plant lipoxygenase (LOX)-derived oxylipins regulate defence against pathogens and that the host-pathogen lipid cross-talk influences the pathogenesis. The expression profiles of fifteen genes of the LOX pathway were studied in kernels of resistant and susceptible maize lines, grown in field condition, at 3, 7 and 14 days post inoculation (dpi) with F. verticillioides. Plant defence responses were correlated with the pathogen growth, the expression profiles of fungal FUM genes for fumonisin biosynthesis and fumonisin content in the kernels. The resistant genotype limited fungal growth and fumonisin accumulation between 7 and 14 dpi. Pathogen growth became exponential in the susceptible line after 7 dpi, in correspondence with massive transcription of FUM genes and fumonisins augmented exponentially at 14 dpi. LOX pathway genes resulted strongly induced after pathogen inoculation in the resistant line at 3 and 7 dpi, whilst in the susceptible line the induction was reduced or delayed at 14 dpi. In addition, all genes resulted overexpressed before infection in kernels of the resistant genotype already at 3 dpi. The results suggest that resistance in maize may depend on an earlier activation of LOX genes and genes for jasmonic acid biosynthesis. Copyright © 2015 Elsevier GmbH. All rights reserved.

  20. [The effect and mechanism of vinorelbine on cisplatin resistance of human lung cancer cell line A549/DDP].

    Science.gov (United States)

    Qi, Chunsheng; Gao, Sen; Li, Huiqiang; Gao, Weizhen

    2014-02-01

    Drug resistance is a major obstacle on lung cancer treatment and Vinorelbine is an effective drug to inhibition of tumor proliferation and metastasis. In this study, we investigated the effect and mechanism of Vinorelbine on reversing the cisplatin resistance of human lung cancer A549/DDP cell line. With 1 μmol/L and 5 μmol/L Vinorelbine treatment, MTS assay was employed to determine the effect of the cisplatin sensitivity of tumor cells, flow cytometry to determine the apoptosis rate and change of Rh-123 content; Western blot to determine the expression of MDR1, Bcl-2, surviving, PTEN, caspase-3/8 and phosphorylation level of Akt (p-Akt); Real-time PCR was to determine the mRNA expression of MDR1, Bcl-2, survivin and PTEN. Finally the transcriptional activities of NF-κB, Twist and Snail were determined by reporter gene system. With 1 μmol/L and 5 μmol/L Vinorelbine treatment, the sensitivity of cancer cells to cisplatin was increased by 1.91- and 2.54- folds respectively, flow cytometry showed that the content of Rh-123 was elevated 1.93- and 2.95- folds and apoptosis rate was increased 2.25- and 3.82- folds, Western blot showed that the expression of multidrug resistance related proteins MDR, Bcl-2 and survivin were downregulated, caspase-3/8 and PTEN was upregulated, phosphorylation of Akt was downregulated as well, real-time assay showed that the mRNA expression of MDR1 was downregulated 43.5% and 25.8%, Bcl-2 was downregulated 57.3% and 34.1%, survivin was downregulated 37.6% and 12.4%, PTEN was upregulated 183.4% and 154.2%, the transcriptional activities of NF-κB was downregulated 53.2% and 34.5%, Twist was downregulated 61.4% and 33.5%, and Snail was downregulated 57.8% and 18.7%. Vinorelbine treatment led to increase of cisplatin sensitivity of A549/DDP cells and the mechanisms included the regulation of PTEN/AKT/NF-κB signal pathway to decreased drug resistance gene expression and increased pro-apoptosis gene expression.

  1. Cisgenic Rvi6 scab-resistant apple lines show no differences in Rvi6 transcription when compared with conventionally bred cultivars.

    Science.gov (United States)

    Chizzali, Cornelia; Gusberti, Michele; Schouten, Henk J; Gessler, Cesare; Broggini, Giovanni A L

    2016-03-01

    The expression of the apple scab resistance gene Rvi6 in different apple cultivars and lines is not modulated by biotic or abiotic factors. All commercially important apple cultivars are susceptible to Venturia inaequalis, the causal organism of apple scab. A limited number of apple cultivars were bred to express the resistance gene Vf from the wild apple genotype Malus floribunda 821. Positional cloning of the Vf locus allowed the identification of the Rvi6 (formerly HcrVf2) scab resistance gene that was subsequently used to generate cisgenic apple lines. It is important to understand and compare how this resistance gene is transcribed and modulated during infection in conventionally bred cultivars and in cisgenic lines. The aim of this work was to study the transcription pattern of Rvi6 in three classically bred apple cultivars and six lines of 'Gala' genetically modified to express Rvi6. Rvi6 transcription was analyzed at two time points using quantitative real-time PCR (RT-qPCR) following inoculation with V. inaequalis conidia or water. Rvi6 transcription was assessed in relation to five reference genes. β-Actin, RNAPol, and UBC were the most suited to performing RT-qPCR experiments on Malus × domestica. Inoculation with V. inaequalis conidia under conditions conducive to scab infection failed to produce any significant changes to the transcription level of Rvi6. Rvi6 expression levels were inconsistent in response to external treatments in the different apple cultivars, and transgenic, intragenic or cisgenic lines.

  2. Cotton fiber quality determined by fruit position, temperature and management

    OpenAIRE

    Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.

    2013-01-01

    CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.

  3. 7 CFR 1205.319 - Cotton-producing region.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

  4. Performance and feeding behaviour of two biotypes of the black currant-lettuce aphid, Nasonovia ribisnigri, on resistant and susceptible Lactuca sativa near-isogenic lines.

    Science.gov (United States)

    ten Broeke, Cindy J M; Dicke, Marcel; van Loon, Joop J A

    2013-10-01

    The black currant-lettuce aphid, Nasonovia ribisnigri, is an important pest of cultivated lettuce, Lactuca sativa. Since 1982, the control of this aphid on lettuce is largely based on host plant resistance, conferred by the Nr gene, introgressed from Lactuca virosa. The resistance mechanism remains to be identified. N. ribisnigri populations virulent on the Nr-based resistance in lettuce have emerged in several locations in Europe since 2007. The objective of this study was to investigate the resistance mechanism mediated by the Nr gene in lettuce by detailed studies of aphid feeding behaviour and performance. Both avirulent (Nr:0) and virulent (Nr:1)biotypes of N. ribisnigri were studied on five resistant and two susceptible near isogenic lines (NILs). In addition, survival and colony development were quantified.Nr:0 aphids showed a strong decrease in sieve element ingestion and took longer to accept a sieve element on resistant NILs compared with susceptible NILs, and no aphids survived on the resistant NIL. Nr:1 aphids fed and performed equally well on the resistant and susceptible NILs. The resistance mechanism against Nr:0 aphids encoded by the Nr gene seems to be located in the phloem, although we also observed differences in feeding behaviour during the pathway phase to the phloem. Nr:1 aphids were highly virulent to the resistance conferred by the Nr gene. The consequences of the appearance of Nr:1 aphids for control of N. ribisnigri are discussed.

  5. B cell signatures of BCWD-resistant and susceptible lines of rainbow trout: a shift towards more EBF-expressing progenitors and fewer mature B cells in resistant animals.

    Science.gov (United States)

    Zwollo, Patty; Ray, Jocelyn C; Sestito, Michael; Kiernan, Elizabeth; Wiens, Gregory D; Kaattari, Steve; StJacques, Brittany; Epp, Lidia

    2015-01-01

    Bacterial cold water disease (BCWD) is a chronic disease of rainbow trout, and is caused by the Gram-negative bacterium Flavobacterium psychrophilum (Fp), a common aquaculture pathogen. The National Center for Cool and Cold Water Aquaculture has bred two genetic lines of rainbow trout: a line of Fp-resistant trout (ARS-Fp-R or R-line trout) and a line of susceptible trout (ARS-Fp-S, or S-line). Little is known about how phenotypic selection alters immune response parameters or how such changes relate to genetic disease resistance. Herein, we quantify interindividual variation in the distribution and abundance of B cell populations (B cell signatures) and examine differences between genetic lines of naive animals. There are limited trout-specific cell surface markers currently available to resolve B cell subpopulations and thus we developed an alternative approach based on detection of differentially expressed transcription factors and intracellular cytokines. B cell signatures were compared between R-line and S-line trout by flow cytometry using antibodies against transcription factors early B cell factor-1 (EBF1) and paired domain box protein Pax5, the pro-inflammatory cytokine IL-1β, and the immunoglobulin heavy chain mu. R-line trout had higher percentages of EBF(+) B myeloid/ progenitor and pre-B cells in PBL, anterior and posterior kidney tissues compared to S-line trout. The opposite pattern was detected in more mature B cell populations: R-line trout had lower percentages of both IgM(+) mature B cells and IgM-secreting cells in anterior kidney and PBL compared to S-line trout. In vitro LPS-activation studies of PBL and spleen cell cultures revealed no significant induction differences between R-line and S-line trout. Together, our findings suggest that selective resistance to BCWD may be associated with shifts in naive animal developmental lineage commitment that result in decreased B lymphopoiesis and increased myelopoiesis in BCWD resistant trout relative

  6. Performance of some transgenic cotton cultivars against insect pest complex, virus incidence and yield

    International Nuclear Information System (INIS)

    Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.

