Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm.

Science.gov (United States)

Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J

2018-01-01

Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.

A maize resistance gene functions against bacterial streak disease in rice.

Science.gov (United States)

Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

2005-10-25

Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

Spread of tetracycline resistance genes at a conventional dairy farm

Directory of Open Access Journals (Sweden)

Martina eKyselkova

2015-05-01

Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

Czech Academy of Sciences Publication Activity Database

Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

2015-01-01

Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

Science.gov (United States)

Nabi, Ari Q.

2017-09-01

Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

Natural variation of rice blast resistance gene Pi-d2

Science.gov (United States)

Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

A maize resistance gene functions against bacterial streak disease in rice

OpenAIRE

Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

2005-01-01

Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

Directory of Open Access Journals (Sweden)

Harsi Dewantari Kusumaningrum

2016-08-01

Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations.

Science.gov (United States)

Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes

2015-10-01

The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci. © 2015 APMIS. Published by John Wiley & Sons Ltd.

Putative resistance genes in the CitEST database

Directory of Open Access Journals (Sweden)

Simone Guidetti-Gonzalez

2007-01-01

Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

Science.gov (United States)

Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

2003-01-01

Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

Non-host Plant Resistance against Phytophthora capsici Is Mediated in Part by Members of the I2 R Gene Family in Nicotiana spp.

Science.gov (United States)

Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter

2017-01-01

The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.

RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

Science.gov (United States)

Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

2015-06-01

4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

Science.gov (United States)

Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

2012-06-01

Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

Science.gov (United States)

Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

2017-01-01

Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

Directory of Open Access Journals (Sweden)

Dipak K Sahoo

Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

Gene Expression Analysis of Four Radiation-resistant Bacteria

OpenAIRE

Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

2009-01-01

To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

Non-selective regulation of peroxide and superoxide resistance genes by PerR in Campylobacter jejuni

Directory of Open Access Journals (Sweden)

Jong-Chul eKim

2015-02-01

Full Text Available Campylobacter jejuni is an important foodborne pathogen. The molecular mechanisms for the regulation of oxidative stress resistance have not yet been understood fully in this bacterium. In this study, we investigated how PerR (peroxide stress regulator modulates the transcriptional regulation of both peroxide and superoxide resistance genes in C. jejuni, particularly under oxidative stress conditions. The transcriptional levels of ahpC, katA, and sodB were substantially increased by aeration and oxidant exposure. Interestingly, a perR mutation completely abrogated the transcriptional response of ahpC, katA and sodB to oxidants. Furthermore, we demonstrated that perR transcription was reduced by aeration and oxidant exposure. In contrast to the unique role of PerR homologs in peroxide stress regulation in other bacteria, interestingly, C. jejuni PerR directly regulates the transcription of sodB, the most important gene in superoxide defense, as evidenced by the alteration of sodB transcription by the perR mutation and direct binding of rPerR to the sodB promoter. In addition, we also observed notable morphological changes in C. jejuni from spiral rods to coccoid morphology under aerobic conditions. Based on the intracellular ATP levels, C. jejuni entered a viable-but-non-culturable state under aerobic conditions. These findings clearly demonstrate that C. jejuni possesses a unique regulatory mechanism of oxidative stress defense that does not specifically distinguish between peroxide and superoxide defense, and PerR plays a pivotal role in this non-selective regulation of oxidative stress resistance in C. jejuni.

SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species

Directory of Open Access Journals (Sweden)

Vleeshouwers Vivianne GAA

2011-08-01

Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a

Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

Science.gov (United States)

Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

2010-09-08

Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

Bacillus cereus AR156 primes induced systemic resistance by suppressing miR825/825* and activating defense-related genes in Arabidopsis.

Science.gov (United States)

Niu, Dongdong; Xia, Jing; Jiang, Chunhao; Qi, Beibei; Ling, Xiaoyu; Lin, Siyuan; Zhang, Weixiong; Guo, Jianhua; Jin, Hailing; Zhao, Hongwei

2016-04-01

Small RNAs play an important role in plant immune responses. However, their regulatory function in induced systemic resistance (ISR) is nascent. Bacillus cereus AR156 is a plant growth-promoting rhizobacterium that induces ISR in Arabidopsis against bacterial infection. Here, by comparing small RNA profiles of Pseudomonas syringae pv. tomato (Pst) DC3000-infected Arabidopsis with and without AR156 pretreatment, we identified a group of Arabidopsis microRNAs (miRNAs) that are differentially regulated by AR156 pretreatment. miR825 and miR825* are two miRNA generated from a single miRNA gene. Northern blot analysis indicated that they were significantly downregulated in Pst DC3000-infected plants pretreated with AR156, in contrast to the plants without AR156 pretreatment. miR825 targets two ubiquitin-protein ligases, while miR825* targets toll-interleukin-like receptor (TIR)-nucleotide binding site (NBS) and leucine-rich repeat (LRR) type resistance (R) genes. The expression of these target genes negatively correlated with the expression of miR825 and miR825*. Moreover, transgenic plants showing reduced expression of miR825 and miR825* displayed enhanced resistance to Pst DC3000 infection, whereas transgenic plants overexpressing miR825 and miR825* were more susceptible. Taken together, our data indicates that Bacillus cereus AR156 pretreatment primes ISR to Pst infection by suppressing miR825 and miR825* and activating the defense related genes they targeted. © 2015 Institute of Botany, Chinese Academy of Sciences.

The expression of R genes in genetic and induced resistance to potato cyst nematode Globodera rostochiensis (Wollenweber, 1923) Behrens, 1975.

Science.gov (United States)

Lavrova, V V; Matveeva, E M; Zinovieva, S V

2015-01-01

The characteristics of expression of two genes, H1 and Gro1-4, which determine the resistance to the sedentary parasitic nematode Globodera rostochiensis (Wollenweber, 1923) Behrens, 1975, in the resistant (Krepysh) and susceptible (Nevskii) potato cultivars was studied under a short-term exposure to low temperatures. Such treatment of susceptible plants at the early stages of ontogeny led to the activation of expression of H1 and Gro1-4 genes in roots and the H1 gene in leaves. The transcriptional activity of R genes was detected not only in roots but also in leaves (i.e., in tissue remote from the site of direct injury by the nematode) in the case of both genetic and induced resistance, indicating the development of a systemic defense response of plants to infection.

Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

Science.gov (United States)

Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

2017-09-30

Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

Cloning and characterization of NBS-LRR resistance gene ...

African Journals Online (AJOL)

biotech

2013-07-03

Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet

Science.gov (United States)

Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....

A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

Science.gov (United States)

Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

2013-05-01

A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

Science.gov (United States)

Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

2014-01-01

MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340

Prevalence of 16S rRNA methylase genes among β-lactamase ...

African Journals Online (AJOL)

Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...

Data on the genome-wide identification of CNL R-genes in Setaria italica (L.) P. Beauv.

OpenAIRE

Andersen, Ethan J.; Nepal, Madhav P.

2017-01-01

We report data associated with the identification of 242 disease resistance genes (R-genes) in the genome of Setaria italica as presented in “Genetic diversity of disease resistance genes in foxtail millet (Setaria italica L.)” (Andersen and Nepal, 2017) [1]. Our data describe the structure and evolution of the Coiled-coil, Nucleotide-binding site, Leucine-rich repeat (CNL) R-genes in foxtail millet. The CNL genes were identified through rigorous extraction and analysis of recently available ...

Effector-mediated discovery of a novel resistance gene against Bremia lactucae in a nonhost lettuce species.

Science.gov (United States)

Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W

2017-11-01

Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its cross-compatibility with the host species L. sativa enables the study of inheritance of nonhost resistance (NHR). We performed transient expression of candidate RXLR effector genes from B. lactucae in a diverse Lactuca germplasm set. Responses to two candidate effectors (BLR31 and BLN08) were genetically mapped and tested for co-segregation with disease resistance. BLN08 induced a hypersensitive response (HR) in 55% of the L. saligna accessions, but responsiveness did not co-segregate with resistance to Bl:24. BLR31 triggered an HR in 5% of the L. saligna accessions, and revealed a novel R gene providing complete B. lactucae race Bl:24 resistance. Resistant hybrid plants that were BLR31 nonresponsive indicated other unlinked R genes and/or nonhost QTLs. We have identified a candidate avirulence effector of B. lactucae (BLR31) and its cognate R gene in L. saligna. Concurrently, our results suggest that R genes are not required for NHR of L. saligna. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

Science.gov (United States)

Rôças, Isabela N; Siqueira, José F

2012-12-01

Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

Genome-Wide Distribution, Organisation and Functional Characterization of Disease Resistance and Defence Response Genes across Rice Species

Science.gov (United States)

Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj

2015-01-01

The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056

Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

Science.gov (United States)

Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

2016-07-01

Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

Science.gov (United States)

Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

2018-01-01

The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

Science.gov (United States)

Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

2016-01-01

We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

Regulatory role of tetR gene in a novel gene cluster of Acidovorax avenae subsp. avenae RS-1 under oxidative stress

Directory of Open Access Journals (Sweden)

He eLiu

2014-10-01

Full Text Available Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay (EMSA demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, SOD and catalase activity, and oxide detoxicating ability.

Regulatory role of tetR gene in a novel gene cluster of Acidovorax avenae subsp. avenae RS-1 under oxidative stress.

Science.gov (United States)

Liu, He; Yang, Chun-Lan; Ge, Meng-Yu; Ibrahim, Muhammad; Li, Bin; Zhao, Wen-Jun; Chen, Gong-You; Zhu, Bo; Xie, Guan-Lin

2014-01-01

Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, superoxide dismutase and catalase activity, and oxide detoxicating ability.

A dual resistance gene system prevents infection by three distinct pathogens.

Science.gov (United States)

Narusaka, Mari; Kubo, Yasuyuki; Shiraishi, Tomonori; Iwabuchi, Masaki; Narusaka, Yoshihiro

2009-10-01

Colletotrichum higginsianum causes typical anthracnose lesions on the leaves, petioles, and stems of cruciferous plants. Inoculation of Arabidopsis thaliana ecotype Columbia leaves with C. higginsianum results in fungal growth and disease symptoms reminiscent of those induced in other cruciferous plants. We performed map-based cloning and natural variation analysis of 19 A. thaliana ecotypes to identify a dominant resistance locus against C. higginsianum. We found that the A. thaliana RCH2 (for recognition of C. higginsianum) locus encodes two NB-LRR proteins, both of which are required for resistance to C. higginsianum in the A. thaliana ecotype Ws-0. Both proteins are well-characterized R proteins involved in resistance against bacterial pathogens; RRS1 (resistance to Ralstonia solanacearum 1) confers resistance to strain Rs1000 of R. solanacearum and RPS4 to Pseudomonas syringae pv. tomato strain DC3000 expressing avrRps4 (Pst-avrRps4). Furthermore, we found that both RRS1-Ws and RPS4-Ws genes are required for resistance to Pst-avrRps4 and to Rs1002 R. solanacearum. We therefore demonstrate that a pair of neighboring genes, RRS1-Ws and RPS4-Ws, function cooperatively as a dual R-gene system against at least three distinct pathogens.

Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

Directory of Open Access Journals (Sweden)

Aimée M Moore

Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

Occurrence of tetracycline resistance genes in aquaculture facilities with varying use of oxytetracycline

Science.gov (United States)

Seyfried, Erin E.; Newton, Ryan J.; Rubert, Kennedy F.; Pedersen, Joel A.; McMahon, Katherine D.

2014-01-01

The contribution of human activities to environmental reservoirs of antibiotic resistance is poorly understood. The purpose of this study was to determine if oxytetracycline (OTC) use in aquaculture facilities increased the detection frequency (i.e. prevalence) of tetracycline resistance genes relative to facilities with no recent OTC treatment. We used PCR to screen water and sediment from four non-commercial fish farms in northwestern Wisconsin for the presence of ten tetracycline resistance determinants (tetR): tet(A), tet(B), tet(D), tet(E), tet(G), tet(M), tet(O), tet(Q), tet(S) and tet(W). Water from farms with recent OTC use had significantly higher tetR detection frequencies than did water from farms without recent OTC use, with prevalence in raceways and rearing ponds of farms with recent OTC use exceeded by more than two-fold that of farms not using OTC. Effluent from all farms, regardless of treatment regime, had higher tetR detection frequencies than their corresponding influent for all genes, but the specific combinations of tetR genes detected in a sample were not different from their corresponding influent. Although OTC use was associated with the increased occurrence and diversity of tetR genes in water samples, it was not found to relate to tetR gene occurrence in sediment samples. Sediment samples from facilities with no recent OTC use had significantly higher frequencies of tetR gene detection than did samples from facilities with recent OTC use. All of the tetR genes were detected in both the medicated and non-medicated feed samples analyzed in this study. These findings suggest that both OTC treatment in aquaculture facilities, and the farms themselves, may be sources of tetR gene introduction to the environment. To our knowledge, this is the first study to use genotypic and cultivation-independent methods to examine tetR gene occurrence associated with OTC use in aquaculture. PMID:20217406

Identification of acquired antimicrobial resistance genes

DEFF Research Database (Denmark)

Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

2012-01-01

ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

Global regulator SoxR is a negative regulator of efflux pump gene expression and affects antibiotic resistance and fitness in Acinetobacter baumannii.

Science.gov (United States)

Li, Henan; Wang, Qi; Wang, Ruobing; Zhang, Yawei; Wang, Xiaojuan; Wang, Hui

2017-06-01

SoxR is a global regulator contributing to multidrug resistance in Enterobacteriaceae. However, the contribution of SoxR to antibiotic resistance and fitness in Acinetobacter baumannii has not yet been studied. Comparisons of molecular characteristics were performed between 32 multidrug-resistant A. baumannii isolates and 11 susceptible isolates. A soxR overexpression mutant was constructed, and its resistance phenotype was analyzed. The impact of SoxR on efflux pump gene expression was measured at the transcription level. The effect of SoxR on the growth and fitness of A. baumannii was analyzed using a growth rate assay and an in vitro competition assay. The frequency of the Gly39Ser mutation in soxR was higher in multidrug-resistant A. baumannii, whereas the soxS gene was absent in all strains analyzed. SoxR overexpression led to increased susceptibility to chloramphenicol (4-fold), tetracycline (2-fold), tigecycline (2-fold), ciprofloxacin (2-fold), amikacin (2-fold), and trimethoprim (2-fold), but it did not influence imipenem susceptibility. Decreased expression of abeS (3.8-fold), abeM (1.3-fold), adeJ (2.4-fold), and adeG (2.5-fold) were correlated with soxR overexpression (P baumannii.

Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

Science.gov (United States)

Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

2018-04-01

Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

Mutation of Rv2887, a marR-like gene, confers Mycobacterium tuberculosis resistance to an imidazopyridine-based agent.

Science.gov (United States)

Winglee, Kathryn; Lun, Shichun; Pieroni, Marco; Kozikowski, Alan; Bishai, William

2015-11-01

Drug resistance is a major problem in Mycobacterium tuberculosis control, and it is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M. tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor) family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

2015-10-01

Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

AFLP markers for the R-gene in the flea beetle, Phyllotreta nemorum, conferring resistance to defenses in Barbarea vulgaris

NARCIS (Netherlands)

Breuker, C.J.; Victoir, K.; Jong, de P.W.; Meijden, van der E.; Brakefield, P.M.; Vrieling, K.

2005-01-01

A so-called R-gene renders the yellow-striped flea beetle Phyllotreta nemorum L. (Coleoptera: Chrysomelidae: Alticinae) resistant to the defenses of the yellow rocket Barbarea vulgaris R.Br. (Brassicacea) and enables it to use it as a host plant in Denmark. In this study, genetic markers for an

Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis.

Science.gov (United States)

Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul

2017-11-01

A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.

Data on the genome-wide identification of CNL R-genes in Setaria italica (L.) P. Beauv.

Science.gov (United States)

Andersen, Ethan J; Nepal, Madhav P

2017-08-01

We report data associated with the identification of 242 disease resistance genes (R-genes) in the genome of Setaria italica as presented in "Genetic diversity of disease resistance genes in foxtail millet ( Setaria italica L.)" (Andersen and Nepal, 2017) [1]. Our data describe the structure and evolution of the Coiled-coil, Nucleotide-binding site, Leucine-rich repeat (CNL) R-genes in foxtail millet. The CNL genes were identified through rigorous extraction and analysis of recently available plant genome sequences using cutting-edge analytical software. Data visualization includes gene structure diagrams, chromosomal syntenic maps, a chromosomal density plot, and a maximum-likelihood phylogenetic tree comparing Sorghum bicolor , Panicum virgatum , Setaria italica , and Arabidopsis thaliana . Compilation of InterProScan annotations, Gene Ontology (GO) annotations, and Basic Local Alignment Search Tool (BLAST) results for the 242 R-genes identified in the foxtail millet genome are also included in tabular format.

Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

Science.gov (United States)

Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

Regulatory role of tetR gene in a novel gene cluster of Acidovorax avenae subsp. avenae RS-1 under oxidative stress

OpenAIRE

Liu, He; Yang, Chun-Lan; Ge, Meng-Yu; Ibrahim, Muhammad; Li, Bin; Zhao, Wen-Jun; Chen, Gong-You; Zhu, Bo; Xie, Guan-Lin

2014-01-01

Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay demonstrated that TetR regulator bound directly to the promoter of ...

Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

Directory of Open Access Journals (Sweden)

Lin Li

2015-12-01

Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

Science.gov (United States)

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Data on the genome-wide identification of CNL R-genes in Setaria italica (L. P. Beauv.

Directory of Open Access Journals (Sweden)

Ethan J. Andersen

2017-08-01

Full Text Available We report data associated with the identification of 242 disease resistance genes (R-genes in the genome of Setaria italica as presented in “Genetic diversity of disease resistance genes in foxtail millet (Setaria italica L.” (Andersen and Nepal, 2017 [1]. Our data describe the structure and evolution of the Coiled-coil, Nucleotide-binding site, Leucine-rich repeat (CNL R-genes in foxtail millet. The CNL genes were identified through rigorous extraction and analysis of recently available plant genome sequences using cutting-edge analytical software. Data visualization includes gene structure diagrams, chromosomal syntenic maps, a chromosomal density plot, and a maximum-likelihood phylogenetic tree comparing Sorghum bicolor, Panicum virgatum, Setaria italica, and Arabidopsis thaliana. Compilation of InterProScan annotations, Gene Ontology (GO annotations, and Basic Local Alignment Search Tool (BLAST results for the 242 R-genes identified in the foxtail millet genome are also included in tabular format.

The Number of Genes Controlling Resistance in Beans to Common ...

African Journals Online (AJOL)

Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

R229Q Polymorphism of NPHS2 Gene in Group of Iraqi Children with Steroid-Resistant Nephrotic Syndrome

Directory of Open Access Journals (Sweden)

Shatha Hussain Ali

2017-01-01

Full Text Available Background. The polymorphism R229Q is one of the most commonly reported podocin sequence variations among steroid-resistant nephrotic syndromes (SRNS. Aim of the Study. We investigated the frequency and risk of this polymorphism among a group of Iraqi children with SRNS and steroid-sensitive nephrotic syndrome (SSNS. Patients and Methods. A prospective case control study which was conducted in Al-Imamein Al-Kadhimein Medical City, spanning the period from the 1st of April 2015 to 30th of November 2015. Study sample consisted of 54 children having NS, divided into 2 groups: patients group consisted of 27 children with SRNS, and control group involved 27 children with SSNS. Both were screened by real time polymerase chain reaction for R229Q in exon 5 of NPHS2 gene. Results. Molecular study showed R229Q polymorphism in 96.3% of SRNS and 100% of SSNS. There were no phenotypic or histologic characteristics of patients bearing homozygous R229Q polymorphism and the patients with heterozygous R229Q polymorphism. Conclusion. Polymorphism R229Q of NPHS2 gene is prevalent in Iraqi children with SRNS and SSNS. Further study needs to be done, for other exons and polymorphism of NPHS2 gene in those patients.

Transcriptome Profiling to Identify Genes Involved in Mesosulfuron-Methyl Resistance in Alopecurus aequalis

Directory of Open Access Journals (Sweden)

Ning Zhao

2017-08-01

Full Text Available Non-target-site resistance (NTSR to herbicides is a worldwide concern for weed control. However, as the dominant NTSR mechanism in weeds, metabolic resistance is not yet well-characterized at the genetic level. For this study, we have identified a shortawn foxtail (Alopecurus aequalis Sobol. population displaying both TSR and NTSR to mesosulfuron-methyl and fenoxaprop-P-ethyl, yet the molecular basis for this NTSR remains unclear. To investigate the mechanisms of metabolic resistance, an RNA-Seq transcriptome analysis was used to find candidate genes that may confer metabolic resistance to the herbicide mesosulfuron-methyl in this plant population. The RNA-Seq libraries generated 831,846,736 clean reads. The de novo transcriptome assembly yielded 95,479 unigenes (averaging 944 bp in length that were assigned putative annotations. Among these, a total of 29,889 unigenes were assigned to 67 GO terms that contained three main categories, and 14,246 unigenes assigned to 32 predicted KEGG metabolic pathways. Global gene expression was measured using the reads generated from the untreated control (CK, water-only control (WCK, and mesosulfuron-methyl treatment (T of R and susceptible (S. Contigs that showed expression differences between mesosulfuron-methyl-treated R and S biotypes, and between mesosulfuron-methyl-treated, water-treated and untreated R plants were selected for further quantitative real-time PCR (qRT-PCR validation analyses. Seventeen contigs were consistently highly expressed in the resistant A. aequalis plants, including four cytochrome P450 monooxygenase (CytP450 genes, two glutathione S-transferase (GST genes, two glucosyltransferase (GT genes, two ATP-binding cassette (ABC transporter genes, and seven additional contigs with functional annotations related to oxidation, hydrolysis, and plant stress physiology. These 17 contigs could serve as major candidate genes for contributing to metabolic mesosulfuron-methyl resistance; hence

Antimicrobial Chemicals Are Associated with Elevated Antibiotic Resistance Genes in the Indoor Dust Microbiome.

Science.gov (United States)

Hartmann, Erica M; Hickey, Roxana; Hsu, Tiffany; Betancourt Román, Clarisse M; Chen, Jing; Schwager, Randall; Kline, Jeff; Brown, G Z; Halden, Rolf U; Huttenhower, Curtis; Green, Jessica L

2016-09-20

Antibiotic resistance is increasingly widespread, largely due to human influence. Here, we explore the relationship between antibiotic resistance genes and the antimicrobial chemicals triclosan, triclocarban, and methyl-, ethyl-, propyl-, and butylparaben in the dust microbiome. Dust samples from a mixed-use athletic and educational facility were subjected to microbial and chemical analyses using a combination of 16S rRNA amplicon sequencing, shotgun metagenome sequencing, and liquid chromatography tandem mass spectrometry. The dust resistome was characterized by identifying antibiotic resistance genes annotated in the Comprehensive Antibiotic Resistance Database (CARD) from the metagenomes of each sample using the Short, Better Representative Extract Data set (ShortBRED). The three most highly abundant antibiotic resistance genes were tet(W), blaSRT-1, and erm(B). The complete dust resistome was then compared against the measured concentrations of antimicrobial chemicals, which for triclosan ranged from 0.5 to 1970 ng/g dust. We observed six significant positive associations between the concentration of an antimicrobial chemical and the relative abundance of an antibiotic resistance gene, including one between the ubiquitous antimicrobial triclosan and erm(X), a 23S rRNA methyltransferase implicated in resistance to several antibiotics. This study is the first to look for an association between antibiotic resistance genes and antimicrobial chemicals in dust.

Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

Science.gov (United States)

Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

2004-03-01

The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

PCR detection of oxytetracycline resistance genes otr(A) and otr(B) in tetracycline-resistant streptomycete isolates from diverse habitats

NARCIS (Netherlands)

Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A

2005-01-01

A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from

Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

Directory of Open Access Journals (Sweden)

Ting Xiang Neik

2017-11-01

Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

Science.gov (United States)

Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

2017-01-01

Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

Genetic mapping, marker assisted selection and allelic relationships for the Pu 6 gene conferring rust resistance in sunflower.

Science.gov (United States)

Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano

2014-09-01

Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.

Mi-1.2, an R gene for aphid resistance in tomato, has direct negative effects on a zoophytophagous biocontrol agent, Orius insidiosus.

Science.gov (United States)

Pallipparambil, Godshen R; Sayler, Ronald J; Shapiro, Jeffrey P; Thomas, Jean M G; Kring, Timothy J; Goggin, Fiona L

2015-02-01

Mi-1.2 is a single dominant gene in tomato that confers race-specific resistance against certain phloem-feeding herbivores including aphids, whiteflies, psyllids, and root-knot nematodes. Few prior studies have considered the potential non-target effects of race-specific resistance genes (R genes), and this paper evaluates the compatibility of Mi-mediated resistance in tomato with a beneficial zoophytophagous predator, Orius insidiosus (Say). In addition to preying on aphids and other pests, this piercing-sucking insect also feeds from the xylem, epidermis, and/or mesophyll, and oviposits within plant tissues. Comparison of O. insidiosus confined to isogenic tomato plants with and without Mi-1.2 revealed that immatures of O. insidiosus had lower survival on resistant plants even when the immatures were provisioned with prey that did not feed on the host plant. Molecular gut content analysis confirmed that adults and immatures of O. insidiosus feed on both resistant (Mi-1.2+) and susceptible (Mi-1.2-) genotypes, and bioassays suggest that resistance does not affect oviposition rates, plant sampling, or prey acceptance by O. insidiosus adults. These results demonstrate a direct negative impact of R-gene-mediated host plant resistance on a non-target beneficial species, and reveal that Mi-mediated resistance can impact organisms that do not feed on phloem sap. Through laser capture microdissection and RT-PCR, Mi-1.2 transcripts were detected in the epidermis and mesophyll as well as the phloem of tomato plants, consistent with our observations that Mi-mediated resistance is active outside the phloem. These results suggest that the mode of action and potential ecological impacts of Mi-mediated resistance are broader than previously assumed. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

Science.gov (United States)

He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

2016-04-01

The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

Improvement of oxytetracycline production mediated via cooperation of resistance genes in Streptomyces rimosus.

Science.gov (United States)

Yin, Shouliang; Wang, Xuefeng; Shi, Mingxin; Yuan, Fang; Wang, Huizhuan; Jia, Xiaole; Yuan, Fang; Sun, Jinliang; Liu, Tiejun; Yang, Keqian; Zhang, Yuxiu; Fan, Keqiang; Li, Zilong

2017-09-01

Increasing the self-resistance levels of Streptomyces is an effective strategy to improve the production of antibiotics. To increase the oxytetracycline (OTC) production in Streptomyces rimosus, we investigated the cooperative effect of three co-overexpressing OTC resistance genes: one gene encodes a ribosomal protection protein (otrA) and the other two express efflux proteins (otrB and otrC). Results indicated that combinational overexpression of otrA, otrB, and otrC (MKABC) exerted a synergetic effect. OTC production increased by 179% in the recombinant strain compared with that of the wild-type strain M4018. The resistance level to OTC was increased by approximately two-fold relative to the parental strain, thereby indicating that applying the cooperative effect of self-resistance genes is useful to improve OTC production. Furthermore, the previously identified cluster-situated activator OtcR was overexpressed in MKABC in constructing the recombinant strain MKRABC; such strain can produce OTC of approximately 7.49 g L -1 , which represents an increase of 19% in comparison with that of the OtcR-overexpressing strain alone. Our work showed that the cooperative overexpression of self-resistance genes is a promising strategy to enhance the antibiotics production in Streptomyces.

Longitudinal characterization of antimicrobial resistance genes in feces shed from cattle fed different subtherapeutic antibiotics

Directory of Open Access Journals (Sweden)

Read Ronald R

2011-01-01

Full Text Available Abstract Background Environmental transmission of antimicrobial-resistant bacteria and resistance gene determinants originating from livestock is affected by their persistence in agricultural-related matrices. This study investigated the effects of administering subtherapeutic concentrations of antimicrobials to beef cattle on the abundance and persistence of resistance genes within the microbial community of fecal deposits. Cattle (three pens per treatment, 10 steers per pen were administered chlortetracycline, chlortetracycline plus sulfamethazine, tylosin, or no antimicrobials (control. Model fecal deposits (n = 3 were prepared by mixing fresh feces from each pen into a single composite sample. Real-time PCR was used to measure concentrations of tet, sul and erm resistance genes in DNA extracted from composites over 175 days of environmental exposure in the field. The microbial communities were analyzed by quantification and denaturing gradient gel electrophoresis (DGGE of PCR-amplified 16S-rRNA. Results The concentrations of 16S-rRNA in feces were similar across treatments and increased by day 56, declining thereafter. DGGE profiles of 16S-rRNA differed amongst treatments and with time, illustrating temporal shifts in microbial communities. All measured resistance gene determinants were quantifiable in feces after 175 days. Antimicrobial treatment differentially affected the abundance of certain resistance genes but generally not their persistence. In the first 56 days, concentrations of tet(B, tet(C, sul1, sul2, erm(A tended to increase, and decline thereafter, whereas tet(M and tet(W gradually declined over 175 days. At day 7, the concentration of erm(X was greatest in feces from cattle fed tylosin, compared to all other treatments. Conclusion The abundance of genes coding for antimicrobial resistance in bovine feces can be affected by inclusion of antibiotics in the feed. Resistance genes can persist in feces from cattle beyond 175 days

Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

DEFF Research Database (Denmark)

Luo, Gang; Li, Bing; Li, Li-Guan

2017-01-01

resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...... the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal...

Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

Science.gov (United States)

Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

2016-04-12

Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

Directory of Open Access Journals (Sweden)

Dhananjay Dhokane

Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

Science.gov (United States)

Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

2015-01-01

The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Abundance and distribution of Macrolide-Lincosamide-Streptogramin resistance genes in an anaerobic-aerobic system treating spiramycin production wastewater.

Science.gov (United States)

Liu, Miaomiao; Ding, Ran; Zhang, Yu; Gao, Yingxin; Tian, Zhe; Zhang, Tong; Yang, Min

2014-10-15

The behaviors of the Macrolide-Lincosamide-Streptogramin (MLS) resistance genes were investigated in an anaerobic-aerobic pilot-scale system treating spiramycin (SPM) production wastewater. After screening fifteen typical MLS resistance genes with different mechanisms using conventional PCR, eight detected genes were determined by quantitative PCR, together with three mobile elements. Aerobic sludge in the pilot system exhibited a total relative abundance of MLS resistance genes (per 16S rRNA gene) 2.5 logs higher than those in control samples collected from sewage and inosine wastewater treatment systems (P resistance genes. However, the total relative gene abundance in anaerobic sludge (4.3 × 10(-1)) was lower than that in aerobic sludge (3.7 × 10(0)) despite of the higher SPM level in anaerobic reactor, showing the advantage of anaerobic treatment in reducing the production of MLS resistance genes. The rRNA methylase genes (erm(B), erm(F), erm(X)) were the most abundant in the aerobic sludge (5.3 × 10(-1)-1.7 × 10(0)), followed by esterase gene ere(A) (1.3 × 10(-1)) and phosphorylase gene mph(B) (5.7 × 10(-2)). In anaerobic sludge, erm(B), erm(F), ere(A), and msr(D) were the major ones (1.2 × 10(-2)-3.2 × 10(-1)). These MLS resistance genes (except for msr(D)) were positively correlated with Class 1 integron (r(2) = 0.74-0.93, P < 0.05), implying the significance of horizontal transfer in their proliferation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Patterns of genetic diversity and differentiation in resistance gene clusters of two hybridizing European Populus species

OpenAIRE

Casey, Céline; Stölting, Kai N.; Barbará, Thelma; González-Martínez, Santiago C.; Lexer, Christian

2015-01-01

Resistance genes (R-genes) are essential for long-lived organisms such as forest trees, which are exposed to diverse herbivores and pathogens. In short-lived model species, R-genes have been shown to be involved in species isolation. Here, we studied more than 400 trees from two natural hybrid zones of the European Populus species Populus alba and Populus tremula for microsatellite markers located in three R-gene clusters, including one cluster situated in the incipient sex chromosome region....

Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

OpenAIRE

Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

2009-01-01

Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

Determination of rust resistance genes in pakistani bread wheats

International Nuclear Information System (INIS)

Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

2014-01-01

Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

Occurrence of antibiotics and antibiotic resistance genes in a sewage treatment plant and its effluent-receiving river.

Science.gov (United States)

Xu, Jian; Xu, Yan; Wang, Hongmei; Guo, Changsheng; Qiu, Huiyun; He, Yan; Zhang, Yuan; Li, Xiaochen; Meng, Wei

2015-01-01

The extensive use of antibiotics has caused the contamination of both antibiotics and antibiotic resistance genes (ARGs) in the environment. In this study, the abundance and distribution of antibiotics and ARGs from a sewage treatment plant (STP) and its effluent-receiving river in Beijing China were characterized. Three classes of antibiotics including tetracycline, sulfonamide and quinolone were quantified by LC-MS/MS. In the secondary effluent they were detected at 195, 2001 and 3866 ng L(-1), respectively, which were higher than in the receiving river water. A total of 13 ARGs (6 tet genes: tetA, tetB, tetE, tetW, tetM and tetZ, 3 sulfonamide genes: sul1, sul2 and sul3, and 4 quinolone genes: gryA, parC, qnrC and qnrD) were determined by quantitative PCR. For all ARGs, sulfonamide resistance genes were present at relatively high concentrations in all samples, with the highest ARG concentration above 10(-1). ARGs remained relatively stable along each sewage treatment process. The abundances of detected ARGs from the STP were also higher than its receiving river. Bivariate correlation analysis showed that relative tet gene copies (tetB/16S-rRNA and tetW/16S-rRNA) were strongly correlated with the concentrations of tetracycline residues (r(2)>0.8, pgenes. A negative correlation between the relative abundance of quinolone resistance gene (qnrC/16S-rRNA) and the concentrations of enrofloxacin (ENR) was also determined. The difference of ARGs levels in the raw influent and secondary effluent suggested that the STP treatment process may induce to increase the abundance of resistance genes. The results showed that the sewage was an important repository of the resistance genes, which need to be effectively treated before discharge into the natural water body. Copyright © 2014 Elsevier Ltd. All rights reserved.

Horizontal Transfer of Tetracycline Resistance Genes in the Subsurface of a Poultry Farm

Science.gov (United States)

You, Y.; Ward, M.; Hilpert, M.