    2013-01-01

    Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)

  7. Development and characterization of a hydrogen peroxide-resistant cholangiocyte cell line: A novel model of oxidative stress-related cholangiocarcinoma genesis

    Energy Technology Data Exchange (ETDEWEB)

    Thanan, Raynoo [Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Techasen, Anchalee [Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Faculty of Associated Medical Science, Khon Kaen University, Khon Kaen 40002 (Thailand); Hou, Bo [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Tsu, Mie 514-8507 (Japan); Jamnongkan, Wassana; Armartmuntree, Napat [Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Yongvanit, Puangrat, E-mail: puangrat@kku.ac.th [Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Murata, Mariko, E-mail: mmurata@doc.medic.mie-u.ac.jp [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Tsu, Mie 514-8507 (Japan)

    2015-08-14

    Oxidative stress is a cause of inflammation–related diseases, including cancers. Cholangiocarcinoma is a liver cancer with bile duct epithelial cell phenotypes. Our previous studies in animal and human models indicated that oxidative stress is a major cause of cholangiocarcinoma development. Hydrogen peroxide (H{sub 2}O{sub 2}) can generate hydroxyl radicals, which damage lipids, proteins, and nucleic acids, leading to cell death. However, some cells can survive by adapting to oxidative stress conditions, and selective clonal expansion of these resistant cells would be involved in oxidative stress-related carcinogenesis. The present study aimed to establish H{sub 2}O{sub 2}-resistant cell line from an immortal cholangiocyte cell line (MMNK1) by chronic treatment with low-concentration H{sub 2}O{sub 2} (25 μM). After 72 days of induction, H{sub 2}O{sub 2}-resistant cell lines (ox-MMNK1-L) were obtained. The ox-MMNK1-L cell line showed H{sub 2}O{sub 2}-resistant properties, increasing the expression of the anti-oxidant genes catalase (CAT), superoxide dismutase-1 (SOD1), superoxide dismutase-2 (SOD2), and superoxide dismutase-3 (SOD3) and the enzyme activities of CAT and intracellular SODs. Furthermore, the resistant cells showed increased expression levels of an epigenetics-related gene, DNA methyltransferase-1 (DNMT1), when compared to the parental cells. Interestingly, the ox-MMNK1-L cell line had a significantly higher cell proliferation rate than the MMNK1 normal cell line. Moreover, ox-MMNK1-L cells showed pseudopodia formation and the loss of cell-to-cell adhesion (multi-layers) under additional oxidative stress (100 μM H{sub 2}O{sub 2}). These findings suggest that H{sub 2}O{sub 2}-resistant cells can be used as a model of oxidative stress-related cholangiocarcinoma genesis through molecular changes such as alteration of gene expression and epigenetic changes. - Highlights: • An H{sub 2}O{sub 2}-resistant ox-MMNK1-L cells was established from

  8. Identification of quantitative trait Loci for resistance to southern leaf blight and days to anthesis in a maize recombinant inbred line population.

    Science.gov (United States)

    Balint-Kurti, P J; Krakowsky, M D; Jines, M P; Robertson, L A; Molnár, T L; Goodman, M M; Holl, J B

    2006-10-01

    ABSTRACT A recombinant inbred line population derived from a cross between the maize lines NC300 (resistant) and B104 (susceptible) was evaluated for resistance to southern leaf blight (SLB) disease caused by Cochliobolus heterostrophus race O and for days to anthesis in four environments (Clayton, NC, and Tifton, GA, in both 2004 and 2005). Entry mean and average genetic correlations between disease ratings in different environments were high (0.78 to 0.89 and 0.9, respectively) and the overall entry mean heritability for SLB resistance was 0.89. When weighted mean disease ratings were fitted to a model using multiple interval mapping, seven potential quantitative trait loci (QTL) were identified, the two strongest being on chromosomes 3 (bin 3.04) and 9 (bin 9.03-9.04). These QTL explained a combined 80% of the phenotypic variation for SLB resistance. Some time-point-specific SLB resistance QTL were also identified. There was no significant correlation between disease resistance and days to anthesis. Six putative QTL for time to anthesis were identified, none of which coincided with any SLB resistance QTL.

  9. Stable Human Hepatoma Cell Lines for Efficient Regulated Expression of Nucleoside/Nucleotide Analog Resistant and Vaccine Escape Hepatitis B Virus Variants and Woolly Monkey Hepatitis B Virus.

    Directory of Open Access Journals (Sweden)

    Xin Cheng

    Full Text Available Hepatitis B virus (HBV causes acute and chronic hepatitis B (CHB. Due to its error-prone replication via reverse transcription, HBV can rapidly evolve variants that escape vaccination and/or become resistant to CHB treatment with nucleoside/nucleotide analogs (NAs. This is particularly problematic for the first generation NAs lamivudine and adefovir. Though now superseded by more potent NAs, both are still widely used. Furthermore, resistance against the older NAs can contribute to cross-resistance against more advanced NAs. For lack of feasible HBV infection systems, the biology of such variants is not well understood. From the recent discovery of Na+-taurocholate cotransporting polypeptide (NTCP as an HBV receptor new in vitro infection systems are emerging, yet access to the required large amounts of virions, in particular variants, remains a limiting factor. Stably HBV producing cell lines address both issues by allowing to study intracellular viral replication and as a permanent source of defined virions. Accordingly, we generated a panel of new tetracycline regulated TetOFF HepG2 hepatoma cell lines which produce six lamivudine and adefovir resistance-associated and two vaccine escape variants of HBV as well as the model virus woolly monkey HBV (WMHBV. The cell line-borne viruses reproduced the expected NA resistance profiles and all were equally sensitive against a non-NA drug. The new cell lines should be valuable to investigate under standardized conditions HBV resistance and cross-resistance. With titers of secreted virions reaching >3 x 10(7 viral genome equivalents per ml they should also facilitate exploitation of the new in vitro infection systems.

  10. SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

    Science.gov (United States)

    Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

    2018-05-22

    Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

  11. Transepithelial resistance and claudin expression in trout RTgill-W1 cell line: effects of osmoregulatory hormones.

    Science.gov (United States)

    Trubitt, Rebecca T; Rabeneck, D Brett; Bujak, Joanna K; Bossus, Maryline C; Madsen, Steffen S; Tipsmark, Christian K

    2015-04-01

    In the present study, we examined the trout gill cell line RTgill-W1 as a possible tool for in vitro investigation of epithelial gill function in fish. After seeding in transwells, transepithelial resistance (TER) increased until reaching a plateau after 1-2 days (20-80Ω⋅cm(2)), which was then maintained for more than 6 days. Tetrabromocinnamic acid, a known stimulator of TER via casein kinase II inhibition, elevated TER in the cell line to 125% of control values after 2 and 6h. Treatment with ethylenediaminetetraacetic acid induced a decrease in TER to hormone (Gh). The effects of three osmoregulatory hormones, Gh, prolactin, and cortisol, on the mRNA expression of three tight junction proteins were examined: claudin-10e (Cldn-10e), Cldn-30, and zonula occludens-1 (Zo-1). The expression of cldn-10e was stimulated by all three hormones but with the strongest effect of Gh (50-fold). cldn-30 expression was stimulated especially by cortisol (20-fold) and also by Gh (4-fold). Finally, zo-1 was unresponsive to hormone treatment. Western blot analysis detected Cldn-10e and Cldn-30 immunoreactive proteins of expected molecular weight in samples from rainbow trout gills but not from RTgill-W1 cultures, possibly due to low expression levels. Collectively, these results show that the RTgill-W1 cell layers have tight junctions between cells, are sensitive to hormone treatments, and may provide a useful model for in vitro study of some in vivo gill phenomena. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Proof of the concept to use a malignant B cell line drug screen strategy for identification and weight of melphalan resistance genes in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Martin Bøgsted

    Full Text Available In a conceptual study of drug resistance we have used a preclinical model of malignant B-cell lines by combining drug induced growth inhibition and gene expression profiling. In the current report a melphalan resistance profile of 19 genes were weighted by microarray data from the MRC Myeloma IX trial and time to progression following high dose melphalan, to generate an individual melphalan resistance index. The resistance index was subsequently validated in the HOVON65/GMMG-HD4 trial data set to prove the concept. Biologically, the assigned resistance indices were differentially distributed among translocations and cyclin D expression classes. Clinically, the 25% most melphalan resistant, the intermediate 50% and the 25% most sensitive patients had a median progression free survival of 18, 32 and 28 months, respectively (log-rank P-value  = 0.05. Furthermore, the median overall survival was 45 months for the resistant group and not reached for the intermediate and sensitive groups (log-rank P-value  = 0.003 following 38 months median observation. In a multivariate analysis, correcting for age, sex and ISS-staging, we found a high resistance index to be an independent variable associated with inferior progression free survival and overall survival. This study provides clinical proof of concept to use in vitro drug screen for identification of melphalan resistance gene signatures for future functional analysis.

  13. Variabilidade isoenzimática entre linhagens de amendoim resistentes à seca Isoenzimatic variability between peanut lines resistant to drought

    Directory of Open Access Journals (Sweden)

    Roseane Cavalcanti dos Santos

    2000-04-01

    Full Text Available O uso da técnica de eletroforese para separar múltiplas formas moleculares de enzimas tem sido bastante explorada na área biológica, cujas diferenças detectadas nos tecidos podem ser eficientemente usadas para diferenciação de cultivares em qualquer fase de seu desenvolvimento fenológico. Nesse trabalho, procedeu-se ao estudo da variabilidade isoenzimática em seis linhagens de amendoim resistentes à seca, com o objetivo de se verificar as possíveis relações da variação encontrada na base desses descritores com essa aptidão no amendoim. Estudaram-se folíolos da parte apical com 5 dias após a germinação, utilizando-se a técnica de eletroforese em gel de poliacrilamida (7% sistema horizontal e contínuo de tampão. Os sistemas estudados foram fosfatase ácida (ACP, malato desidrogenase (MDH, leucina aminopeptidase (LAP, peroxidase (PO, e esterase (EST. A caracterização fenotípica dos genótipos permitiu a separação de quatro grupos para ACP, três para LAP, dois para MDH e seis para PO e EST. A partir da análise dos componentes principais dos grupos obtidos, observou-se que a cultivar IAC Tupã (sensível à seca foi separada das demais, especialmente da cultivar resistente Senegal 55437.The use of electrophoretic techniques to separate multiple molecular forms of enzymes has been used in the biological science, where differences in isozymes among tissues can be used efficiently on cultivar differentiation during any life cycle phase. In this paper, the variability of six drought resistant peanut lines was studied by isozymes analysis aiming to verify the possible relations between enzymatic descriptors and drought resistance character. Leaflets were analyzed by horizontal poliacrylamide gel electrophoresis technique and buffer continuos systems for the following systems: acid phosphatase (ACP, malate dehydrogenase (MDH, leucine aminopeptidase (LAP, peroxidase (POX and esterase (EST. The phenotypic characterization of the

  14. Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

    African Journals Online (AJOL)

    Assessment of Bollgard II cotton pollen mediated transgenes flow to conventional cotton in the farming conditions of Burkina ... This has led to experiment on Bt cotton from 2003 to 2007. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  15. Genetic analysis of a novel broad-spectrum powdery mildew resistance gene from the wheat-Agropyron cristatum introgression line Pubing 74.

    Science.gov (United States)

    Lu, Yuqing; Yao, Miaomiao; Zhang, Jinpeng; Song, Liqiang; Liu, Weihua; Yang, Xinming; Li, Xiuquan; Li, Lihui

    2016-09-01

    A novel broad-spectrum powdery mildew resistance gene PmPB74 was identified in wheat- Agropyron cristatum introgression line Pubing 74. Development of wheat cultivars with broad-spectrum, durable resistance to powdery mildew has been restricted by lack of superior genetic resources. In this study, a wheat-A. cristatum introgression line Pubing 74, originally selected from a wide cross between the common wheat cultivar Fukuhokomugi (Fukuho) and Agropyron cristatum (L.) Gaertn (2n = 4x = 28; genome PPPP), displayed resistance to powdery mildew at both the seedling and adult stages. The putative alien chromosomal fragment in Pubing 74 was below the detection limit of genomic in situ hybridization (GISH), but evidence for other non-GISH-detectable introgressions was provided by the presence of three STS markers specific to A. cristatum. Genetic analysis indicated that Pubing 74 carried a single dominant gene for powdery mildew resistance, temporarily designated PmPB74. Molecular mapping showed that PmPB74 was located on wheat chromosome arm 5DS, and flanked by markers Xcfd81 and HRM02 at genetic distances of 2.5 and 1.7 cM, respectively. Compared with other lines with powdery mildew resistance gene(s) on wheat chromosome arm 5DS, Pubing 74 was resistant to all 28 Blumeria graminis f. sp tritici (Bgt) isolates from different wheat-producing regions of northern China. Allelism tests indicated that PmPB74 was not allelic to PmPB3558 or Pm2. Our work showed that PmPB74 is a novel gene with broad resistance to powdery mildew, and hence will be helpful in broadening the genetic basis of powdery mildew resistance in wheat.

  16. Drug resistance mutations in HIV type 1 isolates from naive patients eligible for first line antiretroviral therapy in JJ Hospital, Mumbai, India.

    Science.gov (United States)

    Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J

    2011-12-01

    More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.

  17. Brachypodium distachyon line Bd3-1 resistance is elicited by the barley stripe mosaic virus triple gene block 1 movement protein

    NARCIS (Netherlands)

    Lee, M.Y.; Yan, L.J.; Gorter, F.A.; Kim, B.Y.T.; Cui, Y.; Hu, Y.; Yuan, C.; Grindheim, J.; Ganesan, U.; Liu, Z.Y.; Han, C.G.; Yu, J.L.; Li, D.W.; Jackson, A.O.

    2012-01-01

    Barley stripe mosaic virus North Dakota 18 (ND18), Beijing (BJ), Xinjiang (Xi), Type (TY) and CV21 strains are unable to infect the Brachypodium distachyon Bd3-1 inbred line, which harbours a resistance gene designated Bsr1, but the Norwich (NW) strain is virulent on Bd3-1. Analysis of ND18 and NW

  18. Cisgenic Rvi6 scab-resistant apple lines show no differences in Rvi6 transcription when compared with conventionally bred cultivars

    NARCIS (Netherlands)

    Chizzali, Cornelia; Gusberti, Michele; Schouten, H.J.; Gessler, Cesare; Broggini, G.A.L.

    2016-01-01

    Main conclusion: The expression of the apple scab resistance geneRvi6in different apple cultivars and lines is not modulated by biotic or abiotic factors.All commercially important apple cultivars are susceptible to Venturia inaequalis, the causal organism of apple scab. A limited number of apple

  19. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie

    2016-10-01

    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  20. Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India

    Directory of Open Access Journals (Sweden)

    Fahmiya Leena Yacoob

    2016-01-01

    Full Text Available In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days as compared to solid and liquid cultures (35.6 days and 13.5 days, resp..

  1. Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India.

    Science.gov (United States)

    Yacoob, Fahmiya Leena; Philomina Jose, Beena; Karunakaran Lelitha, Sarada Devi; Sreenivasan, Sreelatha

    2016-01-01

    In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days) as compared to solid and liquid cultures (35.6 days and 13.5 days, resp.).

  2. Preclinical screening for drugs effective against 5-fluorouracil-resistant cells with a murine L5178Y cell line in vitro

    International Nuclear Information System (INIS)

    Hill, B.T.

    1983-01-01

    A subline of L5178Y cells has been established in vitro that exhibits a fiftyfold order of resistance to 5-fluorouracil (FUra) as compared to that of the parent line. The cytotoxic effects of 24-hour exposures to 23 antitumor drugs and to radiation were compared in the two cell lines. Four patterns of response were identified: 1) Only two drugs, mitomycin C and adriamycin, proved significantly more cytotoxic to FUra-resistant cells. 2) Four other drugs--anguidine, 4'-(9-acridinylamino)-methanesulfon-m-anisidide, melphalan, and quelamycin--showed marginal superiority against resistant cells. 3) X-radiation and the majority of drugs tested--including 5-azacytidine, 1,3-bis(2-chloroethyl)-1-nitrosourea, cisplatin, bleomycin, dibromodulcitol, razoxane, hydroxyurea, methotrexate, teniposide, etoposide, and three experimental agents, metoprine, spirogermanium HCl, and ellipticinum--proved equally cytotoxic to both cell lines. 4) Cross-resistance with FUra was exhibited with vincristine, vindesine, pyrazofurin, and indicine-N-oxide. This experimental system provides a simple method of testing agents for activity against FUra-resistant cells before phase 1 clinical studies

  3. Pollen- and seed-mediated transgene flow in commercial cotton seed production fields.

    Directory of Open Access Journals (Sweden)

    Shannon Heuberger

    Full Text Available BACKGROUND: Characterizing the spatial patterns of gene flow from transgenic crops is challenging, making it difficult to design containment strategies for markets that regulate the adventitious presence of transgenes. Insecticidal Bacillus thuringiensis (Bt cotton is planted on millions of hectares annually and is a potential source of transgene flow. METHODOLOGY/PRINCIPAL FINDINGS: Here we monitored 15 non-Bt cotton (Gossypium hirsutum, L. seed production fields (some transgenic for herbicide resistance, some not for gene flow of the Bt cotton cry1Ac transgene. We investigated seed-mediated gene flow, which yields adventitious Bt cotton plants, and pollen-mediated gene flow, which generates outcrossed seeds. A spatially-explicit statistical analysis was used to quantify the effects of nearby Bt and non-Bt cotton fields at various spatial scales, along with the effects of pollinator abundance and adventitious Bt plants in fields, on pollen-mediated gene flow. Adventitious Bt cotton plants, resulting from seed bags and planting error, comprised over 15% of plants sampled from the edges of three seed production fields. In contrast, pollen-mediated gene flow affected less than 1% of the seed sampled from field edges. Variation in outcrossing was better explained by the area of Bt cotton fields within 750 m of the seed production fields than by the area of Bt cotton within larger or smaller spatial scales. Variation in outcrossing was also positively associated with the abundance of honey bees. CONCLUSIONS/SIGNIFICANCE: A comparison of statistical methods showed that our spatially-explicit analysis was more powerful for understanding the effects of surrounding fields than customary models based on distance. Given the low rates of pollen-mediated gene flow observed in this study, we conclude that careful planting and screening of seeds could be more important than field spacing for limiting gene flow.