2008-12-01

Concentrated animal feeding operations (CAFOs) are considered to be important man-made reservoirs of antibiotic resistant bacteria and antibiotic resistance genes. At a poultry farm, we, together with Mr.~James Doolittle from USDA, measured the apparent subsurface electrical conductivity (ECa) using a EM38 meter. The resulting ECaR) associated with the poultry farm due to the fact that tetracycline (Tc) is one of the most frequently used antibiotics in food animal production and therefore is probably used at this farm. Soil and aquifer samples were taken from the farm. TcR bacteria were detected, with higher concentrations in the top layer of soil than in the aquifer. TcR bacteria were then enriched from a soil sample, and two classes of TcR genes were detected: tet(M) genes encoding ribosomal protection proteins and tet(L) genes encoding tet efflux pumps. Sequences of the PCR products were compared to known tet(M) and tet(L) genes in GenBank using BLASTN. Phylogenetic trees were also built based on the sequence information. The tet(M) genes found in our soil sample were highly similar to those located on transposons. In a soil microcosm experiment, we used the aforementioned soil sample as incubation medium as well as genetic donor (TcR soil bacteria), and a green fluorescent strain of E. coli as a model genetic recipient to study horizontal transfer of TcR genes from soil bacteria to naïve bacteria. Concentrations of inoculated E. coli were continuously monitored for 15 days, TcR E. coli isolated, and colony PCR performed. The tet(M) genes were found to be transferred to naïve E. coli. The highest horizontal transfer ratio, 0.62 transconjugant per recipient, was observed when Tc was supplemented to a soil microcosm at a concentration of 140 μg/kg soil. Modeling is also ongoing to obtain a better understanding of this complex phenomenon.

Selfish restriction modification genes: resistance of a resident R/M plasmid to displacement by an incompatible plasmid mediated by host killing.

Science.gov (United States)

Naito, Y; Naito, T; Kobayashi, I

1998-01-01

Previous work from this laboratory demonstrated that plasmids carrying a type II restriction-modification gene complex are not easily lost from their bacterial host because plasmid-free segregant cells are killed through chromosome cleavage. Here, we have followed the course of events that takes place when an Escherichia coli rec BC sbcA strain carrying a plasmid coding for the PaeR7I restriction-modification (R/M) gene complex is transformed by a plasmid with an identical origin of replication. The number of transformants that appeared was far fewer than with the restriction-minus (r-) control. Most of the transformants were very small. After prolonged incubation, the number and the size of the colonies increased, but this increase never attained the level of the r- control. Most of the transformed colonies retained the drug-resistance of the resident, r+ m+ plasmid. These results indicate that post-segregational host killing occurs when a plasmid bearing an R/M gene complex is displaced by an incompatible plasmid. Such cell killing eliminates the competitor plasmid along with the host and, thus, would allow persistence of the R/M plasmid in the neighboring, clonal host cells in nature. This phenomenon is reminiscent of mammalian apoptosis and other forms of altruistic cell death strategy against infection. This type of resistance to displacement was also studied in a wild type Escherichia coli strain that was normal for homologous recombination (rec+). A number of differences between the recBC sbcA strain and the rec+ strain were observed and these will be discussed.

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

Science.gov (United States)

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

Science.gov (United States)

Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

2016-01-01

Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

Prevalence of antibiotic resistance genes from effluent of coastal aquaculture, South Korea.

Science.gov (United States)

Jang, Hyun Min; Kim, Young Beom; Choi, Sangki; Lee, Yunho; Shin, Seung Gu; Unno, Tatsuya; Kim, Young Mo

2018-02-01

The wide use of antibiotics in aquaculture for prophylactic and therapeutic purposes can potentially lead to the prevalence of antibiotic resistance genes (ARGs). This study reports for the first time the profile of ARGs from effluents of coastal aquaculture located in South Jeolla province and Jeju Island, South Korea. Using quantitative PCR (qPCR), twenty-two ARGs encoding tetracycline resistance (tetA, tetB, tetD, tetE, tetG, tetH, tetM, tetQ, tetX, tetZ, tetBP), sulfonamide resistance (sul1, sul2), quinolone resistance (qnrD, qnrS, aac(6')-Ib-cr), β-lactams resistance (bla TEM , bla CTX , bla SHV ), macrolide resistance (ermC), florfenicol resistance (floR) and multidrug resistance (oqxA) and a class 1 integrons-integrase gene (intI1) were quantified. In addition, Illumina Miseq sequencing was applied to investigate microbial community differences across fish farm effluents. Results from qPCR showed that the total number of detected ARGs ranged from 4.24 × 10 -3 to 1.46 × 10 -2 copies/16S rRNA gene. Among them, tetB and tetD were predominant, accounting for 74.8%-98.0% of the total ARGs. Furthermore, intI1 gene showed positive correlation with tetB, tetD, tetE, tetH, tetX, tetZ tetQ and sul1. Microbial community analysis revealed potential host bacteria for ARGs and intI1. Two genera, Vibrio and Marinomonas belonging to Gammaproteobacteria, showed significant correlation with tetB and tetD, the most dominant ARGs in all samples. Also, operational taxonomic units (OTUs)-based network analysis revealed that ten OTUs, classified into the phyla Proteobacteria, Cyanobacteria/Chloroplast, Bacteroidetes, Verrucomicrobia and an unclassified phylum, were potential hosts of tetracycline resistance genes (i.e., tetA, tetG, tetH, tetM, tetQ and tetZ). Further systematic monitoring of ARGs is warranted for risk assessment and management of antibacterial resistance from fish farm effluents. Copyright © 2017 Elsevier Ltd. All rights reserved.

Spread of tetracycline resistance genes at a conventional dairy farm

Czech Academy of Sciences Publication Activity Database

Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

2015-01-01

Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

Resistance Genes in Global Crop Breeding Networks.

Science.gov (United States)

Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

2017-10-01

Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

Science.gov (United States)

Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

Effector-mediated discovery of a novel resistance gene against Bremia Lactucae in a nonhost lettuce species

NARCIS (Netherlands)

Giesbers, A.K.J.; Pelgrom, Alexandra; Visser, R.G.F.; Niks, R.E.; Ackerveken, Van Den Guido; Jeuken, M.J.W.

2017-01-01

Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its

Effector-mediated discovery of a novel resistance gene against Bremia lactucae in a nonhost lettuce species

NARCIS (Netherlands)

Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W

2017-01-01

Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its

Tetracycline resistance genes persist in soil amended with cattle feces independently from chlortetracycline selection pressure

Czech Academy of Sciences Publication Activity Database

Kyselková, Martina; Kotrbová, Lucie; Bhumibhamon, G.; Chroňáková, Alica; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

2015-01-01

Roč. 81, February (2015), s. 259-265 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:60077344 ; RVO:67179843 Keywords : antibiotic resistance * cattle feces * chlortetracycline * grassland soil * tetracycline resistance genes * intI1 gene Subject RIV: EE - Microbiology, Virology; CE - Biochemistry (UEK-B) Impact factor: 4.152, year: 2015

Molecular mapping and genetic analysis of a rice brown planthopper (Nilaparvata lugens Stål) resistance gene.

Science.gov (United States)

Yang, Haiyuan; Ren, Xiang; Weng, Qingmei; Zhu, Lili; He, Guangcun

2002-01-01

The brown planthopper (BPH), Nilaparvata lugens Stål, is a serious insect pest of rice (Oryza saliva L.). We have determined the chromosomal location of a BPH resistance gene in rice using SSR and RFLP techniques. A rice line 'B14', derived from the wild rice Oryza latifolia, showed high resistance to BPH. For tagging the resistance gene in 'B14X', an F2 population and a recombinant inbred (RI) population from a cross between Taichung Native 1 and 'B14' were developed and evaluated for BPH resistance. The results showed that a single dominant gene controlled the resistance of 'B14' to BPH. Bulked segregant SSR analysis was employed for identification of DNA markers linked to the resistance gene. From the survey of 302 SSR primer pairs, three SSR (RM335, RM261, RM185) markers linked to the resistance gene were identified. The closest SSR marker RM261 was linked to the resistance gene at a distance of 1.8 cM. Regions surrounding the resistance gene and the SSR markers were examined with additional RFLP markers on chromosome 4 to define the location of the resistance gene. Linkage of RFLP markers C820, R288, C946 with the resistance gene further confirmed its location on the short arm of chromosome 4. Closely linked DNA markers will facilitate selection for resistant lines in breeding programs and provide the basis for map-based cloning of this resistance gene.

Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

Directory of Open Access Journals (Sweden)

Chen Tingfu

2010-07-01

Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

Directory of Open Access Journals (Sweden)

Rosa Lozano-Durán

2013-03-01

Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

Antibiotic-resistant genes and antibiotic-resistant bacteria in the effluent of urban residential areas, hospitals, and a municipal wastewater treatment plant system.

Science.gov (United States)

Li, Jianan; Cheng, Weixiao; Xu, Like; Strong, P J; Chen, Hong

2015-03-01

In this study, we determined the abundance of 8 antibiotics (3 tetracyclines, 4 sulfonamides, and 1 trimethoprim), 12 antibiotic-resistant genes (10 tet, 2 sul), 4 antibiotic-resistant bacteria (tetracycline, sulfamethoxazole, and combined resistance), and class 1 integron integrase gene (intI1) in the effluent of residential areas, hospitals, and municipal wastewater treatment plant (WWTP) systems. The concentrations of total/individual targets (antibiotics, genes, and bacteria) varied remarkably among different samples, but the hospital samples generally had a lower abundance than the residential area samples. The WWTP demonstrated removal efficiencies of 50.8% tetracyclines, 66.8% sulfonamides, 0.5 logs to 2.5 logs tet genes, and less than 1 log of sul and intI1 genes, as well as 0.5 log to 1 log removal for target bacteria. Except for the total tetracycline concentration and the proportion of tetracycline-resistant bacteria (R (2) = 0.330, P antibiotics and the corresponding resistant bacteria (P > 0.05). In contrast, various relationships were identified between antibiotics and antibiotic resistance genes (P antibiotic-resistant bacteria (P < 0.01).

Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

Science.gov (United States)

Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

2016-01-01

Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

Census of solo LuxR genes in prokaryotic genomes.

Science.gov (United States)

Hudaiberdiev, Sanjarbek; Choudhary, Kumari S; Vera Alvarez, Roberto; Gelencsér, Zsolt; Ligeti, Balázs; Lamba, Doriano; Pongor, Sándor

2015-01-01

luxR genes encode transcriptional regulators that control acyl homoserine lactone-based quorum sensing (AHL QS) in Gram negative bacteria. On the bacterial chromosome, luxR genes are usually found next or near to a luxI gene encoding the AHL signal synthase. Recently, a number of luxR genes were described that have no luxI genes in their vicinity on the chromosome. These so-called solo luxR genes may either respond to internal AHL signals produced by a non-adjacent luxI in the chromosome, or can respond to exogenous signals. Here we present a survey of solo luxR genes found in complete and draft bacterial genomes in the NCBI databases using HMMs. We found that 2698 of the 3550 luxR genes found are solos, which is an unexpectedly high number even if some of the hits may be false positives. We also found that solo LuxR sequences form distinct clusters that are different from the clusters of LuxR sequences that are part of the known luxR-luxI topological arrangements. We also found a number of cases that we termed twin luxR topologies, in which two adjacent luxR genes were in tandem or divergent orientation. Many of the luxR solo clusters were devoid of the sequence motifs characteristic of AHL binding LuxR proteins so there is room to speculate that the solos may be involved in sensing hitherto unknown signals. It was noted that only some of the LuxR clades are rich in conserved cysteine residues. Molecular modeling suggests that some of the cysteines may be involved in disulfide formation, which makes us speculate that some LuxR proteins, including some of the solos may be involved in redox regulation.

Effector genomics accelerates discovery and functional profiling of potato disease resistance and phytophthora infestans avirulence genes.

Directory of Open Access Journals (Sweden)

Vivianne G A A Vleeshouwers

Full Text Available Potato is the world's fourth largest food crop yet it continues to endure late blight, a devastating disease caused by the Irish famine pathogen Phytophthora infestans. Breeding broad-spectrum disease resistance (R genes into potato (Solanum tuberosum is the best strategy for genetically managing late blight but current approaches are slow and inefficient. We used a repertoire of effector genes predicted computationally from the P. infestans genome to accelerate the identification, functional characterization, and cloning of potentially broad-spectrum R genes. An initial set of 54 effectors containing a signal peptide and a RXLR motif was profiled for activation of innate immunity (avirulence or Avr activity on wild Solanum species and tentative Avr candidates were identified. The RXLR effector family IpiO induced hypersensitive responses (HR in S. stoloniferum, S. papita and the more distantly related S. bulbocastanum, the source of the R gene Rpi-blb1. Genetic studies with S. stoloniferum showed cosegregation of resistance to P. infestans and response to IpiO. Transient co-expression of IpiO with Rpi-blb1 in a heterologous Nicotiana benthamiana system identified IpiO as Avr-blb1. A candidate gene approach led to the rapid cloning of S. stoloniferum Rpi-sto1 and S. papita Rpi-pta1, which are functionally equivalent to Rpi-blb1. Our findings indicate that effector genomics enables discovery and functional profiling of late blight R genes and Avr genes at an unprecedented rate and promises to accelerate the engineering of late blight resistant potato varieties.

Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

DEFF Research Database (Denmark)

Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

2005-01-01

Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

Isolation and identification of differentially expressed genes between ...

African Journals Online (AJOL)

Plants have evolved sophisticated molecular defense mechanisms in order to survive disease conditions. So far, a number of pathogen resistance (R) genes have been reported in plants. These R genes are thought to be involved in activating the signals that lead to disease resistance. The structural specificity of R genes ...

Mutations Found in embCAB, embR, and ubiA Genes of Ethambutol-Sensitive and -Resistant Mycobacterium tuberculosis Clinical Isolates from China

Directory of Open Access Journals (Sweden)

Yuhui Xu

2015-01-01

Full Text Available To better understand the molecular mechanisms of Ethambutol (EMB resistance, the mutant hot spot region of five genes (embB, embA, embC, embR, and ubiA was amplified and sequenced in 109 EMB-resistant and 153 EMB-susceptible clinical isolates from China. Twenty-seven EMB-susceptible isolates were found to have nonsynonym mutations, 23 of which were in embB. The mutations occurred most frequently in embB (85.3%, 93 and were seldom in embC (2.8%, 3, embA (3.7%, 4, embR (3.7%, 4, and ubiA (8.3%, 9 in EMB-resistant isolates. For the embB gene, 63 isolates showed mutations at embB306, 20 at embB406, nine at embB497, and five at embB354 in EMB-resistant isolates. In addition, the particular mutants at embB406 and embB497 indicated both high levels of EMB resistance (MICs>5 μg/mL and broad anti-TB drug resistance spectrums. Our data supported the facts that embB306 could be used as a marker for EMB resistance with a sensitivity of 57.8% and a specificity of 78.8%.

Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

Directory of Open Access Journals (Sweden)

Shenglong Tan

2012-01-01

Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

The diversity of antimicrobial resistance genes among staphylococci of animal origin.

Science.gov (United States)

Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

2013-08-01

Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

Expression of arsenic resistance genes in the obligate anaerobe Bacteroides vulgatus ATCC 8482, a gut microbiome bacterium.

Science.gov (United States)

Li, Jiaojiao; Mandal, Goutam; Rosen, Barry P

2016-06-01

The response of the obligate anaerobe Bacteroides vulgatus ATCC 8482, a common human gut microbiota, to arsenic was determined. B. vulgatus ATCC 8482 is highly resistant to pentavalent As(V) and methylarsenate (MAs(V)). It is somewhat more sensitive to trivalent inorganic As(III) but 100-fold more sensitive to methylarsenite (MAs(III)) than to As(III). B. vulgatus ATCC 8482 has eight continuous genes in its genome that we demonstrate form an arsenical-inducible transcriptional unit. The first gene of this ars operon, arsR, encodes a putative ArsR As(III)-responsive transcriptional repressor. The next three genes encode proteins of unknown function. The remaining genes, arsDABC, have well-characterized roles in detoxification of inorganic arsenic, but there are no known genes for MAs(III) resistance. Expression of each gene after exposure to trivalent and pentavalent inorganic and methylarsenicals was analyzed. MAs(III) was the most effective inducer. The arsD gene was the most highly expressed of the ars operon genes. These results demonstrate that this anaerobic microbiome bacterium has arsenic-responsive genes that confer resistance to inorganic arsenic and may be responsible for the organism's ability to maintain its prevalence in the gut following dietary exposure to inorganic arsenic. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

Science.gov (United States)

González, Ana M; Godoy, Luís; Santalla, Marta

2017-11-23

Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

PCR detection of oxytetracycline resistance genes from diverse habitats in total community DNA and in streptomycete isolates.

NARCIS (Netherlands)

Nikolakopoulou, T.L.; Egan, S.; Overbeek, van L.S.; Guillaume, G.; Heuer, H.; Wellington, E.M.H.; Elsas, van J.D.; Collard, J.M.; Smalla, K.; Karagouni, A.D.

2005-01-01

A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolates from

Mapping, isolation and characterization of genes responsible for late blight resistance in potato

NARCIS (Netherlands)

Pel, M.