  4. In vitro release of arachidonic acid and in vivo responses to respirable fractions of cotton dust

    International Nuclear Information System (INIS)

    Thomson, T.A.; Edwards, J.H.; Al-Zubaidy, T.S.; Brown, R.C.; Poole, A.; Nicholls, P.J.

    1986-01-01

    It was considered that the fall in lung function seen after exposure to cotton dust may be attributable in part to the activity of arachidonic acid metabolites, such as leucotrienes as well as to the more established release of histamine by cotton dust. However, we found that cotton and barley dusts elicited poor release of arachidonic acid from an established macrophage like cell line compared with that observed with other organic dusts. In the experimental animal, pulmonary cellular responses to both cotton and barley dust were similar to those evoked by moldy hay and pigeon dropping dusts, although after multiple doses a more severe response was seen to cotton and barley. Since both moldy hay and pigeon droppings elicit a greater arachidonic acid release than cotton or barley, a role for arachidonic acid in inducing the cellular response is less likely than other factors. There are limitations to our conclusions using this system, i.e., the arachidonic acid may be released in a nonmetabolized form, although it is noted that the two dusts with the greatest arachidonic acid release produce their clinical responses in humans largely by hypersensitivity mechanisms

  5. Evolving of mutant lines resistant to lodging, blast, and high yield in rice by induce mutation using gamma ray (physical mutagen)

    International Nuclear Information System (INIS)

    Majd, F.; Rahimi, M.; Rezazadeh, M.

    2003-01-01

    Induction of mutation for the purpose of producing variations in the gene pool has been used in recent years. In this experiment the locally adapted rice C V Moosa-Tarom was used as a high quality, tall and very lodging susceptible mutation material. The main purpose of this project was to evolve lodging resistant mutants of high yielding. The elite seeds of Moosa-Tarom variety after moisture regulation were exposed to 100, 200 and 300 Gy from Cobalt 60 source at the Nuclear Research Center. The irradiated seeds were sown in the field along with a comparable number of unirradiated seeds taken as control. All the first panicles of M1 plants were individually harvested and classified according to the dose rate as M2 material . Among M2 plant populations 203 plants that appeared from the agronomic point of view, along with a number of on unirradiated seeds, were selected and moved to the next generations. During subsequent screening for three generations (M 3-M 5) and due to lodging resistant, height and efficient factors of yield potential some mutant lines were harvested. From these lines in a preliminary and advanced randomized complete design agronomic traits, 13 promising lines were selected. From the experiment, line 43-3 were confirmed, which is characterized by lodging resistant and high yield. This line showed relative superiority and introduced to Rice Research Institute

  6. New wheat-rye 5DS-4RS·4RL and 4RS-5DS·5DL translocation lines with powdery mildew resistance.

    Science.gov (United States)

    Fu, Shulan; Ren, Zhenglong; Chen, Xiaoming; Yan, Benju; Tan, Feiquan; Fu, Tihua; Tang, Zongxiang

    2014-11-01

    Powdery mildew is one of the serious diseases of wheat (Triticum aestivum L., 2 n = 6 × = 42, genomes AABBDD). Rye (Secale cereale L., 2 n = 2 × = 14, genome RR) offers a rich reservoir of powdery mildew resistant genes for wheat breeding program. However, extensive use of these resistant genes may render them susceptible to new pathogen races because of co-evolution of host and pathogen. Therefore, the continuous exploration of new powdery mildew resistant genes is important to wheat breeding program. In the present study, we identified several wheat-rye addition lines from the progeny of T. aestivum L. Mianyang11 × S. cereale L. Kustro, i.e., monosomic addition lines of the rye chromosomes 4R and 6R; a disomic addition line of 6R; and monotelosomic or ditelosomic addition lines of the long arms of rye chromosomes 4R (4 RL) and 6R (6 RL). All these lines displayed immunity to powdery mildew. Thus, we concluded that both the 4 RL and 6 RL arms of Kustro contain powdery mildew resistant genes. It is the first time to discover that 4 RL arm carries powdery mildew resistant gene. Additionally, wheat lines containing new wheat-rye translocation chromosomes were also obtained: these lines retained a short arm of wheat chromosome 5D (5 DS) on which rye chromosome 4R was fused through the short arm 4 RS (designated 5 DS-4 RS · 4 RL; 4 RL stands for the long arm of rye chromosome 4R); or they had an extra short arm of rye chromosome 4R (4 RS) that was attached to the short arm of wheat chromosome 5D (5 DS) (designated 4 RS-5 DS · 5 DL; 5 DL stands for the long arm of wheat chromosome 5D). These two translocation chromosomes could be transmitted to next generation stably, and the wheat lines containing 5 DS-4 RS · 4 RL chromosome also displayed immunity to powdery mildew. The materials obtained in this study can be used for wheat powdery mildew resistant breeding program.

  7. Aqueous supercapacitors on conductive cotton

    KAUST Repository

    Pasta, Mauro; La Mantia, Fabio; Hu, Liangbing; Deshazer, Heather Dawn; Cui, Yi

    2010-01-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

  8. Aqueous supercapacitors on conductive cotton

    KAUST Repository

    Pasta, Mauro

    2010-06-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

  9. Effect of cotton leaf-curl virus on the yield-components and fibre properties of cotton genotypes under varying plant spacing and nitrogen fertilizer

    International Nuclear Information System (INIS)

    Ahmad, S.; Hayat, K.; Ashraf, F.; Sadiq, M.A.

    2008-01-01

    Cotton leaf-curl virus (CLCu VB. Wala strain) is one of the major biotic constraints of cotton production in Punjab. Development of resistant cotton genotype is the most feasible, economical and effective method to combat this hazardous problem, but so far no resistant genotype has been reported. Therefore, the objective of this study was to compare yield and yield-components and fiber traits of different genotypes/varieties under different plant spacing and nitrogen fertilizer as a management strategy to cope with this viral disease. Field experiment was conducted during 2006-07 to evaluate the effect of genotype, plant spacing and nitrogen fertilizer on cotton. Five genotypes (MNH-786, MNH-789, MNH- 6070, CIM- 496, and BH-160), three plant-spacings (15, 30 and 45 cm) and three nitrogen fertilizer-levels (6.5, 8.6 and 11 bags Urea / ha) were studied. Results showed that significant differences exist for plant height, no. of bolls/m/sup -2/, seed-cotton yield (kg/ha) due to genotype, interaction of genotype with plant spacing and nitrogen fertilizer level. Whereas boll weight, ginning out-turn, staple length and fiber fineness were not affected significantly by the plant spacing and nitrogen fertilizer, the effect due to genotype was significant for these traits. CLCuV infestation varied significantly with genotypes, while all other factors, i.e., plant spacing and nitrogen fertilizers, have non-significant effect. As the major objective of cotton cultivation is production of lint for the country and seed- cotton yield for the farmers, it is noted that genotypes grown in narrow plant-spacing (15 cm) and higher nitrogen fertilizer level (11.0 bags of urea/ha) produced maximum seed-cotton yield under higher CLCu V infestation in case of CIM-496, MNH-789 and BH-I60, while the new strain MNH-6070 gave maximum yield under 30cm plant-spacing and 8.6 bags of urea/ha has the 2.3% CLCu V infestation was observed in this variety. From the present study, it is concluded that

  10. HIV-1 drug resistance genotyping from antiretroviral therapy (ART naïve and first-line treatment failures in Djiboutian patients

    Directory of Open Access Journals (Sweden)

    Elmi Abar Aden

    2012-10-01

    Full Text Available Abstract In this study we report the prevalence of antiretroviral drug resistant HIV-1 genotypes of virus isolated from Djiboutian patients who failed first-line antiretroviral therapy (ART and from ART naïve patients. Patients and methods A total of 35 blood samples from 16 patients who showed first-line ART failure (>1000 viral genome copies/ml and 19 ART-naïve patients were collected in Djibouti from October 2009 to December 2009. Both the protease (PR and reverse transcriptase (RT genes were amplified and sequenced using National Agency for AIDS Research (ANRS protocols. The Stanford HIV database algorithm was used for interpretation of resistance data and genotyping. Results Among the 16 patients with first-line ART failure, nine (56.2% showed reverse transcriptase inhibitor-resistant HIV-1 strains: two (12.5% were resistant to nucleoside (NRTI, one (6.25% to non-nucleoside (NNRTI reverse transcriptase inhibitors, and six (37.5% to both. Analysis of the DNA sequencing data indicated that the most common mutations conferring drug resistance were M184V (38% for NRTI and K103N (25% for NNRTI. Only NRTI primary mutations K101Q, K103N and the PI minor mutation L10V were found in ART naïve individuals. No protease inhibitor resistant strains were detected. In our study, we found no detectable resistance in ∼ 44% of all patients who experienced therapeutic failure which was explained by low compliance, co-infection with tuberculosis and malnutrition. Genotyping revealed that 65.7% of samples were infected with subtype C, 20% with CRF02_AG, 8.5% with B, 2.9% with CRF02_AG/C and 2.9% with K/C. Conclusion The results of this first study about drug resistance mutations in first-line ART failures show the importance of performing drug resistance mutation test which guides the choice of a second-line regimen. This will improve the management of HIV-infected Djiboutian patients. Virtual slides The virtual slide(s for this article can be found

  11. Conventional P-ω/Q-V Droop Control in Highly Resistive Line of Low-Voltage Converter-Based AC Microgrid

    DEFF Research Database (Denmark)

    Hou, Xiaochao; Sun, Yao; Yuan, Wenbin

    2016-01-01

    -ω/Q-V droop control is adopted in the low-voltage AC microgrid. As a result, the active power sharing among the distributed generators (DGs) is easily obtained without communication. More importantly, this study clears up the previous misunderstanding that conventional P-ω/Q-V droop control is only applicable...... to microgrids with highly inductive lines, and lays a foundation for the application of conventional droop control under different line impedances. Moreover, in order to guarantee the accurate reactive power sharing, a guide for designing Q-V droop gains is given, and virtual resistance is adopted to shape......In low-voltage converter-based alternating current (AC) microgrids with resistive distribution lines, the P-V droop with Q-f boost (VPD/FQB) is the most common method for load sharing. However, it cannot achieve the active power sharing proportionally. To overcome this drawback, the conventional P...

  12. Characterization of Camptothecin-induced Genomic Changes in the Camptothecin-resistant T-ALL-derived Cell Line CPT-K5

    DEFF Research Database (Denmark)

    Kjeldsen, Eigil; Nielsen, Christine J F; Roy, Amit

    2018-01-01

    -K5 and its parental cell line. We identified copy number alterations affecting genes important for maintaining genome integrity and reducing CPT-induced DNA damage. We show for the first time that short tandem repeats are targets for TOP1 cleavage, that can be differentially stimulated by CPT.......Acquisition of resistance to topoisomerase I (TOP1)-targeting camptothecin (CPT) derivatives is a major clinical problem. Little is known about the underlying chromosomal and genomic mechanisms. We characterized the CPT-K5 cell line expressing mutant CPT-resistant TOP1 and its parental T......-cell derived acute lymphoblastic leukemia CPT-sensitive RPMI-8402 cell line by karyotyping and molecular genetic methods, including subtractive oligo-based array comparative genomic hybridization (soaCGH) analysis. Karyotyping revealed that CPT-K5 cells had acquired additional structural aberrations...

  13. Cotton transformation via pollen tube pathway.

    Science.gov (United States)

    Wang, Min; Zhang, Baohong; Wang, Qinglian

    2013-01-01

    Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

  14. Quantitative Trait Loci Mapping of Western Corn Rootworm (Coleoptera: Chrysomelidae) Host Plant Resistance in Two Populations of Doubled Haploid Lines in Maize (Zea mays L.).

    Science.gov (United States)

    Bohn, Martin O; Marroquin, Juan J; Flint-Garcia, Sherry; Dashiell, Kenton; Willmot, David B; Hibbard, Bruce E

    2018-02-09

    Over the last 70 yr, more than 12,000 maize accessions have been screened for their level of resistance to western corn rootworm, Diabrotica virgifera virgifera (LeConte; Coleoptera: Chrysomelidae), larval feeding. Less than 1% of this germplasm was selected for initiating recurrent selection or other breeding programs. Selected genotypes were mostly characterized by large root systems and superior root regrowth after root damage caused by western corn rootworm larvae. However, no hybrids claiming native (i.e., host plant) resistance to western corn rootworm larval feeding are currently commercially available. We investigated the genetic basis of western corn rootworm resistance in maize materials with improved levels of resistance using linkage disequilibrium mapping approaches. Two populations of topcrossed doubled haploid maize lines (DHLs) derived from crosses between resistant and susceptible maize lines were evaluated for their level of resistance in three to four different environments. For each DHL topcross an average root damage score was estimated and used for quantitative trait loci (QTL) analysis. We found genomic regions contributing to western corn rootworm resistance on all maize chromosomes, except for chromosome 4. Models fitting all QTL simultaneously explained about 30 to 50% of the genotypic variance for root damage scores in both mapping populations. Our findings confirm the complex genetic structure of host plant resistance against western corn rootworm larval feeding in maize. Interestingly, three of these QTL regions also carry genes involved in ascorbate biosynthesis, a key compound we hypothesize is involved in the expression of western corn rootworm resistance. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  16. Causative Organisms and Associated Antimicrobial Resistance in Healthcare-Associated, Central Line-Associated Bloodstream Infections From Oncology Settings, 2009-2012.

    Science.gov (United States)

    See, Isaac; Freifeld, Alison G; Magill, Shelley S

    2016-05-15

    Recent antimicrobial resistance data are lacking from inpatient oncology settings to guide infection prophylaxis and treatment recommendations. We describe central line-associated bloodstream infection (CLABSI) pathogens and antimicrobial resistance patterns reported from oncology locations to the Centers for Disease Control and Prevention's National Healthcare Safety Network (NHSN). CLABSI data reported to NHSN from 2009 to 2012 from adult inpatient oncology locations were compared to data from nononcology adult locations within the same hospitals. Pathogen profile, antimicrobial resistance rates, and CLABSI incidence rates per 1000 central line-days were calculated. CLABSI incidence rates were compared using Poisson regression. During 2009-2012, 4654 CLABSIs were reported to NHSN from 299 adult oncology units. The most common organisms causing CLABSI in oncology locations were coagulase-negative staphylococci (16.9%), Escherichia coli (11.8%), and Enterococcus faecium (11.4%). Fluoroquinolone resistance was more common among E. coli CLABSI in oncology than nononcology locations (56.5% vs 41.5% of isolates tested; P oncology compared to nononcology locations for fluoroquinolone-resistant E. coli (rate ratio, 7.37; 95% confidence interval [CI], 6.20-8.76) and vancomycin-resistant E. faecium (rate ratio, 2.27, 95% CI, 2.03-2.53). However, resistance rates for some organisms, such as Klebsiella species and Pseudomonas aeruginosa, were lower in oncology than in nononcology locations. Antimicrobial-resistant E. coli and E. faecium have become significant pathogens in oncology. Practices for antimicrobial prophylaxis and empiric antimicrobial therapy should be regularly assessed in conjunction with contemporary antimicrobial resistance data. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  17. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

    2013-03-28

    Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

  18. Identification of multiple ear-colonizing insect and disease resistance in CIMMYT maize inbred lines with varying levels of silk maysin.

    Science.gov (United States)

    Ni, Xinzhi; Krakowsky, Matthew D; Buntin, G David; Rector, Brian G; Guo, Baozhu; Snook, Maurice E

    2008-08-01

    Ninety four corn inbred lines selected from International Center for the Improvement of Maize and Wheat (CIMMYT) in Mexico were evaluated for levels of silk maysin in 2001 and 2002. Damage by major ear-feeding insects [i.e., corn earworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae); maize weevil, Sitophilus zeamais (Motschulsky) (Coleoptera: Curculionidae); brown stink bug, Euschistus servus (Say); southern green stink bugs, Nezara viridula (L.) (Heteroptera: Pentatomidae)], and common smut [Ustilago maydis DC (Corda)] infection on these inbred lines were evaluated in 2005 and 2006 under subtropical conditions at Tifton, GA. Ten inbred lines possessing good agronomic traits were also resistant to the corn earworm. The correlation between ear-feeding insect damage or smut infection and three phenotypic traits (silk maysin level, husk extension, and husk tightness of corn ears) was also examined. Corn earworm and stink bug damage was negatively correlated to husk extension, but not to either silk maysin levels or husk tightness. In combination with the best agronomic trait ratings that show the least corn earworm and stink bug damage, lowest smut infection rate, and good insect-resistant phenotypic traits (i.e., high maysin and good husk coverage and husk tightness), 10 best inbred lines (CML90, CML92, CML94, CML99, CML104, CML108, CML114, CML128, CML137, and CML373) were identified from the 94 lines examined. These selected inbred lines will be used for further examination of their resistance mechanisms and development of new corn germplasm that confers multiple ear-colonizing pest resistance.

  19. Genomics-enabled analysis of the emergent disease cotton bacterial blight.

    Directory of Open Access Journals (Sweden)

    Anne Z Phillips

    2017-09-01

    Full Text Available Cotton bacterial blight (CBB, an important disease of (Gossypium hirsutum in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars.

  20. Resistance mechanisms to erlotinib in the non-small cell lung cancer cell line, HCC827 examined by RNA-seq

    DEFF Research Database (Denmark)

    Jacobsen, Kirstine; Alcaraz, Nicolas; Ditzel, Henrik

    (Illumina) prior to sequencing on an Illumina HiSeq platform (100bp paired end). The resistant subclones were examined both in presence and absence of erlotinib. The data was analyzed by an in-house developed pipeline including quality control by Trim Galore v0.3.3, mapping of reads to HG19 by TopHat2 v.2......Background: Erlotinib, an EGFR selective reversible inhibitor, has dramatically changed the treatment of non-small cell lung cancer (NSCLC) as approximately 70% of patients show significant tumor regression upon treatment. However, all patients eventually relapse due to development of acquired...... - in erlotinib-resistant subclones of the NSCLC cell line HCC827. Materials & Methods: We established 3 erlotinib-resistant subclones (resistant to 10, 20, 30 µM erlotinib, respectively), and prepared cDNA libraries of purified RNA from biological duplicates using TruSeq® Stranded Total RNA Ribo-Zero™ Gold...