2010-01-01

Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
have been used by breeders to generate late blight resistant cultivars, but resistance was soon
overcome

High prevalence of plasmid-mediated 16S rRNA methylase gene rmtB among Escherichia coli clinical isolates from a Chinese teaching hospital

Directory of Open Access Journals (Sweden)

Zhang Xue-qing

2010-06-01

Full Text Available Abstract Background Recently, production of 16S rRNA methylases by Gram-negative bacilli has emerged as a novel mechanism for high-level resistance to aminoglycosides by these organisms in a variety of geographic locations. Therefore, the spread of high-level aminoglycoside resistance determinants has become a great concern. Methods Between January 2006 and July 2008, 680 distinct Escherichia coli clinical isolates were collected from a teaching hospital in Wenzhou, China. PCR and DNA sequencing were used to identify 16S rRNA methylase and extended-spectrum β-lactamase (ESBL genes, including armA and rmtB, and in situ hybridization was performed to determine the location of 16S rRNA methylase genes. Conjugation experiments were subsequently performed to determine whether aminoglycoside resistance was transferable from the E. coli isolates via 16S rRNA methylase-bearing plasmids. Homology of the isolates harboring 16S rRNA methylase genes was determined using pulse-field gel electrophoresis (PFGE. Results Among the 680 E. coli isolates, 357 (52.5%, 346 (50.9% and 44 (6.5% isolates were resistant to gentamicin, tobramycin and amikacin, respectively. Thirty-seven of 44 amikacin-resistant isolates harbored 16S rRNA methylase genes, with 36 of 37 harboring the rmtB gene and only one harboring armA. The positive rates of 16S rRNA methylase genes among all isolates and amikacin-resistant isolates were 5.4% (37/680 and 84.1% (37/44, respectively. Thirty-one isolates harboring 16S rRNA methylase genes also produced ESBLs. In addition, high-level aminoglycoside resistance could be transferred by conjugation from four rmtB-positive donors. The plasmids of incompatibility groups IncF, IncK and IncN were detected in 34, 3 and 3 isolates, respectively. Upstream regions of the armA gene contained ISCR1 and tnpU, the latter a putative transposase gene,. Another putative transposase gene, tnpD, was located within a region downstream of armA. Moreover, a

Differential Expression of P450 Genes and nAChR Subunits Associated With Imidacloprid Resistance in Laodelphax striatellus (Hemiptera: Delphacidae).

Science.gov (United States)

Zhang, Yueliang; Liu, Baosheng; Zhang, Zhichun; Wang, Lihua; Guo, Huifang; Li, Zhong; He, Peng; Liu, Zewen; Fang, Jichao

2018-05-28

Imidacloprid is a key insecticide used for controlling sucking insect pests, including the small brown planthopper (Laodelphax striatellus, Fallén) (Hemiptera: Delphacidae), an important agricultural pest of rice. A strain of L. striatellus (YN-ILR) developed 21-fold resistance when selected with imidacloprid on a susceptible YN strain. An in vitro study on piperonyl butoxide synergism indicated that enhanced detoxification mediated by cytochrome P450s contributed to imidacloprid resistance to some extent, and multiple P450 genes showed altered expression in the imidacloprid-resistant YN-ILR strain compared with the susceptible YN strain (CYP425B1-CYP6BD10 had 1.51- to 11.45-fold higher expression, CYP4CE2-CYP4DD1V2 had 0.12- to 0.57-fold lower expression). While there were no mutations in target nicotinic acetylcholine receptor (nAChR) genes, subunits of Lsα1, Lsβ1, and Lsβ3 in the YN-ILR strain showed 3.86-, 4.39-, and 2.59-fold higher expression and Lsa8 displayed 0.38-fold lower expression than the YN strain. Moreover, 21-fold moderate imidacloprid resistance in individuals of L. striatellus did not produce a fitness cost. The findings suggest that L. striatellus has the capacity to develop resistance to imidacloprid through P450 detoxification and potential target nAChR expression changes, and moderate imidacloprid resistance was not associated with a fitness cost.

Microarray Analysis in a Cell Death Resistant Glioma Cell Line to Identify Signaling Pathways and Novel Genes Controlling Resistance and Malignancy

Energy Technology Data Exchange (ETDEWEB)

Seznec, Janina; Naumann, Ulrike, E-mail: ulrike.naumann@uni-tuebingen.de [Laboratory of Molecular Neuro-Oncology, Department of General Neurology, Hertie-Institute for Clinical Brain Research and Center Neurology, University of Tuebingen, Otfried-Mueller-Str. 27, Tuebingen 72076 (Germany)

2011-06-27

Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies.

Microarray Analysis in a Cell Death Resistant Glioma Cell Line to Identify Signaling Pathways and Novel Genes Controlling Resistance and Malignancy

International Nuclear Information System (INIS)

Seznec, Janina; Naumann, Ulrike

2011-01-01

Glioblastoma multiforme (GBM) is a lethal type of cancer mainly resistant to radio- and chemotherapy. Since the tumor suppressor p53 functions as a transcription factor regulating the expression of genes involved in growth inhibition, DNA repair and apoptosis, we previously assessed whether specific differences in the modulation of gene expression are responsible for the anti-tumor properties of a dominant positive p53, chimeric tumor suppressor (CTS)-1. CTS-1 is based on the sequence of p53 and designed to resist various mechanisms of inactivation which limit the activity of p53. To identify CTS-1-regulated cell death-inducing genes, we generated a CTS-1-resistant glioma cell line (229R). We used Affymetrix whole-genome microarray expression analysis to analyze alterations in gene expression and identified a variety of CTS-1 regulated genes involved in cancer-linked processes. 313 genes were differentially expressed in Adeno-CTS-1 (Ad-CTS-1)-infected and 700 genes in uninfected 229R cells compared to matching parental cells. Ingenuity Pathway Analysis (IPA) determined a variety of differentially expressed genes in Ad-CTS-1-infected cells that were members of the intracellular networks with central tumor-involved players such as nuclear factor kappa B (NF-κB), protein kinase B (PKB/AKT) or transforming growth factor beta (TGF-β). Differentially regulated genes include secreted factors as well as intracellular proteins and transcription factors regulating not only cell death, but also processes such as tumor cell motility and immunity. This work gives an overview of the pathways differentially regulated in the resistant versus parental glioma cells and might be helpful to identify candidate genes which could serve as targets to develop novel glioma specific therapy strategies

A set of vectors for introduction of antibiotic resistance genes by in vitro Cre-mediated recombination

Directory of Open Access Journals (Sweden)

Vassetzky Yegor S

2008-12-01

Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

Science.gov (United States)

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

The expression of antibiotic resistance genes in antibiotic-producing bacteria.

Science.gov (United States)

Mak, Stefanie; Xu, Ye; Nodwell, Justin R

2014-08-01

Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

The wheat homolog of putative nucleotide-binding site-leucine-rich repeat resistance gene TaRGA contributes to resistance against powdery mildew.

Science.gov (United States)

Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong

2016-03-01

Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.

Candidate genes for cross-resistance against DNA-damaging drugs

DEFF Research Database (Denmark)

Wittig, Rainer; Nessling, Michelle; Will, Rainer D

2002-01-01

Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

Science.gov (United States)

Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

2013-07-01

The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

Directory of Open Access Journals (Sweden)

Wan Hongjian

2010-08-01

Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

Directory of Open Access Journals (Sweden)

Norman Hembach

2017-07-01

Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

Directory of Open Access Journals (Sweden)

Ana M. González

2017-11-01

Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

Directory of Open Access Journals (Sweden)

Jiongming Sui

2018-03-01

Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

Directory of Open Access Journals (Sweden)

Orla Coleman

2015-03-01

Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

Science.gov (United States)

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Fine mapping of the rice bacterial blight resistance gene Xa-4 and its co-segregation marker

Institute of Scientific and Technical Information of China (English)

无

2000-01-01

An F2 population developed from the Xa-4 near isogenic lines,IR24 and IRBB4,was used for fine mapping of the rice bacterial blight resistance gene,Xa-4.Some restriction fragment length polymorphism (RFLP) markers on the high-density map constructed by Harushima et al.and the amplified DNA fragments homologous to the conserved domains of plant disease resistance (R) genes were used to construct the genetic linkage map around the gene Xa-4 by scoring susceptible individuals in the population.Xa-4 was mapped between the RFLP marker G181 and the polymerase chain reaction (PCR) marker M55.The R gene homologous fragment marker RS13 was found co-segregating with Xa-4 by analyzing all the plants in the population.This result opened an approach to map-based cloning of this gene,and marker RS13 can be applied to molecular marker-assisted selection of Xa-4 in rice breeding programs.

Molecular mapping of a sunflower rust resistance gene from HAR6.

Science.gov (United States)

Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

2013-03-01

Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

Directory of Open Access Journals (Sweden)

Qing-Bin Yuan

Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

Abundances of tetracycline, sulphonamide and beta-lactam antibiotic resistance genes in conventional wastewater treatment plants (WWTPs) with different waste load

DEFF Research Database (Denmark)

Laht, Mailis; Karkman, Antti; Voolaid, Veiko

2014-01-01

Antibiotics and antibiotic resistant bacteria enter wastewater treatment plants (WWTPs), an environment where resistance genes can potentially spread and exchange between microbes. Several antibiotic resistance genes (ARGs) were quantified using qPCR in three WWTPs of decreasing capacity located...... abundances with 16S rRNA gene abundances while assessing if the respective genes increased or decreased during treatment. ARGs were detected in most samples; sul1, sul2, and tetM were detected in all samples. Statistically significant differences (adjusted p... in the relative abundance of resistance genes, while the raw abundances fell by several orders of magnitude. Standard water quality variables (biological oxygen demand, total phosphorus and nitrogen, etc.) were weakly related or unrelated to the relative abundance of resistance genes. Based on our results we...

Development and dissection of diagnostic SNP markers for the downy mildew resistance genes Pl Arg and Pl 8 and maker-assisted gene pyramiding in sunflower (Helianthus annuus L.).

Science.gov (United States)

Qi, L L; Talukder, Z I; Hulke, B S; Foley, M E

2017-06-01

Diagnostic DNA markers are an invaluable resource in breeding programs for successful introgression and pyramiding of disease resistance genes. Resistance to downy mildew (DM) disease in sunflower is mediated by Pl genes which are known to be effective against the causal fungus, Plasmopara halstedii. Two DM resistance genes, Pl Arg and Pl 8 , are highly effective against P. halstedii races in the USA, and have been previously mapped to the sunflower linkage groups (LGs) 1 and 13, respectively, using simple sequence repeat (SSR) markers. In this study, we developed high-density single nucleotide polymorphism (SNP) maps encompassing the Pl arg and Pl 8 genes and identified diagnostic SNP markers closely linked to these genes. The specificity of the diagnostic markers was validated in a highly diverse panel of 548 sunflower lines. Dissection of a large marker cluster co-segregated with Pl Arg revealed that the closest SNP markers NSA_007595 and NSA_001835 delimited Pl Arg to an interval of 2.83 Mb on the LG1 physical map. The SNP markers SFW01497 and SFW06597 delimited Pl 8 to an interval of 2.85 Mb on the LG13 physical map. We also developed sunflower lines with homozygous, three gene pyramids carrying Pl Arg , Pl 8 , and the sunflower rust resistance gene R 12 using the linked SNP markers from a segregating F 2 population of RHA 340 (carrying Pl 8 )/RHA 464 (carrying Pl Arg and R 12 ). The high-throughput diagnostic SNP markers developed in this study will facilitate marker-assisted selection breeding, and the pyramided sunflower lines will provide durable resistance to downy mildew and rust diseases.

Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

Science.gov (United States)

Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

2009-11-01

Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

Differential gene expression in granulosa cells from polycystic ovary syndrome patients with and without insulin resistance: identification of susceptibility gene sets through network analysis.

Science.gov (United States)

Kaur, Surleen; Archer, Kellie J; Devi, M Gouri; Kriplani, Alka; Strauss, Jerome F; Singh, Rita

2012-10-01

Polycystic ovary syndrome (PCOS) is a heterogeneous, genetically complex, endocrine disorder of uncertain etiology in women. Our aim was to compare the gene expression profiles in stimulated granulosa cells of PCOS women with and without insulin resistance vs. matched controls. This study included 12 normal ovulatory women (controls), 12 women with PCOS without evidence for insulin resistance (PCOS non-IR), and 16 women with insulin resistance (PCOS-IR) undergoing in vitro fertilization. Granulosa cell gene expression profiling was accomplished using Affymetrix Human Genome-U133 arrays. Differentially expressed genes were classified according to gene ontology using ingenuity pathway analysis tools. Microarray results for selected genes were confirmed by real-time quantitative PCR. A total of 211 genes were differentially expressed in PCOS non-IR and PCOS-IR granulosa cells (fold change≥1.5; P≤0.001) vs. matched controls. Diabetes mellitus and inflammation genes were significantly increased in PCOS-IR patients. Real-time quantitative PCR confirmed higher expression of NCF2 (2.13-fold), TCF7L2 (1.92-fold), and SERPINA1 (5.35-fold). Increased expression of inflammation genes ITGAX (3.68-fold) and TAB2 (1.86-fold) was confirmed in PCOS non-IR. Different cardiometabolic disease genes were differentially expressed in the two groups. Decreased expression of CAV1 (-3.58-fold) in PCOS non-IR and SPARC (-1.88-fold) in PCOS-IR was confirmed. Differential expression of genes involved in TGF-β signaling (IGF2R, increased; and HAS2, decreased), and oxidative stress (TXNIP, increased) was confirmed in both groups. Microarray analysis demonstrated differential expression of genes linked to diabetes mellitus, inflammation, cardiovascular diseases, and infertility in the granulosa cells of PCOS women with and without insulin resistance. Because these dysregulated genes are also involved in oxidative stress, lipid metabolism, and insulin signaling, we hypothesize that these

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.

Science.gov (United States)

López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V

2003-08-01

Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

Science.gov (United States)

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

Analysis of non-TIR NBS-LRR resistance gene analogs in Musa acuminata Colla: Isolation, RFLP marker development, and physical mapping

Directory of Open Access Journals (Sweden)

Souza Manoel T

2008-01-01

Full Text Available Abstract Background Many commercial banana varieties lack sources of resistance to pests and diseases, as a consequence of sterility and narrow genetic background. Fertile wild relatives, by contrast, possess greater variability and represent potential sources of disease resistance genes (R-genes. The largest known family of plant R-genes encode proteins with nucleotide-binding site (NBS and C-terminal leucine-rich repeat (LRR domains. Conserved motifs in such genes in diverse plant species offer a means for isolation of candidate genes in banana which may be involved in plant defence. Results A computational strategy was developed for unbiased conserved motif discovery in NBS and LRR domains in R-genes and homologues in monocotyledonous plant species. Degenerate PCR primers targeting conserved motifs were tested on the wild cultivar Musa acuminata subsp. burmannicoides, var. Calcutta 4, which is resistant to a number of fungal pathogens and nematodes. One hundred and seventy four resistance gene analogs (RGAs were amplified and assembled into 52 contiguous sequences. Motifs present were typical of the non-TIR NBS-LRR RGA subfamily. A phylogenetic analysis of deduced amino-acid sequences for 33 RGAs with contiguous open reading frames (ORFs, together with RGAs from Arabidopsis thaliana and Oryza sativa, grouped most Musa RGAs within monocotyledon-specific clades. RFLP-RGA markers were developed, with 12 displaying distinct polymorphisms in parentals and F1 progeny of a diploid M. acuminata mapping population. Eighty eight BAC clones were identified in M. acuminata Calcutta 4, M. acuminata Grande Naine, and M. balbisiana Pisang Klutuk Wulung BAC libraries when hybridized to two RGA probes. Multiple copy RGAs were common within BAC clones, potentially representing variation reservoirs for evolution of new R-gene specificities. Conclusion This is the first large scale analysis of NBS-LRR RGAs in M. acuminata Calcutta 4. Contig sequences were

Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

Science.gov (United States)

Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

2017-09-01

Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

Science.gov (United States)

Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

2017-06-01

Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

Science.gov (United States)

Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

2008-01-01

Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

Science.gov (United States)

Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

2014-04-01

The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

Inheritance and Gene Mapping of Resistance to Soybean Mosaic Virus Strain SC14 in Soybean

Institute of Scientific and Technical Information of China (English)

Hai-Chao Li; Hai-Jian Zhi; Jun-Yi Gai; Dong-Quan Guo; Yan-Wei Wang; Kai Li; Li Bai; Hua Yang

2006-01-01

Soybean mosaic virus (SMV) is one of the most broadly distributed diseases worldwide. It causes severe yield loss and seed quality deficiency in soybean (Glycine max (L.) Merr.). SMV Strain SC14 isolated from Shanxi Province, China, was a newly identified virulent strain and can infect Kefeng No. 1, a source with wide spectrum resistance. In the present study, soybean accessions, PI96983, Qihuang No. 1 and Qihuang No. 22 were identified to be resistant (R) and Nannong 1138-2, Pixianchadou susceptible (S) to SC14. Segregation analysis of PI96983 × Nannong 1138-2 indicated that a single dominant gene (designated as Rsc14) controlled the resistance to SC14 at both V2 and R1 developmental stages. The same results were obtained for the crosses of Qihuang No. 1 × Nannong 1138-2 and Qihuang No. 22 × Nannong 1138-2 as in PI96983 × Nannong 1138-2 at V2 stage, but at R1 stage,the F1 performed as necrosis (a susceptible symptom other than mosaic), F2 segregated in a ratio of 1R:2N:1S,and the progenies of necrotic (N) F2 individuals segregated also in R, N and S. It indicated that a single gene (designated as Rsc14o, to be different from that of PI96983) controlled the resistance to SC14, its dominance was the same as in PI96983 × Nannong 1138-2 (without symptoms) at V2 stage and not the same at R1 stage. The tightly linked co-dominant simple sequence repeat (SSR) marker Satt334 indicated that all the heterozygous bands were completely corresponding to the necrotic F2 individuals, or all the necrotic F2 individuals were heterozygotes.It was inferred that necrosis might be due to the interaction among SMV strains, resistance genes, genetic background of the resistance genes, and plant development stage. Furthermore, the bulked segregant analysis (BSA) of SSR markers was conducted to map the resistance genes. In F2 of PI96983 × Nannong 1138-2, five SSR markers, Sat_297, Sat_234, Sat_154, Sct_033 and Sat_120, were found closely linked to Rsc14, with genetic distances of 14

Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

Institute of Scientific and Technical Information of China (English)

Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

2014-01-01

Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

Directory of Open Access Journals (Sweden)

S.S. Sandhu

2003-12-01

Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

Directory of Open Access Journals (Sweden)

Aditya Verma

2017-12-01

Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide, Visceral

Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

International Nuclear Information System (INIS)

Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

1998-01-01

This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

Science.gov (United States)

Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

2017-10-16

A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

Science.gov (United States)

Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

2010-07-01

Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

Overexpression of antibiotic resistance genes in hospital effluents over time.