  1. Transmission of HIV drug resistance and the predicted effect on current first-line regimens in Europe

    NARCIS (Netherlands)

    Hofstra, L. Marije; Sauvageot, Nicolas; Albert, Jan; Alexiev, Ivailo; Garcia, Federico; Struck, Daniel; Van De Vijver, David A M C; Åsjö, Birgitta; Beshkov, Danail; Coughlan, Suzie; Descamps, Diane; Griskevicius, Algirdas; Hamouda, Osamah; Horban, Andrzej; Van Kasteren, Marjo; Kolupajeva, Tatjana; Kostrikis, Leontios G.; Liitsola, Kirsi; Linka, Marek; Mor, Orna; Nielsen, Claus; Otelea, Dan; Paraskevis, Dimitrios; Paredes, Roger; Poljak, Mario; Puchhammer-Stöckl, Elisabeth; Sönnerborg, Anders; Staneková, Danica; Stanojevic, Maja; Van Laethem, Kristel; Zazzi, Maurizio; Lepej, Snjezana Zidovec; Boucher, Charles A B; Schmit, Jean Claude; Wensing, Annemarie M J; Puchhammer-Stockl, E.; Sarcletti, M.; Schmied, B.; Geit, M.; Balluch, G.; Vandamme, A. M.; Vercauteren, J.; Derdelinckx, I.; Sasse, A.; Bogaert, M.; Ceunen, H.; De Roo, A.; De Wit, S.; Echahidi, F.; Fransen, K.; Goffard, J. C.; Goubau, P.; Goudeseune, E.; Yombi, J. C.; Lacor, P.; Liesnard, C.; Moutschen, M.; Pierard, D.; Rens, R.; Schrooten, Y.; Vaira, D.; Vandekerckhove, L. P R; Van Den Heuvel, A.; Van Der Gucht, B.; Van Ranst, M.; Van Wijngaerden, E.; Vandercam, B.; Vekemans, M.; Verhofstede, C.; Clumeck, N.; Van Laethem, K.; Beshkov, D.; Alexiev, I.; Lepej, S. Zidovec; Begovac, J.; Kostrikis, Leontios G.; Demetriades, I.; Kousiappa, I.; Demetriou, V.; Hezka, J.; Linka, M.; Maly, M.; Machala, L.; Nielsen, C.; Jørgensen, L. B.; Gerstoft, J.; Mathiesen, L.; Pedersen, C.; Nielsen, H.; Laursen, A.; Kvinesdal, B.; Liitsola, K.; Ristola, M.; Suni, J.; Sutinen, J.; Descamps, D.; Assoumou, L.; Castor, G.; Grude, M.; Flandre, P.; Storto, A.; Hamouda, O.; Kücherer, C.; Berg, T.; Braun, P.; Poggensee, G.; Däumer, M.; Eberle, J.; Heiken, H.; Kaiser, R.; Knechten, H.; Korn, K.; Müller, H.; Neifer, S.; Schmidt, B.; Walter, H.; Gunsenheimer-Bartmeyer, B.; Harrer, T.; Paraskevis, D.; Hatzakis, A.; Zavitsanou, A.; Vassilakis, A.; Lazanas, M.; Chini, M.; Lioni, A.; Sakka, V.; Kourkounti, S.; Paparizos, V.; Antoniadou, A.; Papadopoulos, A.; Poulakou, G.; Katsarolis, I.; Protopapas, K.; Chryssos, G.; Drimis, S.; Gargalianos, P.; Xylomenos, G.; Lourida, G.; Psichogiou, M.; Daikos, G. L.; Sipsas, N. V.; Kontos, A.; Gamaletsou, M. N.; Koratzanis, G.; Sambatakou, E.; Mariolis, H.; Skoutelis, A.; Papastamopoulos, V.; Georgiou, O.; Panagopoulos, P.; Maltezos, E.; Coughlan, S.; De Gascun, C.; Byrne, C.; Duffy, M.; Bergin, C.; Reidy, D.; Farrell, G.; Lambert, J.; O'Connor, E.; Rochford, A.; Low, J.; Coakely, P.; O'Dea, S.; Hall, W.; Mor, O.; Levi, I.; Chemtob, D.; Grossman, Z.; Zazzi, M.; De Luca, A.; Balotta, C.; Riva, C.; Mussini, C.; Caramma, I.; Capetti, A.; Colombo, M. C.; Rossi, C.; Prati, F.; Tramuto, F.; Vitale, F.; Ciccozzi, M.; Angarano, G.; Rezza, G.; Kolupajeva, T.; Kolupajeva, T.; Vasins, O.; Griskevicius, A.; Lipnickiene, V.; Schmit, J. C.; Struck, D.; Sauvageot, N.; Hemmer, R.; Arendt, V.; Michaux, C.; Staub, T.; Sequin-Devaux, C.; Wensing, A. M J; Boucher, C. A B; Van Kessel, A.; Van Bentum, P. H M; Brinkman, K.; Connell, B. J.; Van Der Ende, M. E.; Hoepelman, I. M.; Van Kasteren, M.; Kuipers, M.; Langebeek, N.; Richter, C.; Santegoets, R. M W J; Schrijnders-Gudde, L.; Schuurman, R.; Van De Ven, B. J M; Åsjö, B.; Kran, A. M Bakken; Ormaasen, V.; Aavitsland, P.; Horban, A.; Stanczak, J. J.; Stanczak, G. P.; Firlag-Burkacka, E.; Wiercinska-Drapalo, A.; Jablonowska, E.; Maolepsza, E.; Leszczyszyn-Pynka, M.; Szata, W.; Camacho, R.; Palma, C.; Borges, F.; Paixão, T.; Duque, V.; Araújo, F.; Otelea, D.; Paraschiv, S.; Tudor, A. M.; Cernat, R.; Chiriac, C.; Dumitrescu, F.; Prisecariu, L. J.; Stanojevic, M.; Jevtovic, Dj; Salemovic, D.; Stanekova, D.; Habekova, M.; Chabadová, Z.; Drobkova, T.; Bukovinova, P.; Shunnar, A.; Truska, P.; Poljak, M.; Lunar, M.; Babic, D.; Tomazic, J.; Vidmar, L.; Vovko, T.; Karner, P.; Garcia, F.; Paredes, R.; Monge, S.; Moreno, S.; Del Amo, J.; Asensi, V.; Sirvent, J. L.; De Mendoza, C.; Delgado, R.; Gutiérrez, F.; Berenguer, J.; Garcia-Bujalance, S.; Stella, N.; De Los Santos, I.; Blanco, J. R.; Dalmau, D.; Rivero, M.; Segura, F.; Elías, M. J Pérez; Alvarez, M.; Chueca, N.; Rodríguez-Martín, C.; Vidal, C.; Palomares, J. C.; Viciana, I.; Viciana, P.; Cordoba, J.; Aguilera, A.; Domingo, P.; Galindo, M. J.; Miralles, C.; Del Pozo, M. A.; Ribera, E.; Iribarren, J. A.; Ruiz, L.; De La Torre, J.; Vidal, F.; Clotet, B.; Albert, J.; Heidarian, A.; Aperia-Peipke, K.; Axelsson, M.; Mild, M.; Karlsson, A.; Sönnerborg, A.; Thalme, A.; Navér, L.; Bratt, G.; Karlsson, A.; Blaxhult, A.; Gisslén, M.; Svennerholm, B.; Bergbrant, I.; Björkman, P.; Säll, C.; Lindholm, A.; Kuylenstierna, N.; Montelius, R.; Azimi, F.; Johansson, B.; Carlsson, M.; Johansson, E.; Ljungberg, B.; Ekvall, H.; Strand, A.; Mäkitalo, S.; Öberg, S.; Holmblad, P.; Höfer, M.; Holmberg, H.; Josefson, P.; Ryding, U.

    2016-01-01

    Background. Numerous studies have shown that baseline drug resistance patterns may influence the outcome of antiretroviral therapy. Therefore, guidelines recommend drug resistance testing to guide the choice of initial regimen. In addition to optimizing individual patient management, these baseline

  2. Down-regulated βIII-tubulin Expression Can Reverse Paclitaxel Resistance in A549/Taxol Cells Lines

    Directory of Open Access Journals (Sweden)

    Yinling ZHUO

    2014-08-01

    Full Text Available Background and objective Chemotherapy drug resistance is the primary causes of death in patients with pulmonary carcinoma which make tumor recurrence or metastasis. β-tubulin is the main cell targets of anti-microtubule drug. Increased expression of βIII-tubulin has been implicated in non-small cell lung cancer (NSCLC cell lines. To explore the relationship among the expression level of βIII-tubulin and the sensitivity of A549/Taxolcell lines to Taxol and cell cycles and cell apoptosis by RNA interference-mediated inhibition of βIII-tubulin in A549/Taxol cells. Methods Three pairs of siRNA targetd βIII-tubulin were designed and prepared, which were transfected into A549/Taxol cells using LipofectamineTM 2000. We detected the expression of βIII-tubulin mRNA using Real-time fluorescence qRT-PCR. Tedhen we selected the most efficient siRNA by the expression of βIII-tubulin mRNA in transfected group. βIII-tubulin protein level were mesured by Western blot. The taxol sensitivity in transfected group were evaluated by MTT assay. And the cell apoptosis and cell cycles were determined by flow cytometry. Results βIII-tubulin mRNA levels in A549/Taxol cells were significantly decreased in transfected grop by Real-time qRT-PCR than control groups. And βIII-tubulin siRNA-1 sequence showed the highest transfection efficiency, which was (87.73±4.87% (P<0.01; Western blot results showed that the expressional level of BIII tublin protein was significantly down-reulated in the transfectant cells than thant in the control cells. By MTT assay, we showed that the inhibition ratio of Taxol to A549/Taxol cells transfeced was higher than that of control group (51.77±4.60% (P<0.01. The early apoptosis rate of A549/Taxol cells in transfected group were significantly higher than that of control group (P<0.01; G2-M content in taxol group obviously increased than untreated samples by the cell cycle (P<0.05. Conclusion βIII-tubulin down-regulated significantly

  3. Fungal diversity associated with verticillium wilt of cotton

    International Nuclear Information System (INIS)

    Khaskheli, M.I.; Sun, J.L.; Li, F.

    2014-01-01

    The association of fungal diversity with Verticillium wilt is rarely known, which is important to know for the control of this detrimental disease. Our study is the preliminary attempt to find the associations of fungal diversity with Verticillium wilt and provides the baseline information for biological control. About 30 different fungi from soil and 23 from cotton plants were isolated and confirmed through molecular characterization. The colony forming unit (CFU)/g dry soil of fungi before and after planting cotton showed significant variation among all the fungi. The overall frequency of all fungi for soil after sowing was significantly higher than before sowing. A. alternata, F. equiseti, F. concentricum, A. flavus, F. proliferatum, and Chaetomium sp. associated with high resistance (Arcot-1) to Verticillium wilt, whereas, V. dahliae, A.niger and Paecilomyces sp., with high susceptible (Arcot-438) germplasm. However, T. basicola, C. ramotenellum and G. intermedia were isolated from both. Soil plating was comparatively easiest than soil dilution method for the determination of frequency percentage, however, later method is useful for the screening of single spore isolation. Most of the antagonistic species were screened from soil; nevertheless, Paecilomyces and Chaetomium spp. were screened from plant and soil. In vitro test of T. longibrachiatum. T. atroviride, Paecilomyces and T. viride showed the strongest efficacy against V. dahliae. These efficient bio-agents can be used as an effective tool for other future studies regarding to Verticillium wilt of cotton. (author)

  4. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.

    2010-01-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  5. RXLR and CRN Effectors from the Sunflower Downy Mildew Pathogen Plasmopara halstedii Induce Hypersensitive-Like Responses in Resistant Sunflower Lines

    Science.gov (United States)

    Gascuel, Quentin; Buendia, Luis; Pecrix, Yann; Blanchet, Nicolas; Muños, Stéphane; Vear, Felicity; Godiard, Laurence

    2016-01-01

    Plasmopara halstedii is an obligate biotrophic oomycete causing downy mildew disease on sunflower, Helianthus annuus, an economically important oil crop. Severe symptoms of the disease (e.g., plant dwarfism, leaf bleaching, sporulation and production of infertile flower) strongly impair seed yield. Pl resistance genes conferring resistance to specific P. halstedii pathotypes were located on sunflower genetic map but yet not cloned. They are present in cultivated lines to protect them against downy mildew disease. Among the 16 different P. halstedii pathotypes recorded in France, pathotype 710 is frequently found, and therefore continuously controlled in sunflower by different Pl genes. High-throughput sequencing of cDNA from P. halstedii led us to identify potential effectors with the characteristic RXLR or CRN motifs described in other oomycetes. Expression of six P. halstedii putative effectors, five RXLR and one CRN, was analyzed by qRT-PCR in pathogen spores and in the pathogen infecting sunflower leaves and selected for functional analyses. We developed a new method for transient expression in sunflower plant leaves and showed for the first time subcellular localization of P. halstedii effectors fused to a fluorescent protein in sunflower leaf cells. Overexpression of the CRN and of 3 RXLR effectors induced hypersensitive-like cell death reactions in some sunflower near-isogenic lines resistant to pathotype 710 and not in susceptible corresponding lines, suggesting they could be involved in Pl loci-mediated resistances. PMID:28066456

  6. Quantitative trait loci underlying resistance to sudden death syndrome (SDS) in MD96-5722 by 'Spencer' recombinant inbred line population of soybean.

    Science.gov (United States)

    Anderson, J; Akond, M; Kassem, M A; Meksem, K; Kantartzi, S K

    2015-04-01

    The best way to protect yield loss of soybean [Glycine max (L.) Merr.] due to sudden death syndrome (SDS), caused by Fusarium virguliforme (Aoki, O'Donnel, Homma & Lattanzi), is the development and use of resistant lines. Mapping quantitative trait loci (QTL) linked to SDS help developing resistant soybean germplasm through molecular marker-assisted selection strategy. QTL for SDS presented herein are from a high-density SNP-based genetic linkage map of MD 96-5722 (a.k.a 'Monocacy') by 'Spencer' recombinant inbred line using SoySNP6K Illumina Infinium BeadChip genotyping array. Ninety-four F 5:7 lines were evaluated for 2 years (2010 and 2011) at two locations (Carbondale and Valmeyer) in southern Illinois, USA to identify QTL controlling SDS resistance using disease index (DX). Composite interval mapping identified 19 SDS controlling QTL which were mapped on 11 separate linkage group (LG) or chromosomes (Chr) out of 20 LG or Chr of soybean genome. Many of these significant QTL identified in one environment/year were confirmed in another year or environment, which suggests a common genetic effects and modes of the pathogen. These new QTL are useful sources for SDS resistance studies in soybean breeding, complementing previously reported loci.

  7. Expression Analysis of Stress-Related Genes in Kernels of Different Maize (Zea mays L.) Inbred Lines with Different Resistance to Aflatoxin Contamination

    Science.gov (United States)

    Jiang, Tingbo; Zhou, Boru; Luo, Meng; Abbas, Hamed K.; Kemerait, Robert; Lee, Robert Dewey; Scully, Brian T.; Guo, Baozhu

    2011-01-01

    This research examined the expression patterns of 94 stress-related genes in seven maize inbred lines with differential expressions of resistance to aflatoxin contamination. The objective was to develop a set of genes/probes associated with resistance to A. flavus and/or aflatoxin contamination. Ninety four genes were selected from previous gene expression studies with abiotic stress to test the differential expression in maize lines, A638, B73, Lo964, Lo1016, Mo17, Mp313E, and Tex6, using real-time RT-PCR. Based on the relative-expression levels, the seven maize inbred lines clustered into two different groups. One group included B73, Lo1016 and Mo17, which had higher levels of aflatoxin contamination and lower levels of overall gene expression. The second group which included Tex6, Mp313E, Lo964 and A638 had lower levels of aflatoxin contamination and higher overall levels of gene expressions. A total of six “cross-talking” genes were identified between the two groups, which are highly expressed in the resistant Group 2 but down-regulated in susceptible Group 1. When further subjected to drought stress, Tex6 expressed more genes up-regulated and B73 has fewer genes up-regulated. The transcript patterns and interactions measured in these experiments indicate that the resistant mechanism is an interconnected process involving many gene products and transcriptional regulators, as well as various host interactions with environmental factors, particularly, drought and high temperature. PMID:22069724

  8. RXLR and CRN effectors from the sunflower downy mildew pathogen Plasmopara halstedii induce hypersensitive-like responses in resistant sunflower lines

    Directory of Open Access Journals (Sweden)

    Quentin Gascuel

    2016-12-01

    Full Text Available Plasmopara halstedii is an obligate biotrophic oomycete causing downy mildew disease on sunflower, Helianthus annuus, an economically important oil crop. Severe symptoms of the disease (e.g. plant dwarfism, leaf bleaching, sporulation and production of infertile flower strongly impair seed yield. Pl resistance genes conferring resistance to specific P. halstedii pathotypes were located on sunflower genetic map but yet not cloned. They are present in cultivated lines to protect them against downy mildew disease. Among the 16 different P. halstedii pathotypes recorded in France, pathotype 710 is frequently found, and therefore continuously controlled in sunflower by different Pl genes. High-throughput sequencing of cDNA from P. halstedii led us to identify potential effectors with the characteristic RXLR or CRN motifs described in other oomycetes. Expression of six P. halstedii putative effectors, five RXLR and one CRN, was analysed by qRT-PCR in pathogen spores and in the pathogen infecting sunflower leaves and these six effectors were selected for functional analyses. We developed a new method for transient expression in sunflower plant leaves and showed for the first time subcellular localization of P. halstedii effectors fused to a fluorescent protein in sunflower leaf cells. Overexpression of the CRN and of 3 RXLR effectors induced hypersensitive-like cell death reactions in some sunflower near-isogenic lines resistant to pathotype 710 and not in susceptible corresponding lines, suggesting they could be involved in Pl loci-mediated resistances.