Science.gov (United States)

Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

2017-06-01

Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

Directory of Open Access Journals (Sweden)

Baozhu Guo

2011-06-01

Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

Usage of the Heterologous Expression of the Antimicrobial Gene afp From Aspergillus giganteus for Increasing Fungal Resistance in Olive

Science.gov (United States)

Narvaez, Isabel; Khayreddine, Titouh; Pliego, Clara; Cerezo, Sergio; Jiménez-Díaz, Rafael M.; Trapero-Casas, José L.; López-Herrera, Carlos; Arjona-Girona, Isabel; Martín, Carmen; Mercado, José A.; Pliego-Alfaro, Fernando

2018-01-01

The antifungal protein (AFP) produced by Aspergillus giganteus, encoded by the afp gene, has been used to confer resistance against a broad range of fungal pathogens in several crops. In this research, transgenic olive plants expressing the afp gene under the control of the constitutive promoter CaMV35S were generated and their disease response against two root infecting fungal pathogens, Verticillium dahliae and Rosellinia necatrix, was evaluated. Embryogenic cultures derived from a mature zygotic embryo of cv. ‘Picual’ were used for A. tumefaciens transformation. Five independent transgenic lines were obtained, showing a variable level of afp expression in leaves and roots. None of these transgenic lines showed enhanced resistance to Verticillium wilt. However, some of the lines displayed a degree of incomplete resistance to white root rot caused by R. necatrix compared with disease reaction of non-transformed plants or transgenic plants expressing only the GUS gene. The level of resistance to this pathogen correlated with that of the afp expression in root and leaves. Our results indicate that the afp gene can be useful for enhanced partial resistance to R. necatrix in olive, but this gene does not protect against V. dahliae. PMID:29875785

Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

African Journals Online (AJOL)

SERVER

2008-02-19

Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

Directory of Open Access Journals (Sweden)

David Jean-Philippe

2009-11-01

Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

PRGPred: A platform for prediction of domains of resistance gene analogue (RGA in Arecaceae developed using machine learning algorithms

Directory of Open Access Journals (Sweden)

MATHODIYIL S. MANJULA

2015-12-01

Full Text Available Plant disease resistance genes (R-genes are responsible for initiation of defense mechanism against various phytopathogens. The majority of plant R-genes are members of very large multi-gene families, which encode structurally related proteins containing nucleotide binding site domains (NBS and C-terminal leucine rich repeats (LRR. Other classes possess' an extracellular LRR domain, a transmembrane domain and sometimes, an intracellular serine/threonine kinase domain. R-proteins work in pathogen perception and/or the activation of conserved defense signaling networks. In the present study, sequences representing resistance gene analogues (RGAs of coconut, arecanut, oil palm and date palm were collected from NCBI, sorted based on domains and assembled into a database. The sequences were analyzed in PRINTS database to find out the conserved domains and their motifs present in the RGAs. Based on these domains, we have also developed a tool to predict the domains of palm R-genes using various machine learning algorithms. The model files were selected based on the performance of the best classifier in training and testing. All these information is stored and made available in the online ‘PRGpred' database and prediction tool.

Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

Science.gov (United States)

Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

2011-06-01

Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

Science.gov (United States)

Fukuda, H; Hiramatsu, K

1997-05-01

Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

Antibiotic resistance and virulence genes in coliform water isolates.

Science.gov (United States)

Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

2016-11-01

Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

Epigenetic control of virulence gene expression in Pseudomonas aeruginosa by a LysR-type transcription regulator.

Directory of Open Access Journals (Sweden)

Keith H Turner

2009-12-01

Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.

Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

Science.gov (United States)

Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

2016-01-01

Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

The cfr and cfr-like multiple resistance genes

DEFF Research Database (Denmark)

Vester, Birte

2018-01-01

. The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

Science.gov (United States)

Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

2017-12-19

WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

Science.gov (United States)

Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

2015-07-01

The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

Sponge microbiota are a reservoir of functional antibiotic resistance genes

Directory of Open Access Journals (Sweden)

Dennis Versluis

2016-11-01

Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

Science.gov (United States)

Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

Multiyear evaluation of the durability of the resistance conferred by Ma and RMia genes to Meloidogyne incognita in Prunus under controlled conditions.

Science.gov (United States)

Khallouk, Samira; Voisin, Roger; Portier, Ulysse; Polidori, Joël; Van Ghelder, Cyril; Esmenjaud, Daniel

2013-08-01

Root-knot nematodes (RKNs) (Meloidogyne spp.) are highly polyphagous pests that parasitize Prunus crops in Mediterranean climates. Breeding for RKN-resistant Prunus cultivars, as an alternative to the now-banned use of nematicides, is a real challenge, because the perennial nature of these trees increases the risk of resistance breakdown. The Ma plum resistance (R) gene, with a complete spectrum, and the RMia peach R gene, with a more restricted spectrum, both provide total control of Meloidogyne incognita, the model parthenogenetic species of the genus and the most important RKN in terms of economic losses. We investigated the durability of the resistance to this nematode conferred by these genes, comparing the results obtained with those for the tomato Mi-1 reference gene. In multiyear experiments, we applied a high and continuous nematode inoculum pressure by cultivating nematode-infested susceptible tomato plants with either Prunus accessions carrying Ma or RMia R genes, or with resistant tomato plants carrying the Mi-1 gene. Suitable conditions for Prunus development were achieved by carrying out the studies in a glasshouse, in controlled conditions allowing a short winter leaf fall and dormancy. We first assessed the plum accession 'P.2175', which is heterozygous for the Ma gene, in two successive 2-year evaluations, for resistance to two M. incognita isolates. Whatever the isolate used, no nematodes reproducing on P.2175 were detected, whereas galls and nematodes reproducing on tomato plants carrying Mi-1 were observed. In a second experiment with the most aggressive isolate, interspecific full-sib material (P.2175 × ['Garfi' almond × 'Nemared' peach]), carrying either Ma or RMia (from Nemared) or both (in the heterozygous state) or neither of these genes, was evaluated for 4 years. No virulent nematodes developed on Prunus spp. carrying R genes, whereas galling and virulent individuals were observed on Mi-1-resistant tomato plants. Thus, the resistance to

Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

Science.gov (United States)

Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

2012-12-01

Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

Gene Profiling in Late Blight Resistance in Potato Genotype SD20

Directory of Open Access Journals (Sweden)

Xiaohui Yang

2018-06-01

Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

Science.gov (United States)

Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

2014-02-01

This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

Integrative analysis of miRNA and gene expression reveals regulatory networks in tamoxifen-resistant breast cancer

DEFF Research Database (Denmark)

Joshi, Tejal; Elias, Daniel; Stenvang, Jan

2016-01-01

and 14-3-3 family genes. Integrating the inferred miRNA-target relationships, we investigated the functional importance of 2 central genes, SNAI2 and FYN, which showed increased expression in TamR cells, while their corresponding regulatory miRNA were downregulated. Using specific chemical inhibitors......Tamoxifen is an effective anti-estrogen treatment for patients with estrogen receptor-positive (ER+) breast cancer, however, tamoxifen resistance is frequently observed. To elucidate the underlying molecular mechanisms of tamoxifen resistance, we performed a systematic analysis of miRNA......-mediated gene regulation in three clinically-relevant tamoxifen-resistant breast cancer cell lines (TamRs) compared to their parental tamoxifen-sensitive cell line. Alterations in the expression of 131 miRNAs in tamoxifen-resistant vs. parental cell lines were identified, 22 of which were common to all Tam...

Removal of bacterial cells, antibiotic resistance genes and integrase genes by on-site hospital wastewater treatment plants: surveillance of treated hospital effluent quality

KAUST Repository

Timraz, Kenda Hussain Hassan

2016-12-15

This study aims to evaluate the removal efficiency of microbial contaminants, including total cell counts, antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs, e.g. tetO, tetZ, sul1 and sul2) and integrase genes (e.g. intl1 and intl2), by wastewater treatment plants (WWTPs) operated on-site of two hospitals (i.e., SH WWTP and IH WWTP). Both SH and IH WWTPs utilize the conventional activated sludge process but differences in the removal efficiencies were observed. Over the 2 week sampling period, IH WWTP outperformed SH WWTP, and achieved an approximate 0.388 to 2.49-log log removal values (LRVs) for total cell counts compared to the 0.010 to 0.162-log removal in SH WWTP. Although ARB were present in the hospital influent, the treatment process of both hospitals effectively removed ARB from most of the effluent samples. In instances where ARB were recovered in the effluent, none of the viable isolates were identified to be opportunistic pathogenic species based on 16S rRNA gene sequencing. However, sul1 and intl1 genes remained detectable at up to 105 copies per mL or 8 x 10(-1) copies per 16S rRNA gene in the treated effluent, with an LRV of less than 1.2. When the treated effluent is discharged from hospital WWTPs into the public sewer for further treatment as per requirement in many countries, the detected amount of ARGs and integrase genes in the hospital effluent can become a potential source of horizontal gene dissemination in the municipal WWTP. Proper on-site wastewater treatment and surveillance of the effluent quality for emerging contaminants are therefore highly recommended.

Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

African Journals Online (AJOL)

The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

Science.gov (United States)

Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

2013-03-23

Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes.

Science.gov (United States)

Czekalski, Nadine; Sigdel, Radhika; Birtel, Julia; Matthews, Blake; Bürgmann, Helmut

2015-08-01

Antibiotic resistance genes (ARGs) are emerging environmental contaminants, known to be continuously discharged into the aquatic environment via human and animal waste. Freshwater aquatic environments represent potential reservoirs for ARG and potentially allow sewage-derived ARG to persist and spread in the environment. This may create increased opportunities for an eventual contact with, and gene transfer to, human and animal pathogens via the food chain or drinking water. However, assessment of this risk requires a better understanding of the level and variability of the natural resistance background and the extent of the human impact. We have analyzed water samples from 21 Swiss lakes, taken at sampling points that were not under the direct influence of local contamination sources and analyzed the relative abundance of ARG using quantitative real-time PCR. Copy numbers of genes mediating resistance to three different broad-spectrum antibiotic classes (sulfonamides: sul1, sul2, tetracyclines: tet(B), tet(M), tet(W) and fluoroquinolones: qnrA) were normalized to copy numbers of bacterial 16S rRNA genes. We used multiple linear regression to assess if ARG abundance is related to human activities in the catchment, microbial community composition and the eutrophication status of the lakes. Sul genes were detected in all sampled lakes, whereas only four lakes contained quantifiable numbers of tet genes, and qnrA remained below detection in all lakes. Our data indicate higher abundance of sul1 in lakes with increasing number and capacity of wastewater treatment plants (WWTPs) in the catchment. sul2 abundance was rather related to long water residence times and eutrophication status. Our study demonstrates the potential of freshwater lakes to preserve antibiotic resistance genes, and provides a reference for ARG abundance from lake systems with low human impact as a baseline for assessing ARG contamination in lake water. Copyright © 2015 Elsevier Ltd. All rights

Modeling the fate of antibiotic resistance genes and class 1 integrons during thermophilic anaerobic digestion of municipal wastewater solids.

Science.gov (United States)

Burch, Tucker R; Sadowsky, Michael J; LaPara, Timothy M

2015-10-19

This study investigated the use of thermophilic anaerobic digestion for removing antibiotic resistance genes (ARGs) from residual municipal wastewater solids. Four laboratory-scale anaerobic digesters were operated in 8-day batch cycles at temperatures of 40, 56, 60, and 63 °C. Two tetracycline resistance genes (tet(W) and tet(X)), a fluoroquinolone resistance gene (qnrA), the integrase gene of class 1 integrons (intI1), 16S rRNA genes of all Bacteria, and 16S rRNA genes of methanogens were quantified using real-time quantitative PCR. ARG and intI1 quantities decreased at all temperatures and were described well by a modified form of the Collins-Selleck disinfection kinetic model. The magnitudes of Collins-Selleck kinetic parameters were significantly greater at thermophilic temperatures compared to 40 °C, but few statistically significant differences were observed among these parameters for the thermophilic anaerobic digesters. This model allows for the direct comparison of different operating conditions (e.g., temperature) on anaerobic digestion performance in mitigating the quantity of ARGs in wastewater solids and could be used to design full-scale anaerobic digesters to specifically treat for ARGs as a "pollutant" of concern.

Molecular detection of disease resistance genes to powdery mildew ...

African Journals Online (AJOL)

A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

Salt resistance genes revealed by functional metagenomics from brines and moderate-salinity rhizosphere within a hypersaline environment

Directory of Open Access Journals (Sweden)

Salvador eMirete

2015-10-01

Full Text Available Hypersaline environments are considered one of the most extreme habitats on earth and microorganisms have developed diverse molecular mechanisms of adaptation to withstand these conditions. The present study was aimed at identifying novel genes involved in salt resistance from the microbial communities of brines and the rhizosphere from the Es Trenc saltern (Mallorca, Spain. The microbial diversity assessed by pyrosequencing of 16S rRNA gene libraries revealed the presence of communities that are typical in such environments. Metagenomic libraries from brine and rhizosphere samples, were transferred to the osmosensitive strain Escherichia coli MKH13, and screened for salt resistance. As a result, eleven genes that conferred salt resistance were identified, some encoding for well known proteins previously related to osmoadaptation as a glycerol and a proton pump, whereas others encoded for proteins not previously related to this function in microorganisms as DNA/RNA helicases, an endonuclease III (Nth and hypothetical proteins of unknown function. Furthermore, four of the retrieved genes were cloned and expressed in Bacillus subtilis and they also exhibited salt resistance in this bacterium, broadening the spectrum of bacterial species where these genes can operate. This is the first report of salt resistance genes recovered from metagenomes of a hypersaline environment.

Accumulation of pharmaceuticals, Enterococcus, and resistance genes in soils irrigated with wastewater for zero to 100 years in central Mexico.

Directory of Open Access Journals (Sweden)

Philipp Dalkmann

Full Text Available Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin, 4.3 µg/kg (sulfamethoxazole, and 5.4 µg/kg (carbamazepine in soils irrigated for 19-28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15 × 10(-3 ± 0.22 × 10(-3 copies/16S rDNA than in non-irrigated soils (4.35 × 10(-5± 1.00 × 10(-5 copies/16S rDNA, while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61 × 10(-4 ± 0.59 × 10(-4 versus 2.99 × 10(-5 ± 0.26 × 10(-5 copies/16S rDNA. Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a

Genome scanning for identification of resistance gene analogs (RGAs)

African Journals Online (AJOL)

Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

Prediction of novel target genes and pathways involved in bevacizumab-resistant colorectal cancer

Science.gov (United States)

Makondi, Precious Takondwa; Lee, Chia-Hwa; Huang, Chien-Yu; Chu, Chi-Ming; Chang, Yu-Jia

2018-01-01

Bevacizumab combined with cytotoxic chemotherapy is the backbone of metastatic colorectal cancer (mCRC) therapy; however, its treatment efficacy is hampered by therapeutic resistance. Therefore, understanding the mechanisms underlying bevacizumab resistance is crucial to increasing the therapeutic efficacy of bevacizumab. The Gene Expression Omnibus (GEO) database (dataset, GSE86525) was used to identify the key genes and pathways involved in bevacizumab-resistant mCRC. The GEO2R web tool was used to identify differentially expressed genes (DEGs). Functional and pathway enrichment analyses of the DEGs were performed using the Database for Annotation, Visualization, and Integrated Discovery(DAVID). Protein–protein interaction (PPI) networks were established using the Search Tool for the Retrieval of Interacting Genes/Proteins database(STRING) and visualized using Cytoscape software. A total of 124 DEGs were obtained, 57 of which upregulated and 67 were downregulated. PPI network analysis showed that seven upregulated genes and nine downregulated genes exhibited high PPI degrees. In the functional enrichment, the DEGs were mainly enriched in negative regulation of phosphate metabolic process and positive regulation of cell cycle process gene ontologies (GOs); the enriched pathways were the phosphoinositide 3-kinase-serine/threonine kinase signaling pathway, bladder cancer, and microRNAs in cancer. Cyclin-dependent kinase inhibitor 1A(CDKN1A), toll-like receptor 4 (TLR4), CD19 molecule (CD19), breast cancer 1, early onset (BRCA1), platelet-derived growth factor subunit A (PDGFA), and matrix metallopeptidase 1 (MMP1) were the DEGs involved in the pathways and the PPIs. The clinical validation of the DEGs in mCRC (TNM clinical stages 3 and 4) revealed that high PDGFA expression levels were associated with poor overall survival, whereas high BRCA1 and MMP1 expression levels were associated with favorable progress free survival(PFS). The identified genes and pathways

Prediction of novel target genes and pathways involved in bevacizumab-resistant colorectal cancer.