  9. Forkhead Box Protein C2 Promotes Epithelial-Mesenchymal Transition, Migration and Invasion in Cisplatin-Resistant Human Ovarian Cancer Cell Line (SKOV3/CDDP

    Directory of Open Access Journals (Sweden)

    Chanjuan Li

    2016-08-01

    Full Text Available Background/Aims: Forkhead Box Protein C2 (FOXC2 has been reported to be overexpressed in a variety of human cancers. However, it is unclear whether FOXC2 regulates epithelial-mesenchymal transition (EMT in CDDP-resistant ovarian cancer cells. The aim of this study is to investigate the effects of FOXC2 on EMT and invasive characteristics of CDDP-resistant ovarian cancer cells and the underlying molecular mechanism. Methods: MTT, Western blot, scratch wound healing, matrigel transwell invasion, attachment and detachment assays were performed to detect half maximal inhibitory concentration (IC50 of CDDP, expression of EMT-related proteins and invasive characteristics in CDDP-resistant ovarian cancer cell line (SKOV3/CDDP and its parental cell line (SKOV3. Small hairpin RNA (shRNA was used to knockdown FOXC2 and analyze the effect of FOXC2 knockdown on EMT and invasive characteristics of SKOV3/CDDP cells. Also, the effect of FOXC2 upregulation on EMT and invasive characteristics of SKOV3 cells was analyzed. Furthermore, the molecular mechanism underlying FOXC2-regulating EMT in ovarian cancer cells was determined. Results: Compared with parental SKOV3 cell line, SKOV3/CDDP showed higher IC50 of CDDP (43.26μM (PConclusions: Taken together, these data demonstrate that FOXC2 may be a promoter of EMT phenotype in CDDP-resistant ovarian cancer cells and a potential therapeutic target for the treatment of advanced ovarian cancer.

  10. Methotrexate diethyl ester-loaded lipid-core nanocapsules in aqueous solution increased antineoplastic effects in resistant breast cancer cell line.

    Science.gov (United States)

    Yurgel, Virginia C; Oliveira, Catiuscia P; Begnini, Karine R; Schultze, Eduarda; Thurow, Helena S; Leon, Priscila M M; Dellagostin, Odir A; Campos, Vinicius F; Beck, Ruy C R; Guterres, Silvia S; Collares, Tiago; Pohlmann, Adriana R; Seixas, Fabiana K

    2014-01-01

    Breast cancer is the most frequent cancer affecting women. Methotrexate (MTX) is an antimetabolic drug that remains important in the treatment of breast cancer. Its efficacy is compromised by resistance in cancer cells that occurs through a variety of mechanisms. This study evaluated apoptotic cell death and cell cycle arrest induced by an MTX derivative (MTX diethyl ester [MTX(OEt)2]) and MTX(OEt)2-loaded lipid-core nanocapsules in two MTX-resistant breast adenocarcinoma cell lines, MCF-7 and MDA-MB-231. The formulations prepared presented adequate granulometric profile. The treatment responses were evaluated through flow cytometry. Relying on the mechanism of resistance, we observed different responses between cell lines. For MCF-7 cells, MTX(OEt)2 solution and MTX(OEt)2-loaded lipid-core nanocapsules presented significantly higher apoptotic rates than untreated cells and cells incubated with unloaded lipid-core nanocapsules. For MDA-MB-231 cells, MTX(OEt)2-loaded lipid-core nanocapsules were significantly more efficient in inducing apoptosis than the solution of the free drug. S-phase cell cycle arrest was induced only by MTX(OEt)2 solution. The drug nanoencapsulation improved apoptosis induction for the cell line that presents MTX resistance by lack of transport receptors.

  11. Linkage Map Construction and Quantitative Trait Locus Analysis of Agronomic and Fiber Quality Traits in Cotton

    Directory of Open Access Journals (Sweden)

    Michael A. Gore

    2014-03-01

    Full Text Available The superior fiber properties of L. serve as a source of novel variation for improving fiber quality in Upland cotton ( L., but introgression from has been largely unsuccessful due to hybrid breakdown and a lack of genetic and genomic resources. In an effort to overcome these limitations, we constructed a linkage map and conducted a quantitative trait locus (QTL analysis of 10 agronomic and fiber quality traits in a recombinant inbred mapping population derived from a cross between TM-1, an Upland cotton line, and NM24016, an elite line with stabilized introgression from . The linkage map consisted of 429 simple-sequence repeat (SSR and 412 genotyping-by-sequencing (GBS-based single-nucleotide polymorphism (SNP marker loci that covered half of the tetraploid cotton genome. Notably, the 841 marker loci were unevenly distributed among the 26 chromosomes of tetraploid cotton. The 10 traits evaluated on the TM-1 × NM24016 population in a multienvironment trial were highly heritable, and most of the fiber traits showed considerable transgressive variation. Through the QTL analysis, we identified a total of 28 QTLs associated with the 10 traits. Our study provides a novel resource that can be used by breeders and geneticists for the genetic improvement of agronomic and fiber quality traits in Upland cotton.

  12. Radiation resistant fiber Bragg grating in random air-line fibers for sensing applications in nuclear reactor cores.

    Science.gov (United States)

    Zaghloul, Mohamed A S; Wang, Mohan; Huang, Sheng; Hnatovsky, Cyril; Grobnic, Dan; Mihailov, Stephen; Li, Ming-Jun; Carpenter, David; Hu, Lin-Wen; Daw, Joshua; Laffont, Guillaume; Nehr, Simon; Chen, Kevin P

    2018-04-30

    This paper reports the testing results of radiation resistant fiber Bragg grating (FBG) in random air-line (RAL) fibers in comparison with FBGs in other radiation-hardened fibers. FBGs in RAL fibers were fabricated by 80 fs ultrafast laser pulse using a phase mask approach. The fiber Bragg gratings tests were carried out in the core region of a 6 MW MIT research reactor (MITR) at a steady temperature above 600°C and an average fast neutron (>1 MeV) flux >1.2 × 10 14 n/cm 2 /s. Fifty five-day tests of FBG sensors showed less than 5 dB reduction in FBG peak strength after over 1 × 10 20 n/cm 2 of accumulated fast neutron dose. The radiation-induced compaction of FBG sensors produced less than 5.5 nm FBG wavelength shift toward shorter wavelength. To test temporal responses of FBG sensors, a number of reactor anomaly events were artificially created to abruptly change reactor power, temperature, and neutron flux over short periods of time. The thermal sensitivity and temporal responses of FBGs were determined at different accumulated doses of neutron flux. Results presented in this paper reveal that temperature-stable Type-II FBGs fabricated in radiation-hardened fibers can survive harsh in-pile conditions. Despite large parameter drift induced by strong nuclear radiation, further engineering and innovation on both optical fibers and fiber devices could lead to useful fiber sensors for various in-pile measurements to improve safety and efficiency of existing and next generation nuclear reactors.

  13. microRNA-mediated resistance to hypoglycemia in the HepG2 human hepatoma cell line

    International Nuclear Information System (INIS)

    Ueki, Satomi; Murakami, Yuko; Yamada, Shoji; Kimura, Masaki; Saito, Yoshimasa; Saito, Hidetsugu

    2016-01-01

    It is generally accepted that the energy resources of cancer cells rely on anaerobic metabolism or the glycolytic system, even if they have sufficient oxygen. This is known as the Warburg effect. The cells skillfully survive under hypoglycemic conditions when their circumstances change, which probably at least partly involves microRNA (miRNA)-mediated regulation. To determine how cancer cells exploit miRNA-mediated epigenetic mechanisms to survive in hypoglycemic conditions, we used DNA microarray analysis to comprehensively and simultaneously compare the expression of miRNAs and mRNAs in the HepG2 human hepatoma cell line and in cultured normal human hepatocytes. The hypoglycemic condition decreased the expression of miRNA-17-5p and -20a-5p in hepatoma cells and consequently upregulated the expression of their target gene p21. These regulations were also confirmed by using antisense inhibitors of these miRNAs. In addition to this change, the hypoglycemic condition led to upregulated expression of heat shock proteins and increased resistance to caspase-3-induced apoptosis. However, we could not identify miRNA-mediated regulations, despite using comprehensive detection. Several interesting genes were also found to be upregulated in the hypoglycemic condition by the microarray analysis, probably because of responding to this cellular stress. These results suggest that cancer cells skillfully survive in hypoglycemic conditions, which frequently occur in malignancies, and that some of the gene regulation of this process is manipulated by miRNAs. The online version of this article (doi:10.1186/s12885-016-2762-7) contains supplementary material, which is available to authorized users

  14. Regulation of voltage-gated potassium channels attenuates resistance of side-population cells to gefitinib in the human lung cancer cell line NCI-H460.

    Science.gov (United States)

    Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong

    2017-02-21

    Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.

  15. Emerging Gram negative resistance to last-line antimicrobial agents fosfomycin, colistin and ceftazidime-avibactam - epidemiology, laboratory detection and treatment implications.

    Science.gov (United States)

    Sherry, Norelle; Howden, Benjamin

    2018-04-01

    Multidrug-resistant (MDR) and extensively-drug-resistant (XDR) Gram-negative bacteria have emerged as a major threat to human health globally. This has resulted in the 're-discovery' of some older antimicrobials and development of new agents, however resistanc