Directory of Open Access Journals (Sweden)

Precious Takondwa Makondi

Full Text Available Bevacizumab combined with cytotoxic chemotherapy is the backbone of metastatic colorectal cancer (mCRC therapy; however, its treatment efficacy is hampered by therapeutic resistance. Therefore, understanding the mechanisms underlying bevacizumab resistance is crucial to increasing the therapeutic efficacy of bevacizumab. The Gene Expression Omnibus (GEO database (dataset, GSE86525 was used to identify the key genes and pathways involved in bevacizumab-resistant mCRC. The GEO2R web tool was used to identify differentially expressed genes (DEGs. Functional and pathway enrichment analyses of the DEGs were performed using the Database for Annotation, Visualization, and Integrated Discovery(DAVID. Protein-protein interaction (PPI networks were established using the Search Tool for the Retrieval of Interacting Genes/Proteins database(STRING and visualized using Cytoscape software. A total of 124 DEGs were obtained, 57 of which upregulated and 67 were downregulated. PPI network analysis showed that seven upregulated genes and nine downregulated genes exhibited high PPI degrees. In the functional enrichment, the DEGs were mainly enriched in negative regulation of phosphate metabolic process and positive regulation of cell cycle process gene ontologies (GOs; the enriched pathways were the phosphoinositide 3-kinase-serine/threonine kinase signaling pathway, bladder cancer, and microRNAs in cancer. Cyclin-dependent kinase inhibitor 1A(CDKN1A, toll-like receptor 4 (TLR4, CD19 molecule (CD19, breast cancer 1, early onset (BRCA1, platelet-derived growth factor subunit A (PDGFA, and matrix metallopeptidase 1 (MMP1 were the DEGs involved in the pathways and the PPIs. The clinical validation of the DEGs in mCRC (TNM clinical stages 3 and 4 revealed that high PDGFA expression levels were associated with poor overall survival, whereas high BRCA1 and MMP1 expression levels were associated with favorable progress free survival(PFS. The identified genes and pathways

Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

DEFF Research Database (Denmark)

Guardabassi, L.; Christensen, H.; Hasman, Henrik

2004-01-01

Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

Science.gov (United States)

Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

2017-03-01

Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

The relationship between codon usage bias and cold resistant genes

International Nuclear Information System (INIS)

Barozai, M.Y.; Din, M.

2014-01-01

This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

Comparative genome analysis and resistance gene mapping in grain legumes

International Nuclear Information System (INIS)

Young, N.D.

1998-01-01

Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Science.gov (United States)

Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

2014-01-01

Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

Expression Study of Banana Pathogenic Resistance Genes

Directory of Open Access Journals (Sweden)

Fenny M. Dwivany

2016-10-01

Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

Age-related Resistance and the Defense Signaling Pathway of Ph-3 Gene Against Phytophthora infestans in Tomatoes

Directory of Open Access Journals (Sweden)

Sayed Rashad Ali Shah

2015-09-01

Full Text Available Resistance (R genes against plant pathogens often have age-related resistance (ARR effects. However, the mechanism involved in this phenomenon remains unknown. In this paper, Solanum lycopersicum ‘CLN2037B’ and S. pimpinellifolium ‘L3708’ harboring the Ph-3 gene, as well as S. habrochaites ‘LA2099’, ‘LA1777’ and ‘LA1033’ harboring quantitative trait loci (QTLs, were tested to investigate age-related resistance against late blight (LB; caused by Phytophthora infestans in the three-leaf stage of the plants. The results demonstrated that the QTL-related LB resistance showed the same age-related resistance as the Ph-3-mediated resistance at the six- and nine-leaf stages compared with the three-leaf stage. This indicated that there is a common defense mechanism in tomatoes against P. infestans via ARR. In addition, we combined ethylene (ET, salicylic acid (SA and jasmonic acid (JA mutants with virus-induced gene silencing (VIGS to study the Ph-3-dependent resistance signaling pathway. The results showed that ethylene and salicylic acid, but not jasmonic acid, are involved in the LB resistance mediated by the Ph-3 gene.

Abundances of tetracycline, sulphonamide and beta-lactam antibiotic resistance genes in conventional wastewater treatment plants (WWTPs with different waste load.

Directory of Open Access Journals (Sweden)

Mailis Laht

Full Text Available Antibiotics and antibiotic resistant bacteria enter wastewater treatment plants (WWTPs, an environment where resistance genes can potentially spread and exchange between microbes. Several antibiotic resistance genes (ARGs were quantified using qPCR in three WWTPs of decreasing capacity located in Helsinki, Tallinn, and Tartu, respectively: sulphonamide resistance genes (sul1 and sul2, tetracycline resistance genes (tetM and tetC, and resistance genes for extended spectrum beta-lactams (blaoxa-58, blashv-34, and blactx-m-32. To avoid inconsistencies among qPCR assays we normalised the ARG abundances with 16S rRNA gene abundances while assessing if the respective genes increased or decreased during treatment. ARGs were detected in most samples; sul1, sul2, and tetM were detected in all samples. Statistically significant differences (adjusted p<0.01 between the inflow and effluent were detected in only four cases. Effluent values for blaoxa-58 and tetC decreased in the two larger plants while tetM decreased in the medium-sized plant. Only blashv-34 increased in the effluent from the medium-sized plant. In all other cases the purification process caused no significant change in the relative abundance of resistance genes, while the raw abundances fell by several orders of magnitude. Standard water quality variables (biological oxygen demand, total phosphorus and nitrogen, etc. were weakly related or unrelated to the relative abundance of resistance genes. Based on our results we conclude that there is neither considerable enrichment nor purification of antibiotic resistance genes in studied conventional WWTPs.

Diversity of 23S rRNA genes within individual prokaryotic genomes.

Directory of Open Access Journals (Sweden)

Anna Pei

Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

Obesity genes and insulin resistance.

Science.gov (United States)

Belkina, Anna C; Denis, Gerald V

2010-10-01

The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

Cloning of resistance gene analogs located on the alien chromosome in an addition line of wheat-Thinopyrum intermedium.

Science.gov (United States)

Jiang, Shu-Mei; Hu, Jun; Yin, Wei-Bo; Chen, Yu-Hong; Wang, Richard R-C; Hu, Zan-Min

2005-09-01

Homology-based gene/gene-analog cloning method has been extensively applied in isolation of RGAs (resistance gene analogs) in various plant species. However, serious interference of sequences on homoeologous chromosomes in polyploidy species usually occurred when cloning RGAs in a specific chromosome. In this research, the techniques of chromosome microdissection combined with homology-based cloning were used to clone RGAs from a specific chromosome of Wheat-Thinopyrum alien addition line TAi-27, which was derived from common wheat and Thinopyrum intermedium with a pair of chromosomes from Th. intermedium. The alien chromosomes carry genes for resistance to BYDV. The alien chromosome in TAi-27 was isolated by a glass needle and digested with proteinase K. The DNA of the alien chromosome was amplified by two rounds of Sau3A linker adaptor-mediated PCR. RGAs were amplified by PCR with the degenerated primers designed based on conserved domains of published resistance genes (R genes) by using the alien chromosome DNA, genomic DNA and cDNA of Th. intermedium, TAi-27 and 3B-2 (a parent of TAi-27) as templates. A total of seven RGAs were obtained and sequenced. Of which, a constitutively expressed single-copy NBS-LRR type RGA ACR 3 was amplified from the dissected alien chromosome of TAi-27, TcDR 2 and TcDR 3 were from cDNA of Th. intermedium, AcDR 3 was from cDNA of TAi-27, FcDR 2 was from cDNA of 3B-2, AR 2 was from genomic DNA of TAi-27 and TR 2 was from genomic DNA of Th. intermedium. Sequence homology analyses showed that the above RGAs were highly homologous with known resistance genes or resistance gene analogs and belonged to NBS-LRR type of R genes. ACR 3 was recovered by PCR from genomic DNA and cDNA of Th. intermedium and TAi-27, but not from 3B-2. Southern hybridization using the digested genomic DNA of Th. intermedium, TAi-27 and 3B-2 as the template and ACR 3 as the probe showed that there is only one copy of ACR 3 in the genome of Th. intermedium and TAi

[Knockdown of InR gene in ventral nephrocytes promotes resistance to toxic stress in Drosophila melanogaster females].

Science.gov (United States)

Andreenkova, O V; Karpova, E K; Menshanov, P N; Rauschenbach, I Yu

2015-02-01

Hemolymph filtration in insects is performed by nephrocytes, additional cells of the circulatory system that are not connected to Malpighian vessels. Drosophila has two types of nephrocytes: the ventral ("garland"), which are situated around the connection site of the esophagus and proventriculus, and the pericardial, which are localized around the heart. In this study, we examined the role of the of insulin-like receptor (InR)gene in regulation of the function of ventral nephrocytes (VNC) in D. melanogaster females. Immunofluorescent analysis of female VNC with anti-InR antibodies revealed for the first time that the InR gene is expressed in VNC cells. To determine whether a change in the level of InR expression has an effect on VNC function in Drosophila females, we implemented an antisense suppressor of the InR gene, together with a driver that is expressed specifically in VNC. VNC function was evaluated by survival of the females exposed to toxic stress (treatment with AgNO3). This study has shown for the first time that suppression of InR expression in VNC leads to a rise in the survival of flies under conditions of toxic stress.

Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

Directory of Open Access Journals (Sweden)

Liang Yan

2017-01-01

Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

Science.gov (United States)

Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

2018-01-01

Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

Effector-driven marker development and cloning of resistance genes against Phytophthora infestans in potato breeding clone SW93-1015

DEFF Research Database (Denmark)

Lenman, Marit; Ali, Ashfaq; Mühlenbock, Per

2016-01-01

different P. infestans effectors, containing the conserved motif RXLR (for Arg, any amino acid, Leu, Arg), revealed a specific response to Avr2, which suggests that SW93-1015 might contain a functional homolog of the R2 resistance gene. We cloned eight R2 gene homologs from SW93-1015, whereof seven have...

SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

Science.gov (United States)

de Man, Tom J B; Limbago, Brandi M

2016-01-01

We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

Directory of Open Access Journals (Sweden)

Bertinellys TEIXEIRA

2016-01-01

Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

Science.gov (United States)

Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

2016-01-01

The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

Science.gov (United States)

Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

2015-05-01

Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

Variation of antibiotic resistance genes in municipal wastewater treatment plant with A(2)O-MBR system.

Science.gov (United States)

Du, Jing; Geng, Jinju; Ren, Hongqiang; Ding, Lili; Xu, Ke; Zhang, Yan

2015-03-01

The variation of five antibiotic resistance genes (ARGs)-tetG, tetW, tetX, sul1, and intI1-in a full-scale municipal wastewater treatment plant with A(2)O-MBR system was studied. The concentrations of five resistance genes both in influent and in membrane bioreactor (MBR) effluent decreased as sul1 > intI1 > tetX > tetG > tetW, and an abundance of sul1 was statistically higher than three other tetracycline resistance genes (tetG, tetW, and tetX) (p MBR effluent. The reduction of tetW, intI1, and sul1 was all significantly positively correlated with the reduction of 16S ribosomal DNA (rDNA) in the wastewater treatment process (p MBR was observed for all ARGs.

Identification of molecular markers linked to rice bacterial blight resistance genes from Oryza meyeriana

Directory of Open Access Journals (Sweden)

Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN

2015-09-01

Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.

Class 1 integrons and tetracycline resistance genes in Alcaligenes, Arthrobacter, and Pseudomonas spp. isolated from pigsties and manured soil

DEFF Research Database (Denmark)

Agersø, Yvonne; Sandvang, Dorthe

2005-01-01

The presence of tetracycline resistance (Tc-r) genes and class I integrons (in-1), and their ability to cotransfer were investigated in Tc-r gram-negative (185 strains) and gram-positive (72 strains) bacteria from Danish farmland and pigsties. The isolates belonged to the groups or species...... tet(33). No isolates contained more than one tet gene. The in-l-positive isolates were tested for resistance to selected antimicrobial agents and showed resistance to three to nine drugs. Filter-mating experiments showed cotransfer of Tc-r and class I integrons from soil isolates to Escherichia coli...... and/or Pseudomonas putida. We conclude that soil bacteria in close contact to manure or pigsty environment may thus have an important role in horizontal spread of resistance. Use of tetracyclines in food animal production may increase not only Tc-r but also multidrug resistance (caused by the presence...

miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention.

Science.gov (United States)

Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K

2011-04-04

that miR-24-2 is more effective in controlling H2AX gene expression, regardless of the change in gene copy number. Further, the study indicates that combination therapy with miR-24-2 along with an anticancer drug such as cisplatin could provide a new avenue in cancer therapy for patients with tumors otherwise resistant to drugs.

Genetic Mapping of a Major Resistance Gene to Pea Aphid (Acyrthosipon pisum in the Model Legume Medicago truncatula

Directory of Open Access Journals (Sweden)

Lars G. Kamphuis

2016-07-01

Full Text Available Resistance to the Australian pea aphid (PA; Acyrthosiphon pisum biotype in cultivar Jester of the model legume Medicago truncatula is mediated by a single dominant gene and is phloem-mediated. The genetic map position for this resistance gene, APR (Acyrthosiphon pisum resistance, is provided and shows that APR maps 39 centiMorgans (cM distal of the A. kondoi resistance (AKR locus, which mediates resistance to a closely related species of the same genus bluegreen aphid (A. kondoi. The APR region on chromosome 3 is dense in classical nucleotide binding site leucine-rich repeats (NLRs and overlaps with the region harbouring the RAP1 gene which confers resistance to a European PA biotype in the accession Jemalong A17. Further screening of a core collection of M. truncatula accessions identified seven lines with strong resistance to PA. Allelism experiments showed that the single dominant resistance to PA in M. truncatula accessions SA10481 and SA1516 are allelic to SA10733, the donor of the APR locus in cultivar Jester. While it remains unclear whether there are multiple PA resistance genes in an R-gene cluster or the resistance loci identified in the other M. truncatula accessions are allelic to APR, the introgression of APR into current M. truncatula cultivars will provide more durable resistance to PA.

Influence of tra genes of IncP and F plasmids on the mobilization of small Kanamycin resistance ColE1-Like plasmids in bacterial biofilms

Science.gov (United States)

Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...

Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

International Nuclear Information System (INIS)

Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

2014-01-01

Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

Expression profile of genes during resistance reversal in a temephos selected strain of the dengue vector, Aedes aegypti.

Directory of Open Access Journals (Sweden)

Clare Strode

Full Text Available BACKGROUND: The mosquito Aedes aegypti is one of the most important disease vectors because it transmits two major arboviruses, dengue and yellow fever, which cause significant global morbidity and mortality. Chemical insecticides form the cornerstone of vector control. The organophosphate temephos a larvicide recommended by WHO for controlling Ae. aegypti, however, resistance to this compound has been reported in many countries, including Brazil. METHODOLOGY/PRINCIPAL FINDINGS: The aim of this study was to identify genes implicated in metabolic resistance in an Ae. aegypti temephos resistant strain, named RecR, through microarray analysis. We utilized a custom 'Ae. aegypti detox chip' and validated microarray data through RT-PCR comparing susceptible and resistant individuals. In addition, we analyzed gene expression in 4(th instar larvae from a reversed susceptible strain (RecRev, exposed and unexposed to temephos. The results obtained revealed a set of 13 and 6 genes significantly over expressed in resistant adult mosquitoes and larvae, respectively. One of these genes, the cytochrome P450 CYP6N12, was up-regulated in both stages. RT-PCR confirmed the microarray results and, additionally, showed no difference in gene expression between temephos exposed and unexposed RecRev mosquitoes. This suggested that the differences in the transcript profiles among the strains are heritable due to a selection process and are not caused by immediate insecticide exposure. Reversal of temephos resistance was demonstrated and, importantly, there was a positive correlation between a decrease in the resistance ratio and an accompanying decrease in the expression levels of previously over expressed genes. Some of the genes identified here have also been implicated in metabolic resistance in other mosquito species and insecticide resistant populations of Ae. aegypti. CONCLUSIONS/SIGNIFICANCE: The identification of gene expression signatures associated to

Stable gene transfer of CCR5 and CXCR4 siRNAs by sleeping beauty transposon system to confer HIV-1 resistance

Directory of Open Access Journals (Sweden)

Akkina Ramesh

2008-07-01

Full Text Available Abstract Background Thus far gene therapy strategies for HIV/AIDS have used either conventional retroviral vectors or lentiviral vectors for gene transfer. Although highly efficient, their use poses a certain degree of risk in terms of viral mediated oncogenesis. Sleeping Beauty (SB transposon system offers a non-viral method of gene transfer to avoid this possible risk. With respect to conferring HIV resistance, stable knock down of HIV-1 coreceptors CCR5 and CXCR4 by the use of lentiviral vector delivered siRNAs has proved to be a promising strategy to protect cells from HIV-1 infection. In the current studies our aim is to evaluate the utility of SB system for stable gene transfer of CCR5 and CXCR4 siRNA genes to derive HIV resistant cells as a first step towards using this system for gene therapy. Results Two well characterized siRNAs against the HIV-1 coreceptors CCR5 and CXCR4 were chosen based on their previous efficacy for the SB transposon gene delivery. The siRNA transgenes were incorporated individually into a modified SB transfer plasmid containing a FACS sortable red fluorescence protein (RFP reporter and a drug selectable neomycin resistance gene. Gene transfer was achieved by co-delivery with a construct expressing a hyperactive transposase (HSB5 into the GHOST-R3/X4/R5 cell line, which expresses the major HIV receptor CD4 and and the co-receptors CCR5 and CXCR4. SB constructs expressing CCR5 or CXCR4 siRNAs were also transfected into MAGI-CCR5 or MAGI-CXCR4 cell lines, respectively. Near complete downregulation of CCR5 and CXCR4 surface expression was observed in transfected cells. During viral challenge with X4-tropic (NL4.3 or R5-tropic (BaL HIV-1 strains, the respective transposed cells showed marked viral resistance. Conclusion SB transposon system can be used to deliver siRNA genes for stable gene transfer. The siRNA genes against HIV-1 coreceptors CCR5 and CXCR4 are able to downregulate the respective cell surface proteins

Characterization and Structure Prediction of Partial Length Protein Sequences of pcoA, pcoR and chrB Genes from Heavy Metal Resistant Bacteria from the Klip River, South Africa

Directory of Open Access Journals (Sweden)

Patience Chihomvu

2015-04-01

Full Text Available The Klip River has suffered from severe anthropogenic effects from industrial activities such as mining. Long-term exposure to heavy metal pollution has led to the development of heavy metal resistant strains of Pseudomonas sp. KR23, Lysinibacillus sp. KR25, and E. coli KR29. The objectives of this study were to characterize the genetics of copper and chromate resistance of the isolates. Copper and chromate resistance determinants were cloned and sequenced. Open reading frames (ORFs related to the genes CopA and CopR were identified in E. coli KR29, PcoA in Lysinibacillus sp. KR25 and none related to chromate resistance were detected. The 3D-models predicted by I-TASSER disclose that the PcoA proteins consist of β-sheets, which form a part of the cupredoxin domain of the CopA copper resistance family of genes. The model for PcoR_29 revealed the presence of a helix turn helix; this forms part of a DNA binding protein, which is part of a heavy metal transcriptional regulator. The bacterial strains were cured using ethidium bromide. The genes encoding for heavy metal resistance and antibiotic resistance were found to be located on the chromosome for both Pseudomonas sp. (KR23 and E. coli (KR29. For Lysinibacillus (KR25 the heavy metal resistance determinants are suspected to be located on a mobile genetic element, which was not detected using gel electrophoresis.

Characterization and structure prediction of partial length protein sequences of pcoA, pcoR and chrB genes from heavy metal resistant bacteria from the Klip River, South Africa.

Science.gov (United States)

Chihomvu, Patience; Stegmann, Peter; Pillay, Michael

2015-04-01

The Klip River has suffered from severe anthropogenic effects from industrial activities such as mining. Long-term exposure to heavy metal pollution has led to the development of heavy metal resistant strains of Pseudomonas sp. KR23, Lysinibacillus sp. KR25, and E. coli KR29. The objectives of this study were to characterize the genetics of copper and chromate resistance of the isolates. Copper and chromate resistance determinants were cloned and sequenced. Open reading frames (ORFs) related to the genes CopA and CopR were identified in E. coli KR29, PcoA in Lysinibacillus sp. KR25 and none related to chromate resistance were detected. The 3D-models predicted by I-TASSER disclose that the PcoA proteins consist of β-sheets, which form a part of the cupredoxin domain of the CopA copper resistance family of genes. The model for PcoR_29 revealed the presence of a helix turn helix; this forms part of a DNA binding protein, which is part of a heavy metal transcriptional regulator. The bacterial strains were cured using ethidium bromide. The genes encoding for heavy metal resistance and antibiotic resistance were found to be located on the chromosome for both Pseudomonas sp. (KR23) and E. coli (KR29). For Lysinibacillus (KR25) the heavy metal resistance determinants are suspected to be located on a mobile genetic element, which was not detected using gel electrophoresis.

Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

Energy Technology Data Exchange (ETDEWEB)

Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

2007-07-24

Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

DEFF Research Database (Denmark)

Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

2015-01-01

To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Untreated urban waste contaminates Indian river sediments with resistance genes to last resort antibiotics.

Science.gov (United States)

Marathe, Nachiket P; Pal, Chandan; Gaikwad, Swapnil S; Jonsson, Viktor; Kristiansson, Erik; Larsson, D G Joakim

2017-11-01

Efficient sewage treatment is critical for limiting environmental transmission of antibiotic-resistant bacteria. In many low and middle income countries, however, large proportions of sewage are still released untreated into receiving water bodies. In-depth knowledge of how such discharges of untreated urban waste influences the environmental resistome is largely lacking. Here, we highlight the impact of uncontrolled discharge of partially treated and/or untreated wastewater on the structure of bacterial communities and resistome of sediments collected from Mutha river flowing through Pune city in India. Using shotgun metagenomics, we found a wide array (n = 175) of horizontally transferable antibiotic resistance genes (ARGs) including carbapenemases such as NDM, VIM, KPC, OXA-48 and IMP types. The relative abundance of total ARGs was 30-fold higher in river sediments within the city compared to upstream sites. Forty four ARGs, including the tet(X) gene conferring resistance to tigecycline, OXA-58 and GES type carbapenemases, were significantly more abundant in city sediments, while two ARGs were more common at upstream sites. The recently identified mobile colistin resistance gene mcr-1 was detected only in one of the upstream samples, but not in city samples. In addition to ARGs, higher abundances of various mobile genetic elements were found in city samples, including integron-associated integrases and ISCR transposases, as well as some biocide/metal resistance genes. Virulence toxin genes as well as bacterial genera comprising many pathogens were more abundant here; the genus Acinetobacter, which is often associated with multidrug resistance and nosocomial infections, comprised up to 29% of the 16S rRNA reads, which to our best knowledge is unmatched in any other deeply sequenced metagenome. There was a strong correlation between the abundance of Acinetobacter and the OXA-58 carbapenemase gene. Our study shows that uncontrolled discharge of untreated urban

The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

DEFF Research Database (Denmark)

Liu, M; Kirpekar, F; Van Wezel, G P

2000-01-01

tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

Science.gov (United States)

Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

2017-03-16

Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Imidacloprid does not induce Cyp genes involved in insecticide resistance of a mutant Drosophila melanogaster line.

Science.gov (United States)

Kalajdzic, Predrag; Markaki, Maria; Oehler, Stefan; Savakis, Charalambos

2013-10-01

Certain xenobiotics have the capacity to induce the expression of genes involved in various biological phenomena, including insecticide resistance. The induction potential of different chemicals, among them different insecticides, has been documented for a number of insect species. In this study, we have analyzed the induction potential of Imidacloprid, a widely used member of the neonicotinoid insecticide family. Genes Cyp6g1 and Cyp6a2, known to be involved in the resistance of mutant Drosophila melanogaster line MiT[W⁻]3R2 to Imidacloprid and DDT were included in the analyzed sample. We find that Imidacloprid does not induce expression of the analyzed genes. Copyright © 2013 Elsevier Ltd. All rights reserved.

Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

Science.gov (United States)

Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

2014-09-12

This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

Influence of mutations in some structural genes of heat-shock proteins on radiation resistance of Escherichia coli

International Nuclear Information System (INIS)

Verbenko, V.N.; Kuznetsova, L.V.; Bikineeva, E.G.; Kalinin, V.L.

1992-01-01

Lethal effects of γ-irradiation were studied in Escherichia coli strains with normal repair genotype and in radiation-resistant Gam r strains, both carrying additional mutations in the structural genes dnaK, grpE, groES or groEL. The null mutation ΔdnaK52::Cm r enhanced radiation sensitivity of wild-type cells and abolished the effect of heat induced rediation-resistance (ETIRR) and elevated radiation resistance of the Gam r strains

Expressed sequence enrichment for candidate gene analysis of citrus tristeza virus resistance.

Science.gov (United States)

Bernet, G P; Bretó, M P; Asins, M J

2004-02-01

Several studies have reported markers linked to a putative resistance gene from Poncirus trifoliata ( Ctv-R) located at linkage group 4 that confers resistance against one of the most important citrus pathogens, citrus tristeza virus (CTV). To be successful in both marker-assisted selection and transformation experiments, its accurate mapping is needed. Several factors may affect its localization, among them two are considered here: the definition of resistance and the genetic background of progeny. Two progenies derived from P. trifoliata, by self-pollination and by crossing with sour orange ( Citrus aurantium), a citrus rootstock well-adapted to arid and semi-arid areas, were used for linkage group-4 marker enrichment. Two new methodologies were used to enrich this region with expressed sequences. The enrichment of group 4 resulted in the fusion of several C. aurantium linkage groups. The new one A(7+3+4) is now saturated with 48 markers including expressed sequences. Surprisingly, sour orange was as resistant to the CTV isolate tested as was P. trifoliata, and three hybrids that carry Ctv-R, as deduced from its flanking markers, are susceptible to CTV. The new linkage maps were used to map Ctv-R under the hypothesis of monogenic inheritance. Its position on linkage group 4 of P. trifoliata differs from the location previously reported in other progenies. The genetic analysis of virus-plant interaction in the family derived from C. aurantium after a CTV chronic infection showed the segregation of five types of interaction, which is not compatible with the hypothesis of a single gene controlling resistance. Two major issues are discussed: another type of genetic analysis of CTV resistance is needed to avoid the assumption of monogenic inheritance, and transferring Ctv-R from P. trifoliata to sour orange might not avoid the CTV decline of sweet orange trees.

Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

Science.gov (United States)

Peng, Fred Y; Yang, Rong-Cai

2017-06-20

The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

Directory of Open Access Journals (Sweden)

Yongda Zhao

2018-04-01

Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

Science.gov (United States)

Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

2011-12-01

Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

Science.gov (United States)

Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

2014-01-01

Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

Science.gov (United States)

Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

2018-02-07

Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

Induced mutations of rust resistance genes in wheat

International Nuclear Information System (INIS)

McIntosh, R.A.

1983-01-01

Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

Accumulation of Pharmaceuticals, Enterococcus, and Resistance Genes in Soils Irrigated with Wastewater for Zero to 100 Years in Central Mexico

Science.gov (United States)

Siebe, Christina; Willaschek, Elisha; Sakinc, Tuerkan; Huebner, Johannes; Amelung, Wulf; Grohmann, Elisabeth; Siemens, Jan

2012-01-01

Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin), 4.3 µg/kg (sulfamethoxazole), and 5.4 µg/kg (carbamazepine) in soils irrigated for 19–28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate) were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15×10−3±0.22×10−3 copies/16S rDNA) than in non-irrigated soils (4.35×10−5±1.00×10−5 copies/16S rDNA), while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61×10–4±0.59×10−4 versus 2.99×10−5±0.26×10−5 copies/16S rDNA). Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a long-term increase in

Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

Science.gov (United States)

Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

2014-01-01

Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

Prevalence, antibiotic-resistance properties and enterotoxin gene ...

African Journals Online (AJOL)

Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

Directory of Open Access Journals (Sweden)

Yuanman Tang

2017-11-01

Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

Science.gov (United States)

Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

2015-01-01

Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

Science.gov (United States)

The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

Science.gov (United States)

Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

2018-04-01

Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

Characterization of Vibrio parahaemolyticus isolated from oysters in Korea: Resistance to various antibiotics and prevalence of virulence genes.

Science.gov (United States)

Kang, Chang-Ho; Shin, YuJin; Jang, SeokCheol; Yu, HongSik; Kim, SuKyung; An, Sera; Park, Kunbawui; So, Jae-Seong

2017-05-15

Vibrio parahaemolyticus, found frequently in oysters, is the most prevalent gastroenteritis-causing pathogen in Korea and in several other Asian countries. This study monitored changes in the environmental parameters and occurrence of V. parahaemolyticus in oyster aquaculture sites. Of the 44 presumed V. parahaemolyticus isolates obtained, when tested against 16 antibiotics, 90.9, 86.4, and 75.0% of the 44 isolates exhibited resistance to vancomycin, ampicillin, and streptomycin, respectively. PCR analysis for the presence of the toxR gene confirmed 31 of the 44 isolates as being positive V. parahaemolyticus strains. The toxR positive isolates were tested for the presence of thermostable direct hemolysin (tdh) and tdh-related hemolysin (trh) virulence genes. Only 9.1% toxR positive isolate exhibit the trh gene and none of the isolates were tested positive for tdh. The occurrence of multi drug resistance strains in the environment could be an indication of excessive usage of antibiotics in agriculture and aquaculture fields. Copyright © 2017 Elsevier Ltd. All rights reserved.

Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure wastewater as influenced by three swine management systems.

Science.gov (United States)

Brooks, John P; Adeli, Ardeshir; McLaughlin, Michael R

2014-06-15

The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vast changes to the microbial biota and ecological structure of both the pig and waste manure lagoon wastewater. While some of these changes may not be negative, it is possible that CAFOs can enrich antibiotic resistant bacteria or pathogens based on farm type, thereby influencing the impact imparted by the land application of its respective wastewater. The purpose of this study was to measure the microbial constituents of swine-sow, -nursery, and -finisher farm manure lagoon wastewater and determine the changes induced by farm management. A total of 37 farms were visited in the Mid-South USA and analyzed for the genes 16S rRNA, spaQ (Salmonella spp.), Camp-16S (Campylobacter spp.), tetA, tetB, ermF, ermA, mecA, and intI using quantitative PCR. Additionally, 16S rRNA sequence libraries were created. Overall, it appeared that finisher farms were significantly different from nursery and sow farms in nearly all genes measured and in 16S rRNA clone libraries. Nearly all antibiotic resistance genes were detected in all farms. Interestingly, the mecA resistance gene (e.g. methicillin resistant Staphylococcus aureus) was below detection limits on most farms, and decreased as the pigs aged. Finisher farms generally had fewer antibiotic resistance genes, which corroborated previous phenotypic data; additionally, finisher farms produced a less diverse 16S rRNA sequence library. Comparisons of Camp-16S and spaQ GU (genomic unit) values to previous culture data demonstrated ratios from 10 to 10,000:1 depending on farm type, indicating viable but not cultivatable bacteria were dominant. The current study indicated that swine farm management schemes positively and negatively affect microbial and antibiotic resistant populations in CAFO wastewater which has future "downstream" implications from both an environmental and public health perspective. Published by Elsevier Ltd.

Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

Directory of Open Access Journals (Sweden)

Masayoshi Hashimoto

2016-10-01

Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

FunGene: the functional gene pipeline and repository.

Science.gov (United States)

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

FunGene: the Functional Gene Pipeline and Repository

Directory of Open Access Journals (Sweden)

Jordan A. Fish

2013-10-01

Full Text Available Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer.While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/ offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

Science.gov (United States)

Egervärn, M; Roos, S; Lindmark, H

2009-11-01

The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Directory of Open Access Journals (Sweden)

Na Wang

Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

Science.gov (United States)

Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

2018-01-01

In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Introducing the "TCDD-inducible AhR-Nrf2 gene battery".

Science.gov (United States)

Yeager, Ronnie L; Reisman, Scott A; Aleksunes, Lauren M; Klaassen, Curtis D

2009-10-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces genes via the transcription factor aryl hydrocarbon receptor (AhR), including Cyp1a1, NAD(P)H:quinone oxidoreductase 1 (Nqo1), UDP-glucuronosyltransferase 1a6 (Ugt1a6), and glutathione S-transferase a1 (Gsta1). These genes are referred to as the "AhR gene battery." However, Nqo1 is also considered a prototypical target gene of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2). In mice, TCDD induction of Nrf2 and Nrf2 target, Nqo1, is dependent on AhR, and thus TCDD induction of drug-processing genes may be routed through an AhR-Nrf2 sequence. There has been speculation that Nrf2 may be involved in the TCDD induction of drug-processing genes; however, the data are not definitive. Therefore, to address whether TCDD induction of Nqo1, Ugts, and Gsts is dependent on Nrf2, we conducted the definitive experiment by administering TCDD (50 mug/kg, ip) to Nrf2-null and wild-type (WT) mice and collecting livers 24 h later to quantify the mRNA of drug-processing genes. TCDD induction of Cyp1a1 and Ugt1a1 was similar in WT and Nrf2-null mice, whereas TCDD induction of Ugt1a5 and 1a9 was blunted in Nrf2-null mice. TCDD induced Nqo1, Ugt1a6, 2b34, 2b35, 2b36, UDP-glucuronic acid-synthesizing gene UDP-glucose dehydrogenase, and Gsta1, m1, m2, m3, m6, p2, t2, and microsomal Gst1 in WT mice but not in Nrf2-null mice. Therefore, the present study demonstrates the novel finding that Nrf2 is required for TCDD induction of classical AhR battery genes Nqo1, Ugt1a6, and Gsta1, as well as most Ugt and Gst isoforms in livers of mice.

Comparison of the aflR gene sequences of strains in Aspergillus section Flavi.

Science.gov (United States)

Lee, Chao-Zong; Liou, Guey-Yuh; Yuan, Gwo-Fang

2006-01-01

Aflatoxins are polyketide-derived secondary metabolites produced by Aspergillus parasiticus, Aspergillus flavus, Aspergillus nomius and a few other species. The toxic effects of aflatoxins have adverse consequences for human health and agricultural economics. The aflR gene, a regulatory gene for aflatoxin biosynthesis, encodes a protein containing a zinc-finger DNA-binding motif. Although Aspergillus oryzae and Aspergillus sojae, which are used in fermented foods and in ingredient manufacture, have no record of producing aflatoxin, they have been shown to possess an aflR gene. This study examined 34 strains of Aspergillus section Flavi. The aflR gene of 23 of these strains was successfully amplified and sequenced. No aflR PCR products were found in five A. sojae strains or six strains of A. oryzae. These PCR results suggested that the aflR gene is absent or significantly different in some A. sojae and A. oryzae strains. The sequenced aflR genes from the 23 positive strains had greater than 96.6 % similarity, which was particularly conserved in the zinc-finger DNA-binding domain. The aflR gene of A. sojae has two obvious characteristics: an extra CTCATG sequence fragment and a C to T transition that causes premature termination of AFLR protein synthesis. Differences between A. parasiticus/A. sojae and A. flavus/A. oryzae aflR genes were also identified. Some strains of A. flavus as well as A. flavus var. viridis, A. oryzae var. viridis and A. oryzae var. effuses have an A. oryzae-type aflR gene. For all strains with the A. oryzae-type aflR gene, there was no evidence of aflatoxin production. It is suggested that for safety reasons, the aflR gene could be examined to assess possible aflatoxin production by Aspergillus section Flavi strains.

Bacterial metal resistance genes and metal bioavailability in contaminated sediments

International Nuclear Information System (INIS)

Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

2014-01-01

In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

Effective genes for resistance to stripe rust and virulence of Puccinia ...

African Journals Online (AJOL)

The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population

Science.gov (United States)

Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

2016-01-01

Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

Science.gov (United States)

Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

2014-07-22

Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Intrachromosomal amplification, locus deletion and point mutation in the aquaglyceroporin AQP1 gene in antimony resistant Leishmania (Viannia guyanensis.

Directory of Open Access Journals (Sweden)

Rubens Monte-Neto

2015-02-01

Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.

Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

Science.gov (United States)

Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

2011-01-01

Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

Directory of Open Access Journals (Sweden)

Andrew J Burt

Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

Directory of Open Access Journals (Sweden)

Roderick M. Card

2018-06-01

Full Text Available Brachyspira hyodysenteriae is the aetiological agent of swine dysentery, a globally distributed disease that causes profound economic loss, impedes the free trade and movement of animals, and has significant impact on pig health. Infection is generally treated with antibiotics of which pleuromutilins, such as tiamulin, are widely used for this purpose, but reports of resistance worldwide threaten continued effective control. In Brachyspira hyodysenteriae pleuromutilin resistance has been associated with mutations in chromosomal genes encoding ribosome-associated functions, however the dynamics of resistance acquisition are poorly understood, compromising stewardship efforts to preserve pleuromutilin effectiveness. In this study we undertook whole genome sequencing (WGS and phenotypic susceptibility testing of 34 UK field isolates and 3 control strains to investigate pleuromutilin resistance in Brachyspira hyodysenteriae. Genome-wide association studies identified a new pleuromutilin resistance gene, tva(A (tiamulin valnemulin antibiotic resistance, encoding a predicted ABC-F transporter. In vitro culture of isolates in the presence of inhibitory or sub-inhibitory concentrations of tiamulin showed that tva(A confers reduced pleuromutilin susceptibility that does not lead to clinical resistance but facilitates the development of higher-level resistance via mutations in genes encoding ribosome-associated functions. Genome sequencing of antibiotic-exposed isolates identified both new and previously described mutations in chromosomal genes associated with reduced pleuromutilin susceptibility, including the 23S rRNA gene and rplC, which encodes the L3 ribosomal protein. Interesting three antibiotic-exposed isolates harboured mutations in fusA, encoding Elongation Factor G, a gene not previously associated with pleuromutilin resistance. A longitudinal molecular epidemiological examination of two episodes of swine dysentery at the same farm indicated

RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

Directory of Open Access Journals (Sweden)

Michele Gusberti

Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

Science.gov (United States)

Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

2016-04-01

The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

Activation of erythropoietin receptors by Friend viral gp55 and by erythropoietin and down-modulation by the murine Fv-2r resistance gene

International Nuclear Information System (INIS)

Hoatlin, M.E.; Kozak, S.L.; Kabat, D.; Lilly, F.; Chakraborti, A.; Kozak, C.A.

1990-01-01

The leukemogenic membrane glycoprotein (gp55) encoded by Friend spleen focus-forming virus appears to bind to erythropoietin receptors (EpoR) to stimulate erythroblastosis. To directly compare the effects of gp55 with erythropoietin (Epo), the authors produced retrovirions that encode either gp55, Epo, or EpoR. After infection with EpoR virus, interleukin 3-dependent DA-3 cells bound 125 I-labeled Epo and grew without interleukin 3 in the presence of Epo. These latter cells, but not parental DA-3 cells, became factor-independent after superinfection either with Epo virus or with Friend spleen focus-forming virus. In addition, Epo virus caused a disease in mice that mimicked Friend erythroleukemia. Although Fv-2 r homozygotes are susceptible to all other retroviral diseases, they are resistant to both Epo viral and Friend viral erythroleukemia. These results indicate that both gp55 and Epo stimulate EpoR and that the Fv-2 gene encodes a protein that controls response to these ligands. However, the Fv-2 protein is not EpoR because the corresponding genes map to opposite ends of mouse chromosome 9. These results have important implications for understanding signal transduction by EpoR and the role of host genetic variation in controlling susceptibility to an oncogenic protein

Design of magnetic gene complexes as effective and serum resistant gene delivery systems for mesenchymal stem cells.

Science.gov (United States)

Zhang, Tian-Yuan; Wu, Jia-He; Xu, Qian-Hao; Wang, Xia-Rong; Lu, Jingxiong; Hu, Ying; Jo, Jun-Ichiro; Yamamoto, Masaya; Ling, Daishun; Tabata, Yasuhiko; Gao, Jian-Qing

2017-03-30

Gene engineered mesenchymal stem cells (MSCs) have been proposed as promising tools for their various applications in biomedicine. Nevertheless, the lack of an effective and safe way to genetically modify these stem cells is still a major obstacle in the current studies. Herein, we designed novel magnetic complexes by assembling cationized pullulan derivatives with magnetic iron oxide nanoparticles for delivering target genes to MSCs. Results showed that this complexes achieved effective gene expression with the assistance of external magnetic field, and resisted the adverse effect induced by serum proteins on the gene delivery. Moreover, neither significant cytotoxicity nor the interference on the osteogenic differentiation to MSCs were observed after magnetofection. Further studies revealed that this effective and serum resistant gene transfection was partly due to the accelerated and enhanced intracellular uptake process driven by external magnetic field. To conclude, the current study presented a novel option for genetic modification of MSCs in an effective, relatively safe and serum compatible way. Copyright © 2017 Elsevier B.V. All rights reserved.

The antimicrobial resistance crisis: management through gene monitoring

Science.gov (United States)

2016-01-01

Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

Directory of Open Access Journals (Sweden)

Juan J. González-Plaza

2018-01-01

Full Text Available Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs, which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the

Functional Repertoire of Antibiotic Resistance Genes in Antibiotic Manufacturing Effluents and Receiving Freshwater Sediments

Science.gov (United States)

González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina

2018-01-01

Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs

Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines.

Science.gov (United States)

Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T

2013-01-01

Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in "colony forming bacterial assemblages" and "natural bacterial assemblages." Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX) is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86% of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10(-5)-10(-2) copy/16S) but not sul3. Among the natural bacterial assemblage, all sul1, sul2, and sul3 were detected (10(-5)-10(-3) copy/16S), whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

Who Possesses Drug Resistance Genes in the Aquatic Environment? : Sulfamethoxazole (SMX Resistance Genes among the Bacterial Community in Water Environment of Metro-Manila, Philippines

Directory of Open Access Journals (Sweden)

Satoru eSuzuki

2013-04-01

Full Text Available Recent evidence has shown that antibiotic resistant bacteria (ARB and antibiotic resistance genes (ARG are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in colony forming bacterial assemblages and natural bacterial assemblages. Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86 % of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10-5-10-2 copy/16S but not sul3. Among the natural bacterial assemblage, all sul1, sul2 and sul3 were detected (10-5-10-3 copy/16S, whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

Directory of Open Access Journals (Sweden)

Gui Hong Fu

2014-12-01

Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

OpenAIRE

Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

2014-01-01

Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

Science.gov (United States)

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

Remapping of the stripe rust resistance gene Yr10 in common wheat.

Science.gov (United States)

Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

2018-02-23

Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

Science.gov (United States)

Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

2015-10-05

Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

Transportin-SR is required for proper splicing of resistance genes and plant immunity.

Directory of Open Access Journals (Sweden)

Shaohua Xu

2011-06-01

Full Text Available Transportin-SR (TRN-SR is a member of the importin-β super-family that functions as the nuclear import receptor for serine-arginine rich (SR proteins, which play diverse roles in RNA metabolism. Here we report the identification and cloning of mos14 (modifier of snc1-1, 14, a mutation that suppresses the immune responses conditioned by the auto-activated Resistance (R protein snc1 (suppressor of npr1-1, constitutive 1. MOS14 encodes a nuclear protein with high similarity to previously characterized TRN-SR proteins in animals. Yeast two-hybrid assays showed that MOS14 interacts with AtRAN1 via its N-terminus and SR proteins via its C-terminus. In mos14-1, localization of several SR proteins to the nucleus was impaired, confirming that MOS14 functions as a TRN-SR. The mos14-1 mutation results in altered splicing patterns of SNC1 and another R gene RPS4 and compromised resistance mediated by snc1 and RPS4, suggesting that nuclear import of SR proteins by MOS14 is required for proper splicing of these two R genes and is important for their functions in plant immunity.

QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

Science.gov (United States)

Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

2018-01-01

Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

Directory of Open Access Journals (Sweden)

Jason Gioia

Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

Prevalence of quinolone resistance genes, copper resistance genes, and the bacterial communities in a soil-ryegrass system co-polluted with copper and ciprofloxacin.

Science.gov (United States)

Tuo, Xiaxia; Gu, Jie; Wang, Xiaojuan; Sun, YiXin; Duan, Manli; Sun, Wei; Yin, Yanan; Guo, Aiyun; Zhang, Li

2018-04-01

The presence of high concentrations of residual antibiotics and antibiotic resistance genes (ARGs) in soil may pose potential health and environmental risks. This study investigated the prevalence of plasmid-mediated quinolone resistance (PMQR) genes, copper resistance genes (CRGs), and the bacterial communities in a soil-ryegrass pot system co-polluted with copper and ciprofloxacin (CIP; 0, 20, or 80 mg kg -1 dry soil). Compared with the samples on day 0, the total relative abundances of the PMQR genes and mobile genetic elements (MGEs) were reduced significantly by 80-89% in the ryegrass and soil by the cutting stage (after 75 days). The abundances of PMQR genes and MGEs were reduced by 63-81% in soil treated with 20 mg kg -1 CIP compared with the other treatments, but the abundances of CRGs increased by 18-42%. The presence of 80 mg kg -1 CIP affected the microbial community structure in the soil by increasing the abundances of Acidobacteria and Thaumarchaeota, but decreasing those of Firmicutes. Redundancy analysis indicated that the pH and microbial composition were the main factors that affected the variations in PMQR genes, MGEs, and CRGs, where they could explain 42.2% and 33.3% of the variation, respectively. Furthermore, intI2 may play an important role in the transfer of ARGs. We found that 80 mg kg -1 CIP could increase the abundances of ARGs and CRGs in a soil-ryegrass pot system. Copyright © 2018 Elsevier Ltd. All rights reserved.

Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

Science.gov (United States)

Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

2017-12-01

Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

A horizontally gene transferred copper resistance locus confers hyper‐resistance to antibacterial copper toxicity and enables survival of community acquired methicillin resistant Staphylococcus aureus USA300 in macrophages

Science.gov (United States)

Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.

2018-01-01

Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441

The gene expression profile of resistant and susceptible Bombyx mori strains reveals cypovirus-associated variations in host gene transcript levels.

Science.gov (United States)

Guo, Rui; Wang, Simei; Xue, Renyu; Cao, Guangli; Hu, Xiaolong; Huang, Moli; Zhang, Yangqi; Lu, Yahong; Zhu, Liyuan; Chen, Fei; Liang, Zi; Kuang, Sulan; Gong, Chengliang

2015-06-01

High-throughput paired-end RNA sequencing (RNA-Seq) was performed to investigate the gene expression profile of a susceptible Bombyx mori strain, Lan5, and a resistant B. mori strain, Ou17, which were both orally infected with B. mori cypovirus (BmCPV) in the midgut. There were 330 and 218 up-regulated genes, while there were 147 and 260 down-regulated genes in the Lan5 and Ou17 strains, respectively. Gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment for differentially expressed genes (DEGs) were carried out. Moreover, gene interaction network (STRING) analyses were performed to analyze the relationships among the shared DEGs. Some of these genes were related and formed a large network, in which the genes for B. mori cuticular protein RR-2 motif 123 (BmCPR123) and the gene for B. mori DNA replication licensing factor Mcm2-like (BmMCM2) were key genes among the common up-regulated DEGs, whereas the gene for B. mori heat shock protein 20.1 (Bmhsp20.1) was the central gene among the shared down-regulated DEGs between Lan5 vs Lan5-CPV and Ou17 vs Ou17-CPV. These findings established a comprehensive database of genes that are differentially expressed in response to BmCPV infection between silkworm strains that differed in resistance to BmCPV and implied that these DEGs might be involved in B. mori immune responses against BmCPV infection.

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

Science.gov (United States)

Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

2018-04-01

Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Are duplicated genes responsible for anthracnose resistance in common bean?

Science.gov (United States)

Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

2017-01-01

The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

Effect of silver nanoparticles and antibiotics on antibiotic resistance genes in anaerobic digestion.

Science.gov (United States)

Miller, Jennifer H; Novak, John T; Knocke, William R; Young, Katherine; Hong, Yanjuan; Vikesland, Peter J; Hull, Matthew S; Pruden, Amy

2013-05-01

Water resource recovery facilities have been described as creating breeding ground conditions for the selection, transfer, and dissemination of antibiotic resistance genes (ARGs) among various bacteria. The objective of this study was to determine the effect of direct addition of antibiotic and silver nanoparticles (Ag NPs, or nanosilver) on the occurrence of ARGs in thermophilic anaerobic digesters. Test thermophilic digesters were amended with environmentally-relevant concentrations of Ag NP (0.01, 0.1, and 1.0 mg-Ag/L; corresponding to approximately 0.7, 7.0, and 70 mg-Ag/kg total solids) and sulfamethoxazole (SMX) that span susceptible to resistant classifications (1, 5, and 50 mg/L) as potential selection pressures for ARGs. Tetracycline (tet(O), tet(W)) and sulfonamide (sulI, sulII) ARGs and the integrase enzyme gene (intI1) associated with Class 1 integrons were measured in raw sludge, test thermophilic digesters, a control thermophilic digester, and a control mesophilic digester. There was no apparent effect of Ag NPs on thermophilic anaerobic digester performance. The maximum SMX addition (50 mg/L) resulted in accumulation of volatile fatty acids and low pH, alkalinity, and volatile solids reduction. There was no significant difference between ARG gene copy numbers (absolute or normalized to 16S rRNA genes) in amended thermophilic digesters and the control thermophilic digester. Antibiotic resistance gene copy numbers in digested sludge ranged from 10(3) to 10(6) copies per microL (approximately 8 x10(1) to 8 x 10(4) copies per microg) of sludge as result of a 1-log reduction of ARGs (2-log reduction for intI1). Quantities of the five ARGs in raw sludge ranged from 10(4) to 10(8) copies per microL (approximately 4 x 10(2) to 4 x 10(6) per microg) of sludge. Test and control thermophilic digesters (53 degrees C, 12-day solids retention time [SRT]) consistently reduced but did not eliminate levels of all analyzed genes. The mesophilic digester (37 degrees C

Genetics and mapping of a new leaf rust resistance gene in Triticum ...

Indian Academy of Sciences (India)

Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

Science.gov (United States)

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

Science.gov (United States)

Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

2015-12-01

Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

Science.gov (United States)

Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

2014-12-01

The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.